Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4093-4100, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mitochondrial Group II Introns, Cytochrome
c Oxidase, and Senescence in Podospora
anserina
Odile
Begel,
Jocelyne
Boulay,
Beatrice
Albert,
Eric
Dufour, and
Annie
Sainsard-Chanet*
Centre de Génétique
Moléculaire-Centre National de la Recherche Scientifique,
91198 Gif-sur-Yvette Cedex, France
Received 18 September 1998/Returned for modification 23 November
1998/Accepted 5 March 1999
 |
ABSTRACT |
Podospora anserina is a filamentous fungus with a
limited life span. It expresses a degenerative syndrome called
senescence, which is always associated with the accumulation of
circular molecules (senDNAs) containing specific regions of the
mitochondrial chromosome. A mobile group II intron (
) has been
thought to play a prominent role in this syndrome. Intron
is the
first intron of the cytochrome c oxidase subunit I gene
(COX1). Mitochondrial mutants that escape the senescence
process are missing this intron, as well as the first exon of the
COX1 gene. We describe here the first mutant of P. anserina that has the
sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of
wild-type cells. The integration site of the intron is slightly
modified, and this change prevents efficient homing of intron
. We
show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life
span. These data clearly demonstrate that intron
is not the
specific senescence factor but rather an accelerator or amplifier of
the senescence process. They emphasize the role that intron
plays
in the instability of the mitochondrial chromosome and the link between
this instability and longevity. Our results strongly support the idea
that in Podospora, "immortality" can be acquired not by
the absence of intron
but rather by the lack of active cytochrome
c oxidase.
 |
INTRODUCTION |
The filamentous fungus
Podospora anserina has limited vegetative growth
(36). After several divisions, the apical cells stop growing
and die. Earlier studies showed that the transition from the juvenile
to the senescent state is caused by the recurrent appearance of a
specific cytoplasmic factor (25, 48). Subsequently, molecular analysis of the mitochondrial DNA (mtDNA) revealed that the
senescent state is always correlated with the accumulation of circular
multimeric DNA molecules called senDNAs. Several groups of senDNAs
(
,
, and
, etc.), which originate from separate regions of the
mitochondrial chromosome, can be recovered from independently growing
senescent cultures. Strikingly, one senDNA (senDNA
) is present in
all senescent cultures of wild-type strains; it corresponds exactly to
the first intron (intron
) of the COX1 gene, which
encodes subunit I of cytochrome c oxidase (for a review, see
reference 10).
Intron
is a mobile group II intron that is able to transpose into
the mitochondrial chromosome (45). Recent studies with yeast
have shown that mobility of group II introns involves intron-encoded reverse transcriptase and DNA endonuclease activities that are needed
for the site-specific insertion of the introns into DNA (12, 17,
53-56). Because of its intronic properties and because of the
systematic accumulation of senDNA
during senescence of wild-type
strains, intron
has been thought to have a prominent role in the
natural senescence process of P. anserina. However, this
idea has been questioned recently by the analysis of some long-lived
nuclear mutants that undergo the senescence process and accumulate
mitochondrial rearrangements other than senDNA
(6, 47).
Nevertheless, the role of the senDNAs and, more specially, the role of
intron
in the natural senescence process in wild-type strains
remains unsolved. The only way to clarify this question is to compare
the properties of two strains that differ only by the presence or
absence of this intron. Until now the only available mutants lacking
this sequence are the mex mutants, which carry a deletion of
their mitochondrial chromosome that covers part of the intron and its
upstream exon. As a consequence, mutants that escape the senescence
process are deficient not only for the intron and its encoded functions
but also for cytochrome c oxidase activity (2, 39,
50); i.e., they use a cyanide-insensitive respiration pathway.
Such alternative pathways exist in many eukaryotic organisms
(27) and in particular in the related fungus
Neurospora crassa (11, 24, 29). Thus, it was not
clear whether the "immortality" of the mex mutants was
due to a lack of intron
or to their respiratory defect.
Here we report the selection and analysis of a new mitochondrial mutant
(the mid26 mutant) that has the intronic sequence precisely
deleted. Moreover, the sequence of the integration site of the intron
is slightly modified to prevent the reinvasion of the site by the
intron, as would otherwise occur with a mobile element. This
modification does not disrupt the reading frame of the COX1
gene, and the encoded protein differs by only two amino acids from the
wild-type protein. The mutation has no effect on the cytochrome
c oxidase activity, and the growth rate and fertility of the
mid26 strain are identical to those of the wild-type strain.
We show that this strain displays a senescence syndrome whose
characteristics are similar to those of the wild-type strain, with
systematic amplification of
and
senDNAs. However, its life span
is about twofold longer. The introduction of another group II intron,
COX1i4, into the mitochondrial genome does not restore a
wild-type life span.
This comparative study of two strains which differ by the presence or
absence of intron
allows us for the first time to define precisely
and directly the role that this intron plays in the senescence process
of P. anserina. The results show clearly that deletion of
intron
in the mitochondrial chromosome does not prevent senescence
but rather delays its appearance. These data emphasize the role of this
