Instituto de Microbiología
Bioquímica del CSIC/Universidad de Salamanca, 37007 Salamanca,
Spain,1 and Section on Molecular
Genetics of Lower Eukaryotes, Laboratory of Molecular Genetics,
National Institute of Child Health and Human Development, Bethesda,
Maryland 208922
Received 30 October 1998/Returned for modification 23 December
1998/Accepted 3 March 1999
 |
INTRODUCTION |
Eukaryotic cells respond to
different conditions of starvation and stress by down-regulating the
rates of protein biosynthesis. One aspect of this response in mammalian
cells involves phosphorylation on serine 51 of the alpha subunit of
translation initiation factor 2 (eIF2
) (53). This
phosphorylation event reduces the activity of eIF2B, the guanine
nucleotide exchange factor for eIF2 that recycles eIF2-GDP to the
active form eIF2-GTP (20, 40, 46, 59). Only eIF2-GTP can
bind initiator methionyl-tRNA (tRNAiMet) to produce the
eIF2-GTP-tRNAiMet ternary complex that delivers
initiator tRNA to the 43S preinitiation complex; thus, phosphorylation
of eIF2 inhibits general protein synthesis initiation. In the budding
yeast Saccharomyces cerevisiae, eIF2
becomes
phosphorylated when cells are deprived of an amino acid or purine,
leading to depletion of ternary complex levels, just as occurs in
mammalian cells (19, 31). Interestingly, it also
specifically stimulates translation of the distinctive mRNA encoding
Gcn4p, a transcriptional activator of more than 40 genes involved in
amino acid biosynthesis (29), thereby alleviating the
nutrient limitation conditions that trigger phosphorylation of eIF2
in yeast.
The molecular mechanism that couples GCN4 translation to
amino acid availability has been explored in great detail over past several years (reviewed in references 31 and
32). Four short upstream open reading frames (uORFs)
present in the GCN4 mRNA leader sequence prevent ribosomes
from initiating translation at the GCN4 start codon under
conditions of amino acid sufficiency. Amino acid starvation triggers
activation of the protein kinase Gcn2p, which phosphorylates eIF2
and thereby inhibits eIF2-GTP-tRNAiMet ternary complex
formation. This situation specifically favors GCN4
translation because, after translating uORF1, many ribosomes cannot
acquire the ternary complex in time to recognize the start codons at
uORF2, -3, and -4 and thus continue scanning downstream. The majority
of these ribosomes rebind the ternary complex by the time they reach
the GCN4 AUG codon and reinitiate there instead (19,
20).
Recessive mutations in any of the genes encoding the four essential
subunits of eIF2B, GCD1, GCD2, GCD6,
and GCD7, mimic the effects of eIF2 phosphorylation and
derepress GCN4 mRNA translation in the absence of Gcn2p and
amino acid starvation (29, 30). These gcd
mutations also lead to unconditional slow growth or temperature
sensitivity on nutrient-rich medium, phenotypes that result from
defects in general translation initiation (9, 16, 22, 27).
It is thought that gcd1, gcd2, gcd6,
and gcd7 mutations impair the ability of eIF2B to recycle
eIF2-GDP to eIF2-GTP and thereby decrease the rate of ternary complex
formation in vivo (31, 46). This causes lower rates of
translation initiation on most mRNAs but leads to increased translation
of GCN4 mRNA, which is inversely coupled to the availability
of ternary complexes in the cell (20).
Recessive mutations in GCD10 also lead to
temperature-sensitive growth and constitutive derepression of
GCN4 translation in the absence of Gcn2p (26,
42). GCD10 is an essential gene and was shown to
encode a 62-kDa protein that copurified and coimmunoprecipitated with
subunits of eIF3 (23). eIF3 stimulates several steps of the
initiation pathway in mammalian cells (among others, binding of ternary
complexes to 40S ribosomes [47]). Accordingly, we proposed that gcd10 mutations might derepress
GCN4 translation by decreasing the ability of eIF3 to
promote rebinding of ternary complexes to 40S subunits that have
translated uORF1 and continued scanning downstream on the
GCN4 mRNA leader. This would allow these subunits to skip
uORF4 and reinitiate translation at the GCN4 AUG without any
reduction in the level of ternary complex formation (23).
More recently, we found that gcd10 mutations reduce the
expression of mature tRNAiMet at a posttranscriptional
step and that the phenotypes of gcd10 mutants are suppressed
by multiple copies of the genes IMT1 to IMT4,
encoding tRNAiMet (3). Interestingly,
gcd10 mutants lack 1-methyladenosine (m1A) at
position 58 in tRNAiMet and in all other tRNAs (17 or
more) containing this modified base. The absence of m1A
seems to impair specifically the expression of mature
tRNAiMet through degradation of the unprocessed
precursors containing 5' and 3' extensions (3). The
reduction in mature tRNAiMet levels in gcd10
mutants should diminish ternary complex formation, decreasing the rate
of general translation initiation and producing constitutive
derepression of GCN4 translation (20). Thus, the impaired maturation of tRNAiMet can also explain the
known phenotypes of gcd10 mutants (3).
We previously identified GCD14 and GCD15 as novel
genes in S. cerevisiae that are required for translational
repression of GCN4 mRNA under amino acid-replete conditions
(17). Here we report the molecular cloning of
GCD14 and show that it encodes an essential protein
containing binding motifs for S-adenosylmethionine (S-AdoMet). We found that gcd14 mutants have reduced levels
of mature tRNAiMet and accumulate
tRNAiMet precursors containing 5' and 3' extensions.
Similar to the case for gcd10 mutants, the presence of
IMT1 to IMT4 in high copy number suppresses the
phenotypes of gcd14-1 and gcd14-2 mutants, and overexpression of IMT4 overcomes the lethality of a
gcd14::URA3 deletion. Gcd14p is physically
associated with Gcd10p in cell extracts (3), and we observed
additive effects of gcd14 and gcd10 mutations on
cell growth and expression of mature tRNAiMet.
