Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4047-4055, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Expression and Functional Characteristics of
Calpain 3 Isoforms Generated through Tissue-Specific
Transcriptional and Posttranscriptional Events
Muriel
Herasse,1
Yasuko
Ono,2
Françoise
Fougerousse,1
Ei-ichi
Kimura,2
Daniel
Stockholm,1
Cyriaque
Beley,1
Didier
Montarras,3
Christian
Pinset,3
Hiroyuki
Sorimachi,2
Koichi
Suzuki,2
Jacques S.
Beckmann,1,* and
Isabelle
Richard1
Généthon, CNRS URA 1922, 91000 Evry,1 and Institut Pasteur, 75015 Paris,3 France, and IMCB, University
of Tokyo, Tokyo 113-0032, Japan2
Received 1 December 1998/Returned for modification 22 December
1998/Accepted 3 March 1999
 |
ABSTRACT |
Calpain 3 is a nonlysosomal cysteine protease whose biological
functions remain unknown. We previously demonstrated that this protease
is altered in limb girdle muscular dystrophy type 2A patients.
Preliminary observations suggested that its gene is subjected to
alternative splicing. In this paper, we characterize transcriptional
and posttranscriptional events leading to alterations involving the NS,
IS1, and IS2 regions and/or the calcium binding domains of the mouse
calpain 3 gene (capn3). These events can be divided into
three groups: (i) splicing of exons that preserve the translation
frame, (ii) inclusion of two distinct intronic sequences between exons
16 and 17 that disrupt the frame and would lead, if translated, to a
truncated protein lacking domain IV, and (iii) use of an alternative
first exon specific to lens tissue. In addition, expression of these
isoforms seems to be regulated. Investigation of the proteolytic
activities and titin binding abilities of the translation products of
some of these isoforms clearly indicated that removal of these
different protein segments affects differentially the biochemical
properties examined. In particular, removal of exon 6 impaired the
autolytic but not fodrinolytic activity and loss of exon 16 led to an
increased titin binding and a loss of fodrinolytic activity. These
results are likely to impact our understanding of the pathophysiology
of calpainopathies and the development of therapeutic strategies.
 |
INTRODUCTION |
Study of calpain 3 received an
important impetus after the demonstration of its involvement in limb
girdle muscular dystrophy type 2A (Mendelian Inheritance in Man [MIM]
253600) (24). This neuromuscular disorder is characterized
mainly by symmetrical atrophy and weakness of proximal limb muscles, by
elevated creatine kinase in serum, and by a dystrophic pattern in
muscle biopsies (4). Calpains are members of a family of
intracellular nonlysosomal cysteine proteases (for reviews, see
references 35 and 36). They are
comprised of three ubiquitous calpains (µ, m, and µ/m); a skeletal
muscle-specific calpain (calpain 3, CAPN3, nCL-1, or p94
[31]), a variant of which is also expressed in a
lens-specific manner (17, 18); a digestive tract-specific
calpain (nCL-4 [16]); and the stomach-specific
calpains (nCL-2 and nCL-2' [33]).
The human calpain 3 gene was reported to consist of 24 exons spanning
approximately 45 kb (24). It encodes a 3.5-kb mRNA expressed
predominantly in skeletal muscle tissues. The 821-amino-acid-long calpain 3 protein can be subdivided, like the other calpains, into four
domains that include a proteolytic (domain II) and a calcium binding
(domain IV) domain (26, 31). In addition, three short
calpain 3-specific sequences (NS, IS1, and IS2 [36]) are present. These are located, respectively, at the N terminus, in the
protease domain, and between domains III and IV. IS2 includes a titin
(connectin) binding site (11, 34) as well as a putative nuclear localization signal (31). Calpain 3 differs from the ubiquitous calpains by its rapid autolysis, at least when it is expressed in COS-7 cells (32). Furthermore, under such
conditions, calpain 3 can be detected in the nucleus (32).
The IS2 sequence appears to be involved in these phenomena
(32). In addition, it was shown that when wild-type calpain
3 is expressed in COS-7 cells, the 230-kDa intrinsic fodrin
subunit
(7, 19) is proteolyzed, yielding a 150-kDa fragment
(20).
Preliminary observations suggested the existence of alternatively
spliced isoforms of the calpain 3 gene. To better understand the
different modes of calpain 3 expression, we characterized alternatively
spliced products of the mouse capn3 gene. In addition, we
examined the impact of the murine capn3 isoforms on the
known biochemical properties of calpain 3.
 |
MATERIALS AND METHODS |
RNA isolation.
Total cellular RNAs from skeletal muscles of
Swiss mice and from NMRI mouse embryos at days 11.5 to 18.5 were
isolated by the Fast RNA GREEN method (Bio 101). Total cellular RNA was
prepared from primary cultures of human satellite cells, or from C2C12 mouse cell lines, by the guanidinium thiocyanate-CsCl gradient method.
Total RNAs from embryonic (day 15.5) and 6-month-old adult mouse lenses
and from primary culture of rat satellite cells were obtained by the
RNA-Zol method (Bioprob System). Brain, smooth muscle (from small
intestine), skeletal muscle, and heart poly(A)+ RNAs from
9- to 10-week-old BALB/c mice were purchased from Clontech.
RT-PCR amplification.
One microgram of total RNA was reverse
transcribed to single-stranded cDNA with Superscript II reverse
transcriptase (Gibco-BRL) and random hexamer primers in a 20-µl
volume. The reverse transcription (RT) reaction was conducted at 42°C
for 60 min. cDNA was amplified by PCR with calpain 3-specific primers
(Table 1). PCR products were separated by
agarose and polyacrylamide gel electrophoreses and revealed with
ethidium bromide staining. The long-range PCR was performed with the
Expand Long Template PCR System (Boehringer Mannheim) with two 25-mer
primer pairs (Table 1). PCR amplification of the alternative first exon
in mouse cDNA was performed with a primer, 5pRat.a, based on the
alternative first exon of rat lens (EMBL accession no. U96367), and a
primer, 5p.m, based on the second exon of mouse calpain 3 cDNA (Table
1).
Cloning of the cDNA isoforms.
PCR products were subcloned
into the pCRII or pCR2.1 plasmid (Invitrogen) in Escherichia
coli XL1 Blue. When appropriate, clones were subjected to sequence
analysis with internally specific primers and specific primers of the
plasmid, by the dideoxy termination method on Applied Biosystems sequencers.
Quantitative RT-PCR.
Expression of the calpain 3 gene was
investigated by a quantitative RT-PCR method with TaqMan probes
(Perkin-Elmer). This technique allows real-time detection of PCR
products by measuring the increase in fluorescence due to TaqMan probe
degradation (8). Fluorescence emission was monitored with a
sequence detector (Perkin-Elmer model 7700). The ubiquitous
transcription factor TFIID was used to normalize the data across
samples. The primer pairs used for amplification were M811CANP3.a
(ACAACAATCAGCTGGTTTTCACC) and M954CANP3.m (CAAAAAACTCTGTCACCCCTCC) for calpain 3 and M616TFIID.a
(ACGGACAACTGCGTTGATTTT) and M724TFIID.m
(ACTTAGCTGGGAAGCCCAAC) for TFIID. The Taqman
probes labeled with Tamra and with Fam were M884CAPN3.p
(TGCCAAGCTCCATGGCTCCTATGAAG) and M654TFIID.p
(TGTGCACAGGAGCCAAGAGTGAAGA) for calpain 3 and for TFIID, respectively.
Expression in COS-7 cells and Western blot analyses.
cDNA
constructs corresponding to alternatively spliced isoforms, inserted in
the correct orientation into a pSRD vector (37), were
transfected into COS-7 cells by electroporation as described previously
(2). After 48 h of incubation at 37°C, the
transfected cells were harvested and sonicated in lysis buffer (100 mM
Tris-HCl [pH 7.5], 10 mM EDTA, 1 mM dithiothreitol). Samples were
fractionated by sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis, blotted, and analyzed with antiserum against an
-fodrin peptide, kindly provided by T. C. Saido, and a peptide
in the IS2-specific region of calpain 3 (32). The
immunological reaction was revealed by peroxidase staining as described
previously (20).
Titin binding assay.
cDNAs corresponding to alternatively
spliced isoforms were inserted into a pAS2C-1 vector (modified pAS2-1
vector; Clontech) in frame with the GAL4 DNA sequence. Two titin cDNA
clones (pCNT-N2 and pCNT-52 [32]) were used for a
binding assay in a Saccharomyces cerevisiae two-hybrid
system. Each calpain 3 isoform construct was cotransfected with either
pCNT-N2 or pCNT-52 into the CG-1945 S. cerevisiae yeast
strain by the Li acetate method. Yeast cells were grown for 48 h
at 30°C in SD medium with leucine-tryptophan dropout supplement
(Clontech). Interaction between calpain 3 isoforms and titin peptides
was tested by monitoring (i) the growth capacity of transfected yeast
in LW medium lacking histidine in the presence of 1.5 mM or 5 mM
3-amino-1,2,4-triazol and (ii)
-galactosidase activity with a
chlorophenol red-
-D-galactopyranoside (CPRG) substrate
as described previously (34). Yeast cultures at equal cell
densities were used for the
-galactosidase assays, and substrate hydrolysis was measured in the linear response range.
Nucleotide sequence accession number.
The 2,513-bp sequence
for murine intron 1 and 780-bp sequence for murine intron 16 have been
deposited in the EMBL database under accession no. AJ224981 and
AJ224980.
 |
RESULTS |
(i) Characterization of a putative splicing event in intron
16.
In the course of the cloning of the mouse calpain 3 cDNA
(25), we isolated, from a mouse poly(A)+ muscle
cDNA library (random lgt10 library from Stratagene), a clone (S15)
containing a sequence between exons 16 and 17. This clone was
sequenced, and the inserted sequence was found to be identical to the
first 308 bp of the 780-bp-long murine intron 16 sequence (EMBL
accession no. AJ224980).
The presence of these nucleotides in S15 suggested that an alternative
5' splice donor site within this intron had been used instead of the
regular one. In view of this observation, we undertook a systematic
isolation of calpain splice variants.
(ii) Systematic PCR screening for additional isoforms.
A
series of RT-PCR amplifications was performed with sets of primers
covering the entire coding sequences of the murine capn3 transcripts (Table 1). These reactions were performed on total RNAs
from established murine cell lines, at either the myoblast or the
myotube stage. We observed differences in the gel profiles of the PCR
products after amplification with the primer pairs p94sys3.a and
p94sys3.m, p94sys5.a and p94sys5.m, and p94sys6.a and p94sys6.m
(Fig. 1). Interestingly, these primer
pairs flank either IS1 or IS2 (Fig. 2).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Electrophoresis of variant PCR products from the
systematic screening of myoblast and myotube RNAs. Amplifications were
performed with p94sys3 primers flanking the IS1 region (A) and with
p94sys5 (B) and p94sys6 (C) primers flanking the IS2 region. MB,
myoblast; MT, myotube. (A) The 396-bp band corresponds to the splicing
out of exon 6. (B) The 601-, 505-, and 487-bp bands correspond,
respectively, to the skipping of exon 15 and exon 16 and the splicing
out of both exons 15 and 16. (C) The 603- and 774-bp bands correspond,
respectively, to the retention of the int137 and int308 sequences.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
Alternative splicing events of mouse calpain 3 mRNA. (A)
Schematic diagrams of the calpain 3 protein with its four domains and
its three specific sequences, NS, IS1, and IS2, and the exon structure
of the mRNA. Positions of the primers used for long-range PCR are
indicated. (B) Sites of alternative splicing with deletion of (i) exon
6, (ii) exon 15, (iii) exon 16, and (iv) exons 15 and 16. Arrows denote
the positions of primers used in PCR for identifying alternative
splicing events. (C) Variant forms of mouse calpain 3 mRNA produced by
the association of alternative splicing of the three exons, 6, 15, and
16 (gaps in black lines), and retention of the sequences int137 and
int308 (short and somewhat longer gray lines, respectively). (D)
Retention of the sequences int137 and int308 in intron 16. AS and DS
are 3' acceptor and 5' donor sites, respectively. Putative splice
sites are in italics. The scores of comparison between consensus splice
sites and normal or putative alternative splice sites are indicated.
|
|
PCR products whose fragment sizes differed from expected sizes were
cloned and sequenced. The 396-bp band seen in Fig.
1A
corresponds to
the splicing out of exon 6; the 601-, 505-, and
487-bp products seen in
Fig.
1B correspond, respectively, to the
splicing out of exon 15, exon
16, and both exons 15 and 16. The
774- and 603-bp products seen in Fig.
1C correspond to the retention
of two sequences internal to intron 16 (int308 and int137). The
names of these internal sequences refer to the
number of intronic
(int) nucleotides retained. int308 and int137
correspond, respectively,
to the insertion sequence present in
clone S15 and to the last
137 nucleotides of int308. The different
events are depicted in
Fig.
2.
Products containing or lacking exon 6 were detected in both RNA
populations, but their relative amounts were, however, in
inverse
proportions, the ex6

