Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4065-4078, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Ku Antigen-DNA Conformation Determines the
Activation of DNA-Dependent Protein Kinase and DNA Sequence-Directed
Repression of Mouse Mammary Tumor Virus Transcription
Ward
Giffin,1
Wenrong
Gong,1
Caroline
Schild-Poulter,1 and
Robert
J. G.
Haché1,2,*
Departments of
Medicine1 and Biochemistry, Microbiology
and Immunology,2 The Loeb Health Research
Institute at the Ottawa Hospital, University of Ottawa, Ottawa,
Ontario, Canada
Received 30 September 1998/Returned for modification 5 February
1999/Accepted 15 March 1999
 |
ABSTRACT |
Mouse mammary tumor virus (MMTV) transcription is repressed by
DNA-dependent protein kinase (DNA-PK) through a DNA sequence element,
NRE1, in the viral long terminal repeat that is a sequence-specific DNA
binding site for the Ku antigen subunit of the kinase. While Ku is an
essential component of the active kinase, how the catalytic subunit of
DNA-PK (DNA-PKcs) is regulated through its association with
Ku is only beginning to be understood. We report that activation of
DNA-PKcs and the repression of MMTV transcription from NRE1 are dependent upon Ku conformation, the manipulation of DNA structure by Ku, and the contact of Ku80 with DNA. Truncation of one copy of the
overlapping direct repeat that comprises NRE1 abrogated the repression
of MMTV transcription by Ku-DNA-PKcs. Remarkably, the
truncated element was recognized by Ku-DNA-PKcs with
affinity similar to that of the full-length element but was unable to
promote the activation of DNA-PKcs. Analysis of
Ku-DNA-PKcs interactions with DNA ends, double- and
single-stranded forms of NRE1, and the truncated NRE1 element revealed
striking differences in Ku conformation that differentially affected
the recruitment of DNA-PKcs and the activation of kinase activity.
 |
INTRODUCTION |
The long terminal repeat (LTR) of
mouse mammary tumor virus (MMTV) includes a complex transcriptional
regulatory region that is strongly responsive to steroid hormones and
prolactin (5, 6, 13-15, 18, 37, 39, 67, 73, 83).
Tumorigenesis is mediated through the insertional activation of
cellular proto-oncogenes (12, 42, 84). In addition to the
promoter-proximal hormone response element and distal
prolactin-responsive region, MMTV also contains several DNA sequence
elements in the central portion of the LTR that repress or limit
virally induced transcription and the response of the virus to steroid
hormones (3, 51, 55, 56, 76, 77, 90). At least some of these
elements appear to function to restrict virally induced gene expression and tumorigenesis to the lactating mammary gland, where the effects of
prolactin and steroid converge to overcome the negative regulatory elements to promote a strong induction of virally induced
transcription. Deletion of portions of the viral LTR that include one
or more of the negative regulatory sequences deregulates MMTV-induced transcription and leads to virally induced tumors at sites not normally
observed with wild-type virus, most notably T-cell lymphoma (40,
77, 90, 91).
Studies by several groups have shown that one of the negative
regulatory sequences in the MMTV LTR that acts to repress viral transcription occurs in a region between 350 and 400 bp upstream of the
viral transcriptional initiation site (21, 40, 77, 85, 90).
We previously delimited the repressor element within this region, NRE1,
to 23 bp of DNA centered over a sequence containing an overlapping
direct repeat of the sequence GAGAAAGA (31). NRE1
was shown to inhibit transcription from the MMTV promoter-proximal regulatory region in T cells and in transformed mammary fibroblasts derived from an MMTV-induced tumor (31). Deletion of
sequences including this element from the viral LTR also led to
increased viral transcription in other T cells and fibroblasts
(30, 31, 90).
In subsequent studies, we showed that NRE1 was a direct,
sequence-specific DNA binding site for the Ku antigen (p70/p80) DNA binding subunit of DNA-dependent protein kinase (DNA-PK) and that it
supported the activation of the kinase catalytic subunit
(DNA-PKcs) (29, 30). Further, the repression of
MMTV transcription correlated with the recruitment of
DNA-PKcs to NRE1, as MMTV transcription was unaffected by
NRE1 in cells derived from the severe combined immunodeficient
(SCID) mouse, in which DNA-PKcs is mutated
(30). However, whether DNA-PKcs has a structural
or enzymatic role in regulation remains to be established. Repression
was also absent from cells containing inactivating mutations in the
Ku80
/
subunit but was recovered upon replenishment of
Ku80 (30). Subsequently, we have reported that Ku also binds
to the upper, single strand of NRE1 (upNRE1) in the MMTV LTR
(78), which suggested that the effects of
Ku-DNA-PKcs at NRE1 may also involve the Ku-mediated induction of a structural transition in the DNA.
The DNA sequence-directed regulation of MMTV transcription by
Ku-DNA-PKcs is one activity for a protein complex that has
recently been shown to play important roles in many cellular processes, including nonhomologous double-stranded DNA break repair (24, 36,
59, 65, 75), V(D)J recombination (8, 48, 72, 75, 94),
the suppression of thymic lymphoblastic lymphoma (54), and,
from several perspectives, transcription (22, 30, 49, 50,
66).
Ku is an unconventional DNA binding protein that, in addition to
double-stranded NRE1 (dsNRE1) and single-stranded NRE1, binds double-stranded DNA ends and binds to DNA structures containing double-
to single-strand transitions (7, 11, 19, 23, 33, 35, 63). Ku
has also been reported to translocate linearly along double-stranded
DNA from DNA ends and NRE1 (19, 63) and to have limited DNA
helicase activity (82). The binding of Ku to DNA ends and
hairpin structures appears to be required for the V(D)J recombination
and nonhomologous double-stranded DNA break repair (16, 36,
44-46, 58, 62, 87, 94). Ku binding to NRE1, however, occurs in
vitro with an affinity at least 10-fold higher than DNA end binding
(29), which may reflect the increased affinity required to
recognize internal DNA sequences in chromatin.
DNA end-bound Ku recruits and promotes the activation of
DNA-PKcs (33, 38, 92). DNA-PKcs is
also activated by Ku bound to DNA through NRE1 (29, 30).
Further, the specific targeting of DNA-PKcs to NRE1 and DNA
ends through Ku is reflected by a striking preference for the
phosphorylation of substrates linked to DNA-PK in cis on DNA
(29, 30). This preference for cis phosphorylation, which may exceed 3 orders of magnitude, likely reflects the low affinity of DNA-PKcs for substrate
(Km, ~200 µM) compared to its much higher
affinity for NRE1 and DNA ends (1, 29). By contrast, the
binding of Ku to DNA nicks or structural features such as hairpins does
not appear to promote the activation of DNA-PKcs (33,
38, 71).
Significantly, Ku also is involved in many cellular processes,
apparently independently of DNA-PKcs. These include
telomere maintenance (9, 34, 80), progression through the
G2/M transition in the cell cycle (57), and
Sir4-mediated transcriptional silencing (80). Ku occurs in
the cell at higher levels than DNA-PKcs and does not
interact with DNA-PKcs in solution (33, 74).
However, Ku has been found to interact in solution with several other
factors. These include protein phosphatase 2A (53);
p95vav, a hematopoietic oncogene
(69); Sir4 (80); TATA binding protein (26); REF1, a redox factor that regulates transcription
through negative calcium response elements (17); HSF1, a
heat shock gene regulatory factor (41); and the bromodomains
of the GCN5/CBP/TAFII250 transcriptional coactivator
(4). Little is known of the effect of Ku-DNA binding on
these interactions.
In the present study, we have begun to dissect the molecular basis for
the repression of MMTV transcription by DNA-PK and the DNA sequence
requirements for that repression. Our results indicate that
DNA-PKcs kinase activity plays a central role in the
repression of MMTV transcription through NRE1 and support a model in
which the activation of kinase activity correlates with the induction
of a DNA structural transition adjacent to NRE1 by Ku. Moreover,
our results reveal Ku to be a strikingly flexible protein that adopts
multiple DNA-dependent conformations that differentially control the
recruitment and activation of DNA-PKcs and that may be
expected to play a major role in regulating the interaction of Ku
with other proteins.
 |
MATERIALS AND METHODS |
Oligonucleotides, microcircles, and plasmids.