Interestingly, we found that gcd14 mutations also lead to
reduced expression of other tRNAs and the RNA components of RNases P
(38) and MRP (54) when combined with a deletion
of LHP1, encoding a yeast homologue of the human autoantigen
La. These findings and others (3) suggest that Gcd10p and
Gcd14p functionally cooperate with Lhp1p to promote the maturation of a
subset of RNA polymerase III transcripts.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmids constructed in this work are represented
in Fig. 1. Plasmid pRC5 was isolated from
a yeast genomic library in the low-copy-number vector YCp50
(51) by selecting for complementation of the
3-amino-1,2,4-triazol resistance (3ATr) and
Slg
phenotypes of strain Hm316 (gcd14-2).
Plasmids pRC55 and pRC56 contain, respectively, the 2.3-kb
XbaI and the 2.8-kb SpeI-ClaI fragments from pRC5 subcloned into the corresponding sites of pRS316
(56).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of the GCD14 coding region. A
partial restriction map of the GCD14 region is shown in the
center, indicating the positions of the two ORFs, GCD14 and
SPT10 (44), identified in the plasmid isolated
from the genomic library bearing GCD14 (pRC5). The direction
of transcription is indicated by the arrows. The top line depicts the
genomic DNA insert in pRC5, and below that are depicted the fragments
present in subclones constructed from pRC5 in low-copy-number vector
pRS316 (pRC55 and pRC56). The ability of each subclone to complement
the phenotypes of gcd14-1 and gcd14-2 mutants is
shown on the right. Below the map of the GCD14 region are
shown enlargements of the 2.6-kb SpeI-ClaI region
in plasmid pRC56 and of the 3.2-kb SpeI-ClaI
region in pRC560 bearing the gcd14::URA3 allele,
in which a 1.1-kb URA3 fragment replaces ~730 bp of the
GCD14 coding sequence. Restriction enzyme sites: B,
BamHI; Bg, BglII; C, ClaI; H,
HindIII; Hp, HpaI; S, Sau3A; X,
XbaI; Sp, SpeI.
|
|
Plasmid pRC56 was digested with HpaI and BglII to
delete an internal 730-bp fragment of the GCD14 coding
sequence, and the BglII end was filled in with Klenow
fragment. The resulting linearized plasmid was ligated to a blunt-ended
1.1-kb HindIII-HindIII fragment containing the URA3 gene, generating pRC560.
Plasmid pRC57 was generated by subcloning into pRS306 a ~2.8-kb
HpaI-BamHI fragment from pRC5, extending from 1 kb upstream of the GCD14 ATG to ~30 nucleotides 5' of the
stop codon. Plasmids pRC64 and pRC65 were constructed as follows. (i)
The 2.8-kb SpeI-ClaI fragment from pRC56 was
cloned into the corresponding sites of the SK+ polylinker of Bluescript
M13+ (Stratagene), generating plasmid pRC6. (ii) A NotI site
was introduced upstream of the GCD14 stop codon by in vitro
mutagenesis with a MUTA-GENE in vitro mutagenesis kit (Bio-Rad), using
plasmid pRC6 and an oligonucleotide (RC 22) containing a
NotI site
(5'CGATCCACGGAAAAACGCGGCCGCTAATTAAATGATTAAC3'; the NotI site is underlined, and the GCD14 stop
codon is in boldface). The resulting plasmid was named pRC61. (To avoid
methylation of the ClaI site located downstream of the
GCD14 gene in plasmid pRC61, it was always amplified in the
dam mutant Escherichia coli strain GM119.) (iii)
A 2.4-kb ClaI fragment containing all of the
GCD14 coding sequences was subcloned in YCp50 or in the
high-copy-number YEp24 vector (50), generating plasmids
pRC62 and pRC63, respectively. (iv) A 115-bp NotI fragment,
encoding three in-tandem copies of the hemagglutinin (HA) epitope, was
inserted at the NotI site in pRC62 and pRC63, to create
plasmids pRC64 and pRC65, respectively. Sequence analysis confirmed the
in-frame insertion of the HA-coding sequence just upstream of the
GCD14 stop codon.
A 670-bp HpaI-EcoRI fragment from the 3' coding
region of the GCD14 gene was fused in frame to the
trpE coding sequence in pATH2 (21) to generate
pTRPC14. Construction of the correct in-frame fusion was confirmed by
DNA sequencing.
Plasmid pJA128 was constructed by inserting the ca. 3.5-kb
XbaI-XhoI fragment bearing GCD10 from
pMG107 (23) into YCplac111 (24). Plasmid pJA103,
containing the
lhp1::hisG::URA3::hisG allele,
was constructed by PCR amplification of 200- and 350-bp fragments
containing, respectively, the 5' and 3' flanking sequences at
LHP1 by using the appropriate primers. The 5' PCR product
was digested with EcoRI and BglII and cloned into
EcoRI- and BglII-digested pNKY51 (1)
to create pJA103'. The 3' PCR product was digested with
BamHI and SphI and cloned into BamHI-
and SphI-digested pJA103' to create pJA103.
All other plasmids used in this work have been previously described:
pE107 (GCD10) (23); p1775 (IMT4)
(20); p2632 (IMT1), p2633 (IMT2),
p2634 (IMT3), p2635 (IMT4), and
p2626(LHP1) (3); pNK985 (1); pRS315
(56); pRS426 (13); and pKOIII (60).
Yeast strain constructions.
The genotypes and origins of all
yeast strains used in this study are summarized in Table
1. Strains Hm295 (gcd14-1),
Hm296 (gcd14-2), and Hm316 (gcd14-2) were
selected as 3ATr and Slg
ascospores from
genetic crosses previously described (17). Isogenic Hm296G
and Hm296g strains were obtained by transforming Hm296 to
Ura+ with the integrating plasmid pRC57, containing an
incomplete copy of GCD14. Depending on the location of the
crossover, integration of pRC57 yielded a nontandem duplication of
wild-type GCD14 and the truncated gcd14 allele,
or the gcd14-2 and truncated gcd14 alleles,
separated by plasmid sequences. The former (in Hm296G) led to a
3AT-sensitive phenotype, whereas the latter (in Hm296g) conferred 3AT
resistance.