isoform (lacking exon 6) being more
abundant in myoblasts than
in myotubes (Fig.
1A). While splicing out of
exon 16 is seen in
cDNAs from both myoblast and myotube cultures,
splicing of both
exons 15 and 16 seems to be present only in myoblast
cDNA, where
it is the major form (Fig.
1B). Amplification products
containing
int137 and int308 were detected in cDNA from myoblast
cultures
(Fig.
1C) and also in cDNA from myotube cultures, as was shown
after subcloning of PCR
products.
To investigate the association between these different events in
individual mRNA molecules, amplification of the entire cDNA
was
performed by long-range RT-PCR on mRNAs from myoblasts and
myotubes.
Screening of at least 40 independent clones from each
mRNA population
led to the identification of several variant forms
of mouse calpain 3 mRNA. The majority of them, representing 12
independent isoforms, are
produced by combinatorial associations
of alternative splicing events
involving exon 6, 15, or 16 and/or
retention of int137 or int308 (Fig.
2C). Skipping of exon 4, 5,
or 7 or retention of intron 18 was also
occasionally encountered,
but this occurred in too few clones to be
taken into
account.
(iii) Analysis of the sequences in intron 16.
Examination of
the 3' border of the murine int137 and int308 sequences (Fig. 2D) for
the presence of potential consensus splice sites revealed the existence
of a donor splice site (Shapiro's rodent score of 74.6%
[30]). It must be noted that this site corresponds to
the nonconventional consensus sequence carrying a GC instead of the
so-called invariant GT (10). Moreover, an acceptor splice
site presenting a score of 90.6% with respect to the rodent consensus
score is found in the murine sequence at the position corresponding to
the 5' border of the int137 sequence. Furthermore, a sequence
corresponding to the consensus branch site is present 35 bp upstream of
this putative acceptor site. These findings are thus compatible with
the notion that int137 and int308 represent alternatively spliced
products of the mouse capn3 gene. The corresponding murine
calpain 3 polypeptides, if produced, would terminate before domain IV,
due to the introduction of premature stop codons, and hence be devoid
of the corresponding Ca2+ binding sites.
(iv) Additional events involving the NS region.
In our
systematic screening of muscle cell lines, no alternative splicing
products affecting NS, the N-terminus-specific region of calpain 3, were detected. However, several eye-specific calpain 3 isoforms
carrying a variant and shorter first exon have recently been described:
Lp82 (EMBL accession no. U96367 [17]), Lp85 (EMBL
accession no. AF052540), both of which are present in lens
tissue, and Rt88 (EMBL accession no. AF061726), which is present in
retinoid and choroid tissues. The existence of these calpain 3 isoforms
is therefore further proof of the existence of alternative splicing events.
To confirm whether the sequences encoding the different N termini
reside in the same region of the genome and therefore to
further
characterize the genomic organization of the murine
capn3 gene, lens-specific primers taken from the Lp82 sequence were
used in
PCR experiments on various genomic DNA fragments from
the mouse
capn3 region. The results obtained enabled us to locate
lens-specific exon 1, named exon 1', in the 3' part of the first
capn3 intron. We thus initiated the sequencing of murine
intron
1. Analysis of the 2,513-bp-long sequence obtained showed the
presence of a potential donor splice site with an excellent consensus
score (82.4%) (
30) at a position corresponding to the 3'
end
of this exon. As for the rat sequence, a start codon included
in a
related Kozak consensus sequence (
14) was present 311 bp
upstream of this splice site. This exon is highly homologous (95.5%)
to the corresponding published rat variant sequence (
17).
As no significant acceptor splice site was found at the 5' end of this
exon, computer analyses were performed to detect the
presence of a
promoter. Use of the promoter prediction program
Proscan
(
21) revealed a score of 88.27 (cutoff, 53) for the
nucleotide sequence from positions