Oligonucleotides were synthesized on a Beckman Oligo 1000 DNA
synthesizer. The following sequences are those of the upper strands of
all oligonucleotides: 23-mer NRE1, 5'-AACTGAGAAAGAGAAAGACGACA-3'; 58-mer NRE1,
5'-AGCTTGAGCTAGACCT CCTTGGTGTATGCTAACTGAGAAAGAGAAAGACGACATGAAA-3'; 17-mer MT upper, 5'-AACTGAGAAAGACGACA-3';
MTmt, 5'-AACTGAGATAGACGACA-3'; 58-mer MT,
5'AGCTTGAGCTAGACCTCCTTGGTGTATGCTAACTGAGAAAGACGACATGAAACAACAG-3'; 39-mer nonspecific oligonucleotide,
5'-ACCCTACTGCAGTAATAGTGAACCTGCTGTGTTTTGCTC-3'; and a 58-mer
nonspecific oligonucleotide,
5'-TCGAGGATCCTGAG CTCATGTACCCTTACGACGTGCCAGATTATGCATATGGTACCGT-3'. The
oligonucleotides used for primer extension of KMnO4-treated plasmids were 5'-GACTTAAATTGGGATAG-3' (upstream of NRE1) and
5'-TGTTCTATCAGTCCAG-3' (downstream).
Covalently closed microcircles were prepared free of nicks or other
structural features exactly as described previously (30) from 223-, 240-, and 246-bp pBluescript fragments containing no insert
or containing single copies of the MT, MTmt, or NRE1
oligonucleotides, respectively, cloned into the SmaI site of
pBluescript. Recircularized DNA was routinely digested with exonuclease
III to remove DNA ligated on only one strand (nicked DNAs) and the
remaining linearized DNA. Covalently closed microcircles were
subsequently gel purified and verified for resistance to S1 nuclease,
exonuclease III, and Bal31 exactly as we have described previously
(30). In addition, the microcircles were also tested and
were shown to be completely resistant to T4 and T7 endonucleases and to
modification by a 20 mM concentration of the
single-stranded-DNA-specific reagent KMnO4.
KMnO4 treatment was performed as described below for
covalently closed circular plasmid DNAs. Following modification, the
DNA was restricted, cleaved with piperidine, and resolved on DNA
sequencing gels against a KMnO4 sequencing track of the
lower, polypyrimidine-rich NRE1 strand prepared by treatment of the
single strand of the parent fragment with 1 mM KMnO4, as we
have previously described (78).
Plasmid pHCMT was created by inserting one copy of the double-stranded
58-mer MT oligonucleotide into the HindIII site of plasmid pHC364. This resulted in the truncation of NRE1 to MT while
maintaining the exact position of NRE1 and without otherwise affecting
the LTR sequence to position
421. Plasmids pHC17 (MMTV sequence
positions
421 to +125) and pHC364 (MMTV sequence positions
364 to
+125) have been described previously (55). Covalently closed
circular plasmids were prepared as described above for the microcircles
except that gel purification was performed through agarose rather than polyacrylamide.
Recombinant proteins.
Expression and purification of Ku from
insect cells was performed essentially as described by Ono et al.
(61). Baculovirus expression vectors containing the p86
subunit (VBB2-Kup86) and a hexahistidine-tagged p70 subunit
(VBB2-Kup70tH6) of human Ku antigen were coinfected into Sf9 cells.
Three days postinfection, cells were harvested and lysed by sonication
in 40 mM HEPES (pH 7.9), 1 mM EDTA, 2 mM dithiothreitol, 0.1% Nonidet
P-40, 1 mg of leupeptin/ml, 1 mg of pepstatin/ml, and 1 mM
phenylmethylsulfonyl fluoride. Ku heterodimers were then purified by
using a Ni 21 affinity resin (His-Bind Resin; Novagen). Purity was
assessed by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis as we have described previously (29, 30) and
was estimated at over 95%. pGEX-2T-X568, encoding a glutathione
S-transferase (GST)-glucocorticoid receptor (GR) fusion
protein containing amino acids 407 to 568 of rat GR, was created by
cloning the BamHI-EcoRI fragment of pSP64X568
(70) in frame into the BamHI-EcoRI
sites of pGEX-2T (Pharmacia). GST-GR expression and purification were performed as we have described previously (29).
Tissue culture, transfections, nuclear extracts, and CAT
assays.
V79 Chinese hamster fibroblast cells (93) were
cultured in Dulbecco's modified Eagle's medium supplemented with 10%
fetal calf serum (Life Technologies, Inc.), while Jurkat T cells were cultured in similarly supplemented RPMI medium (Life Technologies, Inc.). Plasmid DNAs were grown in Escherichia coli DH5
and purified through two CsCl gradients. V79 cells (2 × 106 per plate) were transfected with 4 µg of
MMTV/chloramphenicol acetyltransferase (CAT) plasmids (pHC17, pHC364,
or pHCMT), 2 µg of rat GR expression vector p6RGR (64),
and 1 µg of Rous sarcoma virus-
-galactosidase (RSV-
-gal) by
using DEAE-dextran (14). Sixteen hours after transfection,
cells were treated with 2 × 10
7 M dexamethasome
(dex) for 48 h. Jurkat cells (5 × 106 in 0.8 ml)
were transfected with 1 µg of CAT reporter plasmid, 200 ng of rat GR
expression vector p6RGR (64), 500 g of RSV-
-gal, and 1.3 µg of pBluescript carrier DNA by using 20 µl of
Lipofectamine (Life Technologies, Inc.) for 6 h and were then
cultured overnight in complete medium. Treatment with dex (2 × 10
7 M) was for 2 h. CAT and
-gal assays were
performed as described previously (14, 30). Transfections
and assays were performed in duplicate on three to five separate
occasions and were standardized to
-gal activity (± standard errors
of the means). Nuclear extracts were prepared from Jurkat cell cultures
(2 × 108 to 2 × 109 cells)
essentially in accordance with standard protocol (20, 31).
EMSA and protease digestion.
Binding of purified Ku or
DNA-PK (Promega) to 4 to 5 pmol of
-32P-labeled
oligonucleotides (NRE1, MT, or nonspecific) or 4 to 5 pmol of pBlue,
MT, MTmt, and NRE1 containing microcircles was performed in
a 20-µl final volume in a solution containing 12 mM HEPES (pH 7.9),
12% glycerol, 60 mM KCl, 0.12 mM EDTA, and 1 µg of bovine serum
albumin for 20 min at 20°C. Binding to linear, nonspecific DNAs was
performed in the presence of 100 ng of highly sheared calf thymus DNA,
while sequence-specific binding was performed in the presence of 2 µg
of single- or double-stranded highly sheared calf thymus DNA. The
labeling efficiency of the microcircles was 100% as recirculization
depended upon
-32P addition, while the efficiency of
oligonucleotide labeling was carefully monitored by spectrometry and
scintillation counting to ensure that equal amounts of radioactivity
and oligonucleotide were added to each incubation. Where indicated, the
DNA-PKcs monoclonal antibody 25-4 or Ku antibody 111 (Neomarkers) was added to the reaction at the beginning of the
incubations. DNA protein complexes were resolved on 4 and 10%
polyacrylamide gels that were electrophoresed at between 225 and 600 V/h in 0.5× Tris borate buffer. Where indicated, following the
equilibration of binding, samples were incubated for an additional 5 min prior to electrophoretic mobility shift assay (EMSA) with 2 to 5 µg of L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin, 1 µg of chymotrypsin (Boehringer Mannheim), or 2 µg of Asp-N (Boehringer Mannheim).
Kinase assays.
Analysis of the phosphorylation of GST-GR by
DNA-PK on covalently closed circular DNAs was performed essentially as
previously described (30). Plasmids employed as cofactors
were linearized with HindIII, recircularized with T4 DNA
ligase, and nuclease treated, and the covalently closed circles were
gel purified (29, 30). Kinase reactions were performed for
20 min at 30°C in kinase buffer (50 mM HEPES [pH 7.5], 100 mM KCl,
10 mM MgCl2, 0.2 mM Na2-EGTA) in the presence
or absence of 10 ng of plasmid DNA (pHC364, pHCMT, or pHC17), 0.5 U of
DNA-PK (Promega), 5 µCi of [
-32P]ATP (6,000 Ci/mmol;
Amersham) and 2 to 6 µl of a 1:1 slurry of GST-GR bound to
glutathione-Sepharose beads that had been prewashed twice in kinase
buffer. Reactions were stopped by dilution in binding buffer lacking
MgCl2 and containing 10 mM Na2-EDTA at 4°C.
The beads were washed three times in kinase buffer to remove free
[
-32P]ATP. The GST-GR was eluted by boiling in SDS
sample buffer, and 32P incorporation was determined by
autoradiography and phosphorimage analysis (model 525 phosphorimager;
Bio-Rad) of SDS-12% polyacrylamide gels.
