Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4159-4166, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
DNA Hairpin Opening Mediated by the RAG1 and
RAG2 Proteins
Penny E.
Shockett and
David G.
Schatz*
Howard Hughes Medical Institute and Section
of Immunobiology, Yale University School of Medicine, New Haven,
Connecticut 06520-8011
Received 14 January 1999/Returned for modification 19 February
1999/Accepted 15 March 1999
 |
ABSTRACT |
The lymphoid cell-specific proteins RAG1 and RAG2 initiate V(D)J
recombination by cleaving DNA adjacent to recombination signals, generating blunt signal ends and covalently sealed, hairpin coding ends. A critical next step in the reaction is opening of the hairpins, but the factor(s) responsible has not been identified and had been
thought to be a ubiquitous component(s) of the DNA repair machinery.
Here we demonstrate that RAG1 and RAG2 possess an intrinsic single-stranded nuclease activity capable of nicking hairpin coding ends at or near the hairpin tip. In Mn2+, a synthetic
hairpin is nicked 5 nucleotides (nt) 5' of the hairpin tip, with more
distant sites of nicking suppressed by HMG2. In Mg2+,
hairpins generated by V(D)J cleavage are nicked whereas synthetic hairpins are not. Cleavage-generated hairpins are nicked at the tip and
predominantly 1 to 2 nt 5' of the tip. RAG1 and RAG2 may therefore be
responsible for initiating the processing of coding ends and for the
generation of P nucleotides during V(D)J recombination.
 |
INTRODUCTION |
V(D)J recombination assembles the
variable regions of antigen receptor genes during lymphocyte
development by joining together V (variable), J (joining), and in some
cases D (diversity), coding gene segments (28).
Recombination is specifically directed to coding elements by
recombination signal sequences (RSSs) which flank the segments to be
joined. These RSSs consist of a conserved heptamer which is contiguous
to the coding flank and an AT-rich nonamer. Heptamer and nonamer are
separated by a nonconserved spacer of either 12 or 23 bp, yielding the
12-RSS or 23-RSS, respectively. In vivo, recombination primarily occurs
between coding elements with RSS spacers of different lengths, thereby
preventing the joining of inappropriate elements. This restriction is
referred to as the 12/23 rule.
Mechanistically, the recombination reaction is envisioned to occur in
two stages. In the first stage, initiation of recombination is mediated
by the proteins encoded by the recombination-activating genes,
RAG1 and RAG2, which bind directly to RSSs
(10, 32, 47, 51). Binding by RAG proteins is followed by RSS
synapsis and concerted cleavage at both signals. Cleavage involves
hydrolytic nicking at the heptamer-coding flank border, and the the
3'-hydroxyl thus generated serves as a nucleophile to attack the
phosphodiester bond on the other DNA strand opposite the nick in a
direct transesterification reaction (32, 52). The coding
ends generated by cleavage are covalently sealed DNA hairpins, while
signal ends are blunt and 5' phosphorylated. This reaction is
stimulated in vitro, especially at the 23-RSS, by addition of
DNA-bending proteins HMG1 and HMG2 (44, 50). Coordinate
cleavage in accordance with the 12/23 rule requires Mg2+
rather than Mn2+ as divalent metal cofactor and is
stimulated by HMG1 or HMG2 (12, 43, 44, 50, 53). In the
second stage of the reaction, coding ends are processed, and coding
joints and signal joints form in reactions with similarities to the
repair of DNA double-strand breaks by nonhomologous end joining (NHEJ)
(9).
A hallmark of V(D)J recombination in many species is generation of
receptor diversity required for specific immune recognition. Many
coding elements can be joined in different combinations, and joining is
imprecise by virtue of nucleotide deletions and insertions. The source
of nucleotide deletions is unknown, but two mechanisms are known to
contribute to insertions. Terminal deoxynucleotidyltransferase, a
lymphoid cell-specific polymerase, adds untemplated nucleotides to DNA
3' termini (16, 25). Another source of nucleotide insertions
is asymmetric nicking of coding-end hairpins to generate palindromic
extensions termed P nucleotides (26, 30, 33).
The opening of covalently sealed coding ends is a prerequisite for
coding-joint formation, and evidence exists for a ubiquitous hairpin
opening activity (4, 29, 48). Mice deficient in general
factors required for repair of DNA double-strand breaks by NHEJ,
including XRCC4, DNA ligase IV, Ku70, Ku80, and the DNA-dependent protein kinase (DNAPK), are deficient in coding-joint formation and
lymphocyte development (13-15, 17, 18, 41, 49, 55). Deficiencies in Ku80 and DNAPK also result in the accumulation of
hairpin coding ends (15, 41, 55), indicating that Ku and
DNAPK may regulate the hairpin opening reaction. Together, these data
have supported the hypothesis that hairpin opening in V(D)J
recombination is probably performed by a ubiquitous factor (29). Recent evidence, however, indicates that the RAG
proteins have a postcleavage role in coding-joint formation (27,
39) and that they remain associated with coding ends after
cleavage (20). In an effort to understand their role in
coupling the two stages of V(D)J recombination, we examined the
alternative possibility that coding-end hairpins are opened by RAG1 and RAG2.
While this report was in preparation, Besmer et al. reported concurrent
work demonstrating DNA hairpin opening by RAG proteins (5).
Our results are consistent with their basic findings and lead to a
number of novel conclusions concerning the hairpin opening reaction.
 |
MATERIALS AND METHODS |
Synthetic hairpin nicking reactions.
RAG and HMG2 proteins
have been described previously (1, 47). RAG proteins
(expressed individually or coexpressed) contained either a C-terminal
polyhistidine and Myc antibody epitope (MH) tag (MH-RAGs) or an
N-terminal glutathione S-transferase (GST) tag (GST-RAGs,
GST-RAG1, and GST-RAG2). MH-RAGs (30 ng of each; 0.3 to 0.6 pmol) or
GST-RAGs (30 ng of each; 0.3 to 0.4 pmol) and, where appropriate, HMG2
(75 ng; 2.5 pmol) were incubated with 25 to 50 fmol of
32P-end-labeled, annealed, synthetic hairpins at 30°C for
3 h (unless otherwise indicated). Reaction mixtures (20 µl)
contained 20 mM HEPES (pH 7.5), 16 mM sodium acetate (pH 7.0), 34 mM
NaCl, 10 µM ZnSO4, 2 mM dithiothreitol, 100 µg of
bovine serum albumin per ml, 15% glycerol, and 1 mM MnCl2
(unless otherwise indicated) and were terminated essentially as
described previously (1). DNA samples were resuspended in
loading buffer containing 80% formamide, 10 mM NaOH, and 1 mM EDTA.
After heating for 2 min at 95°C, DNA was analyzed at 40 to 45°C by
denaturing (8% polyacrylamide, 7 M urea, and 40% formamide)
polyacrylamide gel electrophoresis (PAGE).
Oligonucleotides used in synthetic hairpin nicking
reactions.
The 126-nucleotide (nt) hairpin oligonucleotide was
HPBSAI
(5'-GCGAGCGTCGGTCTCG CCAATCGAGCCATGTCGTCGTCGATCCTCTCATCGATGAGAGGATC CGGATCCTCTCATCGATGAGAGGATCGACGACGACATGGCTCGATT GGCGAGACCGACGCTCGC). This is identical to the 23 coding-end hairpin of pJH299 except that 14 bp (including a BsaI site) have been added at a position 51 bp from the hairpin tip. Hairpin oligonucleotides were denatured at
95°C and quick cooled on ice to favor intramolecular hairpin annealing rather than intermolecular association. Linear DNA duplex substrate was made by annealing the oligonucleotides HPBSAI-T (5'-GCGAGCGTCGGTCTCGCCAATCGAGCCATGTCGTCGTCGATCCTCTCATCGATGAGAGGATCC) and HPBSAI-B
(5'-GGATCCTCTCATCGATGAGAGGATCGACGACGACATGGCTCGATTGGCGAGACCGACGCTCGC).