267 to

28, including a TATA
box
at position

96, before the putative initiation ATG. Comparison
with
sequences in the Transfac database (
9) with the TFSEARCH
and
MatInspector programs (
23) revealed the presence of GC box
and CCAAT box promoter elements at nucleotides

112 and

87,
respectively
(
1). In the same analysis, we observed two
putative binding
sites for the

-crystallin enhancer binding protein,

EF1, at
nucleotide positions

1042 to

1036 and

535 to

529
(
29). These
data suggest that the lens variant is
transcribed from an alternative
promoter.
(v) Tissue distribution of calpain 3 transcripts.
Mouse
embryos of different developmental days (11.5 to 18.5) and several
muscular and nonmuscular mouse tissues were investigated to verify the
presence of calpain 3 mRNA isoforms and the extent to which other
nonmuscular tissues may contribute to the production of calpain 3 isoforms. Primers covering alternatively spliced regions were
used to generate RT-PCR products, which were visualized by
electrophoresis (Table 1; Fig. 3). PCR
amplification performed with primers specific to the ubiquitously
expressed transcription factor TFIID was used as an internal control
(Table 1).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Visualization of calpain 3 isoforms. Electrophoresis of
RT-PCR products during mouse embryonic development from days 11.5 to
18.5 (A) and in different tissues (embryonic lens and lens, brain,
heart, and smooth and skeletal muscle tissues from 9- to 11-week-old
mice) (B). E, embryonic day. (a) PCR products obtained with p94sys3
primers. The 540- and 396-bp bands correspond, respectively, to the
entire segment with and without exon 6. (b) PCR products obtained with
primers p94sys5.a and p94sys5b.m. The 619-bp band is from the unspliced
mRNA. The 601-, 505-, and 487-bp bands correspond, respectively, to the
splicings of exon 15 and exon 16 and the association of splicings of
exons 15 and 16. The embryonic lens profile was obtained with a
Southern blot probed with the peroxidase-labeled primer sIS2
(5'-GGAAGCTGAAAATACAATCTCTG-3', positions 1746 to 1768) (the
figure is a photographic negative). (c) Amplification of a TFIID
sequence.
|
|
No
capn3 transcripts could be seen in embryos before day
12.5, in agreement with in situ hybridization results (see below).
Isoforms present in myoblast and myotube cultures (ex6

,
ex15

, ex16

, int137
+, and
int308
+) were also found in mouse embryos (Fig.
3A).
Transcripts lacking
exon 6, though present in embryos from days 12.5 to
18.5, represented
the predominant forms from embryonic days 12.5 to
15.5 (Fig.
3A).
Figure
3B shows that isoforms lacking both exons 15 and
16 are
the major isoforms in the early stage and that their expression
decreases during development in favor of the complete isoform.
In
addition, the int137
+ and int308
+ transcripts
were found at some stages and in low copy numbers
(data not
shown).
Different mouse tissues (adult skeletal, cardiac and smooth muscle,
brain, and lens tissues and lens tissue of a day 15.5
embryo) were also
subjected to similar analyses. While both spliced
and unspliced
isoforms were seen in all these tissues (Fig.
3B),
our results clearly
showed that the relative amounts of the calpain
3 RNA isoforms vary
from tissue to tissue. Whereas in the striated
tissues the complete
forms are the most common ones, isoforms
lacking exon 6 or both exons
15 and 16 are expressed at high levels
in adult brain, adult smooth
muscle, and embryonic lens. The embryonic
lens pattern is also seen in
adult lens but at lower
intensities.
These experiments were completed by measuring, by a semiquantitative
RT-PCR method, the calpain 3 mRNA levels among mRNA preparations
extracted from the same embryonic and adult mouse tissues. The
experimental design was such that the total amount of calpain
3 was
taken into account, independently of alternative splicing
events. The
results presented are relative to the amount of calpain
3 mRNA present
in the skeletal muscle (Fig.
4). Although
calpain
3 mRNA is present in trace amounts in most tissues examined (at
levels from 100- to 1,000-fold lower than the level present in
skeletal
muscle), it is present at an exceptionally higher level
in one tissue,
the embryonic lens. In addition, this experiment
enabled us to
demonstrate a dramatic decrease of calpain 3 expression
in lens between
the mouse embryonic and adult stages.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Measure of calpain 3 mRNA level by quantitative RT-PCR.
Calpain 3 transcription was monitored in six different tissues by a
quantitative PCR method with TaqMan probes. The level of TFIID mRNA was
used to normalize the results across different tissues. An arbitrary
value of 1 was assigned to the skeletal muscle value, and the values
measured in the other tissues are expressed as ratios to the skeletal
muscle content, these ratios being drawn in a logarithmic scale.
|
|
(vi) In situ hybridization.
A previous in situ hybridization
study of murine embryo slices demonstrated that an
oligonucleotide probe specific to exon 1 (NS region) failed to
yield any lens signal but that probes for exon 6 and exon 16 (in
the IS1 and IS2 regions, respectively) unambiguously demonstrated the
presence of calpain 3 transcripts in this tissue (5). To
complete these data, isoform-specific oligonucleotides (var5p.AS,
int308.AS, int137.AS, ep6.AS, ep15.AS, ep16.AS, and ep1516.AS) were
used in similar experiments (Table 2).
Hybridization of the oligonucleotide probe derived from the 5'
sequence of the mouse lens-specific capn3 gene (var5p.AS)
yielded intense labeling, which was seen only in the lens (Fig.
5). The probes specific for splicing
events involving the IS1 and IS2 regions also yielded a restricted
and intense lens-specific signal (Table
3). It should be noted that the signal
obtained with the isoform-specific oligonucleotides was far more
intense than the signals obtained with the exon 6- and exon 16-specific
probes, suggesting that alternatively spliced transcripts predominate in embryonic lens tissue. This result is in agreement with RT-PCR results. In addition, the lens capn3 signal is present in
embryos at day 12.5, well before the visualization of calpain 3 expression in skeletal muscles, and is still present 1 week after birth
(6). The signal corresponding to the probes ep16.AS and
ep1516.AS disappeared after embryonic day 13.5, although the
corresponding RNA isoforms were still detected by RT-PCR. The apparent
discrepancy between these results may be explained by the differential
sensitivities of the two methods used.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
In situ hybridization on an embryonic lens region. Shown
are transverse sections of NMRI mice embryos at day 12.5 (A to C) and
sagittal sections at day 17.5 (D to F). In the phase-contrast images (A
and D), the bars represent 600 mm. The other panels show results of
dark-field in situ hybridization with a probe specific for the exon 1'
sequence (var5pAS) (B and E), a sense probe (var5p.S) (F), and a
titin-specific probe (C) (6). EOM, extrinsic ocular muscle;
FM, facial muscle; L, lens, NL, neural layer of retina; O, orbital
plate of frontal bone; PNC, primitive nasal cavity; PV, primitive
vitreous humor. Note that pigments of the neural layer of the retina
and primitive ossification within the medial part of the roof of the
orbit are due to nonspecific labeling.
|
|
(vii) Investigation of functional characteristics of the translated
products.
While the exact physiological functions of calpain 3 remain unknown, some characteristics of this protein are already
accessible to testing (20). These include calpain 3's titin
binding ability and its autolytic and fodrinolytic capacities. The
extent to which the spliced regions are involved in mediating these
properties was investigated with COS-7 cells and in the yeast
two-hybrid system. The advantage of these assay systems is that they
allow dissection of the various splicing events, including the testing of isoforms that are not seen in vivo, and thereby assessment of the
impacts of individual events.
Cell extracts from COS-7 cells in which the different isoforms are
transiently expressed were subjected to Western blot analyses.
First,
calpain 3 polypeptides were detected with a polyclonal
antibody
directed against a peptide from the NH
2-terminal region
of
the IS2 region, spanning the end of exon 14, exon 15, and the
beginning
of exon 16 (
32). Under the conditions used, the full-length
products were present only if the autolytic property was impaired.
The
results showed that the calpain 3 products derived from complete
p94-mRNA were not detectable (Fig.
6B). A similar result
was seen
for the variant in which exon 1' was substituted for exon
1 (ex1'
+,1