A 3.2-kb SpeI-ClaI fragment from pRC560
containing gcd14::URA3 was used for one-step gene
disruptions (52) of one of the two GCD14 alleles
in diploid strain YRC1 or YRC2, constructed by crossing Hm316 with H753
and F104 with F105, respectively (Table 1). Total DNA was isolated from
Ura+ transformants and analyzed by Southern blotting to
verify that replacement by the null allele was successful. Heterozygous
GCD14/gcd14::URA3 or
gcd14/gcd14::URA3 diploids were sporulated, and
tetrad analysis was conducted as described in Results.
The diploid strain YNG1 was constructed by crossing W3031A
(ura3-52 leu2-3,112) with W3031B (ura3-52
leu2-3,112) (Table 1). One allele of GCD14 in YNG1 was
replaced by gcd14::URA3 (as described above), and
a Ura+ Leu
heterozygous GCD14/
gcd14::URA3 diploid was transformed with the
high-copy-number LEU2 plasmid p1775 containing
IMT4 (20). A Leu+ diploid
transformant was sporulated, and tetrad analysis was conducted with the
following results: a 4:0 segregation for viability was observed in
ascospores of 7 tetrads of 12 analyzed, showing that p1775
(IMT4) rescued the lethality of a
gcd14::URA3 deletion.
To construct strain Hm397, a gcd10-505 gcd14-2 ascospore
clone was isolated from a tetratype tetrad obtained from a cross between Hm296 and Hm298 (23). The genotypes of all four
ascopore clones from this tetrad were transformed with empty vectors or low-copy-number plasmids containing GCD10 or
GCD14, followed by phenotype testing of the transformants.
The LEU2 gene was disrupted in the gcd10-504
gcd14-2 strain by transforming it with a 6.5-kb BglII
fragment from pNK985 (1), containing the 3.8-kb
hisG::URA3::hisG cassette inserted at
the EcoRI site of the LEU2 gene, and
Leu
Ura+ transformants were selected. The
transformants were plated on SD medium containing 1 mg of
5-fluoro-orotic acid (5-FOA) per ml (6) to select the
Ura
derivative Hm397 (see Table 1 for genotypes). Hm397
was transformed with low-copy-number plasmids containing
GCD10 (pJA128), GCD14 (pRC56), or empty vectors
(pRS315 or pRS316) to generate the isogenic transformants with the
genotypes GCD10 gcd14-2 (Hm420), gcd10-505 GCD14
(Hm421), GCD10 GCD14 (Hm422), and gcd10-505
gcd14-2 (Hm423).
LHP1 was replaced in GCD14 and gcd14
strains with a null allele in which the coding sequence was completely
replaced with LEU2 (60) as follows. A
Ura
derivative of strain H117 was selected in 5-FOA
medium, and this strain, named YNG174 (GCD14), along with
Hm295 (gcd14-1) and Hm296 (gcd14-2), was
transformed with the 6.5-kb BglII fragment from pNK985
(1) described above to disrupt the LEU2 gene in
each strain with hisG::URA3::hisG
sequences. Leu
Ura+ transformants were
selected and transformed with a 4.6-kb SalI-XbaI fragment from pKOIII (60) containing the null allele
lhp1::LEU2. Total RNA was isolated from
Leu+ transformants and analyzed by Northern blotting to
verify the absence of LHP1 mRNA in isogenic strains Hm406
(GCD14 lhp1::LEU2), Hm407 (gcd14-1
lhp1::LEU2), and Hm408 (gcd14-2
lhp1::LEU2).
Strain JAy113 was constructed by transforming H1515 (MATa
ura3-52 leu2-3,112 trp1
63) to Ura+ with a
4.3-kb SphI/EcoRI fragment isolated from pJA103
containing lhp1::hisG::URA3::hisG.
Disruption of LHP1 was confirmed by PCR amplification of
fragments diagnostic of
lhp1::hisG::URA3::hisG from
JAy113 genomic DNA. Strain JAy206 was constructed by transforming JAy143 (3) to Leu+ with pJA128, bearing
single-copy GCD10 and LEU2, and a stable Ura
derivative exhibiting wild-type growth was isolated
on medium containing 1 mg of 5-FOA per ml (6).
Media and genetic techniques.
Sensitivity to 3AT (Sigma;
catalog no. A8056) was tested as previously described (28).
Transformation of yeast strains was carried out as described by Ito et
al. (34). Standard genetic techniques and media were as
previously described (55).
Chromosomal mapping of GCD14.
GCD14 was
physically mapped to chromosome X by using a Chromo-Blot (Clontech), in
which yeast chromosomes were fractionated by clamped homogeneous
electrical field electrophoresis and blotted to a nylon membrane. Two
individual blot lanes were probed, hybridizing a radiolabeled 2.8-kb
HpaI-BamHI fragment from pRC5 that contains most
of the GCD14 coding sequence. The same probe and a
radiolabeled 2.4-kb XbaI fragment from pRC55 were used to
hybridize a set of filters containing an ordered lambda library of
yeast genomic DNA (49). The first probe hybridized to clone
70692, and the second hybridized with the same clone and also with
clone 70091, both bearing inserts corresponding to containing a region
encompassing TIF2 and URA2 sequences on in the
left arm of chromosome X. To map GCD14 genetically, we
crossed H168 (gcn2-101 gcn3-101 gcd14-2 ino1) with H753
(gcn2::LEU2 GCD14 INO1) and analyzed cosegregation of the 3ATr, Slg
, and Ino
phenotypes in 45 tetrads. We observed 32 parental ditype, 0 nonparental ditype, and 13 tetratype asci, thus locating GCD14 at 14.4 centimorgans from INO1.
DNA sequence analysis and cloning of gcd14
alleles.
The nucleotide sequence of a 2.8-kb
SpeI-ClaI fragment in pRC56 was obtained for both
strands by using a Sequenase version 2.0 kit (U.S. Biochemical Corp).