Detection of coding ends after 12/23-regulated cleavage.
Reactions were performed essentially as described above, with 10 mM
MgCl2 in place of 1 mM MnCl2. Reaction mixtures
(40 µl) contained 100 ng of DNA substrate and 60 ng each of MH-RAG1
and MH-RAG2 (and 150 ng of HMG2 where appropriate) and were incubated at 30°C for 3 h. The DNA substrate was pJH299 (19) or
pJ2VIS6 (45), which contains the endogenous V
21C and
J
1 gene segments (and their flanking RSSs) separated by 670 bp in
inversional orientation. Reactions were terminated by addition of
0.06% sodium dodecyl sulfate (SDS), 1.1 mM EDTA, and proteinase K (180 ng/µl) and incubation at 55°C for 30 min. After organic extraction
and ethanol precipitation, DNA was digested with HinfI for
analysis of the 23 coding end of pJH299 (or MseI and
SalI for analysis of the 12 and 23 coding ends,
respectively, of pJ2VIS6) and analyzed as described above by denaturing
PAGE. After electroblotting to Gene Screen Plus and base (0.4 N NaOH,
10 min) treatment of the membrane, blots were hybridized at 37°C for
18 h in a mixture containing 4× SSPE (1× SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA [pH 7.7]), 10×
Denhardt's solution, 0.1% SDS, fish sperm DNA (100 µg/ml), yeast
RNA (250 µg/ml), and 5'-end-labeled lower-strand-specific oligonucleotide probe PSHP1 (5'-TCGCAGCAACTTGTCGCGCCAATCGAGCCA; 7 × 106 cpm/ml) for pJH299. Blots were washed
at 37°C in 4× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate)-0.5% SDS and at 55°C in 2× SSC-0.5% SDS.
Detection of coding ends by LMPCR.
Anchor oligonucleotides
used in ligation-mediated PCR (LMPCR) (DR19 and DR20), described
previously (42), contained a terminal EcoRI site
for cloning. Forward primers, all of which contained a terminal
XbaI site for cloning, were CBLMP1-XB
(5'-GCCTCTAGACAAGAACAGCAAGCAGCATTGAG; specific for sequences
upstream of the 23 coding flank of pJH299, generating a 249-bp PCR
product with a full-length coding end), J2LM-XB12
(5'-GCCTCTAGACGAAGATTGGCTGTGTCTCTAGG; 12 coding flank of
pJ2V1S6; 309-bp product with a full-length coding end), and J2LM-XB23
(5'-GCCTCTAGAGCAAGATTCCGAATACCGCAAGC; 23 coding flank of
J2V1S6; 294-bp product with a full-length coding end). Coding flank
refers to coding-end sequences immediately adjacent to the RSS
heptamer. Five percent of the DNA recovered from cleavage reactions was
treated for 30 min at 37°C (or mock treated [
T4 reactions]) in
20-µl mixtures containing 0.75 U of T4 DNA polymerase (T4 DNAP; New
England Biolabs), 0.2 mM deoxynucleoside triphosphates, 100 µg of
bovine serum albumin per ml, and 1× T4 DNAP buffer. Reactions were
terminated by heating for 10 min at 75°C. Ten percent of the DNA from
T4 DNAP reactions was ligated to annealed anchor oligonucleotides (2 µM) in a 15-µl reaction mixture containing 1.5 U of T4 DNA ligase
(Gibco/BRL) at 16°C for 18 h. PCR was performed by standard
methods with annealing at 64°C for 23 to 26 cycles, and products were
analyzed by native PAGE on 7% gels.
Cloning and sequencing of coding ends.
DNA from LMPCR
reactions was phenol-chloroform extracted, precipitated, and double
digested with EcoRI and XbaI. Products were gel
purified, cloned into pBluescript II KS+, and sequenced on
an ABI 373 automated DNA sequencer (Perkin-Elmer).
 |
RESULTS |
RAG proteins nick synthetic hairpins in Mn2+ but not
Mg2+.
We first incubated the RAG proteins with a
126-nt synthetic hairpin DNA molecule and detected substrate cleavage
by denaturing PAGE. With two different preparations of RAG proteins,
cleavage was observed at multiple positions when reactions were
performed in Mn2+, but not in Mg2+, EDTA (Fig.
1A, lanes 3, 6, 10, and 13), or
Ca2+ (data not shown). Reciprocal-sized products were
detected with substrates labeled at the 5' and 3' termini (compare
lanes 3 and 6 with lanes 10 and 13), indicating that single-strand
nicks, rather than double-strand breaks, were generated and that these fragments were the immediate products of nicking. One discrete product
(Fig. 1A, large arrows) was shown to be the result of a nick 5 nt 5' of
the hairpin tip (generating 58- and 68-nt products with the 5'- and
3'-end-labeled substrates, respectively; higher-resolution mapping data
is also shown (Fig. 1B). Other nicks occurred at a greater distance
from the hairpin tip, with sites located predominantly in two clusters
(Fig. 1A, small arrows labeled a and b).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 1.
Synthetic hairpin nicking mediated by the RAG proteins.
(A) Synthetic hairpin nicking occurs in the presence of
Mn2+ but not Mg2+. Annealed 5'- and
3'-end-labeled hairpin oligonucleotides were incubated with truncated,
coexpressed MH- or GST-tagged RAG proteins. Sites of nicking distant
from the hairpin tip (small arrows and lowercase letters) and 58-nt (5'
labeled) and 68-nt (3' labeled) fragments corresponding to nicking at a
position 5 nt 5' of the hairpin tip (large arrows) are shown. Reactions
included either 10 mM Mg2+ (Mg), 1 mM Mn2+
(Mn), or 10 mM EDTA (E). Positions of DNA molecular weight markers (M)
are indicated in nucleotides. An asterisk is used to indicate the site
of 32P end labeling. (B) High-resolution mapping of
synthetic hairpin nicking products. Samples from lanes 3, 6, 10, and 13 of panel A were reanalyzed adjacent to marker fragments by denaturing
PAGE. The 58- and 68-nt reciprocal products of hairpin nicking
generated with 5'- and 3'-end-labeled substrates, respectively, are
indicated with arrows.
|
|
Nicking of synthetic hairpins requires both RAG1 and RAG2 and is
inhibited by anti-RAG1 antibody.
To confirm that the RAG proteins,
and not a copurifying nuclease, were responsible for the nicking
activity, we examined the activity of individually expressed and
purified GST-RAG fusion proteins. No nicking could be detected with
either protein alone, but the mixture of RAG1 and RAG2 displayed robust
activity in Mn2+ (Fig. 2A).
Identical results were obtained with a number of other highly purified,
active preparations of recombinant RAG proteins, including RAG1 from
bacteria and RAG2 purified from mammalian cells after infection with a
vaccinia virus expression vector. In all cases, nicking was absolutely
dependent on the presence of both RAG1 and RAG2 (data not shown).