DNA-PK phosphorylation of a p53 peptide was performed in 20 µl of
kinase buffer by using 10 U of DNA-PK, 2.8 nmol of DNA-PK p53 peptide
substrate (EPPLSQEAFADLWKK; Promega) (52), 1 nmol of unlabeled ATP, 5 µCi of [
-32P]ATP, and 2 ng
of the oligonucleotides indicated. Following a 20-min incubation at
30°C, the reactions were stopped by the addition of 30% acetic acid.
The p53 peptide was subsequently recovered on Whatman P-81 paper. After
extensive washing, the incorporated radioactivity was determined by
scintillation counting.
KMnO4 hypersensitivity analysis.
Structural
distortion of covalently closed circular double-stranded DNA template
following specific factor binding was assessed by using the T-specific
DNA-modifying agent KMnO4 (25). Seven micrograms
of Jurkat nuclear extract or 10 ng of recombinant Ku was incubated for
20 min with 10 ng of pHC17 or pHCMT under the same conditions as
employed for EMSA (1 µg of competitor DNA). Samples were then treated
with 5 mM KMnO4 in the presence or absence of 10 mM
MgCl2 for 1 min at room temperature, extracted with
phenol-chloroform, and precipitated before being subjected to
piperidine cleavage at 90°C for 30 min. To identify sites of
cleavage, primer extension of [
-32P]ATP-labeled
oligonucleotides specific for pHC17 and pHCMT was performed, followed
by electrophoresis of the samples on 8% polyacrylamide sequencing gels
to resolve the cleavage sites. KMnO4 and
dimethylsulfate sequence reactions were performed as previously
described (27) on the same plasmids in linear, denatured
form, and primer extension was also used to position sites of
KMnO4 modification.
DNA-protein cross-linking.
To obtain double-stranded
32P-labeled DNA probes, the upper strands of the 23-mer
NRE1 and 17-mer MT or both strands of the 39-mer nonspecific
oligonucleotides were labeled with [
-32P]ATP by using
T4 polynucleotide kinase (New England Biolabs), annealed with their
corresponding unlabeled lower strand, and recovered from polyacrylamide
gels. Probes (20 pmol) were incubated with purified recombinant Ku by
using standard EMSA binding conditions including 10 mM ATP and/or 10 mM
MgCl2 in the incubations as indicated. In the absence of
additional protease digestion, following the equilibration of binding,
samples were directly exposed to UV for 12 min at 4°C in a
Stratalinker 1800 (Stratagene). Cross-linked products were resolved on
SDS-10% polyacrylamide gels. In other experiments, protease digestion
and EMSA were performed first and were followed by UV irradiation of
polyacrylamide gels for 15 min. Gel slices including the Ku-DNA
complexes were then excised from the gel, washed for 10 min three times
in SDS sample buffer, heated to 95°C for 5 min, inserted into the
wells of SDS-15% polyacrylamide gels, and electrophoresed to separate
the cross-linked products. Both protocols are modifications of
procedures reported previously (31, 78). In the protease
experiments, the control undigested samples were also cross-linked in
the gel.
 |
RESULTS |
Repression of MMTV transcription by DNA-PK correlates with the
binding of Ku to single-stranded NRE1.
A distinguishing feature of
the NRE1 element in the MMTV LTR is the overlapping direct repeat of
the sequence GAGAAAGA. In preliminary experiments with
Jurkat T cells, we found that the deletion of one copy of this repeat
from NRE1 compromised the repression of transcription from the MMTV
promoter-proximal regulatory region by a synthetic array of NRE1
elements without appearing to affect the recognition of double-stranded
oligonucleotides in EMSA with crude nuclear extracts (31).
By contrast, binding to upNRE1 was lost.
To examine the extent to which these observations reflected a change in
Ku antigen binding to NRE1, we compared the binding of crude Jurkat
nuclear extract and purified recombinant Ku antigen to various forms of
NRE1 and MT by EMSA. In the first instance, a factor in Jurkat nuclear
extract that we have previously demonstrated to be Ku (30)
formed a specific complex with both the dsNRE1 element and the
purine-rich upNRE1 (Fig. 1, lanes 1 and
2). Under these stringent binding conditions, which included the
addition of 2 µg of highly sheared calf thymus DNA competitor DNA, no
Ku binding was detected on the double-stranded DNA ends of a
nonspecific oligonucleotide (27). Incubation of
dsNRE1 and the upper, single strand with recombinant Ku resulted in the
formation of a similar complex (lanes 5 and 6). The MT
oligonucleotide was also recognized by Jurkat nuclear extract and
recombinant Ku when double stranded (lanes 3 and 7). By contrast,
no complex was detected on the upper, single strand of this sequence in
either instance (lanes 4 and 8), and recombinant Ku also failed bind to
the lower, single strand of either NRE1 or MT (lanes 9 and 10).

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 1.
Differential binding of Ku to double- and
single-stranded DNAs upon truncation of NRE1. EMSA on a 4%
polyacrylamide gel of Ku binding to full-length and truncated NRE1
elements through incubation of Jurkat nuclear extract (lanes 1 to 4) or
purified recombinant Ku expressed from baculovirus (lanes 5 to 10) with
4 to 5 pmol of double-stranded (ds) (lanes 1, 3, 5, and 7),
upper-strand (up) (lanes 2, 4, 6, and 8), and lower-strand (lo)
(lanes 9 and 10) 23-mer NRE1 and 17-mer MT oligonucleotides as
indicated above the gel. Binding was performed in the presence of 2 µg of highly sheared calf thymus DNA.
|
|
To confirm the specificity of binding and to ensure that the binding of
Ku to the double-stranded MT (dsMT) element did not involve the DNA
ends of the oligonucleotide employed, we compared Ku binding to
covalently closed DNA microcircles containing the MT motif, the
full-length NRE1 sequence, and an oligonucleotide containing a single
A-to-T substitution in the MT polypurine core (Fig.
2). Covalently closed microcircles were
prepared free of nicks or structural features from pBluescript plasmids
as previously described (30). The microcircles were
confirmed to be completely resistant to digestion with S1 nuclease,
Bal31, exonuclease III, and T4 and T7 endonucleases and to
be resistant to chemical modification by the
single-stranded-DNA-specific reagent KMnO4 (28).
Binding of crude Jurkat nuclear extract and recombinant Ku was again
assessed in the presence of 2 µg of calf thymus DNA. Under these
conditions, neither Jurkat nuclear extract nor recombinant Ku
recognized a microcircle containing only the pBluescript plasmid
sequences (lanes 1 to 3 and 13 to 15). However, the addition of the
NRE1 sequence to the microcircle resulted in the formation of a shifted complex whose migration was retarded further by a Ku antibody (lanes 4 to 7 and 16 to 18). A microcircle containing the MT element yielded
similar complexes that were supershifted by the Ku antibody (lanes 7 to
9 and 19 to 21). Thus, although truncation of NRE1 to MT eliminated
binding to upNRE1, it had little effect on the binding of Ku to dsNRE1.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
MT is a direct, sequence-specific, double-stranded DNA
binding site for Ku. EMSA on a 4% polyacrylamide gel with recombinant
Ku was performed with 4 to 5 pmol of covalently closed circular DNA
microcircles comprised of a 223-bp DNA microcircle from pBluescript
(lanes 1 to 3 and 13 to 15), a 246-bp microcircle containing the same
pBluescript fragment with a 23-bp NRE1 insert (lanes 4 to 6 and 16 to
18), a 240-bp microcircle containing the pBluescript fragment with a
17-bp MT insert (lanes 7 to 9 and 19 to 21), and a 240-bp microcircle
containing the pBluescript fragment with a 17-mer MT oligonucleotide
containing the substitution GAGATAGA for the GAGAAAGA
MT core sequence (MTmt) (lanes 10 to 12 and 22 to 24)
in the presence of 2 µg of highly sheared calf thymus DNA. Lanes 1 to
12 show the results obtained with Jurkat crude nuclear extract, and
lanes 13 to 24 show results obtained with recombinant Ku. Ku binding
was verified by inclusion of a Ku antibody in lanes 3, 6, 9, 12, 15, 18, 21, and 24. Inclusion of a nonspecific antibody had no effect on
complex migration (28).
|
|
Ku binding to the MT and MMTV microcircles was sequence specific
and not merely dependent upon random polypurine residues, as the
control microcircle derived from pBluescript contained two
polypurine-rich segments of 10 nucleotides (GAAAGGGGGA) and 9 nucleotides (GAGGGGGGG). Further, Ku binding was abrogated
by inversion of an A/T base pair in the MT core to give the
sequence GAGATAGA (lanes 10 to 12 and 21 to 24). Similarly,
rearrangement of the full-length NRE1 or MT polypurine sequences while
maintaining the same overall G and A content also abrogated Ku binding
(28).