Reverse primer, M13-40 primer, and several oligonucleotides derived
from the previously determined sequences were used as primers, and
pRC56 was used as double-stranded DNA template. The DNA sequence was
analyzed by using the DNAsis sequence analysis program (Hitachi
software), and comparisons of the GCD14 sequence were made
with BLAST programs (2).
The gcd14-1 and gcd14-2 alleles were cloned by
PCR with genomic DNAs from strains H160 and H168, respectively, as
templates and the Expand High Fidelity PCR System (Boehringer
Mannheim). The primers consisted of oligonucleotides having 20 bases
corresponding to sequences at the beginning (200 bp upstream of the
ATG) or the end of the GCD14 coding sequence. Amplification
products corresponding to gcd14-1 or gcd14-2 were
isolated from two independent PCRs in each case, subcloned into the
pGEM vector (Promega), and sequenced on both strands by using the
appropriate oligodeoxynucleotides derived from the previously
determined GCD14 sequence as primers.
Production of Gcd14p-specific antiserum.
The TrpE-Gcd14p
fusion protein encoded in plasmid pTRPC14 was overexpressed in E. coli HB101 and partially purified from the insoluble fraction of
whole-cell extracts by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis as already described (21). Gel slices
containing ~200 µg of the fusion protein were used to inoculate
rabbits. Immunization of the rabbits and collection of the immune
antisera were conducted by Hazelton Laboratories (Vienna, Va.).
RNA isolation and Northern blot analysis.
Total RNA was
isolated as previously described (36). Samples were dried,
resuspended in loading buffer (90% formamide, 1 mM EDTA [pH 8.0],
0.1% bromophenol blue, 0.1% xylene cyanol), and heated to >90°C
for 10 min before separation on a 6 or 8% polyacrylamide-bisacrylamide
(19:1)-8.3 M urea gels by electrophoresis at 250 V for approximately
3.5 h. Gels were run at 250 V for 20 min prior to separation of
RNAs. Following electrophoresis, gels were soaked in 0.5×
Tris-borate-EDTA for 20 min, and RNA was transferred to positively
charged nylon membranes (Boehringer Mannheim) in the same buffer by
electrotransfer (Trans-Blot Cell; Bio-Rad) for 3.5 h at 19 V. RNA
was immobilized on membranes by UV cross-linking with a UV-Stratalinker
2400 (Stratagene) according to the manufacturer's instructions. tRNAs
on the membranes were detected by hybridization with radiolabeled
oligonucleotides in hybridization buffer (0.25 M
Na2HPO4 [pH 7.5], 7% SDS, 1% bovine serum
albumin, 1 mM EDTA) at 50 to 52°C for 12 to 20 h.
Oligonucleotides were radiolabeled at the 5' ends with
[
-32P]ATP (6,000 Ci/mmol) and T4 polynucleotide kinase
(Pharmacia). Following hybridization, membranes were washed once with
2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS
for 30 min at room temperature and once in 1× SSC-0.1% SDS at 60°C for 20 min prior to detection by autoradiography. Direct quantitation of all hybridization signals was conducted by phosphorimager analysis with a BAS-1500 PhosphorImager and MacBAS Ver.2.x software (Fuji Film).
For reprobing, membranes were stripped of radioactive probes by
incubation at 100°C in 1.0% SDS and cooled to room temperature.
The oligonucleotides used as probes in Northern blots and the
corresponding transcript species to which they specifically hybridize
(RNA) were as follows: (i) 5'-TCGTTTCGATCCCGAGGACATCAGGGTTATGA-3' (tRNAiMet), (ii)
5'-TCGGTTTCGATCCCGAGGACATCAGGGTTATGA-3'
(tRNAeMet), (iii)
5'-TGCTCGAGGTGGGGWTTGAACCCACGACGG-3' (tRNAUAUIle), (iv)
5'-CAGTTGATCGGACGGGAAAC-3' (5S rRNA), (v)
5'-TGCGTTCTTCATCGATGCGAGAACC-3' (5.8S rRNA), (vi)
5'-GACGTCCTACGATTGCACTC-3' (RPR1 RNA), (vii) 5'-TCCCCCGGGTGAATCCATGGACCAAGA-3' (NME1 RNA), (viii)
5'-GGTTCATCCTTATGCAGGG-3' (U6 RNA), (ix)
5'-AGCCGAACTTTTTATTCCATTCG-3'
(pre-tRNACGASer) (61), and (x)
5'-AGCCCAAGAGATTTCGAGTCTCTCG-3' (tRNACGASer)
(61).
Nucleotide sequence accession number.
The EMBL accession
number for the GCD14 nucleotide sequence is Z54149.
 |
RESULTS |
Isolation and characterization of the wild-type GCD14
gene and of the gcd14-1 and gcd14-2 mutant
alleles.
Mutations in GCD14 were isolated as
suppressors of the 3AT phenotype of a gcn2-101 gcn3-101
double mutant (17). All gcn mutations confer
sensitivity to 3AT because they impair derepression of GCN4,
and of histidine biosynthetic genes regulated by Gcn4p, in response to
histidine starvation imposed by 3AT (28). gcd14 mutations restore derepression of GCN4 translation and thus
confer 3AT resistance in a gcn2 gcn3 background. In
addition, recessive gcd14 mutations lead to a slow-growth
phenotype (Slg
) on rich media at 28°C which is
exacerbated at both lower and higher temperatures (18 and 37°C)
(Ts
phenotype) (data not shown). We cloned the wild-type
allele of GCD14 from a yeast genomic library on plasmid pRC5
(Fig. 1) by complementing the 3ATr and Slg
phenotypes conferred by gcd14-2 in the gcn2-101
gcd14-2 strain Hm316. To prove that we had cloned authentic
GCD14, we mapped the chromosomal location of the genomic
insert in pRC5 to chromosome X of S. cerevisiae. A
radiolabeled 2.8-kb HpaI-BamHI fragment obtained
from pRC5 hybridized exclusively to chromosome X in a yeast Chromo-Blot
(see Materials and Methods). The cloned sequence was mapped to the left
arm of chromosome X, in a region close to SPT10/PBS2/TRK1,
by hybridizing the same HpaI-BamHI fragment to
filters containing an ordered lambda library of yeast genomic clones
(see Materials and Methods). From tetrad analysis we estimated that
gcd14-2 is about 14.4 centimorgans from INO1 (see
Materials and Methods). The fact that INO1 is located 50 kb
from the cloned sequence on the left arm of chromosome X verifies that
the insert in pRC5 contains the wild-type allele of GCD14.