Furthermore, addition of anti-RAG1 antibodies to the reaction
dramatically inhibited nicking activity, whereas anti-RAG2 antibodies
did not have a reproducible effect (Fig. 2B). We conclude that the
nicking activity is due to the action of RAG1 and RAG2 and cannot be
attributed to contaminants in the preparations.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Nicking of synthetic hairpins requires both RAG1 and
RAG2 and is inhibited by anti-RAG1 antibody. (A) 5'-end-labeled,
annealed hairpin oligonucleotide was incubated with individually
expressed (lanes 2 to 5) or coexpressed (co-expr) GST-RAG proteins, in
the presence or absence of purified HMG2 (as indicated above the
lanes). Reactions in both panels were performed in 1 mM
Mn2+ and analyzed as for Fig. 1A; in each, the 58-nt
fragment derived from nicking 5 nt 5' of the hairpin tip is indicated
with an arrow. (B) RAG proteins were preincubated for 25 min at 30°C
with anti-RAG1 (R1) or anti-RAG2 (R2) antibodies or a rabbit
immunoglobulin G specificity control (C) before addition of hairpin
substrate. Antibodies specific for RAG1 (R1P8) and RAG2 have been
described previously (2). Nicking reactions were carried out
for 3 or 2 h with coexpressed GST- or MH-RAGs, respectively.
|
|
A hairpin terminus is not required for single-stranded nicking
activity of the RAG proteins.
To investigate the role of the
hairpin terminus in this reaction, we repeated the experiment with a
linear duplex DNA substrate, identical in sequence to the hairpin
substrate. A product that comigrated with that produced by nicking near
the tip of the hairpin substrate was observed, indicating that the two
substrates were nicked at identical positions 5 nt from the 3' end, or
tip, of the molecule (Fig. 3A). The
linear duplex substrate was also nicked at a variety of sites on the
bottom strand (data not shown), and all activity required the presence
of both RAG1 and RAG2 (Fig. 3B). We conclude that a hairpin terminus is
not required for the single-strand nuclease activity of the RAG
proteins.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Single-stranded endonuclease activity of the RAG
proteins is not specific for a hairpin terminus (A) and requires both
RAG1 and RAG2 (B). Reactions were performed in 1 mM Mn2+
and analyzed as for Fig. 1A. The 58-nt fragment derived from nicking 5 nt 5' of the hairpin tip and the corresponding fragment derived from
nicking of the linear duplex DNA substrate are indicated with arrows.
The 5'-end-labeled hairpin (lanes 1 to 3) and the corresponding linear
duplex DNA substrates are indicated above the lanes.
|
|
HMG2 protein confines nicking to the vicinity of the hairpin
tip.
Since the high-mobility group proteins HMG1 and HMG2 enhance
DNA binding and cleavage by the RAG proteins (44, 50), we examined hairpin nicking in the presence of recombinant HMG2. With HMG2
added, nicking by the RAG proteins in Mn2+ was inhibited at
all sites except that near the hairpin tip (Fig. 4A, lanes 4 and 8; Fig. 2A, lanes 5 and
7; Fig. 3, lane 3). To extend this observation and examine the kinetics
of nicking, we performed time course experiments in the presence or
absence of HMG2 (Fig. 4B). Nicked products could be observed by 10 min
and accumulated for up to 3 h. HMG2 reduced the initial rate of
nicking near the hairpin tip but did not decrease the final yield of
this product, and it inhibited nicking at all other sites. HMG2
exhibited no nicking activity by itself on synthetic hairpins under any conditions tested, including those used in the coupled cleavage reactions described below (Fig. 4A, lanes 3 and 7, and data not shown).
With the linear DNA duplex substrate, RAG-mediated nicking (as
described above) was observed in the presence of HMG2 (Fig. 3A, lane
5). However, HMG2 did not consistently suppress nicking at other sites
(data not shown). Therefore, while altered DNA structures at the DNA
duplex end may be a preferential site for nicking, the effect of HMG2
in targeting the RAG proteins appears to be specific for the hairpin
structure.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
HMG2 inhibits nicking at sites distant from the hairpin
tip. (A) Synthetic 5'-end-labeled hairpins were incubated with RAG
proteins in the presence or absence of HMG2, or with HMG2 alone, as
indicated above the lanes. Reactions were carried out for 3 or 2 h
with coexpressed GST- or MH-RAGs, respectively. Reactions in both
panels were performed in 1 mM Mn2+ and analyzed as for Fig.
1A; in each, the 58-nt fragment derived from nicking 5 nt 5' of the
hairpin tip is indicated with an arrow. (B) RAG proteins were
preincubated with or without HMG2 for 15 min at 30°C before addition
of hairpin substrate, and samples were analyzed at the indicated
times.
|
|
RAG proteins mediate hairpin nicking in Mg2+ in the
context of V(D)J cleavage.
In Mg2+, synapsis of a
12-RSS and 23-RSS is required for efficient hairpin formation by the
RAG proteins, whereas Mn2+ more efficiently supports
disregulated cleavage at a single RSS (12, 32, 43, 53). By
analogy, hairpin nicking in Mg2+ by the RAG proteins might
require the formation of an appropriate postcleavage synaptic complex.
To examine this possibility, cleavage reactions were performed in
Mg2+ with a DNA substrate (pJH299) containing a 12-RSS and
a 23-RSS, and the resulting hairpin coding ends (derived from cleavage
at the 23-RSS) were analyzed for evidence of nicking by denaturing gel
electrophoresis followed by Southern blotting with a strand-specific oligonucleotide probe (Fig. 5A; note that
the synthetic hairpin substrate used in Fig. 1 to 4 has essentially the
same nucleotide sequence as the 23-coding flank of this substrate [see
Materials and Methods]). As expected, DNA cleavage, as measured by the
production of the 131-nt hairpin product, was RAG dependent and
stimulated by HMG2 (Fig. 5B). In addition, in the reaction containing
the RAG and HMG2 proteins, we detected a broad band that migrated with
approximately the same mobility as the 64-nt marker (Fig. 5B, lane 4, large arrow), consistent with nicking of the hairpin at or near its
tip. In the reaction lacking HMG2, a somewhat slower migrating band was
detected (lane 2, arrowhead).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
RAG-mediated hairpin nicking in Mg2+ after
V(D)J cleavage. (A) Diagram indicating possible coding-end products
detectable after RAG-mediated cleavage of pJH299, digestion of DNA with
HinfI, denaturing PAGE, Southern blotting, and hybridization
with a lower-strand-specific oligonucleotide probe. Site of
HinfI cleavage, location of probe, and 12- and 23-RSSs
(triangles) are indicated. (B) Southern blot showing products detected
by denaturing PAGE (as diagrammed in panel A) after cleavage of pJH299
with the RAG proteins in the absence (arrowhead) and presence (large
arrow) of HMG2. A DNA fragment (SmaI-digested pJH299) added
upon termination of the cleavage reaction to ensure equal DNA recovery
during subsequent manipulations (C) and the intact hairpin (small
arrows) are also indicated. The asterisk marks a background band
present in all lanes. Control experiments indicate that the intact
131-nt hairpin is detected with approximately one-third the efficiency
of a linear control oligonucleotide, presumably due to self-reannealing
of the hairpin during or after transfer to the membrane. (C) Native
PAGE showing pJH299 23 coding ends detected by LMPCR. Products
resulting from T4 DNAP-treated coding ends from reactions containing
RAG proteins alone (large arrowhead), or RAG proteins plus HMG2 (arrow)
or coding ends not treated with T4 DNAP (small arrowheads), are
visible. A slower-migrating product resulting from the control DNA
fragment (C; small arrow) is also indicated. DNA products have been
detected by staining with SYBR Green.
|
|
After cleavage, RAG proteins generate open coding ends
predominantly with single-stranded extensions.