). In contrast, unproteolyzed
products derived from all other
isoforms lacking exon 6 or exon 15 and/or both exons 15 and 16
were detected (Fig.
6B). These results
indicated that the preservation
of both IS1 and IS2 is necessary for
the rapid autolysis of calpain
3.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Investigation of the autolytic and fodrinolytic
capacities and titin binding abilities of the different isoforms. (A)
The isoforms investigated for biochemical characteristics are drawn
under the diagram of the calpain 3 protein (Lp82 corresponds to the
ex1'+,1 6 15 16
isoform). Their names and molecular masses are given at the left of the
line. The position of the C129S mutation, which inactivates the
catalytic site, is indicated. Western blot analyses were performed on
lysates of transfected COS-7 cells to visualize proteolytic calpain 3 fragments with an antibody against the IS2-specific region of p94 (B)
and to assess fodrinolysis with an antibody specific to the 150-kDa
-fodrin fragment (C). Open arrowheads indicate the full-length
products, and filled arrowheads indicate proteolyzed fragments. The titin binding capacity
of each isoform was monitored in a yeast two-hybrid system by measuring
-galactosidase activity with CPRG as the substrate (1 U of
-galactosidase is defined as the amount which hydrolyzes 1 mmol of
CPRG in 1 min). (D and E) Histograms of -galactosidase expression
for each isoform following cotransfection into S. cerevisiae
cells of a calpain 3 isoform and pCNT-N2 (D) and pCNT-52 (E) titin
peptide-encoding clones. Bars indicate the mean -galactosidase
activities from three independent experiments; ranges are indicated by
the vertical lines. (Lp82 corresponds to the
ex1'+,1 6 15 16
isoform). The first column corresponds to transfection with the vector
pAS2C-1 alone.
|
|
Second, with the same COS-7 protein extracts, appearance of the 150-kDa
proteolyzed fodrin

subunit (
7,
19) was monitored
with an
antibody against the N-terminal sequence of this protein
(
27). While fodrinolytic activity is preserved in half of
the
extracts, it is barely demonstrable for extracts of
ex1'
+,1