To examine whether truncation of NRE1 to MT within the MMTV LTR would
abrogate the repression of MMTV transcription that we have shown to be
dependent upon both Ku and DNA-PKcs, we compared the
transcriptional responsiveness of an MMTV LTR construct with an MT-NRE1
substitution introduced by site-directed mutagenesis (pHCMT) to
that of a wild-type LTR construct (pHC17) and to that of a
construct from which NRE1 had been completely deleted (pHC364) (Fig. 3). Transfections were performed in
two cell lines: hamster ovary fibroblast V79 cells, in which we have
previously reported DNA-PK-dependent repression of MMTV
transcription (30) (Fig. 3A), and Jurkat cells, a mature
T-cell line representing the cell type in which MMTV containing
deletions over NRE1 leads to increased viral expression and cellular
transformation (Fig. 3B).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Mutation of NRE1 to MT abrogates the repression of MMTV
transcription by Ku. (A) Transient transfection analysis of
glucocorticoid-induced (2 × 10 7 M dex)
transcription from the MMTV LTR in V79 Chinese hamster ovary
fibroblasts transfected with MMTV CAT reporter genes pHC364, which is
truncated prior to NRE1 (MMTV sequences 364 to +125; lanes 1 and 2);
pHCMT ( 421 to +125; lanes 3 and 4), in which one copy of the
GAGAAAGA repeat in NRE1 had been mutated; and pHC17 (MMTV
sequences 421 to +125; lanes 5 and 6), containing wild-type NRE1. (B)
Similar transient transfection analysis in Jurkat T cells. Results are
expressed as percentages of the maximal activity of the pHC364
construct treated with dex. In both panels A and B, CAT values were
corrected against a constitutive RSV- -gal reporter construct to
control for transfection. Results are the averages (± standard errors
of the means) of three to five individual experiments performed in
duplicate.
|
|
In both cell lines, extension of the viral LTR from positions
364
(pHC364) to
421 (pHC17) to include NRE1 resulted in a sharp decrease
in the levels of CAT activity obtained in response to the addition of
the synthetic glucocorticoid dex. In the V79 cells, hormone induction
was reduced from 90-fold to approximately 20-fold, while in the
Jurkat cells, the steroid response was reduced from 50-fold to 10-fold.
By contrast, there was no significant effect on hormone-independent transcription.
Replacement of the NRE1 element by the MT element by site-directed
mutagenesis of pHC17 (pHCMT) completely abrogated the NRE1-mediated repression of MMTV transcription in both cell lines. Thus, our results suggested that the repression of steroid-activated MMTV transcription by DNA-PKcs was somehow related to the
ability of Ku to bind to upNRE1.
MT is a sequence-specific DNA-PK binding site from which
DNA-PKcs is inactive.
To examine whether Ku binding to
MT affected the activation of DNA-PKcs, we compared the
abilities of pHC17 and pHCMT to support the phosphorylation of a
recombinant GR DNA binding domain fusion protein on the MMTV LTR (Fig.
4A). The phosphorylation of DNA-bound GST-GR substrate by DNA-PK in cis on covalently closed
circular MMTV LTR-containing plasmids has been characterized in detail (29, 30). pHC364, the MMTV LTR plasmid truncated prior to NRE1, was unable to support the phosphorylation of GST-GR by DNA-PK when circular (lane 4). However, GST-GR was strongly phosphorylated by
DNA-PK on pHC17 (lane 6). Further, DNA-PK also efficiently phosphorylated GST-GR and a GST-p53 fusion protein on covalently closed
circular pBluescript plasmids containing the appropriate NRE1, GRE, and
p53 binding site oligonucleotide inserts (28). Notably,
however, closed circular pHCMT not only failed to support the
phosphorylation of GST-GR by DNA-PK but actually appeared to decrease
the background level of phosphorylation that resulted from low levels
of DNA contamination in the DNA-PK preparation (lanes 2 and 5).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
MT and single-stranded NRE1 are unable to activate
DNA-PK in vitro. (A) Phosphorylation of GST-GR substrate by DNA-PK in
the presence of covalently closed circular was determined for MMTV LTR
plasmids pHC364 (lane 4), pHCMT (lane 5), and pHC17 (lane 6). Results
of control reactions performed with pHC17 in the absence of DNA-PK and
GST-GR are displayed in lanes 1 and 3, while phosphorylation of GST-GR
in the absence of added DNA is shown in lane 2. Samples were resolved
on 12% polyacrylamide gels. The molecular size markers are showed to
the left, while the position of GST-GR is highlighted to the right. (B)
p53 peptide phosphorylation by DNA-PK in the presence of 58-mer
oligonucleotides encoding a nonspecific double-stranded DNA sequence
(dsNS), the upper, single strand of the MMTV LTR centered over NRE1
(upNRE), or the same sequence in which mutations have been introduced
into one copy of the NRE1 repeat (upMT). The results are expressed as
counts per minute of 32P incorporated, and the error bars
represent the standard errors of the means for three independent
experiments performed in duplicate.
|
|
To directly address whether DNA-PKcs could be activated
from upNRE1, we compared the abilities of double- and single-stranded linear oligonucleotides to support the phosphorylation of a p53 peptide
that has been the classical substrate for measuring DNA-PK activity
from DNA ends (52). In these experiments (Fig. 4B), double-stranded DNA end-dependent peptide phosphorylation by DNA-PK was
strongly activated by a 58-mer double-stranded oligonucleotide of
nonspecific sequence. By contrast, single-stranded oligonucleotides of
the same length from the MMTV LTR containing either the full polypurine-rich NRE1 sequence or the truncated NRE1 MT element had no
significant stimulatory effect on kinase activity.
While this result discounted the possibility of NRE1 serving as a
sequence-specific, single-stranded DNA-PK activation site, it remained
unclear whether our results reflected an inability of the
DNA-PKcs to associate with Ku bound to dsMT and upNRE1 or
whether DNA-PK holoenzyme complexes might assemble on these motifs in a
conformation in which kinase activity failed to be activated. To
investigate this question, we examined the association of
DNA-PKcs with NRE1 and MT by EMSA (Fig.
5). First, when purified DNA-PK was
incubated with the NRE1 containing the microcircle described above, a
very slowly migrating complex was detected near the top of the
polyacrylamide gel which was further retarded upon addition of a
DNA-PKcs antibody (Fig. 5A, lanes 5 to 8). By contrast, no
binding to the pBluescript microcircle was detected (lanes 1 to 4),
indicating that DNA-PKcs binding was dependent upon Ku
binding to NRE1.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Binding of DNA-PK to NRE1 and MT. (A) EMSA on a 4%
polyacrylamide gel of the binding of recombinant Ku (lanes 2, 6, and
10) or purified DNA-PK (lanes 3, 4, 7, 8, 11, and 12) to
32P-labeled, covalently closed microcircles containing no
insert (lanes 1 to 4), the wild-type NRE1 element (lanes 5 to 8), or
the MT element (lanes 9 to 12) in the presence of 2 µg of highly
sheared calf thymus DNA. The incubations in lanes 4, 8, and 12 included
a DNA-PK antibody. (B) EMSA of recombinant Ku (lanes 2 and 6) or
purified DNA-PK (lanes 3, 4, 7, and 8) binding to single-stranded
58-mer oligonucleotides encoding upNRE1 in the presence of 2 µg of
sheared, denatured calf thymus DNA (lanes 1 to 4) or dsNS (lanes 5 to
8) in the presence of 100 ng of highly sheared calf thymus DNA. A
DNA-PK antibody (Ab) was added to the incubations in lanes 4 and 8. The
positions of the Ku-DNA-PK complexes and the shift in migration by the
DNA-PK antibody to just below the well are indicated to the right.
|
|
Remarkably, despite the MT sequence being unable to support kinase
activity, DNA-PKcs interacted with the MT-containing
microcircle to the same extent as to NRE1 (lanes 9 to 12). By contrast,
no DNA-PK complex was detected on the upper strand of NRE1 in a 58-mer upper-stranded MMTV LTR oligonucleotide under the same binding conditions (Fig. 5B, lanes 2 to 4). By comparison, a DNA-PK complex sensitive to DNA-PKcs antibody was readily detected on a
double-stranded linear oligonucleotide of nonspecific DNA sequence of
the same length (lanes 6 to 8) when the highly sheared calf thymus
competitor DNA added to the incubations was decreased to 100 ng from
the 2 µg used with the specific sequences. Thus, while neither dsMT nor upNRE1 supported the activation of DNA-PKcs, these two
Ku binding sites were distinguished by the ability of
DNA-PKcs to associate with dsMT-bound Ku.
MT is a static Ku binding site contacted only by Ku70.