The structure of
the putative open coding ends was examined further by LMPCR assay. In
this assay, products of the cleavage reaction were treated with T4 DNAP
to blunt 5' or 3' overhangs, or left untreated, then ligated to a
blunt-ended, unphosphorylated linker, amplified with appropriate
primers, and analyzed by native PAGE. This analysis revealed
significantly greater amounts of product after T4 DNAP treatment
(Fig. 5C; compare lanes 4 and 5 with lanes 2 and 3), indicating that
a substantial majority of the ends in the cleavage reactions
contained overhangs. In addition, with T4 DNAP-treated samples, the
presence of HMG2 in the cleavage reaction resulted in a more rapidly
migrating LMPCR product (compare lanes 4 and 5), consistent with the
different-sized products seen in lanes 2 and 4 of Fig. 5B.
Coding-end LMPCR products are consistent with RAG proteins nicking
precisely at or a few nucleotides 5' to the hairpin tip.
Cloning
and sequencing of the LMPCR products revealed that the majority of
blunt-ended molecules generated during the cleavage reaction terminated
precisely at the last nucleotide of the coding flank (Fig.
6A,
T4 samples; Table
1). This structure is consistent with
nicking at the tip of the coding-end hairpin. In T4 DNAP-treated samples, the presence of HMG2 in the cleavage reaction strongly influenced the structure of the products obtained (Fig. 6A, +T4 samples; Table 1). In the absence of HMG2, the dominant product contained the entire heptamer attached to the coding end, indicative of
aberrant cleavage inside the 23-RSS. This explains the slower mobility
of the products observed in the absence of HMG2 by Southern blotting
(Fig. 5B, lane 2) and LMPCR (Fig. 5C, lane 4). Cleavage inside the RSS
has been observed in previous studies, both in vivo and in vitro
(27, 38, 46, 54). With HMG2 present, such events were much
less frequent, and instead, ends with 1- or 2-bp palindromic extensions
were the major products (Fig. 6A, bottom; Table 1). Such ends are
likely the result of asymmetric nicking of the hairpin coding end to
generate a 5' overhang that was then filled in by T4 DNAP (3' overhangs
would be removed by T4 DNAP, resulting in deletions rather than
additions). Thus, when coupled cleavage occurs under optimal conditions
(RAG1, RAG2, HMG2, Mg2+), the RAG proteins open the
resulting hairpin coding ends at a variety of sites at or close to the
hairpin tip.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 6.
Sequences of LMPCR products derived from RAG-mediated
cleavage of plasmid substrates in Mg2+. The top line shows
the sequence of the coding flank (uppercase) and RSS (lowercase) from
5' to 3', with the heptamer underlined. The site of precise cleavage is
indicated with an arrow. LMPCR was performed either before ( T4) or
after (+T4) blunting of ends with T4 DNAP. Products of RAG (top half)
or RAG-plus-HMG2 (bottom half) cleavage are displayed, with palindromic
(boldface and underlined) and untemplated (italics) nucleotide
additions indicated. The number of occurrences is indicated to the
right of each sequence. The sizes of deletions and RSS extensions
exceeding 10 bp are indicated with negative and positive numbers,
respectively. (A) Data for the 23 coding end of pJH299, derived from
LMPCR products from the experiment shown in Fig. 5. (B) Data for
V 21C (which is flanked by a 12-RSS) of pJ2VIS6.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Summary of LMPCR coding-end sequences resulting from
RAG-mediated hairpin opening after V(D)J cleavage of
plasmid substrates
|
|
Open coding ends are detected in the context of RAG-mediated,
12/23-regulated cleavage of Ig
locus coding elements and their
flanking RSSs.
We then extended these analyses to coding ends
derived from murine V
21C and J
1 gene segments. In
Mn2+, synthetic hairpins representing these coding ends
were nicked 5' of the hairpin tip by the RAG proteins (data not shown).
In Mg2+, hairpin nicking after coupled cleavage was
assessed by Southern blotting and LMPCR using a plasmid containing the
endogenous J
1 and V
21C gene segments and flanking RSSs. The
results resembled those obtained for the pJH299 23-coding end: with
HMG2, a significant proportion (10 to 30%) of hairpin coding ends were
opened; opening appeared to occur at or near the hairpin tip; and the
great majority of opened coding ends contained an overhang (Fig. 6,
Table 1, and data not shown). Cloning and sequencing of the LMPCR
products revealed that for V
21C (flanked by a 12-RSS), full-length
coding ends were the predominant blunt-ended species (
T4
samples), while coding ends containing 1- or 2-nt palindromic
extensions were most common after T4 DNAP treatment (+T4 samples; Fig.
6B and Table 1). HMG2 had little effect on the pattern of hairpin
opening at this coding end, and cleavage inside the RSS was very rare. For J
1, cleavage inside its flanking 23-RSS was frequent in the absence of HMG2, while with HMG2 added, the previously observed pattern
of blunt full-length coding ends (
T4) and an increase in the
percentage of ends with short palindromic extensions (+T4) was
again observed (Table 1 and data not shown).
 |
DISCUSSION |
Our data support a new model for V(D)J recombination in which the
RAG proteins function as a regulated endonuclease that nicks hairpin
coding ends in the context of a postcleavage complex and thereby serve
to couple the cleavage and end-joining stages of the reaction. Since
nicking of free hairpins by the RAG proteins does not occur in
Mg2+, it is unlikely that the open coding ends that we
observe in the context of coupled V(D)J cleavage derive from hairpin
ends that have been released from this complex. While the complex in which Mg2+-based hairpin opening occurs has not been
determined, it may well coincide with the recently identified cleaved
signal complex thought to contain two coding ends and two signal ends
(20). Several pieces of data support the idea that the RAG
proteins are associated with a pair of signal ends during hairpin
nicking. First, they bind tightly to pairs of, but not individual,
signal ends (2, 20). Second, they bind more tightly to
signal ends than coding ends (2, 20). Third, we and Besmer
et al. (5) observe hairpin nicking in Mg2+
exclusively after cleavage at a pair of RSSs. The requirement for a
postcleavage complex in RAG-mediated hairpin nicking provides a
mechanism for regulating and targeting this nuclease activity. Further,
we predict that in the postcleavage complex, nicking activity is
directed to coding ends rather than signal ends for two reasons. First,
signal ends may be protected by stably bound RAG proteins. Second, the
active site may be oriented such that it predominantly contacts and
cleaves DNA at the heptamer-coding flank border or nearby coding end
hairpins, but not the signal ends to which these proteins are bound.
While our results of hairpin nicking by RAG proteins are consistent
with those of Besmer et al. (5), some important differences are evident. In our experiments, nicking of synthetic hairpins occurs 5 nt 5' of the hairpin tip, with other sites of nicking more distant from
the tip. Nicking at the distant sites is suppressed in the presence of
HMG2. In the experiments of Besmer et al., nicking by RAG proteins in
Mn2+ occurs 2, 3, and 4 nt 5' of the tip. A second
difference is seen in experiments with nonhairpin, linear DNA
substrates, in which we observe nicking 5 nt from the 3' end whereas
Besmer et al. observe a 2-nt 3' end processing activity. Both of these
differences may relate to substrate sequence differences, which could
influence single-stranded DNA character at the hairpin tip or
protein-DNA interactions. The nicking of hairpins by other
single-strand-specific nucleases is influenced by the terminal 4 nt at
the hairpin tip and loose nucleotide preferences exist for different
nucleases (23). We note that nicking 2 nt from the 3' end
may also be occurring in our reactions with linear DNA substrates, but
the product would not be well resolved from the input substrate (Fig. 3A, lanes 4 and 5).
A notable difference between our experiments and those of Besmer et al.