isoforms and undetectable for
isoforms lacking both exons 15
and 16 (Fig.
6C). As isoforms lacking
exon 15 possess fodrinolytic
activity, these results suggest that exon
16 is essential for
fodrin
cleavage.
Third, titin binding ability was tested in a yeast two-hybrid system
using as bait two different regions of titin: an internal
and
C-terminal fragment corresponding, respectively, to the sarcomeric
N
2 and M lines. These regions were previously shown
(
11,
34)
to act as binding sites for calpain 3, with
binding to the N2
line region being much stronger than binding to the M
line region
(
34). Our data demonstrate that binding to the
N2 line region
is affected only in isoforms with exon 1' (Fig.
6D). In
contrast,
binding to the C-terminal region is enhanced (between three-
and
fivefold) for all non-lens isoforms lacking exon 16 (Fig.
6E).
No
significant differences with respect to N2 line binding is
seen between
the calpain 3 isoforms lacking exon 15 or exons 15
and 16. This result
is to be contrasted with the effect on C-terminal
titin binding,
suggesting that the calpain 3 sites responsible
for the association
with these two titin segments are not identical.
Thus, in addition to
the two titin binding sites, there may be
at least two calpain 3 interaction mechanisms which may correspond
to distinct functional
and/or regulatory biological properties.
Considering the fact that
splicing of exons 6, 15, and 16 does
not completely abolish titin
binding, we infer that these exons
are not essential for this
association, though exon 16 might regulate
this binding, as its absence
led to a stronger interaction with
the C-terminal titin
region.
 |
DISCUSSION |
In this report, we describe the isolation and analyses of calpain
3 gene isoforms. We identified different transcriptional and/or
posttranscriptional events in mice which lead to alterations involving
the NS, IS1, and IS2 regions and/or the calcium binding domains. These
events can be divided into three groups: (i) splicing of exons that
preserve the translation frame; (ii) inclusion of two distinct intronic
sequences between exons 16 and 17 that disrupt the frame and would
lead, if translated, to a truncated protein lacking domain IV; and
(iii) use of an alternative first exon specific to lens tissue. The
splicing out of exons 6, 15, and 16 cannot represent transient
intermediate steps towards the production of mature calpain 3 mRNA, and
the status of the molecules retaining parts of intron 16 is still
unclear. The fact that the splicing of exons 6, 15, and 16 were seen
with both total and poly(A)+ RNAs lends credence to the
fact that the corresponding RNAs represent authentic mRNA isoforms.
The mouse myoblast cell line C2C12, which can be induced to
differentiate into myotubes, was chosen as a model for the study of
calpain 3 transcription during in vitro skeletal muscle
differentiation. The results presented here show that differentiation
in this cell culture system is accompanied by a change in the
expression pattern of calpain 3 RNA isoforms, suggesting that the
transcription of the different isoforms is regulated during muscle
differentiation. We also noted an increase in the relative overall
abundance of calpain 3 transcripts, and particularly of mature 3.5-kb
mRNA, in myotubes compared to that in myoblasts.
As the initial observations were carried out ex vivo, there remained a
possibility that the reported RNA splicing events do not occur in vivo.
There was thus a need to substantiate these data by the examination of
different murine tissue samples. Splice variants were observed at
various developmental stages (from days 12 to 18) of fetal gestation as
well as in adult mouse tissues. These data imply that multiple
capn3 RNA isoforms are also generated in vivo and,
furthermore, that they are developmentally regulated. Fougerousse et
al. (6) reached a similar conclusion, upon observation of
the spatiotemporal transcription patterns of CAPN3 during human prenatal development. They demonstrated the presence of alternatively spliced products in smooth muscles in humans by in situ hybridization using oligonucleotides specific for the NS, IS1, and IS2 regions as
probes. Our results further corroborate and extend the observations of
Ma et al. (17), i.e., that a lens-specific exon stemming most likely from the use of a lens-specific promoter exists and that it
is subject to alternative splicing involving the IS1 and IS2 regions.
The examination of the impact of the loss or substitution of defined
exons on a number of biochemical parameters provides us with a refined
and sensitive tool to dissect calpain 3 and establish
structure-function relationships. Furthermore, since the segments
affected by these events span the sequences which are unique to calpain
3, such analyses also enable us to address the specificity of this
protease compared to those of the ubiquitous calpains. Translation of
the calpain 3 isoform transcripts identified in this study would
obviously result in substantial alterations of calpain 3 structure and
properties. Transfection experiments with COS-7 cells demonstrate that
the corresponding proteins are synthesized, at least in these cells.
Assuming that these proteins are also synthesized in vivo (and the
report of Ma et al. demonstrated that in the rat lens this is
definitively the case), and on the basis of the results of the
functional analyses performed in this study, the consequences of the
observed splicing events from the NH2 to COOH termini can
be considered to either prevent or alter the presumed functions of the
domains involved.
The consequences of replacing the NH2 terminus containing
the NS sequence with the lens-specific peptide are not known. Clearly, this substitution needs also to be viewed in the context of a simultaneous loss of parts of IS1 and IS2. The main lens isoform (Lp82)
seems to have lost fodrinolytic as well as autolytic activity, although
the rat lens protein still possesses caseinolytic activity in vitro in
the presence of 20 mM Ca2+ (18). It should be
noted that the experiments presented herein were performed without
addition of Ca2+. It is therefore possible that, unlike p94
(12), this isoform requires exogenous Ca2+ for
exercising proteolytic activity. In support of this hypothesis, autolysis was enhanced in our experiments upon addition of calcium to 5 mM for all tested calpain 3 isoforms lacking exon 16 (data not shown).
It is of interest that exon 1' variants were seen exclusively in the
lens. Furthermore, they all have impaired binding to both known titin
sites, which is congruent with the absence of titin in this tissue.
Taken together, our observations suggest that exon 1' isoforms fulfill
lens-specific functions. Calpain 3 would not be the first enzyme found
to also be expressed in the lens. The related m calpain was reported to
be implicated in proteolysis of crystallins during normal maturation of
rat lens (3). In addition, it is noteworthy that various
metabolic enzymes acquire a second function as taxon-specific lens
structural proteins (22, 39). It is thus conceivable that
calpain 3 belongs to this class of proteins. Whereas our study confirms
that calpain 3 mRNA is less abundant in the adult lens, it also clearly