The
inability of DNA-PK to be activated on MT-containing DNAs despite the
apparent similarity in the binding of Ku-DNA-PKcs to MT
and NRE1 suggested that the interaction of Ku with dsMT might differ
from its interaction with NRE1 in a way that precluded the activation
of DNA-PKcs. To test this hypothesis, we compared the
binding of Ku to NRE1 and MT in several assays.
First (Fig. 6), Ku is a protein that is
known to translocate along DNA from its binding site (19,
63). Translocation from NRE1 is facilitated by Mg2+
(30). Thus, the inclusion of Mg2+ in
electrophoretic mobility shift binding assays leads to the formation of
slower-migrating Ku-DNA complexes, such as that shown in lane 4 of Fig.
6, which is indicative of two molecules of Ku bound to the NRE1
microcircle. In this experiment, the addition of Ku antibody 111 prevented Ku translocation. By contrast, the addition of
Mg2+ to incubations with the MT-containing microcircle
failed to promote the formation of a slower Ku-DNA complex (lane 9),
indicating that the ability of Ku to translocate from MT was at least
decreased and possibly absent.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 6.
Decreased translocation of Ku from MT. EMSA on 4%
polyacrylamide gel of recombinant Ku binding to closed 240- and 246-bp
microcircles containing the wild-type NRE1 element (lanes 1 to 5) or
the MT element (lanes 6 to 10) in the presence of 2 µg of highly
sheared calf thymus DNA. The microcircles were coincubated with Ku, 10 mM MgCl2, and Ku antibody (Ab) as summarized above the
autoradiograph.
|
|
A second property of Ku binding to NRE1 that we have previously
demonstrated as being coincident with its ability to translocate from
NRE1 is the Mg2+/ATP-sensitive cross-linking of Ku80 to the
upper strand of NRE1 by UV irradiation (78). On both single-
and double-stranded DNAs, Ku appears to contact only the upper strand
of NRE1 in a manner that is detectable by UV cross-linking
(78). Further, in the absence of Mg2+/ATP, only
Ku70 was cross-linked to the upper strand of dsNRE1 (Fig.
7, lane 2). By contrast, both Ku70 and
Ku80 were cross-linked to the upper strand of NRE1 when the DNA was
single stranded (Fig. 7, lane 1). Upon addition of Mg2+, a
band representing the cross-linking of Ku80 became detectable with the
double-stranded template (lane 3). Ku80 cross-linking to dsNRE1 became
prominent when ATP was also included in the incubation (lane 4).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 7.
Mg2+/ATP-dependent contact of Ku80 with DNA
is specific for NRE1. A 23-mer NRE1 nucleotide and a 17-mer MT
oligonucleotide were 32P-labeled on the upper, purine-rich
strands, while a 39-mer nonspecific oligonucleotide was labeled on both
strands. Following the incubation of recombinant Ku with the
purine-rich upNRE1 (lane 1), dsNRE1 (lanes 2 to 4), or dsMT (lanes 5 to
7) or the dsNS oligonucleotide (lanes 8 to 10) under standard binding
conditions in the presence of 10 mM MgCl2 and/or 10 mM ATP
as indicated above the autoradiograph, the samples were irradiated with
UV. Following irradiation, the samples were electrophoresed through an
SDS-12% polyacrylamide gel to resolve the cross-linked products.
|
|
Similar to NRE1, in the absence of added Mg2+/ATP, Ku70
alone was cross-linked to the upper strand of the dsMT oligonucleotide (lane 5). However, in contrast to NRE1, Ku80 contact of MT was not
induced by the addition of Mg2+/ATP (lanes 6 and 7).
Cross-linking experiments performed by other groups have suggested that
only Ku70 contacts the DNA when Ku is bound to DNA ends
(33). While these experiments appear to have been performed in the presence of at least a small amount of Mg2+, the
influence of ATP on Ku-DNA contacts was not evaluated. In our
experiments, we confirmed that at Mg2+/ATP concentrations
at which Ku80 was readily crosslinked to dsNRE1, only Ku70 was
cross-linked to DNA when bound at the DNA end (lanes 8 to 10).
These results indicated that the addition of Mg2+/ATP
induced a change in the contact of Ku80 with NRE1 that was accomplished on the full-length element but not on MT or at the DNA end. While this
change resembled the contact of Ku with single-stranded NRE1, this
event was unlikely to include full strand separation, as DNA-PKcs failed to associate with Ku on single-stranded
NRE1. Moreover, although Ku has been shown to have DNA helicase
activity in the presence of an extended single-stranded DNA overhang,
it has been reported to be unable to unwind duplex DNA with blunt ends (82). Similarly, we have not detected complete
unwinding of the MTV oligonucleotide by Ku, even in the presence of
Mg2+/ATP (28).
Ku induces a structural transition in the MMTV LTR upstream of
NRE1.
We have, however, previously reported that sequences
upstream from NRE1 in the MMTV LTR between positions
395 and
420
undergo a Mg2+-dependent structural transition in the
presence of crude nuclear T-cell extract that is detected by
single-stranded-DNA-specific cleavage agents, including
KMnO4 (27). KMnO4 is a reagent that specifically modifies T's in single-stranded DNA or DNAs containing double- to single-strand transitions (25).
To determine the contribution of Ku to the structural transition
observed with crude extracts and the dependence of this transition on
full-length NRE1, we examined covalently closed circular MMTV LTR
plasmids containing the wild-type NRE1 element (pHC17) or the MT motif
(pHCMT) for sensitivity to KMnO4 following incubation with
crude Jurkat nuclear extract or recombinant Ku (Fig.
8). Mg2+-dependent
KMnO4 modification was detected upstream of NRE1 in the
presence of Jurkat nuclear extract (Fig. 8). This sensitivity was not
enhanced further by the addition of exogenous ATP (28). On
the upper strand, the T at position
399 was strongly sensitive to
KMnO4 while T's at positions
410 and
413 were modified
to a lesser extent (Fig. 8A, lanes 2 to 6). By contrast, on the lower strand, T's at positions
416 and
418 were strongly modified while
the T's at
403 and
398 were weakly modified (Fig. 8B, lanes 2 to
6). Modification was strictly dependent upon the presence of
Mg2+/ATP and was not observed in the absence of nuclear
extract. Although these cleavage sites overlap closely with those
previously reported on linear DNA, differences in the exact positions
of modification from the experiments with linear DNA are likely due to
the proximity of the ends of the DNA fragment employed in the previous
study. Interestingly, KMnO4 sensitivity was strictly
localized upstream of NRE1 and was not detected within the core
polypurine-polypyrimidine sequence or downstream of the element. Also,
it appears unlikely that this modification reflects the complete
separation of the two LTR strands, as four T's on the upper strand of
the LTR between positions
399 and
410 remained unmodified. The lack
of modification of T's at positions
402 and
404 on the upper
strand is particularly curious, since the T at
403 was modified on
the lower strand.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 8.
Ku induces an NRE1-dependent structural transition in
the MMTV LTR immediately upstream of NRE1. (A) Upper LTR strand. (B)
Lower LTR strand. Covalently closed circular relaxed pHC17 and pHC17MT
plasmids were incubated with Jurkat nuclear extract (lanes 2 to 6 and
15 to 20) or purified recombinant Ku (lanes 8 to 12 and 22 to 27).
Following the equilibration of binding, samples were treated with
Mg2+ and KMnO4 as indicated.
KMnO4-modified bases were identified following piperidine
treatment by linear PCR from oligonucleotides extended downstream from
the plasmid backbone (upper strand, panel A), or upstream from the MMTV
LTR at position 289, and visualized following electrophoresis on 8%
(8 M urea) polyacrylamide gels. The short arrows beside each gel
highlight the positions of the modified T's in the LTR sequences as
determined by comparison to KMnO4-generated T sequencing
tracks generated with single-stranded DNAs (lanes 1, 7, 13, 14, 21, and
28). The long arrows parallel to the sequences highlight the positions
of the GAGAAGA repeat units that occur twice in NRE1 (left)
but only once in the MT substitution. (C) Summary of
Mg2+-dependent, KMnO4-mediated thymidine
modifications in the MMTV LTR. The overlapping direct repeat of NRE1 is
highlighted by the overlapping arrows parallel to the DNA sequence,
while the positions of the modification are indicated by the
perpendicular arrows. The sizes of the arrows are approximately
proportional to the intensity of cleavage.
|
|
Remarkably, the relative intensity and the exact positions of
KMnO4 modification were exactly reproduced by recombinant
Ku alone (Fig. 8A and B, lanes 8 to 13). Therefore, Ku appeared to be
sufficient for the Mg2+-dependent structural transitions
upstream of NRE1 in the MMTV LTR. By contrast, the covalently closed
circular MMTV LTR plasmid containing the NRE1-to-MT mutation (pHCMT)
was completely resistant to modification by KMnO4,
regardless of the addition of Mg2+ to crude extracts or
recombinant Ku (Fig. 8A and B, lanes 15 to 20 and 22 to 27).