(5) is that in their reactions involving 12/23-regulated cleavage with oligonucleotide substrates in Mg2+, the 23 coding end shows nicking exclusively at the hairpin tip (opening of the
12 coding end was not analyzed). In our reactions with plasmid
substrates, both the 12 and 23 coding ends frequently exhibit 1- or
2-nt 5' extensions, indicative of nicking 5' of the hairpin tip. One
explanation for the difference might be the use of different
preparations of RAG proteins (MH-RAGs in our experiments; GST-RAGs in
those of Besmer et al.). In support of this possibility, initial
experiments reveal that in the context of coupled cleavage of our
plasmid substrates, purified GST-RAG proteins, similar to those used by
Besmer et al., preferentially nick coding-end hairpins at the tip (data
not shown). It is possible that the GST moiety sterically interferes
with the ability of the RAG proteins to nick the hairpin
asymmetrically. Alternatively, since GST can dimerize, the postcleavage
complex formed after GST-mediated dimerization of RAG proteins may
differ structurally from that formed by RAG proteins lacking these
tags. In vivo, the processing of coding ends is influenced by DNA
sequence, and so sequence differences in the hairpin ends analyzed may
also be relevant (reference 36 and references
therein). The hairpins generated by our cleavage reactions contain
5'-ATCC, CTCC, and CCAC at their termini, compared to 5'-CCTA for the
23 coding end in the study of Besmer et al. Systematic analysis of a
variety of hairpins generated by cleavage will help to elucidate
possible sequence preferences for RAG-mediated hairpin nicking.
Finally, the use of DNA substrates with different structures (plasmid
versus oligonucleotide) might also contribute to differences observed in the two systems. The short palindromic extensions that we observe in
the context of V(D)J cleavage (usually 1 to 2 nt in length) are
consistent with the short stretches of P nucleotides (very often 1 to 2 bp in length) inserted in a significant percentage of V(D)J coding
joints in vivo (28, 34). Thus, our data uniquely suggest
that P nucleotides are generated by the RAG proteins.
The mechanism by which HMG2 constrains nicking of synthetic hairpins to
a site near the hairpin tip is unclear, but it is unlikely to be due to
nonspecific binding and protection of the DNA because at the
concentration of HMG2 used (125 nM), it binds poorly to linear duplex
DNA (7). Furthermore, addition of purified Ku protein, which
can bind DNA ends and translocate to internal positions
(11), inhibits nicking at all sites of the hairpin substrate
equally (data not shown). Finally, nicking of DNA duplex substrates is
not similarly influenced by HMG2. It is possible that HMG2 exerts its
influence by virtue of its interaction with RAG1 (3, 40) and
its higher affinity for distorted DNA structures (7), such
as hairpins (6). Current evidence suggests that hairpin
coding ends are usually opened within a few base pairs of the hairpin
tip in vivo (28, 31, 36, 46), and hence this function of
HMG2 may be significant during V(D)J recombination. The requirement for
HMG2 in stimulating properly targeted RSS cleavage of plasmid
substrates, and suppressing inappropriate cleavage at the 23-RSS but
not the 12-RSS, is interesting in light of its selective enhancement of
binding and cleavage at the 23-RSS (44, 50).
It is clear that vertebrate cells contain factors in addition to RAG1
and RAG2 that are capable of processing DNA hairpins (4, 29,
48). For example, the ubiquitous DNA double-strand break repair
factor Mre11 can nick hairpin DNA and promote homology-mediated ligation of DNA ends in vitro (37). RAG1 and RAG2 appear to be in direct physical contact with hairpin coding ends after cleavage (20), and our data demonstrate that they can nick perfect
hairpins. It is therefore plausible that they are responsible for some
or all hairpin opening during V(D)J recombination. Processing of coding
end hairpins by the RAG proteins might enhance subsequent recruitment
and/or activation of general DNA repair factors, perhaps by altering
the structure of the postcleavage complex. In addition, RAG
protein-mediated coding-end processing raises the possibility that
V(D)J end joining and general NHEJ involve somewhat distinct mechanisms.
These findings extend the mechanistic parallels noted between DNA
cleavage in V(D)J recombination and bacterial transposition (1,
22, 35, 52). Tn10 transposase cleaves DNA by
sequential hydrolysis (nicking) and strand transfer (hairpin formation)
reactions, followed by nicking of the hairpin at its tip
(24), and our data indicate that DNA cleavage by the RAG
proteins proceeds via a similar series of chemical reactions. One
principal difference in the reactions is that the RAG proteins can nick
the hairpin at a variety of sites, which could contribute to the
diversity of coding junctions and hence of the encoded antigen
receptors. RAG-mediated hairpin nicking does not occur in
Ca2+ and so in this respect more closely resembles
RAG-mediated RSS nicking than RAG-mediated transposition (21,
22). A single bifunctional active site appears to mediate nicking
and strand transfer by Tn10 transposase (8), and
it is tempting to think that RSS nicking, hairpin formation, and
hairpin nicking during V(D)J recombination similarly involve a single
active site. This possibility is supported by the finding that
mutations in RAG1 or RAG2 that interfere with cleavage also disrupt
nicking of synthetic hairpins in Mn2+ (5). It
will be important to determine whether, in the context of regulated
cleavage in Mg2+, RSS nicking and hairpin nicking involve
the same active site.
Recently it was shown that the RAG proteins are capable in vitro of
mediating open-shut and hybrid joint formation using the 3'OH of
cleaved signal ends as a nucleophile to attack the coding-end hairpin
in a reaction which is the reverse of the V(D)J cleavage reaction
(35). The hairpin nicking reactions that we observe may
proceed by a similar mechanism but with water as the nucleophile to
hydrolyze hairpin DNA. It remains to be proven that this mechanism operates in vivo to open hairpin coding ends or to form hybrid joints.
Two observations must be reconciled with our results and those of
Besmer et al. and with the hypothesis that the RAG proteins open
hairpin coding ends in vivo. First, a majority of the rare coding ends
detected in normal lymphoid precursors have 3' overhangs and show
nucleotide deletion, in contrast to the 5' overhangs that we detect in
vitro (31, 46). However, the coding ends detected in vivo
may have undergone additional processing events after initial hairpin
nicking by RAG1 and RAG2. In addition, these coding ends may be
products that do not go on to form coding joints, although a
correlation was noted between the extent of deletion at coding ends and
the structure of coding joints (46). Second, cells deficient
in general DNA double-strand break repair proteins, such as DNAPK and
Ku80, are deficient in coding-joint formation and accumulate hairpin
coding-end intermediates, despite expression of RAG1 and RAG2 (15,
41, 55). Our results indicate that general repair proteins are
not required for hairpin opening under the simplified conditions of our
in vitro experiments. However, such factors may be necessary to
regulate the extent and sites of RAG-mediated hairpin opening in vivo.
They might do so directly, by posttranslational modification of RAG1,
RAG2, or other proteins in the postcleavage complex or indirectly by
regulating the structure of the postcleavage complex and association of
the RAG proteins with coding ends.
 |
ACKNOWLEDGMENTS |
We thank Q. Eastman, I. Villey, D. Hesselein, A. Tevelev, E. Corbett, and K. K. Rodgers for work leading to and various
preparations of purified proteins from mammalian cells and bacteria, L. Ptaszek for individually expressed GST-RAG1 and GST-RAG2, G. Chu and O. Hammarsten for purified Ku proteins, M. Bianchi for helpful
discussions, A. Agrawal and A. Lee for helpful comments on the
manuscript, and the W. M. Keck Foundation Biotechnology Resource
Laboratory at Yale University for oligonucleotide synthesis and DNA sequencing.