mobile intron in the instability of the mitochondrial genome and the
link, in an obligate aerobe, between this instability and the
longevity. On the other hand, these data indicate that the immortality
of the mex mutants is not due to the lack of the intron but
probably is due to the lack of cytochrome c oxidase and its
metabolic consequences.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
The genetic and biological
properties of P. anserina were first described by Rizet and
Engelmann (38) and have been reviewed by Esser
(13). All of the strains used in this study are derived from
the s (35) or (A)s strain.
The (A)s strain has the nuclear genome of strain
s and the mitochondria from race A. The
AS1-4 mutation was identified as an antisuppressor mutation
(32). AS1-4 mat
strains display the premature
death syndrome, and mycelial death occurs a few centimeters after
ascospore germination. This syndrome is linked to the accumulation of
mtDNA site-specific deletions covering about one-third of the genome
(3, 7). Most often, the deletion chromosomes carry a
specific deletion,
1, in which one endpoint corresponds exactly to
the 5' end of the mobile intron
and the other endpoint corresponds
to a transposition site of the intron. The deletion is assumed to arise
from an intramolecular recombination event between the two repeats of
the intron (45). Other types of deletions can accumulate
within the mitochondrial chromosome of dying AS1-4 mycelia;
they also involve intron
at one end (42).
All media (corn meal extract [MR], minimal synthetic [M2], and
germination [G] media) were as described by Esser (13).
Longevity analysis was performed on M2 medium at 27°C as previously
described (1).
Life spans were measured for four or five subcultures from two to five
strains exhibiting a given genotype. Determination
curves for a given
culture were obtained as follows. As soon as
the spore had germinated,
1 implant was grown in a culture tube
and 15 implants were regularly
taken at 2 cm downstream of the
growth edge. These implants, taken at
various distances from the
initial implant, were analyzed in culture
tubes for their
longevity.
Contamination experiments, which allow the transfer of mobile
mitochondrial sequences between a donor and a recipient strain,
were
performed as previously described (
41). A small inoculum
of
the donor growing mycelium was put onto the recipient mycelium
that had
grown about 3 cm on solid medium. Generally, at about
6 to 8 cm of
growth after the donor was put on the recipient,
all of the mobile
optional sequences, but no other markers from
the donor, were
introduced into the mtDNA of the
recipient.
mtDNA analysis, PCR conditions, and sequencing of the PCR
products.
The characteristics and the complete sequence of the
mitochondrial chromosome of P. anserina, race A, were
described by Cummings et al. (9). mtDNA was extracted by
standard methods either by purification on a CsCl gradient
(8) or by a minipreparation method (23). The
specific probes used to reveal the
intron, the COX1i4
intron, and the
and
senDNAs are, respectively, P
(intron
cloned in pBR322), a cloned fragment of 1,300 bp that covers the
circular junction of the COX1i4 intron (41), a
cloned monomer of one
senDNA (20), and the cloned
EcoRI fragment 1 that covers a part of the
region (see
reference 52, in which the
region is named
).
PCRs were done as described by Sambrook et al. (43). The
mid26 fragment with intron
deleted was obtained after
the cloning of the PCR product amplified with oligonucleotides 1456 (GGATTACTAGGTACAGCG) and 2432 (GGATTATTTTTAATACATCTTCACTA) flanking the
sequence.
Sequencing was performed on four independent clones derived from four
independent PCR experiments. Amplification of molecules derived from
the
1 deletion chromosome and lacking the
sequence was performed
with oligonucleotide 2432, located inside COX1i2, and
oligonucleotide 8456 (AGTCAGTTCACTGTAGCAGG), located about
300 nucleotides upstream from the
1 deletion endpoint. For
amplification of the junction sequences of the
senDNAs, pairs of
divergent oligonucleotides, which were previously shown to hybridize
with the senDNA, were used. Sequencing was performed after cloning of
the PCR products.
Respiration.
The percentages of cyanide (CN)-insensitive and
salicyl hydroxamic acid (SHAM)-insensitive respiration were measured on
mycelia harvested from liquid cultures that were grown for 2 days.
Measurements were done polarographically with a Gilson oxigraph in 0.6 M sorbitol-7.5 mM MgCl2-10 mM
KH2PO4-10 mM imidazole (pH 7.4)-0.2% bovine
serum albumin. KCN and SHAM were added to final concentrations of 1 and
2.5 mM, respectively.
Cytochrome
c oxidase activity was determined on mitochondria
isolated as described by Sellem et al. (
46) by monitoring
cytochrome
c oxidation at 550 nm (
18,
31).
 |
RESULTS |
Selection of the mid26 mutant devoid of the
sequence.
The mid26 (for mitochondrial intron deletion)
mutant was isolated from a strain displaying the premature death
syndrome (3, 7) in an attempt to obtain spontaneous
mutations able to overcome the syndrome. One sector (sector 26) that
was able to escape growth arrest was recovered from a culture grown on
corn meal medium. After 10 cm of growth, it was crossed with a
wild-type strain, and a 1:1 segregation was observed for the
germination phenotype corresponding to the
AS1+/AS1-4 alleles. However, AS1-4
mat
progeny showed the premature death syndrome only when the
growing sector 26 was used as a male, suggesting that the suppressor
mutation of the arrest of growth of the AS1-4 mat
strain
was mitochondrial. The mid26 strain was isolated after three
generations of backcrosses of the strain having the mutant cytoplasm
and a wild-type nuclear genome (as the female parent) with a wild-type
strain (as the male parent).
As shown in Fig.
1, restriction analysis
and hybridization of the mtDNA of the
mid26 strain revealed
that this mtDNA carried
a deletion of the