Further, the binding of Ku to NRE1 was sufficient to promote a
structural transition in flanking DNA independent of the flanking DNA
sequence. A similar Ku- and Mg2+-dependent,
KMnO4-sensitive structural transition was observed upstream
of an NRE1 oligonucleotide cloned into pBluescript (28). Thus, DNA-PKcs kinase activity and the repression of MMTV
transcription from NRE1 correlated with Ku80 DNA contact concomitant
with the induction of a structural transition upstream of NRE1.
Ku conformation is dependent upon the form of DNA to which it is
bound.
Since Ku binding to different DNA sites resulted in the
differential DNA contact of Ku80, the conformation of the individual Ku-DNA complexes might be expected to be distinct. Close examination of
the mobility of the Ku-DNA complexes by EMSAs on covalently closed
microcircle DNA consistently indicated that the mobility of the Ku-MT
complex was slightly, but reproducibly, slower than that of the Ku-NRE1
complex, even though the MT microcircle was 6 bp shorter than the NRE1
microcircle (Fig. 2). A small difference was also observed between Ku
bound to DNA ends and the upper strand of NRE1 (Fig. 5B).
To examine more closely whether the binding of Ku to different forms of
DNA resulted in different conformations for the Ku-DNA complexes, we
increased the percentage of the polyacrylamide in the gels in EMSAs
from 4 to 10% and reexamined the binding of Ku to short
oligonucleotides (Fig. 9A). Four modes of
Ku-DNA binding were compared: to double-stranded NRE1, single-stranded
NRE1, double-stranded MT, and double-stranded DNA ends on an
oligonucleotide of nonspecific sequence. DNA end binding was again
accomplished by reducing the amount of the competitor DNA added to the
binding reaction to 100 ng, while sequence-specific binding to the
specific oligonucleotides was ensured through the inclusion of 2 µg
of highly sheared calf thymus DNA to compete for DNA end binding. Under
these modified electrophoresis conditions, striking differences in the
mobilities of the four Ku-DNA complexes were revealed (lanes 1 to 4).
dsNRE1 binding resulted in the complex with greatest mobility. Ku
binding to upNRE1 resulted in complexes with a slightly slower mobility
that was very close to the mobility of DNA end-bound Ku complexes. It
should be noted that the difference in mobility of the Ku complexes on
dsNRE1 and that of the dsNS oligonucleotide validate our binding
conditions as being specific for DNA ends and NRE1, respectively.
Remarkably, under these conditions, the Ku-MT complex exhibited a
markedly slower mobility than the other Ku-DNA complexes (lane 3).
Interestingly, no obvious change in the mobility of these complexes was
detected when the binding of Ku to these oligonucleotides was performed
in the presence of Mg2+/ATP (28).


View larger version (80K):
[in this window]
[in a new window]
|
FIG. 9.
EMSA of Ku conformation and protease sensitivity when
bound to different DNA forms. (A) EMSA on 10% polyacrylamide gel of Ku
binding to 23-mer dsNRE1, 17-bp dsMT oligonucleotides, a 39-mer dsNS
oligonucleotide, or upNRE1 oligonucleotide on a nondenaturing 10%
polyacrylamide gel with or without a 5-min incubation with 2 or 5 µg
of trypsin following the equilibration of binding. dsNRE1 and dsMT
binding were performed in the presence of 2 µg of highly sheared calf
thymus DNA, DNA end binding was performed in the presence of 100 ng of
the same DNA, and binding to upNRE1 was performed in the presence of 2 µg of heat-denatured calf thymus DNA. (B) EMSA results obtained as
described for panel A, except that protease digestion was performed
with 2 µg of trypsin (Tryp), 1 µg of chymotrypsin (Chymo), or 2 µg of Asp-N as indicated, prior to electrophoresis. (C) Competition
of Ku from DNA following trypsin digestion. Following the incubation of
Ku with the DNAs described for panel A, trypsin was added to the
incubations as indicated for 5 min. EMSA was performed following a
further 5-min incubation in the presence or absence of a 100-fold
excess of unlabeled 23-mer dsNRE1 DNA.
|
|
Differences in protein conformation can often be revealed by protease
digestion. We performed two experiments to evaluate the sensitivity of
Ku to protease digestion when bound to the different DNA forms. First,
following the equilibration of Ku-DNA binding, we digested the samples
with increasing concentrations of trypsin (Fig. 9A, lanes 5 to 16).
Digestion of Ku bound to dsNRE1 resulted in an increase in mobility of
the Ku-DNA complex at a low trypsin concentration that was highly
resistant to the addition of higher concentrations of enzyme,
suggesting the presence of a tightly packaged NRE1 binding core for Ku.
Interestingly, digestion of Ku bound to the single-stranded NRE1,
MT, and DNA ends with trypsin converted the mobility of each of these
Ku-DNA fragments to mobilities indistinguishable from that of the core NRE1-bound Ku fragment.
Digestion of Ku-DNA complexes with two additional proteases with
different cleavage specificities, chymotrypsin and Asp-N, continued to
suggest similarity in the core Ku fragments bound to dsNRE1, dsMT, and
dsNS (Fig. 9B). However, it also revealed a difference in the core
single-stranded NRE1-Ku complex that was reflected by an increased
mobility of the upNRE1-Ku complex upon chymotrypsin digestion (lane 9).
Further, Asp-N digestion of MT-bound Ku resulted in a striking increase
in complex mobility (lane 15 versus lane 12) to match the motility of
Ku on NRE1 in the absence of digest (compare to lane 2). By contrast,
Asp-N did not appear to affect the mobility of the other three Ku-DNA complexes. Finally, resistance to protease digestion appeared to be
strictly a property of DNA-bound Ku, as the preincubation of Ku with
trypsin prior to the addition of dsNRE1 completely prevented Ku-DNA
binding (28).
The protease-resistant nature of the core Ku-DNA complexes suggested
that protease treatment had little effect on Ku-DNA binding. One
feature of Ku-DNA binding is its stability (19, 63, 68). In
one test of whether digestion of Ku to the core fragment affected the
parameters of Ku-DNA binding, we compared the off rates of Ku from the
four DNA forms before and after trypsin digestion (Fig. 9C). Prior to
trypsin digestion, the addition of a 100-fold excess of unlabeled
dsNRE1 oligonucleotide for 10 min prior to EMSA had no significant
effect on the amount of Ku prebound to any of the four DNA forms. After
trypsin digestion, however, the off rates of Ku from all four Ku-DNA
complexes were markedly accelerated, such that competition was now
complete within 5 min. However, this striking increase in the off rate
of Ku from DNA also suggests that the affinities of the three
sequence-specific Ku binding activities relative to DNA end binding
remained similar. All of the incubations with sequence-specific
oligonucleotides were performed in the presence of a large excess of
double-stranded DNA ends in the form of the highly sheared calf thymus
DNA that otherwise would have been expected to compete for the more
dynamic DNA binding of the core Ku fragments.
Lastly, to directly visualize the nature of the Ku peptides associated
with the four DNAs following protease digestion, UV cross-linking of
Ku-DNA complexes was performed in the gel following the electrophoresis
of protease-digested samples (Fig. 10).
In-gel cross-linking of undigested Ku-DNA complexes yielded exactly the same cross-linked products observed when cross-linking was performed in
the tube (28) (Fig. 6). In particular, in the absence of Mg2+, Ku80 was cross-linked only to upNRE1 (28).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 10.
In-gel cross-linking of protease-digested Ku-DNA
complexes reveals a difference in Ku binding to dsNRE1 and DNA ends.