This work was supported by a postdoctoral fellowship from the Arthritis
Foundation to P.E.S. and by grant AI32524 from the National Institutes
of Health to D.G.S. D.G.S. is an associate investigator of the
Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute and Section of Immunobiology, Yale University School of Medicine, 310 Cedar St., P.O. Box 208011, New Haven, CT 06520-8011. Phone: (203) 737-2255. Fax: (203) 737-1764 or (203) 737-1765. E-mail:
david.schatz{at}yale.edu.
 |
REFERENCES |
| 1.
|
Agrawal, A.,
Q. M. Eastman, and D. G. Schatz.
1998.
Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system.
Nature
394:744-751[Medline].
|
| 2.
|
Agrawal, A., and D. G. Schatz.
1997.
RAG1 and RAG2 form a stable post-cleavage synaptic complex with DNA containing signal ends in V(D)J recombination.
Cell
89:43-53[Medline].
|
| 3.
| Aidinis, V., S. Santagata, and M. E. Bianchi.
Personal communication.
|
| 4.
|
Akgün, E.,
J. Zahn,
S. Baumes,
G. Brown,
F. Liang,
P. Romanienko,
S. Lewis, and M. Jasin.
1997.
Palindrome resolution and recombination in the mammalian germ line.
Mol. Cell. Biol.
17:5559-5570[Abstract].
|
| 5.
|
Besmer, E.,
J. Mansilla-Soto,
S. Cassard,
D. J. Sawchuk,
G. Brown,
M. Sadofsky,
S. M. Lewis,
M. C. Nussenzweig, and P. Cortes.
1998.
Hairpin coding end opening is mediated by RAG1 and RAG2 proteins.
Mol. Cell
2:817-828[Medline].
|
| 6.
| Bianchi, M. Personal communication.
|
| 7.
|
Bianchi, M. E.,
M. Beltrame, and G. Paonessa.
1989.
Specific recognition of cruciform DNA by nuclear protein HMG1.
Science
243:1056-1059[Abstract/Free Full Text].
|
| 8.
|
Bolland, S., and N. Kleckner.
1996.
The three chemical steps of Tn10/IS10 transposition involve repeated utilization of a single active site.
Cell
84:223-233[Medline].
|
| 9.
|
Critchlow, S. E., and S. P. Jackson.
1998.
DNA end-joining: from yeast to man.
Trends Biochem. Sci.
23:394-398[Medline].
|
| 10.
|
Difilippantonio, M. J.,
C. J. McMahan,
Q. M. Eastman,
E. Spanopoulou, and D. G. Schatz.
1996.
RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination.
Cell
87:253-262[Medline].
|
| 11.
|
Dynan, W. S., and S. Yoo.
1998.
Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids.
Nucleic Acids Res.
26:1551-1559[Abstract/Free Full Text].
|
| 12.
|
Eastman, Q. M.,
T. M. J. Leu, and D. G. Schatz.
1996.
Initiation of V(D)J recombination in vitro obeying the 12/23 rule.
Nature
380:85-88[Medline].
|
| 13.
|
Frank, K. M.,
J. M. Sekiguchi,
K. J. Seidl,
W. Swat,
G. A. Rathbun,
H. L. Cheng,
L. Davidson,
L. Kangaloo, and F. W. Alt.
1998.
Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV.
Nature
396:173-177[Medline].
|
| 14.
|
Gao, Y.,
Y. Sun,
K. M. Frank,
P. Dikkes,
Y. Fujiwara,
K. J. Seidl,
J. M. Sekiguchi,
G. A. Rathbun,
W. Swat,
J. Wang,
R. T. Bronson,
B. A. Malynn,
M. Bryans,
C. Zhu,
J. Chaudhuri,
L. Davidson,
R. Ferrini,
T. Stamato,
S. H. Orkin,
M. E. Greenberg, and F. W. Alt.
1998.
A critical role for DNA end joining proteins in both lymphomagenesis and neurogenesis.
Cell
95:891-902[Medline].
|
| 15.
|
Gao, Y. J.,
J. Chaudhuri,
C. M. Zhu,
L. Davidson,
D. T. Weaver, and F. W. Alt.
1998.
A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for Ku in V(D)J recombination.
Immunity
9:367-376[Medline].
|
| 16.
|
Gilfillan, S.,
A. Dierich,
M. Lemeur,
C. Benoist, and D. Mathis.
1993.
Mice lacking TdT: mature animals with an immature lymphocyte repertoire.
Science
261:1175-1178[Abstract/Free Full Text].
|
| 17.
|
Grawunder, U.,
D. Zimmer,
S. Fugmann,
K. Schwarz, and M. R. Lieber.
1998.
DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes.
Mol. Cell
2:477-484[Medline].
|
| 18.
|
Gu, Y. S.,
K. J. Seidl,
G. A. Rathbun,
C. M. Zhu,
J. P. Manis,
N. Vanderstoep,
L. Davidson,
H. L. Cheng,
J. M. Sekiguchi,
K. Frank,
P. Stanhopebaker,
M. S. Schlissel,
D. B. Roth, and F. W. Alt.
1997.
Growth retardation and leaky scid phenotype of Ku70-deficient mice.
Immunity
7:653-665[Medline].
|
| 19.
|
Hesse, J. E.,
M. R. Lieber,
K. Mizuuchi, and M. Gellert.
1989.
V(D)J recombination: a functional definition of the joining signals.
Genes Dev.
3:1053-1061[Abstract/Free Full Text].
|
| 20.
|
Hiom, K., and M. Gellert.
1998.
Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination.
Mol. Cell
1:1011-1019[Medline].
|
| 21.
|
Hiom, K., and M. Gellert.
1997.
A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage.
Cell
88:65-72[Medline].
|
| 22.
|
Hiom, K.,
M. Melek, and M. Gellert.
1998.
DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations.
Cell
94:463-470[Medline].
|
| 23.
|
Kabotyanski, E. B.,
C. M. Zhu,
D. A. Kallick, and D. B. Roth.
1995.
Hairpin opening by single-strand-specific nucleases.
Nucleic Acids Res.
23:3872-3881[Abstract/Free Full Text].
|
| 24.
|
Kennedy, A.,
A. Guhathakurta,
N. Kleckner, and D. Haniford.
1998.
Tn10 transposition via a DNA hairpin intermediate.
Cell
95:125-134[Medline].
|
| 25.
|
Komori, T.,
A. Okada,
V. Stewart, and F. W. Alt.
1993.
Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes.
Science
261:1171-1175[Abstract/Free Full Text].
|
| 26.
|
Lafaille, J. J.,
A. DeCloux,
M. Bonneville,
Y. Takagaki, and S. Tonegawa.
1989.
Junctional sequences of T cell receptor gamma delta genes: implications for gamma delta T cell lineages and for a novel intermediate of V-(D)-J joining.
Cell
59:859-870[Medline].
|
| 27.
|
Leu, T. M. J.,
Q. M. Eastman, and D. G. Schatz.
1997.
Coding joint formation in a cell free V(D)J recombination system.
Immunity
7:303-314[Medline].
|
| 28.
|
Lewis, S. M.
1994.
The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses.
Adv. Immunol.
56:27-150[Medline].
|
| 29.
|
Lewis, S. M.
1994.
P nucleotide insertions and the resolution of hairpin DNA structures in mammalian cells.
Proc. Natl. Acad. Sci. USA
91:1332-1336[Abstract/Free Full Text].
|
| 30.
|
Lieber, M. R.
1991.
Site-specific recombination in the immune system.
FASEB J.
5:2934-2944[Abstract].
|
| 31.
|
Livàk, F., and D. G. Schatz.
1997.