sequence. This was
demonstrated by the absence
of the restriction fragments containing the
intron (
HaeIII 1,900-
and 840-bp fragments,
BamHI
3,280-bp fragment, and
HindIII 1,330-,
1,250-, and
5,400-bp fragments) and the absence of hybridization
with an

probe.
The sequence of the modified region was amplified
with primers flanking
the

sequence, and the amplified product
was cloned and sequenced.
The results are shown in Fig.
2, and
they
require several comments. First, in the
mid26 strain, the

sequence was completely deleted, in contrast to the case for
the
mex mutants previously selected (
2,
39,
50).
Second,
there were five nucleotide substitutions, at E-4, E-8, E-11,
E-12,
and E-13 (indicating the nucleotide position in the spliced
transcript,
relative to the site of integration of the intron), in the
COX1e1 open reading frame sequence. Third, the modified
sequence exactly
corresponded to the 13 to 16 nucleotides containing a
potential
intron binding site (IBS'1) and behind which intron

is
able
to transpose. They constitute one endpoint of the junction of
the
deleted

1 chromosome that accumulates in an
AS1-4 strain
(Fig.
2) (
3,
45). Finally, the rearrangement did not
interrupt
the reading frame of gene
COX1, and the encoded
mutant protein
was expected to differ from the wild type by only two
amino acids,
Q to I (glutamine to isoleucine) and A to S (alanine to
serine).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Restriction and hybridization analysis of the mtDNA of
the mid26 strain. (A) mtDNAs of the mid26 (lanes
2, 4, and 6) and wild-type (lanes 1, 3, and 5) strains were digested
with restriction enzymes HaeIII (lanes 1 and 2),
BamHI (lanes 3 and 4), and HindIII (lanes 5 and 6). The fragments lacking in the mid26 mtDNA are
indicated by circles. (B) A corresponding gel was hybridized with a
32P-labeled probe, P (sequence inserted into
pBR322). The expected restriction fragments (HaeIII 1,900 and 840 bp, BamHI 3,280 and 40,000 bp, and
HindIII 1,330, 1,250, and 5,400 bp) are revealed only in
the wild-type lanes. (C) Restriction sites of the COX1
region. , HaeIII; , BamHI; ,
HindIII. CYTb, cytochrome b
gene.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide sequence of the COX1e1-COX1e2
junction of the mid26 strain. The upper line shows the
wild-type (WT) sequence of the COX1e1 and COX1e2
exonic regions flanking the intronic sequence, the middle line
shows the sequence of the COX1e1-COX1e2 junction of the deletion chromosome of the mid26 strain, and the lower line
shows the sequence of the junction of the 1 deletion chromosome. The
wild-type exonic sequence is shaded. The IBS1, IBS'1, and IBS2 motifs
are indicated. The deduced amino acid sequence is shown below the
nucleotide sequence. Variable bases E-4, E-8, E-11, E-12, and E-13
(indicating nucleotide positions in the spliced transcript, relative to
the integration site of the intron) and variable amino acids are in
boldface.
|
|
As just pointed out,
COX1e2 is joined in the
mid26 mutant to a short sequence identical to the

1
deletion endpoint (Fig.
2). The
mid26 chromosome could
originate from a recombination
event between the wild-type chromosome
and reverse transcripts
of

-spliced RNAs derived from the

1
deletion chromosome, as
diagrammed in Fig.
3. To test for the occurrence of such
reverse
transcripts, PCR experiments were done with DNA extracted from
a
AS1-4 mat
culture, using primers surrounding the

sequence
in the

1 chromosome. One was located about 300 nucleotides
upstream
of the

1 junction, and the other one was located about 400 nucleotides
downstream of the 5' end of
COX1e2. A product of
about 700 bp
was obtained. Its sequence, shown in Fig.
4, indicated that it
corresponded to
molecules joining
COX1e2 to the

1 endpoint with
a precise
deletion of the

sequence.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 3.
Model of formation of the mid26 chromosome.
The dark and hatched rectangles symbolize, respectively, the IBS1
sequence of intron (located at the 3' end of COX1e1) and
the IBS'1 sequence (located in an intergenic region about 37,000 bp
upstream of the COX1 gene [3]). The crosses
symbolize recombination events. WT, wild type.
|
|

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 4.
DNA sequence of the amplified product obtained with
primers surrounding the sequence in the 1 chromosome. The
amplification primers were located inside COX1i2 and inside
the intergenic region upstream of the 1 endpoint, respectively. The
junction between the 5' end of COX1e2 and the IBS'- 1
deletion endpoint is indicated by an arrow. The positions of the
nucleotides shown at the top and the bottom of the sequence are
indicated by arrowheads.
|
|
Physiological and respiratory properties of the mid26
strain.
We compared the growth rates and fertilities of the
mid26 and wild-type strains on corn meal and synthetic
media. In contrast to the case for the mex mutants, which
are female sterile and whose growth rates are reduced, the growth rates
and fertilities of the mid26 and wild-type strains were
identical (data not shown). Oxigraphic measurements indicated that the
respiration of exponential-phase cultures of the mid26
strain was almost completely sensitive to inhibition by KCN, as was the
case for the wild type, whereas the respiration of the mex
mutants was completely KCN insensitive but was sensitive to hydroxamic
acids (SHAM) (Table 1). The levels of
cytochrome c oxidase activity of the mid26 and
wild-type strains were measured on purified mitochondria. Table 1 shows
that they were identical in the two strains.
The amino acid sequences of subunits I of cytochrome
c
oxidases of numerous organisms are related. By comparison with the
Paracoccus and the bovine cytochrome
c oxidases,
whose crystal
structures have been established (
19,
49), it
appeared that
the two modified residues, I at position 53 and S at
position
56, were located in a short interhelix region between the
transmembrane
helices I and II. These two changes had no effect on the
activity
of cytochrome
c oxidase. Overall, no difference in
the growth
and respiratory characteristics of the
mid26 and
wild-type strains
was
detectable.
Senescence properties of the mid26 mutant.
The
longevities of mid26 cultures (mat
and
mat+) obtained from different crosses between the
mid26 strain used as female and the wild type used as male
are shown and compared with those of reference wild-type s
cultures in Table 2. These experiments demonstrated two striking points concerning the mid26
mutant. First, the mid26 cultures systematically underwent a
senescence process. Second, they had an increased longevity that
extended the life span by a factor of about 1.5 for mid26
mat
and about 2 for mid26 mat+. The control of the
timing of senescence by the mat haplotype of strain
s and the longer life spans of mat+ versus mat
strains were established long ago (37).
These data, reported as the frequency of living subcultures with
respect to growth length, are presented in Fig.
5. They show that the survival curves were quite similar for the mutant and the wild-type strains with the
exception of the plateau, which is longer in the mutant, suggesting an
increased incubation delay.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Life span curves of the mid26 and wild-type
strains curves for s mat ( ), s mat+ ( ),
mid26 mat ( ), and mid26 mat+ ( ) strains
are shown. The data are reported as the frequency of living subcultures
with respect to growth length. Data are taken from Table 2 (experiment
I).
|
|
Early studies had shown that senescence in wild-type strains of
Podospora is promoted by the appearance and spreading of a
cytoplasmic factor called the determinant (
25,
48). In order
to test whether the senescence process occurring in the
mid26 mutant was similar to the one occurring in wild-type
strains,
determination curves were performed as described by Marcou
(
25).
For a given culture, groups of 15 implants, taken at
various distances
from the germination point, were analyzed for their
longevity.
Most of the determination curves obtained for the wild-type
cultures
showed a sharp slope and a plateau that decreased as a
function
of the distance at which the implants were taken (data not
shown).
In contrast, as shown in Fig.
6,
the determination curves obtained
for the
mid26 strain
indicated that implants taken at 0.3 and
3 cm from the germination
point had the same plateau and had curves
that were similar to the life
span curve of the mutant. For the
implants taken after 3 cm from the
germination point, the curves
showed a plateau that decreased as a
function of the distance
from the senescent edge. These data were in
agreement with Marcou's
model and indicated that the senescence
process in the
mid26 strain
had the same characteristics as
that in wild-type strains.
mid26 mycelia behaved as if a
single random event was responsible for
the transformation from a
nondetermined to a determined state.
Under our culture conditions,
wild-type cultures were determined
as soon as or very early after
germination, whereas most of the
mid26 cultures were
determined after 3 cm of growth. The slopes
for the mutant and wild
type were similar, indicating that the
frequency of occurrence of the
determinant was unaltered in the
mutant and that, as in the wild type,
there was no escape once
the primary event had occurred.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Determination curves for a mid26 culture.
Immediately after germination of a mid26 mat spore
(mid26 11 ), one implant was grown in a culture tube.
Fifteen implants were taken at various distances from the initial
implant and analyzed for their longevity. Results for implants taken at
0.3 ( ), 3 ( ), 6 ( ), 9 ( ), and 11.5 (×) cm are shown. For
this mid26 11 culture, arrest of growth occurred at 18 cm.
Longevity curves for implants taken at 0.3 and 3 cm are similar to each
other and to the longevity curve for the mid26 mat strain
shown in Fig. 5. In contrast, longevity curves for implants taken after
3 cm from the initial implant show a linear decrease of longevity, as
they were taken closer to the senescent edge.
|
|
In
P. anserina, all cases of senescence reported until now
are correlated with the accumulation of senDNAs. Accumulation of
senDNA