SDS-PAGE analysis of Ku cross-linked to dsNRE1, upNRE1, dsMT, and a
39-mer dsNS oligonucleotide following EMSA of protease-treated Ku-DNA
complexes. Ku binding to the dsNS oligonucleotide was performed in the
presence of 100 ng of calf thymus DNA, while binding to dsNRE1, dsMT,
and upNRE1 was performed in the presence of 2 µg of double-stranded
or denatured calf thymus DNA. Protease digestion was performed with
chymotrypsin (Chymo) (lanes 1 to 4), Asp-N (lanes 5 to 8), and trypsin
(Tryp) (lanes 9 to 12). Following EMSA, the wet gel was irradiated with
UV. Polyacrylamide slices containing Ku-DNA complexes were excised from
the gel, washed and heated in SDS sample buffer, and then
electrophoresed through an SDS-20% polyacrylamide gel and subjected
to autoradiography. The asterisks highlight two bands that migrated
within the salt front on the gel and which had mobilities identical to
those of the 32P-labeled free oligonucleotides cut from the
EMSA gel and electrophoresed in parallel with the Ku-DNA complexes
(28). Complexes specific for individual DNAs and/or protease
treatments are highlighted by the numeric labels to the right of the
autoradiograph.
|
|
By contrast, following protease digestion, no intact Ku70 or Ku80 was
found to be cross-linked to any of the DNAs (28). However,
at least four peptide-DNA complexes (labeled 1 to 4) that migrated
between 24 and 33 kDa were observed (Fig. 10). It is important to
recognize that the mobility of these complexes reflected the sum of the
amino acid and nucleotide components. With full-length Ku, this
increased the apparent size of the Ku70- and Ku80-DNA complexes by
approximately 10 kDa, allowing for a rough estimate of the peptide
component of complexes 1 to 4 of between 14 and 25 kDa.
A first observation is that Ku70 binding to all four DNAs was resistant
to cleavage of the Ku70 by at least three different proteases, two of
which were cleaved in at least two places. This was evidenced by the
presence of two cross-linked peptides in most lanes containing samples
treated with trypsin and Asp-N (complexes 3 and 4). Two additional
bands were derived from the migration of the oligonucleotides with the
salt front (28). An additional band at 22 kDa was of
uncertain origin, as it was not observed with the oligonucleotides
alone (28) but appeared in each protease-digested lane.
A second observation is that following cleavage with each of the three
proteases, the peptides cross-linked to the dsNRE1, upNRE1, and dsMT
were electrophoretically indistinguishable. Thus, the expectation of an
additional, Ku80-derived protein-DNA product on upNRE1 was not
realized. Thus, while Ku70-DNA contact resisted protease digestion, it
may have compromised Ku80 contact with upNRE1.
Digestion with chymotrypsin yielded peptide-DNA complexes of 21 kDa for
all four oligonucleotides (complex 1), while trypsin digestion resulted
in doublets of 29 and 33 kDa. However, while Asp-N digestion of
upNRE1-, dsNRE1-, and dsMT-bound Ku yielded 29- and 33-kDa doublets
similar in mobility to the tryptic peptide-DNA products, a unique
peptide-DNA complex with a mobility equivalent to 27 kDa was observed
following Asp-N digestion of DNA end-bound Ku. Thus while the
mobilities of dsNRE1- and DNA end-bound Ku were highly similar in EMSAs
following protease digestion, a clear difference in protease
sensitivities and/or DNA contact by Ku70 was apparent in these
cross-linking experiments. Therefore, the differences in migration of
the four Ku-DNA complexes reflected differences in Ku conformation on
all four DNA forms that were reflected by specific differences in the
protease sensitivities of the DNA-bound Ku.
 |
DISCUSSION |
In this study, we have distinguished the requirements for
sequence-specific Ku-DNA binding from the activation of
DNA-PKcs at NRE1 and DNA ends. Our results support the
proposal that the repression of steroid-induced transcription at the
MMTV promoter through NRE1 is dependent upon the phosphorylation of
target proteins by DNA-PKcs. Further, the activation of
DNA-PKcs from NRE1 was not simply dependent upon the
recruitment of DNA-PKcs to DNA by Ku but appeared to be
determined by the introduction of torsional stress 5' to the Ku binding
site in the MMTV LTR and by the entry of Ku80 into contact with
double-stranded DNA. By contrast, the activation of
DNA-PKcs at DNA ends appeared to be mediated by a distinct
conformation of Ku and occurred in the apparent absence of Ku80-DNA contact.
NRE1 appears to function in the MMTV LTR primarily to repress or blunt
the induction of viral transcription in response to glucocorticoids
(40, 77, 90). Previous results comparing the induction of
MMTV transcription in SCID cells to that observed in normal
cells have suggested that the recruitment of DNA-PKcs to
NRE1 plays a key role in the transcriptional effects mediated through
NRE1 (30). Our present results with the MT element, which
failed to repress MMTV transcription, argue strongly that the
activation of DNA-PK kinase activity at NRE1 is the determining factor
in the repression of MMTV transcription by NRE1.
Potential phosphorylation targets of DNA-PK at the MMTV promoter
include GR and the octamer transcription factors that mediate the
steroid-dependent induction of MMTV transcription (30). Other potential targets, such as nuclear factor 1 and the basal transcription machinery, would seem less likely candidates at this
time, as NRE1 does not appear to influence hormone-independent MMTV
transcription in our system. While nuclear factor 1 has been implicated
in the hormone responsiveness of MMTV on chromatin templates (18,
79), in transient transfection experiments, its effects on
transcription are hormone independent (2, 10). The recent
report that DNA-PK might down regulate the histone acetyltransferase
activity of some transcriptional coactivators (4) suggests
the additional possibility that the recruitment and activation of
DNA-PKcs at NRE1 represses the positive effects of
transcriptional coactivators recruited to the MMTV promoter in response
to steroid.
Ku and DNA-PKcs are known to form a stable complex only on
DNA (33). Two possibilities for the association of Ku and
DNA-PKcs on DNA have been recognized. In the first
instance, the simultaneous interaction of Ku and DNA-PKcs
with DNA would stabilize a transient or low-affinity protein-protein
interaction (38, 88). However, it has also been hypothesized
the binding of Ku to DNA induces a change in Ku conformation that is
required for the presentation of a high-affinity interface for
subsequent contact with DNA-PKcs (43, 46). In
this study, we have compared the binding of Ku and the assembly of
Ku-DNA-PK complexes to four different Ku binding sites. Our results
support the latter hypothesis
that Ku-DNA binding induces a
conformational change in Ku that promotes association with
DNA-PKcs. In particular, Ku binding to dsNRE1 resulted in a
resistance to trypsin that was not observed in the absence of DNA,
supporting the prospects for DNA-dependent changes in Ku conformation.
Unexpectedly, however, Ku was found to adopt multiple conformations on
DNA, each specific for a particular DNA form. Moreover, our results
appear to distinguish requirements for the association of Ku with
DNA-PKcs from the activation of kinase activity.
The similarity of the Ku peptides cross-linked to dsNRE1 and upNRE1
suggests that the difference in mobility and chymotrypsin sensitivity
of Ku-upNRE1 complexes by EMSA were likely due to a difference in the
conformation and DNA contacts of the Ku80 subunit. Interestingly, Ku
bound to upNRE1 failed to form a complex with DNA-PKcs in
EMSA. As DNA-PKcs has been reported to bind to unstructured
single-stranded DNA (38), this result would seem to
emphasize the importance of Ku conformation for its association with
DNA-PKcs on DNA under stringent DNA binding conditions.
Binding of Ku to the MT element was distinguished from binding to the
other DNAs by a markedly decreased mobility of the shifted complex and
a unique sensitivity to Asp-N in EMSA. The lack of Mg2+/ATP-dependent cross-linking of Ku80 to dsMT clearly
distinguished Ku80 DNA contact on MT from binding to dsNRE1. This,
together with the similarity in dsMT-cross-linked Ku70 peptides
following Asp-N treatment, points towards a distinct Ku80 conformation
on MT. Intriguingly, these differences in Ku-DNA association had no
obvious effect on the recruitment of DNA-PKcs to the MT
sequence compared to the full-length NRE1 element. However,
DNA-PKcs failed to be activated from dsMT. This could be
accounted for directly by the differences noted in Ku conformation but
may also have been linked to an alteration in either
DNA-PKcs conformation or the DNA contact of
DNA-PKcs, two additional possibilities that remain to be evaluated.
Lastly, the binding of Ku to dsNRE1 and DNA ends also was reflected by
differences in Ku-DNA complex mobility and protease sensitivity. While
the sensitivities of the two Ku-DNA complexes to the three proteases
employed were similar in EMSA, there was a striking difference in the
size of the Asp-N-digested Ku peptides in direct contact with dsNRE1
and DNA ends. These results are supportive of a difference in Ku70
conformation on NRE1 and DNA ends. However, the interaction of Ku with
DNA is complex and may involve up to three separate Ku domains
(47, 86, 89). Thus, it is also possible that the difference
in cross-linked peptides reflects a difference in the region of Ku70 in
contact with the two DNAs in addition to an alteration in Ku
conformation on the two DNA forms.