shows that in the embryonic lens, the situation is quite the opposite, there being more calpain 3 mRNA in this tissue than in adult skeletal muscle. The presence of such calpain 3 variants in lens may have to do
more with the formation and maturation of the lens than with exercising
visual activities.
The fact that two isoforms for exon 6 coexist in a variety of tissues
suggests the presence of different calpain 3 activities in the same
tissues or perhaps even fibers. The function of the IS1 sequence, which
is encoded partially by exon 6, is unknown. It is located in
proteolytic domain II. Polypeptides lacking exon 6, while capable of
proteolyzing
-fodrin, have impaired autolytic activity. This
observation is in agreement with the location of autolytic cleavage
sites in the IS1 region (12). Cleavage of calpain 3 follows
a three-step process yielding, sequentially, 60-, 58-, and 55-kDa
products. The first two steps involve sites encoded by exon 6. Therefore, the absence of two of three cleavage sites may explain the
impairment of autolysis.
IS2 is presumed to have an important role in the rapid autolysis of the
protein (32). Furthermore, it comprises a binding site for
titin (34) and a putative nuclear translocation signal (31). Splicing modulation of exon 15, which carries the
nuclear translocation signal, may affect, among other things, the
subcellular localizations of the resulting proteins by directing them
either to the cytoplasm or to the nucleus, as well as the selection of the titin binding site (Fig. 6). Our data indicate that the loss of
exon 16 has two effects: increased titin binding at its C-terminal end
and a loss of fodrinolytic activity. As titin is not present in COS-7
cells, we can infer that it is not the sequestration of calpain 3 through its association with titin that prevents fodrinolysis.
Furthermore, the amino acids encoded by exon 16 do not include residues
that participate in the catalytic site. They may, however, be necessary
for substrate recognition. These data (Fig. 6) also suggest that the
two titin binding sites map outside of the sequence contained in exons
15 and 16 (though sequences within these exons may impact
differentially the titin binding sites) and furthermore that the N2
line binding site resides between amino acids 570 and 595 (34).
In addition to splicing events resulting in loss of particular exons,
we also noted the presence of a splicing site and branch sites in
murine intron 16, leading either to the formation of a new exon of 137 bp (int137) or to the addition of a 308-bp sequence 3' to exon 16 (int308). Unlike with Lp85, which retains intron 18 without
consequences to the reading frame (data not shown), inclusions of
intron 16 sequences lead to premature in-frame stop codons
(18). As these sequences are situated between exons 16 and
17, the presumed consequence is the loss of protein domain IV, which is
thought to participate in the calcium regulation of calpain activity.
The resulting isoforms may therefore be calcium independent or less
calcium dependent by using the remaining calcium-binding EF hand motif,
present in the third domain. Similar observations were reported for the
stomach-specific calpains nCL-2 and nCL-2' (33) and for a
Drosophila atypical calpain (38). Elucidation of
these mechanisms and of their significance awaits further investigations.
Since differences in levels of gene expression between mouse and human
are not exceptional, we examined whether human calpain 3 was also
subject to alternative splicing. RNAs extracted from human cultured
muscle cells were analyzed by RT-PCR as described above. Preliminary
results performed on these RNAs demonstrated the existence of similar
splicing events involving the IS1 region. Skipping of exon 6 can be
evidenced in the presence of the ex6
cDNA, both at the
myoblast and myotube stages (data not shown). We also demonstrated that
in lymphoblastoid cell lines, exon 15 is systematically spliced out but
that only half of the molecules have exon 6 spliced out. Evidence of
alternative splicing in vivo in humans is also corroborated by the
presence of splicing events during development, as was revealed by in
situ hybridization (6).
Muscle cells are notorious for their utilization of alternative
splicing as a means to generate multiple isoforms for a given gene
(28). Calpain 3 thus belongs to this category of genes. It
is worth remembering that titin also exists in alternatively spliced
forms (15). In particular, the two titin binding sites recognized by calpain 3 are affected by tissue-specific alternative splicings. These events generate at the N2 line cardiac or skeletal muscle-specific isoforms and at the M line a mixture of isoforms whose
ratios vary from muscle to muscle (13). The generation of
these isoforms suggests that calpain 3, which interacts with at least
one other protein that is also subject to alternative splicing (titin),
may be involved in a complex tissue-specific spectrum of combinatorial
possibilities. The specific topography and characteristics of muscle
involvement in patients with limb girdle muscular dystrophy type 2A may
be related to this potentially complex set of interactions.
The differential splicing of the calpain 3 gene and the modulation of
the expression of the different isoforms need to be taken into account
in investigations of the biological role(s) of calpain 3. It is of
course of crucial importance to demonstrate the existence in vivo of
the translated products generated from the variant calpain 3 mRNA
molecules as reported by Ma et al. for the rat lens (18). It
would also be of interest to determine the exact (sub)cellular
locations of all these isoforms. Finally, the demonstration of the
existence of different calpain 3 protein isoforms is also likely to
have important consequences on our understanding of human
pathophysiology and of the phenotypes of capn3
/
animals as well as on the
establishment of therapeutic strategies.
 |
ACKNOWLEDGMENTS |
We thank Gillian Butler-Brown for providing us with human RNA, P. Daubas for providing embryonic lenses, Takaomi C. Saido for providing
antiserum against an
-fodrin peptide, Michel Vidaud for having
initiated us in the quantitative RT-PCR technique, and Marc Fizman
carefully reading the manuscript. We thank Muriel Durand and Laurence
Suel for their excellent technical assistance.
This work was supported by grants from the Association Française
contre les Myopathies and by a grant-in-aid for international scientific research (joint research) from the Ministry of Education, Science, Sports and Culture of Japan. M.H. is a recipient of an AFM fellowship.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Généthon, 1 rue de l'Internationale, 91000 Evry, France.
Phone: 33-1 69 47 29 38. Fax: 33-1 60 77 86 98. E-mail:
beckmann{at}genethon.fr.
 |
REFERENCES |
| 1.
|
Bucher, P.
1989.
Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences.
J. Mol. Biol.
212:563-578.
|
| 2.
|
Chu, G.,
H. Hayakawa, and P. Berg.
1987.
Electroporation for the efficient transfection of mammalian cells with DNA.
Nucleic Acids Res.
15:1311-1326[Abstract/Free Full Text].
|
| 3.
|
David, L. L., and T. R. Shearer.
1986.
Purification of calpain II from rat lens and determination of endogenous substrates.
Exp. Eye Res.
42:227-238[Medline].
|
| 4.
|
Fardeau, M.,
D. Hillaire,
C. Mignard,
N. Feingold,
D. Mignard,
B. de Ubeda,
H. Collin,
F. M. S. Tomé,