Identification of V(D)J recombination coding end intermediates in normal thymocytes.
J. Mol. Biol.
267:1-9[Medline].
|
| 32.
|
McBlane, J. F.,
D. C. van Gent,
D. A. Ramsden,
C. Romeo,
C. A. Cuomo,
M. Gellert, and M. A. Oettinger.
1995.
Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps.
Cell
83:387-395[Medline].
|
| 33.
|
McCormack, W. T.,
L. W. Tjoelker,
L. M. Carlson,
B. Petryniak,
C. F. Barth,
E. H. Humphries, and C. B. Thompson.
1989.
Chicken IgL gene rearrangement involves deletion of a circular episome and addition of single nonrandom nucleotides to both coding segments.
Cell
56:785-791[Medline].
|
| 34.
|
Meier, J. T., and S. M. Lewis.
1993.
P nucleotides in V(D)J recombination: a fine structure analysis.
Mol. Cell. Biol.
13:1078-1092[Abstract/Free Full Text].
|
| 35.
|
Melek, M.,
M. Gellert, and D. C. van Gent.
1998.
Rejoining of DNA by the RAG1 and RAG2 proteins.
Science
280:301-303[Abstract/Free Full Text].
|
| 36.
|
Nadel, B., and A. J. Feeney.
1997.
Nucleotide deletion and P addition in V(D)J recombination: a determinant role of the coding-end sequence.
Mol. Cell. Biol.
17:3768-3778[Abstract].
|
| 37.
|
Paull, T. T., and M. Gellert.
1998.
The 3' to 5' exonuclease activity of Mre11 facilitates repair of DNA double-strand breaks.
Mol. Cell
1:969-979[Medline].
|
| 38.
|
Ramsden, D. A., and M. Gellert.
1995.
Formation and resolution of double-strand break intermediates in V(D)J rearrangement.
Genes Dev.
9:2409-2420[Abstract/Free Full Text].
|
| 39.
|
Ramsden, D. A.,
T. T. Paull, and M. Gellert.
1997.
Cell-free V(D)J recombination.
Nature
388:488-491[Medline].
|
| 40.
| Rodgers, K. K., I. J. Villey, E. Corbett,
D. G. Schatz, and J. E. Coleman. A dimer of RAG1
recognizes the recombination signal sequence and the complex stably
incorporates HMG2. Submitted for publication.
|
| 41.
|
Roth, D. B.,
J. P. Menetski,
P. B. Nakajima,
M. J. Bosma, and M. Gellert.
1992.
V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes.
Cell
70:983-991[Medline].
|
| 42.
|
Roth, D. B.,
C. M. Zhu, and M. Gellert.
1993.
Characterization of broken DNA molecules associated with V(D)J recombination.
Proc. Natl. Acad. Sci. USA
90:10788-10792[Abstract/Free Full Text].
|
| 43.
|
Santagata, S.,
V. Aidinis, and E. Spanopoulou.
1998.
The effect of Me2+ cofactors at the initial stages of V(D)J recombination.
J. Biol. Chem.
273:16325-16331[Abstract/Free Full Text].
|
| 44.
|
Sawchuk, D. J.,
F. Weis-Garcia,
S. Malik,
E. Besmer,
M. Bustin,
M. C. Nussenzweig, and P. Cortes.
1997.
V(D)J recombination: modulation of RAG1 and RAG2 cleavage activity on 12/23 substrates by whole cell extract and DNA bending proteins.
J. Exp. Med.
185:2025-2032[Abstract/Free Full Text].
|
| 45.
|
Schatz, D. G., and D. Baltimore.
1988.
Stable expression of immunoglobulin gene V(D)J recombinase activity by gene transfer into 3T3 fibroblasts.
Cell
53:107-115[Medline].
|
| 46.
|
Schlissel, M. S.
1998.
Structure of nonhairpin coding-end DNA breaks in cells undergoing V(D)J recombination.
Mol. Cell. Biol.
18:2029-2037[Abstract/Free Full Text].
|
| 47.
|
Spanopoulou, E.,
F. Zaitseva,
F.-H. Wang,
S. Santagata,
D. Baltimore, and G. Panayotou.
1996.
The homeodomain of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination.
Cell
87:263-276[Medline].
|
| 48.
|
Staunton, J. E., and D. T. Weaver.
1994.
Scid cells efficiently integrate hairpin and linear DNA substrates.
Mol. Cell. Biol.
14:3876-3883[Abstract/Free Full Text].
|
| 49.
|
Taccioli, G. E.,
A. G. Amatucci,
H. J. Beamish,
D. Gell,
X. H. Xiang,
M. I. T. Arzayus,
A. Priestley,
S. P. Jackson,
A. M. Rothstein,
P. A. Jeggo, and V. L. M. Herrera.
1998.
Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity.
Immunity
9:355-366[Medline].
|
| 50.
|
van Gent, D. C.,
K. Hiom,
T. T. Paull, and M. Gellert.
1997.
Stimulation of V(D)J cleavage by high mobility group proteins.
EMBO J.
16:2665-2670[Medline].
|
| 51.
|
van Gent, D. C.,
J. F. McBlane,
D. A. Ramsden,
M. J. Sadofsky,
J. E. Hesse, and M. Gellert.
1995.
Initiation of V(D)J recombination in a cell-free system.
Cell
81:925-934[Medline].
|
| 52.
|
van Gent, D. C.,
K. Mizuuchi, and M. Gellert.
1996.
Similarities between initiation of V(D)J recombination and retroviral integration.
Science
271:1592-1594[Abstract].
|
| 53.
|
van Gent, D. C.,
D. A. Ramsden, and M. Gellert.
1996.
The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination.
Cell
85:107-113[Medline].
|
| 54.
|
Weis-Garcia, F.,
E. Besmer,
D. J. Sawchuk,
W. Yu,
Y. Hu,
S. Cassard,
M. C. Nussenzweig, and P. Cortes.
1997.
V(D)J recombination: in vitro coding joint formation.
Mol. Cell. Biol.
17:6379-6385[Abstract].
|
| 55.
|
Zhu, C. M.,
M. A. Bogue,
D. S. Lim,
P. Hasty, and D. B. Roth.
1996.
Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates.
Cell
86:379-389[Medline].
|
Molecular and Cellular Biology, June 1999, p. 4159-4166, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rahman, N. S., Godderz, L. J., Stray, S. J., Capra, J. D., Rodgers, K. K.
(2006). DNA Cleavage of a Cryptic Recombination Signal Sequence by RAG1 and RAG2: IMPLICATIONS FOR PARTIAL VH GENE REPLACEMENT. J. Biol. Chem.
281: 12370-12380
[Abstract]
[Full Text]
-
Raghavan, S. C., Swanson, P. C., Ma, Y., Lieber, M. R.
(2005). Double-Strand Break Formation by the RAG Complex at the Bcl-2 Major Breakpoint Region and at Other Non-B DNA Structures In Vitro. Mol. Cell. Biol.
25: 5904-5919
[Abstract]
[Full Text]
-
Polyanichko, A. M., Andrushchenko, V. V., Chikhirzhina, E. V., Vorob'ev, V. I., Wieser, H.
(2004). The effect of manganese(II) on DNA structure: electronic and vibrational circular dichroism studies. Nucleic Acids Res
32: 989-996
[Abstract]
[Full Text]
-
Swanson, P. C., Volkmer, D., Wang, L.
(2004). Full-length RAG-2, and Not Full-length RAG-1, Specifically Suppresses RAG-mediated Transposition but Not Hybrid Joint Formation or Disintegration. J. Biol. Chem.