To define the boundaries of GCD14, subclones of the genomic
insert in pRC5 were constructed in low-copy-number plasmids and tested
for complementation of the gcd14-1 and gcd14-2
mutations (Fig. 1). The results of this analysis localized
GCD14 to the 2.8-kb SpeI-ClaI fragment
in pRC56 (Fig. 1 and data not shown), since deletions that remove
sequences from the 5' or the 3' end (pRC55) of that fragment completely
abolished complementation activity (Fig. 1). The
SpeI-ClaI fragment was sequenced on both strands
and found to contain a single ORF of 1,149 bp that is predicted to
encode a protein of 383 amino acids with a molecular mass of 43,917 Da.
(Fig. 2). Comparison of the deduced amino
acid sequence of Gcd14p with protein sequences in the GenBank, EMBL, and SWIS-PROT databases revealed that the gene had 60% similarity and
47.5% identity with Schizosaccharomyces pombe CPD1, a gene proposed to encode the 42-kDa subunit of DNA polymerase
(62).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Deduced amino acid sequence of Gcd14p. The predicted
amino acid sequence of S. cerevisiae Gcd14p is given in
single-letter code. Two regions of sequence similarity observed in
several S-AdoMet-dependent methyltransferases are boxed and indicated
as motif I and motif II (35). The conserved G residue at
position 5 of motif I is G118 in Gcd14p. A glutamate residue commonly
located 17 to 19 residues C terminal to motif I is found 17 residues C
terminal to motif I in Gcd14p, at position 139 (*), and a cluster of
hydrophobic residues, hhXh (D/E), at positions 135 to 138 (underlined,
LFSF) precedes the E element. The central invariant aspartate in motif
II is conserved at position 209 in Gcd14p. Motifs I and II are
separated by 83 residues in Gcd14p. A putative nuclear localization
signal (7) (shaded box) is located between residues K282
R294 in the Gcd14p sequence.
|
|
The predicted polypeptide sequence of Gcd14p contains two regions of
sequence similarity described for several S-AdoMet-dependent methyltransferases (35). These motifs always occur in the
same order separated by intervals of similar lengths, and it was
suggested that they contribute to binding of the substrate S-AdoMet or
the product S-adenosylhomocysteine of S-AdoMet-dependent
methyltransferases. Motif I (VIEAGTGSG), located between residues
114 and 122 in Gcd14p (Fig. 2), is similar to conserved regions
described for DNA adenine and cytosine methyltransferases
(33) and was also found in 69 of 84 non-DNA
methyltransferases (35). Gcd14p also contains a conserved
glutamate (E) residue located 17 residues C terminal to motif I and a
cluster of hydrophobic residues, LFSF, at positions 135 to 138 preceding the E element, thus matching the established consensus hhXh
(D/E). Motif II (APWDAIPH), located between amino acid
residues 206 and 213 in Gcd14p (Fig. 2), is present in 46 of the 84 enzyme sequences analyzed (35), including one bacterial tRNA
methyltransferase (33). Generally, motifs I and II are separated by 57 ± 13 amino acids, whereas in Gcd14p the
separation is 82 residues; however, the RNA methyltransferases and
porphyrin precursor methyltransferases are known exceptions to this rule.
We identified the mutations in gcd14-1 and
gcd14-2 by PCR amplification of both alleles from genomic
DNAs of H160 and H168, respectively, followed by automatic DNA
sequencing (see Materials and Methods). The gcd14-1 allele
contains a single point mutation, consisting of a transversion from G
to C at nucleotide 265, replacing a histidine codon (GAC) with an
aspartate codon (CAC) at amino acid residue 89. This mutation falls in
a region of ca. 23 amino acid residues that is very well conserved
between CPD1 of S. pombe and GCD14;
however, it does not alter the predicted S-AdoMet binding motifs in
Gcd14p. The gcd14-2 allele contains a single G-to-T transversion in nucleotide 3 of the GCD14 coding sequence,
replacing the GCD14 methionine start codon ATG (Met) with
ATT (Ile).
Immunoblot analysis of whole-cell extracts with antibodies against
Gcd14p (see Materials and Methods) showed that the gcd14-1 product was expressed at a level greater than or equal to that of the
wild type, whereas the gcd14-2 product was substantially diminished in abundance (data not shown). Presumably, a low level of
gcd14-2 protein can be produced by inefficient translation initiation at the ATT start codon.
GCD14 is an essential gene.
The slow-growth
phenotype of the gcd14-1 and gcd14-2 mutations
suggests that Gcd14p has an essential function beyond its role in
GCN4-specific translational control. To test this
possibility, we constructed a deletion-insertion null allele,
gcd14::URA3, in plasmid pRC560 (Fig. 1) and used
it to replace one allele of GCD14 in
ura3-52/ura3-52 diploid strains YRC1 (gcn2/gcn2
GCD14/gcd14-2 ura3-52/ura3-52) and YRC2 (GCN2/GCN2
GCD14/GCD14 ura3-52/ura3-52) (see Materials and Methods). We
verified by Southern blot analysis that the
gcd14::URA3 allele replaced one of the two copies
of GCD14 in the Ura+ transformants of YRC1 and
YRC2 that were obtained (data not shown). Tetrad analysis of these
transformants revealed that in 24 asci from each diploid, only two of
the four spores formed colonies on rich medium after 4 days at 28°C
(data not shown). All viable spores were Ura
(ura3-52) (and thus contain GCD14), and those
from the YRC1 transformant were also 3ATs (ura3-52
gcn2 GCD14), indicating that the gcd14-2 allele
had been replaced by gcd14::URA3. These results
demonstrate that GCD14 is essential for growth.