I. Richard, and J. S. Beckmann.
1996.
Juvenile limb-girdle muscular dystrophy: clinical, histopathological, and genetic data from a small community living in the Reunion Island.
Brain
119:295-308[Abstract/Free Full Text].
|
| 5.
|
Fougerousse, F.,
M. Durand,
L. Suel,
O. Pourquié,
A.-L. Delezoide,
N. Roméro,
M. Abitbol, and J. S. Beckmann.
1998.
Expression of genes (CAPN3, SGCA, SGCB and TTN) involved in progressive muscular dystrophies during early human development.
Genomics
48:145-156[Medline].
|
| 6.
| Fougerousse, F., P. Bullen, M. Herasse, S. Lindsay, I. Richard, S. Lee, L. Suel, A. McMahon, D. Durand, S. Robson, D. Wilson,
M. Abitbol, J. S. Beckmann, and T. Strachan. Human-mouse
differences in the expression patterns of disease genes and
developmental control genes during early development. Submitted for
publication.
|
| 7.
|
Harris, A. S.,
D. E. Croall, and J. S. Morrow.
1988.
The calmodulin-binding site in alpha-fodrin is near the calcium-dependent protease-I cleavage site.
J. Biol. Chem.
263:15754-15761[Abstract/Free Full Text].
|
| 8.
|
Heid, C. A.,
J. Steven,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 9.
|
Heinemeyer, T.,
E. Wingender,
I. Reuter,
H. Hermjakob,
O. Kel,
E. Ignatieva,
E. Ananko,
O. Podkolodnaya,
F. Kolpakov,
N. Podkolodny, and N. Kolchanov.
1998.
Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL.
Nucleic Acids Res.
26:364-370.
|
| 10.
|
Jackson, I. J.
1991.
A reappraisal of non-consensus mRNA splice sites.
Nucleic Acids Res.
19:3795-3798[Free Full Text].
|
| 11.
|
Kinbara, K.,
H. Sorimachi,
S. Ishiura, and K. Suzuki.
1997.
Muscle-specific calpain, p94, interacts with the extreme C-terminal region of connectin, a unique region flanked by two immunoglobulin C2 motifs.
Arch. Biochem. Biophys.
342:99-107[Medline].
|
| 12.
|
Kinbara, K.,
S. Ishiura,
S. Tomioka,
H. Sorimachi,
S. Y. Jeong,
S. Amano,
H. Kawasaki,
B. Kolmerer,
S. Kimura,
S. Labeit, and K. Suzuki.
1998.
Purification of native p94, a muscle-specific calpain, and characterization of its autolysis.
Biochem. J.
335:589-596.
|
| 13.
|
Kolmerer, B.,
N. Olivieri,
C. C. Witt,
B. G. Herrmann, and S. Labeit.
1996.
Genomic organization of M line titin and its tissue-specific expression in two distinct isoforms.
J. Mol. Biol.
256:556-563[Medline].
|
| 14.
|
Kozak, M.
1986.
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:283-292[Medline].
|
| 15.
|
Labeit, S., and B. Kolmerer.
1995.
Titins: giant proteins in charge of muscle ultrastructure and elasticity.
Science
270:293-296[Abstract/Free Full Text].
|
| 16.
|
Lee, H.-J.,
H. Sorimachi,
S.-Y. Jeong,
S. Ishiura, and K. Suzuki.
1998.
Molecular cloning and characterization of a novel tissue-specific calpain predominantly expressed in the digestive tract.
Biol. Chem.
379:175-183[Medline].
|
| 17.
|
Ma, H.,
C. Fukiage,
M. Azuma, and T. R. Shearer.
1998.
Cloning and expression of mRNA for calpain Lp82 from rat lens: splice variant of p94.
Investig. Ophthalmol. Vis. Sci.
39:454-461[Abstract/Free Full Text].
|
| 18.
|
Ma, H.,
M. Shih,
I. Hata,
C. Fukiage,
M. Azuma, and T. R. Shearer.
1998.
Protein for Lp82 calpain is expressed and enzymatically active in young rat lens.
Exp. Eye Res.
67:221-229[Medline].
|
| 19.
|
McMahon, A. S., and R. T. Moon.
1987.
Structure and evolution of a non-erythroid spevtrin, human alpha-fodrin.
Biochem. Soc. Trans.
15:804-807[Medline].
|
| 20.
|
Ono, Y.,
H. Shimada,
H. Sorimachi,
I. Richard,
T. C. Saido,
J. S. Beckmann,
S. Ishiura, and K. Suzuki.
1998.
Functional defects of a muscle-specific calpain, p94, caused by mutations associated with limb-girdle muscular dystrophy type 2A.
J. Biol. Chem.
273:17073-17078[Abstract/Free Full Text].
|
| 21.
|
Pestridge, D. S.
1995.
Predicting PolII promoter sequences using transcription factor binding sites.
J. Mol. Biol.
249:923-932[Medline].
|
| 22.
|
Piatigorsky, J.
1994.
Puzzle of crystallin diversity in eye lenses.
Dev. Dyn.
196:267-272.
|
| 23.
|
Quandt, K.,
K. Frech,
H. Karas,
E. Wingender, and T. Werner.
1995.
MatInd and MatInspector new fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res.
23:4878-4884[Abstract/Free Full Text].
|
| 24.
|
Richard, I.,
O. Broux,
V. Allamand,
F. Fougerousse,
N. Chiannilkulchai,
N. Bourg,
L. Brenguier,
C. Devaud,
P. Pasturaud,
C. Roudaut,
D. Hillaire,
M.-R. Passos-Bueno,
M. Zatz,
J. A. Tischfield,
M. Fardeau,
C. E. Jackson,
D. Cohen, and J. S. Beckmann.
1995.
Mutations in the proteolytic enzyme calpain 3 cause limb-girdle muscular dystrophy type 2A.
Cell
81:27-40[Medline].
|
| 25.
|
Richard, I., and J. S. Beckmann.
1996.
Molecular cloning of mouse canp3, the gene associated with limb-girdle muscular dystrophy 2A in human.
Mamm. Genome
7:377-379[Medline].
|
| 26.
|
Saido, T.,
H. Sorimachi, and K. Suzuki.
1994.
Calpain: new perspectives in molecular diversity and physiological-pathological involvement.
FASEB J.
8:814-822[Abstract].
|
| 27.
|
Saido, T. C.,
M. Yokota,
S. Nagao,
I. Yamaura,
E. Tani,
T. Tsuchiya,
K. Suzuki, and S. Kawashima.
1993.
Spacial resolution of fodrin proteolysis in postischemic brain.
J. Biol. Chem.
268:25239-25243[Abstract/Free Full Text].
|
| 28.
|
Schiaffino, S., and G. Salviati.
1997.
Molecular diversity of myofibrillar proteins: isoforms analysis at the protein and mRNA level.
Methods Cell Biol.
52:349-369[Medline].
|
| 29.
|
Sekido, R.,
K. Murai,
J.-I. Funahashi,
Y. Kamachi,
A. Fujisawa-Sehara,
Y.-I. Nabeshima, and H. Kondoh.
1994.
The -crystallin enhancer-binding protein EF1 is a repressor of E2-box-mediated gene activation.
Mol. Cell. Biol.
14:5692-5700[Abstract/Free Full Text].
|
| 30.
|
Shapiro, M. B., and P. Senapathy.
1987.
RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression.
Nucleic Acids Res.
15:7155-7174[Abstract/Free Full Text].
|
| 31.
|
Sorimachi, H.,
S. Imajoh-Ohmi,
Y. Emori,
H. Kawasaki,
S. Ohno,
Y. Minami, and K. Suzuki.
1989.
Molecular cloning of a novel mammalian calcium-dependent protease distinct from both m- and mu-types. Specific expression of the mRNA in skeletal muscle.
J. Biol. Chem.
264:20106-20111[Abstract/Free Full Text].
|
| 32.
|
Sorimachi, H.,
N. Toyama-Sorimachi,
T. C. Saido,
H. Kawasaki,
H. Sugita,
M. Miyasaka,
K. Arahata,
S. Ishiura, and K. Suzuki.
1993.
Muscle-specific calpain, p94, is degraded by autolysis immediately after translation, resulting in disappearance from muscle.
J. Biol. Chem.
268:10593-10605[Abstract/Free Full Text].
|
| 33.
|
Sorimachi, H.,
S. Ishiura, and K. Suzuki.
1993.
A novel tissue-specific calpain species expressed predominantly in the stomach comprises two alternative splicing products with and without Ca2+-binding domain.
J. Biol. Chem.
268:19476-19482[Abstract/Free Full Text].
|
| 34.
|
Sorimachi, H.,
K. Kimbara,
S. Kimura,
M. Takahashi,
S. Ishiura,
N. Sasagawa,
N. Sorimachi,
H. Shimada,
K. Tagawa,
K. Maruyama, and K. Suzuki.
1995.
Muscle-specific calpain, p94, responsible for limb-girdle muscular dystrophy type 2A, associates with connectin through IS2, a p94-specific sequence.
J. Biol. Chem.
270:31158-31162[Abstract/Free Full Text].
|
| 35.
|
Sorimachi, H.,
S. Kimura,
K. Kinbara,
J. Kazama,
M. Takahashi,
H. Yajima,
S. Ishiura,
N. Sasagawa,
I. Nonaka,
H. Sugita,
K. Maruyama, and K. Suzuki.
1996.
Structure and physiological functions of ubiquitous and tissue-specific calpain species. Muscle-specific calpain, p94, interacts with connectin/titin.
Adv. Biophys.
33:101-122[Medline].
|
| 36.
|