Unexpectedly, the activation of DNA-PKcs from DNA ends was
accomplished through a process that was clearly distinguished
from activation at NRE1 by the apparent lack of a requirement for Ku80 contact with the DNA. Therefore, it is possible that
DNA-PKcs kinase activity from NRE1 and DNA ends will be
found to have distinct properties. However, one simpler explanation may
be that Ku80 plays an additional role at NRE1 that reflects the
increase in energy required to induce DNA structural transitions
important for DNA-PKcs kinase activity on an internal DNA
sequence as compared to that on DNA ends.
Most current models for the role of Ku association in promoting the
activation of DNA-PKcs from DNA ends do not account for the
potential contribution of the Ku ATPase and helicase activities in
regulating DNA-PKcs. Our results, in which cross-linking
and DNA structural analysis were performed in both the presence and absence of Mg2+/ATP, indicate that the activation of
DNA-PKcs at NRE1 correlates with a Ku-dependent change in
DNA structure that occurred coincidentally with the contact of Ku80
with upNRE1. However, the use of the term helicase to describe Ku in
the context of the activation of DNA-PKcs from NRE1 is
likely an overstatement of the nature of the structural transition
occurring at NRE1. First, the pattern of KMnO4 modification
is inconsistent with extended strand separation. Second,
consistent with other reports (60, 82), we have no evidence
that Ku is able to completely unwind even short double-stranded oligonucleotides with blunt ends regardless of the presence of NRE1
(28). Third, full unwinding of NRE1-containing
oligonucleotides would yield the single-stranded NRE1 oligonucleotide
to which DNA-PKcs was unable to bind.
However, it does seem likely that some limited structural transition
surrounding NRE1 is important for the activation of
DNA-PKcs. Two possibilities seem plausible at this time.
First, the structural transition may be required to allow for the
contact of Ku80 with DNA, which may complete the conformational change
in Ku that is required for the activation of DNA-PKcs at
NRE1. Alternatively, it may be that the transition in DNA structure is
directly important for the binding of DNA-PKcs to DNA in an
active conformation. In this regard, it is interesting to note recent
reports that the treatment of DNA with the cross-linking agent
cis-diamminedichloroplatinum(II) inhibits DNA-PK kinase
activity without affecting the affinity of Ku for DNA ends
(81). Moreover, we have determined that ethidium bromide, which is a potent inhibitor of the Ku ATPase and
helicase activities, is also a potent inhibitor of DNA-PK kinase
activity from both DNA ends and NRE1 (32).
A schema summarizing what presently appear to be the most likely
expectations for the interaction of Ku-DNA-PKcs with the four DNA forms examined in this study is presented in Fig.
11. In solution, DNA-PKcs
occurs in an inactive conformation and does not associate with Ku (Fig.
11A). Ku binds DNA in multiple configurations, depending on the nature
of the DNA binding site, and at least on the dsNRE1, and induces a
structural transition in DNA that is coincident with the DNA contact of
Ku80. Ku80 also appears to directly contact the single-stranded NRE1
element, but the resultant conformation of the DNA-bound Ku is distinct
from that on dsNRE1. By contrast, on MT, no transition in DNA structure is induced, and contact of Ku80 with the DNA does not occur.
DNA-PKcs can associate with Ku in three of these four
configurations (Fig. 11B). However, DNA-PKcs association
leads to the activation of kinase activity from only the two DNAs, NRE1
and double-stranded DNA ends, on which appropriate
Ku-DNA-PKcs conformations are achieved.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 11.
Schematic summary of the association of Ku and
DNA-PKcs with the DNAs employed in this study. (A) In
solution, DNA-PKcs occurs in an inactive conformation
(PKI) that is attracted to Ku bound to dsNRE1 (upper left),
dsMT (upper right), and double-stranded DNA ends (lower left). It does
not appear to interact with Ku bound to the single, upper strand of
NRE1 (ssNRE1) (lower right). The association of Ku with each of these
DNAs is reflected by differences in Ku conformation, DNA conformation,
and Ku-DNA contacts. In this pictogram, differences in conformation of
the Ku heterodimer on DNA, as reflected by differences in protease
sensitivity in EMSA and crosslinking experiments, are illustrated
through differences in the shape of the Ku subunits. The
Mg2+-dependent structural transition upstream of NRE1 is
indicated by the dotted lines in the absence of definitive information
on the exact structure of the DNA. The relative positioning of the Ku
subunits with respect to the DNAs has been assigned arbitrarily. The
DNA bound by Ku at the end is shown in grey to illustrate that it is
not known whether a transition in DNA end structure is also important
for the activation of DNA-PKcs from DNA ends. (B) The
association of DNA-PKcs with Ku and DNA at NRE1 and DNA
ends induces an allosteric change in the kinase that activates
catalytic activity (PKA). By contrast, when associated with
Ku on the MT element, DNA-PKcs remains in an inactive
conformation. The positioning of DNA-PKcs over the
structural transition upstream of NRE1 reflects our anticipation that
this change in DNA structure may be in some way directly important for
activation of the kinase at NRE1. The positioning of
DNA-PKcs at the double-stranded DNA end, with Ku70 moved
internally on the DNA, reflects the findings and model of Hammarsten
and Chu for the assembly of Ku on DNA ends (38), with the
refinement that Ku80 may not directly contact the DNA.
|
|
Finally, Ku is present in the cell in considerable excess of
DNA-PKcs and has recently been reported to associate with a
variety of other cellular proteins. These newly identified Ku binding proteins include p95vav, a hematopoietic
oncogene (69); REF1, a redox factor that regulates transcription through negative calcium response elements
(17); Sir4, a factor implicated in transcriptional silencing
(80); TATA binding protein (26); and the
bromodomains of the GCN5/CBP/TAFII250 transcriptional
coactivator proteins (4). However, the consequences of these
interactions for the activity of Ku and these binding partners
generally remain to be established. Moreover, by contrast to the
DNA-dependent association of Ku with DNA-PKcs, the majority of these newly defined interactions with Ku have been demonstrated in
solution only. Indeed, most of these interactions were identified in
yeast two-hybrid screens in which the Ku subunits employed or detected
did not directly contact DNA. One exception is the interaction of Ku
with the double-stranded DNA repair factor XRCC4, which appears to
increase or facilitate the binding of Ku to double-stranded DNA ends.
It will be interesting to determine whether this factor also promotes
sequence-specific Ku binding. Since Ku is predominantly DNA bound in
the nucleus, understanding how these factors may interact with
DNA-bound Ku is likely to be essential to understanding the molecular
basis for the physiological consequences of these protein-protein interactions.
 |
ACKNOWLEDGMENTS |
We are grateful to B. Kemper and P. Hsieh for samples of T4 and
T7 endonuclease, respectively. We thank Y. Lefebvre and our colleagues
in the Haché laboratory for critical commentary on the manuscript.
This work was supported by an operating grant from the Medical Research
Council of Canada to R.J.G.H. C.S.-P. has been supported by
postdoctoral fellowships from the Medical Research Council and the
Arthritis Society of Canada.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Loeb Health
Research Institute, 725 Parkdale Ave., Ottawa, Ontario, Canada K1Y 4K9.
Phone: (613) 798-5555, ext. 6283. Fax: (613) 761-5036. E-mail: rhache{at}lri.ca.
 |
REFERENCES |
| 1.
|
Anderson, C. W., and S. P. Lees-Miller.
1992.
The nuclear serine/threonine protein kinase DNA-PK.
Crit. Rev. Eukaryot. Gene Expr.
2:283-314[Medline].
|
| 2.
|
Archer, T. K.,
P. Lefebvre,
R. G. Wolford, and G. L. Hager.
1992.
Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation.
Science
255:1573-1576[Abstract/Free Full Text].
|
| 3.
|
Ball, J. K.,
H. Diggelmann,
G. A. Dekaban,
G. F. Grossi,
R. Semmler,
P. A. Waight, and R. F. Fletcher.
1988.
Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus.
J. Virol.
62:2985-2993[Abstract/Free Full Text].
|
| 4.
|
Barlev, N. A.,
V. Poltoratsky,
T. Owen-Hughes,
C. Ying,
L. Liu,
J. L. Workman, and S. L. Berger.
1998.
Repression of GCN5 histone acetyltransferase activity via bromodomain-mediated binding and phosphorylation by the Ku-DNA-dependent protein kinase complex.
Mol. Cell. Biol.
18:1349-1358[Abstract/Free Full Text].
|
| 5.
|
Beato, M.
1996.
Chromatin structure and the regulation of gene expression: remodeling at the MMTV promoter.
J. Mol. Med.
74:711-724[Medline].
|
| 6.
|
Beato, M.
1989.
Gene regulation by steroid hormones.
Cell
56:335-344[Medline].
|
| 7.
|
Blier, P. R.,
A. J. Griffith,
J. Craft, and J. A. Ha |