is systematic in wild-type senescent cultures, and it
is frequently
accompanied by additional senDNAs (

and

, etc.).
The mtDNA
contents of 15 independent
mid26 senescent cultures
were
therefore examined. All cultures tested displayed gross mtDNA
rearrangements involving the amplification of a variety of

and

senDNAs, as shown on the gel and the autoradiograph in Fig.
7. The sequences of the junction sites of
four different

senDNAs
obtained for the
mid26 strain
were established. The breakpoints
of one of them were bound by a
short direct repeat of 6 bp, but
those of the other three senDNAs
did not occur within repeated
sequences. For one of them, the 3'
termini occurred a few nucleotides
upstream of the 5' end of the
tRNA
2Arg gene. All of these properties agreed with
those of the previously
characterized

senDNAs (
21) and
showed that the

senDNAs obtained
for the
mid26 strain
were similar to those obtained for the wild
type when they were
amplified together with senDNA

.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
mtDNA content of senescent cultures from the
mid26 strain. (A) HaeIII restriction patterns of
the mtDNAs of nine senescent cultures of the mid26 strain
(lanes 1 to 9) and of a young culture of the wild-type strain (lane
10). (B) Corresponding hybridization with a specific probe for region
. In the young wild-type culture (lane 10), this probe reveals the
three encompassed HaeIII chromosomal fragments 1 (8,600 bp),
10 (3,400 bp), and 16 (2,100 bp) (*). In the senescent
mid26 cultures (lanes 1, 3, 6, 7, 8, and 9), it reveals the
intact fragment 16 present in large amounts plus additional fragments
corresponding to the junction fragments of senDNAs; these are
constituted by parts of fragments 1 and 10. In senescent cultures 4 and
5, the junction fragments involve the chromosomal fragment 16; in
senescent culture 2, the gross amplification seen in ethidium bromide
staining (panel A) does not correspond to a senDNA. (C)
Corresponding hybridization with a specific probe for region . In
the young wild-type culture (lane 10), this probe reveals the four
encompassed HaeIII fragments 2 (6,700 bp), 4 (4,900 bp), 17 (2,000 bp), and 30 (930 bp) (*). In the mid26 senescent
cultures 5, 6, 7, 8, and 9, the probe identifies an additional junction
fragment whose size is greater than that of chromosomal fragment 2. In
senescent culture 2, it reveals only a monomer whose size is about
5,000 bp; therefore, this culture contains a nonidentified gross
amplification in addition to this senDNA (see panel A).
|
|
Intron
mobility was ineffective in the mid26
mutant, and the absence of intron
was not compensated for by
another group II intron.
The mitochondrial genome of P. anserina contains three group II introns:
(or
COX1i1), COX1i4, and ND5i4
(9). COX1i4 is an optional intron not present in
race s, from which the mid26 strain was obtained.
It is similar to intron
, and its open reading frame also encodes a
protein with putative endonuclease and reverse transcriptase
activities. It has been postulated that its presence in race
A is involved in the decreased longevity of this race (26). We have demonstrated that, as with intron
, intron
COX1i4 is able to form circular DNA molecules that can be
amplified in senescent cultures, although to a lesser degree. In
contrast, intron ND5i4 has never been observed as circular
DNA molecules (41). It differs from the two others in that
the sequence for its putative reverse transcriptase is split by an
insertion (9, 22), and it is possible that this
characteristic is responsible for the absence of ND5i4 DNA circles.
Contamination experiments that allowed the transfer of introns from
donor strain to recipient strain by homing (see Materials
and Methods)
were performed between the
mid26 strain and an
s(
A)
strain, which contains, in addition to
intron

, three optional
sequences:
COX1i4,
CYTbi3, and insert
C (
4). Fifteen
mid26 mycelia were independently contaminated, and their
mtDNAs were
analyzed by restriction and Southern experiments 6 cm after
contact
with the donor inoculum. Probes that hybridized inside and
upstream
of the
COX1i4,
CYTbi3, insert
C, and

sequences revealed that
the 15 mycelia contained
only one type of mitochondrial chromosome,
where the three optional
sequences of the donor, but not the
sequence, invaded the recipient
(data not shown). These results
indicated that although the homing of
group I and II introns was
quite effective in the
mid26
strain, no homing of intron

was
detectable in this
mutant.
The
mid26 mutant that contained the three optional sequences
was called
mid26(
A). Two successive crosses
between the
mid26(
A)
mutant used as a female and
wild-type used as a male were performed,
and the longevities of the
mat
and
mat+ progenies were recorded
and
compared to those of reference wild-type
s(
A) and
mat+ strains
(Table
2). Comparison of the longevities of the
s and
s(
A) strains
on one hand and of
the
mid26 and
mid26(
A) strains on the
other
(Table
2) clearly showed that the presence of one or more of
the
three optional sequences in the mitochondrial chromosome of
isonuclear
strains accelerated the senescence process. However,
comparison of the
longevities of the
s (
+
COX1i4
) and
mid26(
A)
(