Sorimachi, H.,
S. Ishiura, and K. Suzuki.
1997.
Structure and physiological function of calpains.
Biochem. J.
328:721-732.
|
| 37.
|
Takebe, Y.,
M. Seiki,
J.-I. Fujisawa,
P. Hoy,
K. Yokota,
K.-I. Arai,
M. Yoshida, and N. Arai.
1988.
SRa promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol. Cell. Biol.
8:466-472[Abstract/Free Full Text].
|
| 38.
|
Theopold, U.,
M. Pinter,
S. Daffre,
Y. Tryselius,
P. Friedrich,
D. R. Nassel, and D. Hultmark.
1995.
CalpA, a Drosophila calpain homolog specifically expressed in a small set of nerve, midgut, and blood cells.
Mol. Cell. Biol.
15:824-834[Abstract].
|
| 39.
|
Wistow, G., and J. Piatigorsky.
1987.
Recruitment of enzymes as lens structural proteins.
Science
236:1554-1556[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 1999, p. 4047-4055, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Moretti, D., Del Bello, B., Cosci, E., Biagioli, M., Miracco, C., Maellaro, E.
(2009). Novel variants of muscle calpain 3 identified in human melanoma cells: cisplatin-induced changes in vitro and differential expression in melanocytic lesions. Carcinogenesis
30: 960-967
[Abstract]
[Full Text]
-
De Maria, A., Shi, Y., Kumar, N. M., Bassnett, S.
(2009). Calpain Expression and Activity during Lens Fiber Cell Differentiation. J. Biol. Chem.
284: 13542-13550
[Abstract]
[Full Text]
-
Hayashi, C., Ono, Y., Doi, N., Kitamura, F., Tagami, M., Mineki, R., Arai, T., Taguchi, H., Yanagida, M., Hirner, S., Labeit, D., Labeit, S., Sorimachi, H.
(2008). Multiple Molecular Interactions Implicate the Connectin/Titin N2A Region as a Modulating Scaffold for p94/Calpain 3 Activity in Skeletal Muscle. J. Biol. Chem.
283: 14801-14814
[Abstract]
[Full Text]
-
Ojima, K., Ono, Y., Doi, N., Yoshioka, K., Kawabata, Y., Labeit, S., Sorimachi, H.
(2007). Myogenic Stage, Sarcomere Length, and Protease Activity Modulate Localization of Muscle-specific Calpain. J. Biol. Chem.
282: 14493-14504
[Abstract]
[Full Text]
-
Boutz, P. L., Chawla, G., Stoilov, P., Black, D. L.
(2007). MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development. Genes Dev.
21: 71-84
[Abstract]
[Full Text]
-
Kramerova, I., Kudryashova, E., Wu, B., Spencer, M. J.
(2006). Regulation of the M-Cadherin-{beta}-Catenin Complex by Calpain 3 during Terminal Stages of Myogenic Differentiation. Mol. Cell. Biol.
26: 8437-8447
[Abstract]
[Full Text]
-
Ono, Y., Torii, F., Ojima, K., Doi, N., Yoshioka, K., Kawabata, Y., Labeit, D., Labeit, S., Suzuki, K., Abe, K., Maeda, T., Sorimachi, H.
(2006). Suppressed Disassembly of Autolyzing p94/CAPN3 by N2A Connectin/Titin in a Genetic Reporter System. J. Biol. Chem.
281: 18519-18531
[Abstract]
[Full Text]
-
Huebsch, K. A., Kudryashova, E., Wooley, C. M., Sher, R. B., Seburn, K. L., Spencer, M. J., Cox, G. A.
(2005). Mdm muscular dystrophy: interactions with calpain 3 and a novel functional role for titin's N2A domain. Hum Mol Genet
14: 2801-2811
[Abstract]
[Full Text]
-
Diaz, B. G., Moldoveanu, T., Kuiper, M. J., Campbell, R. L., Davies, P. L.
(2004). Insertion Sequence 1 of Muscle-specific Calpain, p94, Acts as an Internal Propeptide. J. Biol. Chem.
279: 27656-27666
[Abstract]
[Full Text]
-
Ono, Y., Kakinuma, K., Torii, F., Irie, A., Nakagawa, K., Labeit, S., Abe, K., Suzuki, K., Sorimachi, H.
(2004). Possible Regulation of the Conventional Calpain System by Skeletal Muscle-specific Calpain, p94/Calpain 3. J. Biol. Chem.
279: 2761-2771
[Abstract]
[Full Text]
-
Taveau, M., Bourg, N., Sillon, G., Roudaut, C., Bartoli, M., Richard, I.
(2003). Calpain 3 Is Activated through Autolysis within the Active Site and Lyses Sarcomeric and Sarcolemmal Components. Mol. Cell. Biol.
23: 9127-9135
[Abstract]
[Full Text]
-
Schor, S. L., Ellis, I. R., Jones, S. J., Baillie, R., Seneviratne, K., Clausen, J., Motegi, K., Vojtesek, B., Kankova, K., Furrie, E., Sales, M. J., Schor, A. M., Kay, R. A.
(2003). Migration-Stimulating Factor: A Genetically Truncated Onco-Fetal Fibronectin Isoform Expressed by Carcinoma and Tumor-Associated Stromal Cells. Cancer Res.
63: 8827-8836
[Abstract]
[Full Text]
-
Fanin, M., Nascimbeni, A. C., Fulizio, L., Trevisan, C. P., Meznaric-Petrusa, M., Angelini, C.
(2003). Loss of Calpain-3 Autocatalytic Activity in LGMD2A Patients with Normal Protein Expression. Am. J. Pathol.
163: 1929-1936
[Abstract]
[Full Text]
-
GOLL, D. E., THOMPSON, V. F., LI, H., WEI, W., CONG, J.
(2003). The Calpain System. Physiol. Rev.
83: 731-801
[Abstract]
[Full Text]
-
Yu, X., Mykles, D. L.
(2003). Cloning of a muscle-specific calpain from the American lobster Homarus americanus: expression associated with muscle atrophy and restoration during moulting. J. Exp. Biol.
206: 561-575
[Abstract]
[Full Text]
-
Welm, A. L., Timchenko, N. A., Ono, Y., Sorimachi, H., Radomska, H. S., Tenen, D. G., Lekstrom-Himes, J., Darlington, G. J.
(2002). C/EBPalpha Is Required for Proteolytic Cleavage of Cyclin A by Calpain 3 in Myeloid Precursor Cells. J. Biol. Chem.
277: 33848-33856
[Abstract]
[Full Text]
-
Spencer, M. J., Guyon, J. R., Sorimachi, H., Potts, A., Richard, I., Herasse, M., Chamberlain, J., Dalkilic, I., Kunkel, L. M., Beckmann, J. S.
(2002). Stable expression of calpain 3 from a muscle transgene in vivo: Immature muscle in transgenic mice suggests a role for calpain 3 in muscle maturation. Proc. Natl. Acad. Sci. USA
99: 8874-8879
[Abstract]
[Full Text]
-
Stockholm, D., Herasse, M., Marchand, S., Praud, C., Roudaut, C., Richard, I., Sebille, A., Beckmann, J. S.
(2001). Calpain 3 mRNA expression in mice after denervation and during muscle regeneration. Am. J. Physiol. Cell Physiol.
280: C1561-C1569
[Abstract]
[Full Text]
-
Fanin, M., Pegoraro, E., Matsuda-Asada, C., Brown, R.H. Jr., Angelini, C.
(2001). Calpain-3 and dysferlin protein screening in patients with limb-girdle dystrophy and myopathy. Neurology
56: 660-665
[Abstract]
[Full Text]
-
Richard, I., Roudaut, C., Marchand, S., Baghdiguian, S., Herasse, M., Stockholm, D., Ono, Y., Suel, L., Bourg, N., Sorimachi, H., Lefranc, G., Fardeau, M., Sebille, A., Beckmann, J. S.
(2000). Loss of Calpain 3 Proteolytic Activity Leads to Muscular Dystrophy and to Apoptosis-associated I{{kappa}}B{{alpha}}/Nuclear Factor {{kappa}}B Pathway Perturbation in Mice. JCB
151: 1583-1590
[Abstract]
[Full Text]
-
Ma, H., Shih, M., Fukiage, C., Azuma, M., Duncan, M. K., Reed, N. A., Richard, I., Beckmann, J. S., Shearer, T. R.
(2000). Influence of Specific Regions in Lp82 Calpain on Protein Stability, Activity, and Localization within Lens. IOVS
41: 4232-4239
[Abstract]
[Full Text]
-
Arthur, J. S. C., Elce, J. S., Hegadorn, C., Williams, K., Greer, P. A.
(2000). Disruption of the Murine Calpain Small Subunit Gene, Capn4: Calpain Is Essential for Embryonic Development but Not for Cell Growth and Division. Mol. Cell. Biol.
20: 4474-4481
[Abstract]
[Full Text]
-
Nakamura, Y., Fukiage, C., Shih, M., Ma, H., David, L. L., Azuma, M., Shearer, T. R.
(2000). Contribution of Calpain Lp82-Induced Proteolysis to Experimental Cataractogenesis in Mice. IOVS
41: 1460-1466
[Abstract]
[Full Text]
-
Fougerousse, F., Bullen, P., Herasse, M., Lindsay, S., Richard, I., Wilson, D., Suel, L., Durand, M., Robson, S., Abitbol, M., Beckmann, J. S., Strachan, T.
(2000). Human-mouse differences in the embryonic expression patterns of developmental control genes and disease genes. Hum Mol Genet
9: 165-173
[Abstract]
[Full Text]