To confirm that GCD14 was the only essential gene whose
function had been disrupted, a Ura
derivative of the
heterozygous gcd14::URA3/GCD14 transformant of
diploid strain YRC2 was isolated by growth on 5-FOA medium (6), transformed with a URA3 low-copy-number
plasmid containing only the GCD14 coding region (pRC56
[Fig. 1]), and induced to sporulate. Tetrads that contained four
viable ascospores were dissected, showing that GCD14
complements the lethal phenotype of haploid spores bearing the
gcd14::URA3 mutation.
gcd14-2 cells exhibit a modest defect in general
translation initiation.
The essential nature of the
GCD14 gene together with its role as a repressor of
GCN4 mRNA translation (17) suggested to us that
Gcd14p could be required for general initiation of translation. To
investigate that possibility, we analyzed total polysome profiles from
wild-type and mutant gcd14-2 strains by fractionating
whole-cell extracts on sucrose gradients by velocity sedimentation. The
gcd14-2 mutants do not form colonies at 37°C; however,
they exhibited little or no growth defect in liquid medium after
several hours at 37°C (data not shown). Quantitation of total
polysome profiles for gcd14-2 and GCD14 strains
grown at 23°C to mid-logarithmic phase and then incubated for 4 h at 37°C revealed no significant differences in the
polysome/monosome (P/M) ratio. Accordingly, we next examined polysome
profiles for the isogenic strains Hm296g (gcd14-2) and
Hm296G (GCD14) grown at 39°C, where the gcd14-2 mutant exhibits a more detectable growth defect in liquid medium. As
shown in Fig. 3, the P/M ratio was
considerably lower in the gcd14-2 mutant (P/M ratio, 2.4)
than in its isogenic GCD14 parent strain (P/M ratio, 5.7)
after 1.5 h at 39°C. There was also a small reduction in the
average size of the polysomes in the gcd14-2 mutant at
39°C (see Fig. 3 legend). Although these differences in polysome size
and content are not dramatic, they were consistently observed in three
independent experiments (see Fig. 3 legend). These data suggest that
the gcd14-2 mutants exhibit a modest defect in general
translation initiation. The magnitude of this defect is less than that
observed in gcd1 or gcd2 mutants, consistent with
the lesser derepression of GCN4 translation associated with gcd14 versus gcd1 or gcd2 mutations
(17, 26).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Polysome profiles of isogenic gcd14-2 and
GCD14 strains. Isogenic strains Hm296g and Hm296G were
cultured overnight in yeast extract-peptone-dextrose at 23°C and used
to inoculate two flasks containing 300 ml of yeast
extract-peptone-dextrose to an optical density at 600 nm of ~0.1.
Cultures were incubated at room temperature in a rotary shaker at 250 rpm. At an optical density at 600 nm of ~4.0, cells were collected
and resuspended in the appropriate volume of yeast
extract-peptone-dextrose prewarmed to 39°C and grown to an optical
density at 600 nm of ~2.0. From both flasks, 150 ml was collected
immediately for the 39°C, t = 0 samples, and 150 ml
of fresh prewarmed yeast extract-peptone-dextrose was added back to
each flask. Samples of 150 ml were collected from both flasks after
1.5 h and processed for polysome analysis by velocity
sedimentation of whole-cell extracts on sucrose gradients
(22). Gradients were fractionated while being scanned at 254 nm, and the resulting absorbance profiles are shown, with the tops of
the gradients on the left. The positions of 40S, 60S, and 80S ribosomal
species are indicated by arrows. For each strain, the top two gradients
correspond to samples incubated at 39°C for 0 h (t = 0) and the two bottom gradients contain samples obtained after
1.5 h of incubation at 39°C. Areas delimited inside the profiles
correspond to the fractions of the total absorbance profiles
represented by 2-mer and 3-mer polysomes. In the gcd14-2
strain, the 2-mers and 3-mers represented 26% of the polysome mass at
the permissive temperature but comprised 32% of the polysomes after
1.5 h at 39°C. In contrast, 2-mers and 3-mers represented 24 and
25% of the polysome mass at 23°C and after 1.5 h at 39°C,
respectively, in the wild-type strain Hm296G. The P/M ratios were
calculated at t = 0 and t = 1.5 h for
three independent experiments, and the following mean values and
standard errors (in parentheses) were obtained: at t = 0, P/M = 4.2 (0.83) for GCD14 and 2.8 (0.44) for
gcd14-2; at t = 1.5 h, P/M = 5.2 (0.35)
for GCD14 and 3.5 (0.72) for gcd14-2.
|
|
Genes encoding initiator tRNAMet or Lhp1p are dosage
suppressors of the Gcd
and Slg
phenotypes
of gcd14 mutants.
gcd10 and gcd14
mutations lead to constitutive derepression of GCN4
translation in the absence of Gcn2p (Gcd
phenotype),
conferring resistance to 3AT in a gcn2 strain background (17, 26). We found recently (3) that the
3ATr and Ts
phenotypes conferred by
gcd10 mutations in a gcn2 background can be fully
suppressed by the presence in high copy number of any of the four
genes, IMT1 to IMT4, encoding
tRNAiMet (11, 14) and can be partially
suppressed by high-copy-number LHP1 (39, 60). In
view of the physical interaction found between Gcd10p and Gcd14p
(3), we asked whether the dosage suppressors of
gcd10 mutations could also suppress the 3ATr and
Slg
phenotypes conferred by gcd14 mutations.
Each of the four IMT genes on high-copy-number
plasmids (hcIMT) suppressed the 3ATr (data not
shown) and Slg
(Fig. 4)
phenotypes in gcd14-1 gcn2-101 and gcd14-2
gcn2-101 mutants to about the same extent as did a
low-copy-number plasmid containing GCD14, whereas
high-copy-number LHP1 (hcLHP1) only partially
suppressed the mutant Slg
phenotype (Fig. 4 and
data not shown). hcGCD10 had no suppressor activity in
the gcd14 mutants (Fig. 4), and neither single-copy GCD14 nor hcGCD14 suppressed the phenotypes of
mutants containing different gcd10 alleles (data not shown).