COX1i4+) strains indicated
that the presence of intron
COX1i4 did not
restore the
characteristic longevity of a strain carrying intron

. Eight
independent senescent cultures of the
mid26(
A)
strain
were examined. Six of them accumulated large quantities of
circular
(or tandemly arranged) copies of intron
COX1i4 in
addition to

and

senDNAs. One accumulated only a

senDNA, and
another
accumulated only circular copies of
COX1i4 (data not
shown).
 |
DISCUSSION |
We describe here a new mitochondrial mutant that differs from the
wild-type only by the absence of intron
and by the benign change of
two amino acids in subunit I of cytochrome c oxidase. We
show that this mutant, whose respiratory properties are identical to
those of the wild type, displays a senescence syndrome correlated with
the accumulation of large amounts of
and
senDNAs and that its
longevity is increased by a factor of 1.5 to 2. This study demonstrates
that the
sequence is not necessary for the senescence syndrome but
that its presence accelerates the process.
The mid26 strain behaves as a pseudo-wild-type strain
devoid of the
intron.
The mitochondrially modified chromosome
was isolated from an AS1-4 mat
strain as a suppressor of
the premature death syndrome. The suppressor effect of the
mid26 mutation will be described elsewhere. The
mid26 chromosome is issued from an heteroplasmic cytoplasm
containing a low concentration of wild-type chromosomes and abundant
1 deletion chromosomes in which intron
is joined to an IBS-like
motif (IBS'1) located 37,000 bp upstream of the 5' end of the intron in
the wild-type chromosome (3). The occurrence of DNA
molecules derived from
1 and with the
sequence precisely deleted
strongly suggests that these molecules probably result from a reverse
transcription mechanism (40). This means that
1
transcripts do exist and that intron
is able to be spliced from
them. One model that could explain the formation of the
mid26 allele relies on recombinational events between the
wild-type chromosome and these
1
-spliced reverse transcripts
(Fig. 3).
The data presented here strongly support the idea that the few changes
in the upstream sequence of the integration site eliminate
or
drastically reduce

homing in the
mid26 strain, whereas
they
do not block splicing of the intron in the

1 chromosome. The
homing process of group II introns occurs by a targeted, DNA-primed
reverse transcription mechanism in which the intron RNA reverse
splices
into the recipient DNA (
12,
17,
53-56). Our data agree
with
those of Eskes et al. (
12), which showed that base pairing
between the EBS1 (RNA) of the intron and the IBS1 of the DNA target
site is essential for homing and that a single base change can
block
intron mobility, whereas it has little effect on splicing.
Moreover, in
vitro experiments indicate that the target site for
reverse splicing
and sense cleavage extends from E

21 to E+1 for
the yeast ai2 intron
(
17). It is therefore not surprising that

homing is
abolished in the
mid26 mutant, since the EBS1-IBS1
pairing
is disturbed by one mismatch (T/C at E

4 [Fig.
2]) and
it also
carries substitutions at E

8, E

11, E

12, and E

13. These
characteristics, in addition to the suppressor effect of the
mid26 mutation on the premature death syndrome, probably
accounts for
the selection and stability of the chromosome devoid of
intron

.
The upstream sequence substitutions flanking the intron insertion site
change only two amino acids, and they do not impair
the reading frame
of the gene
COX1. This modification has no effect
on the
activity of the cytochrome
c oxidase. The
mid26
strain
can be therefore considered a pseudo-wild-type strain that
differs
from the wild-type
s strain of
P. anserina only by the absence
of the
intron.
Role of the
intron in the senescence process of P. anserina.
Intron
has two characteristic properties. First, it
is a mobile group II intron, which is a source of instability of
the mitochondrial chromosome (45). Second, it corresponds to
a senDNA. The role of this intron in the senescence process of
P. anserina has been a much-debated question. On one hand,
it has been hypothesized that the senDNAs (20), and
especially senDNA
(5, 14, 30), correspond to the
senescence factor that Marcou (25) called the determinant.
On the other hand, it has been speculated that senDNA
and the other
senDNAs have only a secondary role in the senescence process
(47).
We show here that a strain lacking only intron

displays a
senescence process caused by a single random event (the determination
event) quite similar to that occurring in a wild-type strain.
This
directly demonstrates that intron

is not the primary determinant.
Nevertheless, this strain does show an increased longevity. It
has been
shown that modifications in the mitochondrial functions
modulate
longevity (
1). Since no change in the cytochrome
c oxidase activity of the
mid26 strain is
detectable, its increased
longevity is probably not due to a change in
its mitochondrial
metabolism but rather is due to the absence of the
intron

. We
show furthermore that the senescence process in the
mid26 strain
is also correlated with mitochondrial
rearrangements and the accumulation
of senDNAs, as is the case for all
senescence events in
P. anserina described until
now.
These results can be formally interpreted in two ways. First, as
suggested in early studies, a threshold concentration of
senDNA
molecules may function as the determinant of senescence.
The different
senDNAs (

,

, and

, etc.) would then play equivalent
roles in
the senescence process, although they would differ in
their rates of
genesis and/or spreading. In this hypothesis, the
increased longevity
of the
mid26 strain would result from a longer
time for
senDNAs, other than

, to reach the necessary amount
for senescence
expression. It is known that senDNA

and the other
senDNAs originate
and accumulate by different mechanisms (
21),
and we have
also shown that the amplification of senDNA

precedes
that of the
other senDNAs in wild-type senescent cultures (unpublished
results). A
second possibility is that the determinant does not
correspond to
senDNAs. In that case, the effect of this factor
would be different
according to whether it occurs in a strain
with or without intron