279: 4034-4044
[Abstract]
[Full Text]
-
Mansilla-Soto, J., Cortes, P.
(2003). VDJ Recombination: Artemis and Its In Vivo Role in Hairpin Opening. JEM
197: 543-547
[Full Text]
-
Rooney, S., Alt, F. W., Lombard, D., Whitlow, S., Eckersdorff, M., Fleming, J., Fugmann, S., Ferguson, D. O., Schatz, D. G., Sekiguchi, J.
(2003). Defective DNA Repair and Increased Genomic Instability in Artemis-deficient Murine Cells. JEM
197: 553-565
[Abstract]
[Full Text]
-
Swanson, P. C.
(2002). A RAG-1/RAG-2 Tetramer Supports 12/23-Regulated Synapsis, Cleavage, and Transposition of V(D)J Recombination Signals. Mol. Cell. Biol.
22: 7790-7801
[Abstract]
[Full Text]
-
Nakajima, P. B., Bosma, M. J.
(2002). Variable Diversity Joining Recombination: Nonhairpin Coding Ends in Thymocytes of SCID and Wild-Type Mice. J. Immunol.
169: 3094-3104
[Abstract]
[Full Text]
-
Tsai, C.-L., Drejer, A. H., Schatz, D. G.
(2002). Evidence of a critical architectural function for the RAG proteins in end processing, protection, and joining in V(D)J recombination. Genes Dev.
16: 1934-1949
[Abstract]
[Full Text]
-
Lee, G. S., Neiditch, M. B., Sinden, R. R., Roth, D. B.
(2002). Targeted Transposition by the V(D)J Recombinase. Mol. Cell. Biol.
22: 2068-2077
[Abstract]
[Full Text]
-
Swanson, P. C.
(2002). Fine Structure and Activity of Discrete RAG-HMG Complexes on V(D)J Recombination Signals. Mol. Cell. Biol.
22: 1340-1351
[Abstract]
[Full Text]
-
Yannoutsos, N., Wilson, P., Yu, W., Chen, H. T., Nussenzweig, A., Petrie, H., Nussenzweig, M. C.
(2001). The Role of Recombination Activating Gene (RAG) Reinduction in Thymocyte Development in Vivo. JEM
194: 471-480
[Abstract]
[Full Text]
-
Sadofsky, M. J.
(2001). The RAG proteins in V(D)J recombination: more than just a nuclease. Nucleic Acids Res
29: 1399-1409
[Abstract]
[Full Text]
-
Mo, X., Bailin, T., Sadofsky, M. J.
(2001). A C-Terminal Region of RAG1 Contacts the Coding DNA during V(D)J Recombination. Mol. Cell. Biol.
21: 2038-2047
[Abstract]
[Full Text]
-
Daniel, R., Katz, R. A., Merkel, G., Hittle, J. C., Yen, T. J., Skalka, A. M.
(2001). Wortmannin Potentiates Integrase-Mediated Killing of Lymphocytes and Reduces the Efficiency of Stable Transduction by Retroviruses. Mol. Cell. Biol.
21: 1164-1172
[Abstract]
[Full Text]
-
Williams, C. J., Grandal, I., Vesprini, D. J., Wojtyra, U., Danska, J. S., Guidos, C. J.
(2001). Irradiation Promotes V(D)J Joining and RAG-Dependent Neoplastic Transformation in SCID T-Cell Precursors. Mol. Cell. Biol.
21: 400-413
[Abstract]
[Full Text]
-
Swanson, P. C.
(2001). The DDE Motif in RAG-1 Is Contributed in trans to a Single Active Site That Catalyzes the Nicking and Transesterification Steps of V(D)J Recombination. Mol. Cell. Biol.
21: 449-458
[Abstract]
[Full Text]
-
Kale, S. B., Landree, M. A., Roth, D. B.
(2001). Conditional RAG-1 Mutants Block the Hairpin Formation Step of V(D)J Recombination. Mol. Cell. Biol.
21: 459-466
[Abstract]
[Full Text]
-
Santagata, S., Gomez, C. A., Sobacchi, C., Bozzi, F., Abinun, M., Pasic, S., Cortes, P., Vezzoni, P., Villa, A.
(2000). N-terminal RAG1 frameshift mutations in Omenn's syndrome: Internal methionine usage leads to partial V(D)J recombination activity and reveals a fundamental role in vivo for the N-terminal domains. Proc. Natl. Acad. Sci. USA
97: 14572-14577
[Abstract]
[Full Text]
-
Livak, F., Burtrum, D. B., Rowen, L., Schatz, D. G., Petrie, H. T.
(2000). Genetic Modulation of T Cell Receptor Gene Segment Usage during Somatic Recombination. JEM
192: 1191-1196
[Abstract]
[Full Text]
-
Klonowski, K. D., Monestier, M.
(2000). Heavy Chain Revision in MRL Mice: A Potential Mechanism for the Development of Autoreactive B Cell Precursors. J. Immunol.
165: 4487-4493
[Abstract]
[Full Text]
-
Gomez, C. A., Ptaszek, L. M., Villa, A., Bozzi, F., Sobacchi, C., Brooks, E. G., Notarangelo, L. D., Spanopoulou, E., Pan, Z. Q., Vezzoni, P., Cortes, P., Santagata, S.
(2000). Mutations in Conserved Regions of the Predicted RAG2 Kelch Repeats Block Initiation of V(D)J Recombination and Result in Primary Immunodeficiencies. Mol. Cell. Biol.
20: 5653-5664
[Abstract]
[Full Text]
-
Agard, E. A., Lewis, S. M.
(2000). Postcleavage Sequence Specificity in V(D)J Recombination. Mol. Cell. Biol.
20: 5032-5040
[Abstract]
[Full Text]
-
Aidinis, V., Dias, D. C., Gomez, C. A., Bhattacharyya, D., Spanopoulou, E., Santagata, S.
(2000). Definition of Minimal Domains of Interaction Within the Recombination-Activating Genes 1 and 2 Recombinase Complex. J. Immunol.
164: 5826-5832
[Abstract]
[Full Text]
-
Landree, M. A., Wibbenmeyer, J. A., Roth, D. B.
(1999). Mutational analysis of RAG1 and RAG2 identifies three catalytic amino acids in RAG1 critical for both cleavage steps of V(D)J recombination. Genes Dev.
13: 3059-3069
[Abstract]
[Full Text]
-
Binnie, A., Olson, S., Wu, G. E., Lewis, S. M.
(1999). Gamma-Irradiation Directly Affects the Formation of Coding Joints in SCID Cell Lines. J. Immunol.
163: 5418-5426
[Abstract]
[Full Text]
-
Yu, W., Misulovin, Z., Suh, H., Hardy, R. R., Jankovic, M., Yannoutsos, N., Nussenzweig, M. C.
(1999). Coordinate Regulation of RAG1 and RAG2 by Cell Type-Specific DNA Elements 5' of RAG2. Science
285: 1080-1084
[Abstract]
[Full Text]
-
GELLERT, M., HESSE, J.E., HIOM, K., MELEK, M., MODESTI, M., PAULL, T.T., RAMSDEN, D.A., VAN GENT, D.C.
(1999). V(D)J Recombination: Links to Transposition and Double-strand Break Repair. Cold Spring Harb Symp Quant Biol
64: 161-168
[Abstract]
-
Arbuckle, J. L., Fauss, L. J., Simpson, R., Ptaszek, L. M., Rodgers, K. K.
(2001). Identification of Two Topologically Independent Domains in RAG1 and Their Role in Macromolecular Interactions Relevant to V(D)J Recombination. J. Biol. Chem.
276: 37093-37101
[Abstract]
[Full Text]