Furthermore, suppression by hcIMT and hcLHP1
seems to be specific for gcd10 and gcd14, as
temperature-sensitive mutations in genes encoding subunits of
translation initiation factors eIF2 and eIF3 (sui2-1 and
prt1-1, respectively) were not suppressed by these dosage
suppressors (3).

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
Phenotypes of gcd14 dosage suppressors. Eight
independent transformants of strains Hm295 (gcd14-1) and
Hm296 (gcd14-2) carrying empty vector pRS426
(gcd14), a low-copy-number plasmid bearing GCD14
(pRC56), or high-copy-number plasmids bearing IMT1 (p2632),
IMT2 (p2633), IMT3 (p2634), IMT4
(p2635), GCD10 (pE107), or LHP1 (p2636) were
streaked for single colonies on minimally supplemented SD plates and
incubated at 28°C (top plates) or 37°C (bottom plates) for 2 days.
The locations of the transformants on plates are indicated inside the
central schematic.
|
|
gcd14 mutants are defective in processing the primary
precursors of the initiator tRNAMet.
High-copy-number
IMT1, -2, -3, and -4 and
LHP1 suppress the phenotypes of gcd10 mutants
because these mutants contain reduced amounts of mature
tRNAiMet, and the dosage suppressors compensate for
this defect by increasing mature tRNAiMet to nearly
wild-type (hcLHP1) or higher-than-wild-type
(hcIMT) levels (3). Accordingly, we used Northern
analysis to investigate whether steady-state levels of mature
tRNAiMet were also reduced in gcd14 mutants
H160 (gcd14-1) and H168 (gcd14-2) compared to
that in their parental wild-type strain (H117). The probe for
tRNAiMet, containing sequences complementary to
nucleotides 33 to 64 in tRNAiMet, hybridizes to both
mature tRNAiMet and different precursor
tRNAiMet species bearing unique 5'-3' extensions
encoded by the different IMT genes (3) (see
Materials and Methods). The Northern data in Fig.
5 were quantified with a phosphorimager,
and the results are given in Table 2.
Relative to the level of elongator tRNAMet
(tRNAeMet), we calculated that the amounts of mature
tRNAiMet in the mutant strains were ca. half of that in
the wild-type strain both at 28°C and after 1.5 h at 37°C
(Fig. 5A; Table 2). In addition, the levels of tRNAiMet
precursors were 2.3- and 3.2-fold higher at 28 and 37°C,
respectively, leading to a fivefold increase in the ratio of precursor
to mature tRNAiMet in the gcd14 mutants
versus the wild type (Fig. 5A; Table 2). These data strongly suggest
that Gcd14p is required for efficient processing of the nascent
tRNAiMet transcripts. It is noteworthy that
tRNAiMet species migrating faster than the wild-type
mature form were detected in both gcd14 mutants under all
conditions (species f in Fig. 5A), suggesting that fully
5'-3'-processed tRNAiMet is either unstable or
incorrectly processed in these mutants. Similar results were obtained
for a gcd14-2 mutant by Anderson et al. (3),
although the accumulation of pre-tRNAiMet at 37°C was
less extensive than that observed here.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
gcd14 mutants are defective in processing the
primary precursors of initiator tRNAMet and
tRNAUAUIle. Northern blot analysis of total RNA (10 µg) isolated from strains H117 (GCD14), H160
(gcd14-1), and H168 (gcd14-2) grown in yeast
extract-peptone-dextrose medium at 28°C to mid-exponential phase (0 h
at 37°C) and shifted to 37°C for 1.5 h is shown. The blot was
probed with a radiolabeled oligonucleotide that specifically hybridized
to tRNAiMet (A) and then was stripped and reprobed with
radiolabeled oligonucleotides specific for tRNAeMet (B)
or tRNAUAUIle (C) (see Materials and Methods). The
positions of pre-tRNAiMet species, mature
tRNAiMet, tRNAeMet, and primary (upper
band) and 5'- and 3'-end-processed intron-containing (lower band)
pre-tRNAUAUIle and mature tRNAUAUIle
are indicated on the left. Indicated on the right are the positions of
pre-tRNAiMet containing 5' and 3' extensions encoded by
IMT2 and IMT3 (b), pre-tRNAiMet
containing 5' and 3' extensions encoded by IMT1 and
IMT4 (c), mature tRNAiMet (e), and
aberrantly processed tRNAiMet species (f) (see text for
details).
|
|
As described for gcd10-504 (3), the
gcd14-1 and gcd14-2 mutations had little or no
effect on the size or steady-state amount of elongator
tRNAMet (Fig. 5B; Table 2). In the case of
tRNAUAUIle, the gcd14-1 and
gcd14-2 mutations led to small increases in the amounts of
the primary transcript containing both 5' and 3' extensions plus the
intron (slower-migrating species of pretRNAUAUIle) and
possibly a small reduction in the levels of mature
tRNAUAUIle in the mutant strains (Fig. 5C; Table 2).
Consequently, the precursor tRNA/mature tRNA ratios for this tRNA were
slightly elevated in the mutant versus the wild-type strain (Table 2), albeit not to the extent observed for tRNAiMet. A
similar result was obtained for tRNAGTATyr (data not
shown). These results raise the possibility that Gcd14p is
required primarily for efficient removal of 5' and 3' extensions from
initiator tRNAMet but may make a small contribution to the
processing of certain other tRNAs besides the initiator.
We confirmed by Northern analysis that the presence of hcIMT
or hcLHP1 plasmids in the gcd14 mutants led to
increased levels of mature tRNAiMet, accounting for
their suppressor phenotypes. Transformants of the gcd14-1
strain containing hcIMT1, hcIMT2,
hcIMT3, or hcIMT4 had levels of mature
tRNAiMet that were 3- to 7-fold higher than that
observed in a vector transformant and 1.5- to 3.5-fold higher than that
seen in the wild-type GCD14 transformant (data not shown).