.
In other words, its mode of expression
or action would depend in part
on the quality of the mitochondrial
chromosome. It is generally
accepted that group II introns, due
to their mobility and their
enzymatic properties, are a source
of mitochondrial instability
(
28,
44,
45). Thus, the effect
of the determinant would be
modulated by the intrinsic properties
of the stability of the
mitochondrial chromosome. We show here
that intron

and intron
COX1i4, although closely related, cannot
substitute for each
other, and this underscores the peculiar role
of intron

in the
instability of the
mtDNA.
Whatever the hypothesis on the nature of the senescence determinant,
our data emphasize the link between longevity and stability
of the
mitochondrial chromosome, and they strengthen the idea
that there is a
causal relationship between these two parameters.
Cases of senescence
in the fungal genera
Aspergillus and
Neurospora have been described. Their study has revealed heterogeneous sets
of
molecular processes. However, the great majority of them lead
to the
degeneration of mitochondrial function and are related
to mtDNA
instability (for a review, see reference
16).
Respiratory metabolism, mitochondrial instability, and senescence
in P. anserina.
Our data allow us for the first time to
choose between the two hypotheses currently used to explain the
immortality of the mex mutants. They strongly support the
idea that the immortality of these mutants is due to the lack of active
cytochrome c oxidase rather than to the lack of intron
.
Recent data obtained from a strain with a disruption in a nuclear gene
coding for a subunit of cytochrome c oxidase confirm this
conclusion (9a). Thus, the initial challenge in
understanding the link between senescence and mitochondrial
rearrangements is now coupled with a new challenge of understanding the
link between senescence and respiratory metabolism. It is tempting to
think that these two questions are connected and that the respiratory
metabolism is involved in the control of the mitochondrial stability.
Strains of
P. anserina lacking cytochrome
c
oxidase use an alternate cyanide-resistant oxidase. It has been
demonstrated that
life spans of cultures of
P. anserina are
greatly increased by
the action of the mitochondrial mutation
capR1 or by growth in
the presence of some inhibitors of the
mitochondrial functions.
All of these situations correspond to a
deficiency in detectable
cytochrome
c oxidase, and it was
proposed as early as 1980 that
the increased life span in
P. anserina is correlated with the
functioning of the alternate
oxidase (
1). Several reports state
that in plants the
alternate oxidase constitutes an efficient
antioxygen defense system of
mitochondria (
33,
51). However
the links between the
functioning of the cyanide-sensitive or
-insensitive respiratory
pathways and longevity are far from being
clear. Indeed, it can
be observed that senescence in
P. anserina (
1), as in
Neurospora (
34), is
paralleled by switching from
cytochrome
c oxidase-mediated
respiration to cyanide-resistant
respiration. Moreover, the
long-living nuclear
iviv double mutant
has been reported to
respire only via the cyanide-sensitive pathway
and to be incapable of
alternate respiration (
15). Taken together,
these data
suggest that the respiratory metabolism plays a major
role in the
control of the mitochondrial DNA integrity. Experiments
to elucidate
the nature of this control are in
progress.
 |
ACKNOWLEDGMENTS |
We thank C. Sellem, R. Chanet, K. Tanner, M. Picard, G. Dujardin,
and C. Lemaire for their helpful discussions and comments on the
manuscript. We gratefully acknowledge P. Hamel for his help in the
cytochrome c oxidase dosage.
This work was supported by grants from the Centre National de la
Recherche Scientifique, the Association Française contre les
Myopathies, and the Ministère de l'Education National de l'Enseignement Supérieur et de la Recherche (ACC-SV4 no. 9504063).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centre de
Génétique Moléculaire-Centre National de la Recherche
Scientifique, 91198 Gif-sur-Yvette Cedex, France. Phone: (33) 1 69 82 38 82. Fax: (33) 1 69 82 38 77. E-mail:
sainsard{at}cgm.cnrs-gif.fr.
This work is dedicated to Leon Belcour.
 |
REFERENCES |
| 1.
|
Belcour, L., and O. Begel.
1980.
Life-span and senescence in Podospora anserina: effect of mitochondrial genes and functions.
J. Gen. Microbiol.
119:505-515.
|
| 2.
|
Belcour, L., and C. Vierny.
1986.
Variable DNA-splicing sites of a mitochondrial intron: relationship to the senescence process in Podospora.
EMBO J.
5:609-614[Medline].
|
| 3.
|
Belcour, L.,
O. Begel, and M. Picard.
1991.
A site-specific deletion in the mitochondrial DNA of Podospora is under the control of nuclear genes.
Proc. Natl. Acad. Sci. USA
88:3579-3583[Abstract/Free Full Text].
|
| 4.
|
Belcour, L.,
M. Rossignol,
F. Koll,
C. H. Sellem, and C. Oldani.
1997.
Plasticity of the mitochondrial genome in Podospora. Polymorphism for 15 optional sequences: group-I, group-II introns, intronic ORFs and an intergenic region.
Curr. Genet.
31:308-317[Medline].
|
| 5.
|
Belcour, L.,
A. Sainsard-Chanet, and C. H. Sellem.
1994.
Mobile group II introns, DNA circles, reverse transcriptase and senescence.
Genetica
93:225-228[Medline].
|
| 6.
|
Borghouts, C.,
E. Kimpel, and H. D. Osiewacz.
1997.
Mitochondrial DNA rearrangements of Podospora anserina are under the control of the nuclear gene grisea.
Proc. Natl. Acad. Sci. USA
94:10768-10773[Abstract/Free Full Text].
|
| 7.
|
Contamine, V.,
G. Lecellier,
L. Belcour, and M. Picard.
1996.
Premature death in Podospora anserina: sporadic accumulation of the deleted mitochondrial genome, translational parameters and innocuity of the mating types.
Genetics
144:541-555[Abstract].
|
| 8.
|
Cummings, D. J.,
L. Belcour, and C. Grandchamp.
1979.
Mitochondrial DNA from Podospora anserina. Isolation and characterization.
Mol. Gen. Genet.
171:229-238[Medline].
|
| 9.
|
Cummings, D. J.,
K. L. McNally,
J. M. Domenico, and E. T. Matsuura.
1990.
The complete DNA sequence of the mitochondrial genome of Podospora anserina.
Curr. Genet.
17:375-402[Medline].
|
| 9a.
| Dufour, E., et al. Unpublished data.
|
| 10.
|
Dujon, B., and L. Belcour.
1989.
Mitochondrial DNA instabilities and rearrangements in yeasts and fungi, p. 861-878.
In
D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
|
| 11.
|
Edwards, D. L., and E. Rosenberg.
1976.
Regulation of cyanide-insensitive respiration in Neurospora.
Eur. J. Biochem.
62:217-221[Medline].
|
| 12.
|
Eskes, R.,
J. Yang,
A. M. Lambowitz, and P. S. Perlman.
1997.
Mobility of yeast mitochondrial group II introns: engineering a new site specificity and retrohoming via full reverse splicing.
Cell
88:865-874[Medline].
|
| 13.
|
Esser, K.
1974.
Podospora anserina, p. 531-551.
In
R. C. King (ed.), Handbook of genetics, vol. 1. Plenum Press, New York, N.Y.
|
| 14.
|
Esser, K.,
P. Tudzynski,
U. Stahl, and U. Kück.
1980.
A model to explain senescence in the filamentous fungus Podospora anserina by the action of plasmid like DNA.
Mol. Gen. Genet.
178:213-216.
|
| 15.
|
Frese, D., and U. Stahl.
1992.
Oxidative stress and ageing in the fungus Podospora anserina.
Mech. Ageing Dev.
65:277-288[Medline].
|
| 16.
|
Griffiths, A. J. F.
1992.
Fungal senescence.
Annu. Rev. Genet.
26:351-372[Medline].
|
| 17.
|
Guo, H.,
S. Zimmerly,
P. S. Perlman, and A. M. Lambowitz.
1997.
Group II intron endonucleases use both RNA and protein subunits for recognition of specific sequences in double-stranded DNA.
EMBO J.
16:6835-6848[Medline].
|
| 18.
|
Hamel, P.,
W. Sakamoto,
H. Wintz, and G. Dujardin.
1997.
Functional complementation of an oxa1- yeast mutation identifies an Arabidopsis thaliana cDNA involved in the assembly of respiratory complexes.
Plant J.
12:1319-1327[Medline].
|
| 19.
|
Iwata, S.,
C. Ostermeier,
B. Ludwig, and H. Michel.
1995.
Structure at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans.
Nature
376:660-669[Medline].
|
| 20.
|
Jamet-Vierny, C.,
O. Begel, and L. Belcour.
1980.
Senescence in Podospora anserina: amplification of a mitochondrial DNA sequence.
Cell
21:189-194[Medline].
|
| 21.
|
Jamet-Vierny, C.,
J. Boulay, and J. F. Briand.
1997.
Intramolecular cross-overs generate deleted mitochondrial DNA molecules in Podospora anserina.
Curr. Genet.
31:162-170[Medline].
|
| 22.
|
Koll, F.,
J. Boulay,
L. Belcour, and Y. d'Aubenton-Carafa.
1996.
Contribution of ultra-short invasive elements to the evolution of the mitochondrial genome in the genus Podospora.
Nucleic Acids Res.
24:1734-1741[Abstract/Free Full Text].
|
| 23.
|
Lecellier, G., and P. Silar.
1994.
Rapid methods for nucleic acids extraction from petri dish grown mycelia.
Curr. Genet.
25:122-123[Medline].
|
| 24.
|
Li, Q.,
R. G. Ritzel,
L. L. T. McLean,
L. McIntosh,
T. Ko,
H. Bertrand, and F. E. Nargang.
1996.
Cloning and analysis of the alternative oxidase gene of Neurospora crassa.
Genetics
142:129-140[Abstract].
|
| 25.
|
Marcou, D.
1961.
Notion de longévité et nature cytoplasmique du déterminant de la sénescence chez quelques champignons.
Ann. Sci. Nat. Bot.
12:653-764.
|
| 26.
|
Matsuura, E. T.,
J. M. Domenico, and D. J. Cummings.
1986.
An additional class II intron with homology to reverse transcriptase in rapidly senescing Podospora anserina.
Curr. Genet.
10:915-922[Medline].
|
| 27.
|
McIntosh, L.
1994.
Molecular biology of the alternative oxidase.
Plant Physiol.
105:781-786[Medline].
|
| 28.
|
Muller, M. W.,
M. Allmaier,
R. Eskes, and R. J. Schweyen.
1993.
Transposition of group II intron ai1 in yeast and invasion of mitochondrial genes at new locations.
Nature
366:174-176[Medline].
|
| 29.
|
Nargang, F. E., and H. Bertrand.
1978.
Nuclear mutants of Neurospora crassa temperature-sensitive for the synthesis of cytochrome aa3. I. Isolation and preliminary characterization.
Mol. Gen. Genet.
166:15-23[Medline].
|
| 30.
|
Osiewacz, H. D.
1992.
Genetic control of aging in the ascomycete Podospora anserina, p. 153-164.
In
R. Zwilling, and C. Balduin (ed.), Biology of aging. Springer-Verlag, Berlin, Germany.
|
| 31.
|
Pajot, P.,
M. Wambier-Kluppel,
Z. Kotylak, and P. Slonimski.
1976.
Genetics and biogenesis of chloroplasts and mitochondria, p. 443-451.
Elsevier North-Holland Biomedical Press, Amsterdam, The Netherlands.
|
| 32.
|
Picard-Bennoun, M.
1976.
Genetic evidence for ribosomal antisuppressors in Podospora anserina.
Mol. Gen. Genet.
147:299-306[Medline].
|
| 33.
|
Popov, V. N.,
R. A. Simonian,
V. P. Skulachev, and A. A. Starkov.
1997.
Inhibition of the alternative oxidase stimulates H2O2 production in plant mitochondria.
FEBS Lett.
415:87-90[Medline].
|
| 34.
|
Rieck, A.,
A. J. F. Griffiths, and H. Bertrand.
1982.
Mitochondrial variants of Neurospora intermedia from nature.
Can. J. Genet. Cytol.
24:741-759[Medline].
|
| 35.
|
Rizet, G.
1952.
Les phénomènes de barrage chez Podospora anserina. I. Analyse génétique des barrages entre souche S et s.
Rev. Cytol. Biol. Veg.
13:51-92.
|
| 36.
|
Rizet, G.
1953.
Sur l'impossibilité d'obtenir la multiplication végétative ininterrompue et illimitée de l'ascomycète Podospora anserina.
C. R. Acad. Sci.
237:838-840.
|
| 37.
|
Rizet, G.
1953.
Sur la longévité des souches de Podospora anserina.
C. R. Acad. Sci.
237:1106-1109.
|
| 38.
|
Rizet, G., and C. Engelmann.
1949.
Contribution à l'étude génétique d'un ascomycète tétrasporé: Podospora anserina.
Rehm. Rev. Cytol. Biol. Veg.
11:201-304.
|
| 39.
|
Sainsard-Chanet, A., and O. Begel.
1990.
Insertion of an LrDNA gene fragment and of filler DNA at a mitochondrial exon-intron junction in Podospora.
Nucleic Acids Res.
18:779-783[Abstract/Free Full Text].
|
| 40.
|
Sainsard-Chanet, A.,
O. Begel, and L. Belcour.
1993.
DNA deletion of mitochondrial introns is correlated with the process of senescence in Podospora anserina.
J. Mol. Biol.
234:1-7[Medline].
|
| 41.
|
Sainsard-Chanet, A.,
O. Begel, and L. Belcour.
1994.
DNA double-strand break in vivo at the 3' extremity of exons located upstream of group II introns senescence and circular DNA introns in Podospora mitochondria.
J. Mol. Biol.
242:630-643[Medline].
|
| 42.
|
Sainsard-Chanet, A.,
O. Begel, and Y. d'Aubenton-Carafa.
1998.
Two coexisting mechanisms account for the large-scale deletions of mitochondrial DNA in Podospora anserina that involve the 5' border of a group II intron.
Curr. Genet.
34:326-335[Medline].
|
| 43.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 44.
|
Schmidt, W. M.,
R. J. Schweyen,
K. Wolf, and M. W. Mueller.
1994.
Transposable group II introns in fission and budding yeast. Site-specific genomic instabilities and formation of group II IVS plDNAs.
J. Mol. Biol.
243:157-166[Medline].
|
| 45.
|
Sellem, C. H.,
G. Lecellier, and L. Belcour.
1993.
Transposition of a group II intron.
Nature
366:176-178[Medline].
|
| 46.
|
Sellem, C. H.,
A. Sainsard-Chanet, and L. Belcour.
1990.
Detection of a protein encoded by a class II mitochondrial intron of Podospora anserina.
Mol. Gen. Genet.
224:232-240[Medline].
|
| 47.
|
Silar, P.,
F. Koll, and M. Rossignol.
1997.
Cytosolic ribosomal mutations that abolish accumulation of circular intron in the mitochondria without preventing senescence of Podospora anserina.
Genetics
145:697-705[Abstract].
|
| 48.
|
Smith, J. R., and I. Rubenstein.
1973.
The development of "senescence" in Podospora anserina.
J. Gen. Microbiol.
76:283-296.
|
| 49.
|
Tsukihara, T.,
H. Aoyama,
E. Yamashita,
T. Tomizaki,
H. Yamaguchi,
K. Shinzawa-Itoh,
R. Nakashima,
R. Yaono, and S. Yoshikawa.
1996.
The whole structure of the 13-subunit oxidized cytochrome c oxidase at 2.8A.
Science
272:1136-1144[Abstract].
|
| 50.
|
Vierny, C.,
A. M. Keller,
O. Begel, and L. Belcour.
1982.
A sequence of mitochondrial DNA is associated with the onset of senescence in a fungus.
Nature
297:157-159[Medline].
|
| 51.
|
Wagner, A. M., and A. L. Moore.
1997.
Structure and function of the plant alternative oxidase: its putative role in the oxygen defense mechanism.
Biosci. Rep.
17:319-333[Medline].
|
| 52.
|
Wright, R. M.,
M. A. Horrum, and D. J. Cummings.
1982.
Are mitochondrial structural genes selectively amplified during senescence in Podospora anserina?
Cell
29:505-515[Medline].
|
| 53.
|
Yang, J.,
G. Mohr,
P. S. Perlman, and A. M. Lambowitz.
1998.
Group II intron mobility in yeast mitochondria: target DNA-primed reverse transcription activity of ai1 and reverse splicing into DNA transposition sites in vitro.
J. Mol. Biol.
282:505-523[Medline].
|
| 54.
|
Yang, J.,
S. Zimmerly,
P. S. Perlman, and A. M. Lambowitz.
1996.
Efficient integration of an intron RNA into double-stranded DNA by reverse splicing.
Nature
381:332-335[Medline].
|
| 55.
|
Zimmerly, S.,
H. Guo,
R. Eskes,
J. Yang,
P. S. Perlman, and A. M. Lambowitz.
1995.
A group II intron RNA is a catalytic component of a DNA endonuclease involved in intron mobility.
Cell
83:529-538[Medline].
|
| 56.
|
Zimmerly, S.,
H. Guo,
P. S. Perlman, and A. M. Lambowitz.
1995.
Group II intron mobility occurs by target DNA-primed reverse transcription.
Cell
82:545-554[Medline].
|
Molecular and Cellular Biology, June 1999, p. 4093-4100, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
El-Khoury, R., Sainsard-Chanet, A.
(2009). Suppression of Mitochondrial DNA Instability of Autosomal Dominant Forms of Progressive External Ophthalmoplegia-Associated ANT1 Mutations in Podospora anserina. Genetics
183: 861-871
[Abstract]
[Full Text]
-
Molina-Sanchez, M. D., Martinez-Abarca, F., Toro, N.
(2006). Excision of the Sinorhizobium meliloti Group II Intron RmInt1 as Circles in Vivo. J. Biol. Chem.
281: 28737-28744
[Abstract]
[Full Text]
-
Lalucque, H., Silar, P.
(2004). Incomplete Penetrance and Variable Expressivity of a Growth Defect as a Consequence of Knocking Out Two K+ Transporters in the Euascomycete Fungus Podospora anserina. Genetics
166: 125-133
[Abstract]
[Full Text]
-
Dequard-Chablat, M., Alland, C.
(2002). Two Copies of mthmg1, Encoding a Novel Mitochondrial HMG-Like Protein, Delay Accumulation of Mitochondrial DNA Deletions in Podospora anserina. Eukaryot Cell
1: 503-513
[Abstract]
[Full Text]
-
Dufour, E., Boulay, J., Rincheval, V., Sainsard-Chanet, A.
(2000). A causal link between respiration and senescence in Podospora anserina. Proc. Natl. Acad. Sci. USA
97: 4138-4143
[Abstract]
[Full Text]