High-copy LHP1 led to only a 1.5-fold increase in the level
of mature tRNAiMet in the gcd14-1 mutant
Hm295 at 37°C, reaching a level slightly below that observed in the
GCD14 strain (data not shown). This last finding is in
accordance with the fact that hcLHP1 is a relatively weak
suppressor of the Gcd
(data not shown) and
Slg
(Fig. 4) phenotypes of gcd14-1.
Additive effects of gcd10-504 and gcd14-2
mutations on processing and accumulation of
tRNAiMet.
In view of the similar phenotypes of
gcd14 and gcd10 mutations, we investigated
possible genetic interactions between them. The gcd10-505
gcd14-2 double mutant Hm397 was transformed with low-copy-number
plasmids containing GCD10, GCD14, or empty
vectors to generate four isogenic transformants with the following
genotypes: (i) gcd10-505 gcd14-2, (ii) GCD10
gcd14-2, (iii) gcd10-505 GCD14, and (iv) GCD10
GCD14. As shown in Fig. 6A, the
gcd10-505 gcd14-2 double mutant grew more slowly at 28 and
34°C than did either single mutant, indicating additivity of the
growth defects conferred by these mutations. Northern analysis of the
transformants grown at 37°C showed that the gcd14-2 single
mutant contained high levels of tRNAiMet precursors and
a modest reduction in mature tRNAiMet levels relative
to the wild-type strain (Fig. 6B; Table
3), similar to the results described
above. Compared to the gcd14-2 mutant, the
gcd10-505 single mutant at 37°C showed a similar
accumulation of the precursors but a somewhat greater reduction
in mature tRNAiMet expression at 37°C (Fig. 6B,
lanes 6 to 8). Both mutants showed 7- to 10-fold increases in the
precursor tRNA/mature tRNA ratios for tRNAiMet (Table
3). These last findings are interesting because they suggest that
Gcd10p is also required for efficient end processing of
tRNAiMet. The gcd10-505 gcd14-2 double
mutant at 37°C showed a greater reduction in mature
tRNAiMet levels than did either single mutant,
exhibiting levels only 30% of that seen in the wild-type transformant
(Fig. 6B, lanes 5 to 8; Table 3). The additivity of these defects
in mature tRNAiMet expression suggests that
Gcd10p and Gcd14p participate in the same process involved in
pre-tRNAiMet processing.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Exacerbation of gcd14-2 phenotypes by a
gcd10-505 mutation. (A) The double mutant Hm423
(gcd10-505 gcd14-2) and isogenic GCD10 gcd14-2
(Hm420), gcd10-505 GCD14 (Hm421), and GCD10 GCD14
(Hm422) strains were streaked for single colonies on minimally
supplemented SD plates and incubated at 28, 34, or 37°C for 2 days.
The genotypes of the transformants are indicated adjacent to the
appropriate sectors of the 28°C plate. (B) Northern blot analysis of
total RNA (10 µg) isolated from the same strains analyzed in panel A,
conducted as described for Fig. 5 except that cells were grown in
minimally supplemented SD at 28°C (t = 0) (lanes 1 to
4) and then shifted to 37°C for 4 h (lanes 5 to 8). The blot was
probed for 5S rRNA, tRNAiMet, and
tRNAUAUIle as described for Fig. 5.
|
|
Following the temperature shift, the double-mutant culture increased in
mass by only about 30% (data not shown), whereas the level of mature
tRNAiMet was reduced by ca. 69% (Table 3). Therefore,
it appears that the reduction in mature tRNAiMet levels
cannot be accounted for by dilution of the preexisting mature molecules
during cell growth following the temperature shift. This implies that a
substantial fraction of the mature tRNAiMet was
degraded at 37°C in the double mutant. It is noteworthy that the
level of tRNAiMet precursors in the double mutant at
37°C, while higher than that in the wild-type strain, was lower than
that seen in the single mutants. This may indicate that the unprocessed
tRNAiMet precursors which accumulate in the double
mutant also are degraded more rapidly at 37°C than in the single
mutants. Finally, it is interesting that the single and double mutants
showed ca. 10-fold-higher levels of the tRNAiMet
precursors at 28°C compared to the wild-type strain, even though there was little or no reduction in mature tRNAiMet
expression under these conditions (Table 3). Perhaps processing of
tRNAiMet is slower in the mutants at all temperatures
but this leads to a deficit in mature tRNAiMet levels
relative to other stable RNAs only at the high growth rates occurring
at elevated temperatures.
Similar to the results shown above for the gcd14 single
mutants (Fig. 5), we observed modest (15 to 35%) reductions in mature tRNAUAUIle expression in the single and double mutants
analyzed in Fig. 6B; however, we did not observe additive reductions in
the levels of mature tRNAUAUIle upon combining
gcd14-2 and gcd10-505 mutations (Table 3). There were also small increases in the amounts of the
tRNAUAUIle primary transcript in the single and double
mutants at 28°C and in the single mutants at 37°C (Fig. 6B),
suggesting that processing of this precursor occurred more slowly in
the mutants. Interestingly, the primary
tRNAUAUIle precursor did not accumulate in the
double mutant at 37°C, perhaps indicating that it is more
susceptible to degradation, as suggested above for
pre-tRNAiMet. Thus, as concluded above, the
gcd10 and gcd14 mutations have considerably
smaller effects on the maturation of pre-tRNAUAUIle
versus pre-tRNAiMet, particularly in the
gcd10-505 gcd14-2 double mutant (Table 3). In fact, as
shown next, maturation of tRNAiMet appears to be the
only essential function of Gcd14p.
GCD14 is dispensable in yeast strains overexpressing
initiator tRNAMet.
Having shown that GCD14
is essential and that gcd14 mutations impair the maturation
of pre-tRNAiMet, we asked whether overexpression of an
IMT gene would allow cells to survive in the absence of
Gcd14p. To test this possibility, we replaced one of the two
GCD14 alleles in the wild-type diploid strain YNG1 with the
gcd14::URA3 deletion-insertion allele and verified
the gene replacement by Southern blot analysis (data not shown).
After sporulation of the resulting
GCD14/gcd14::URA3 diploid, tetrad analysis
revealed the expected 2+:2
segregation for
cell viability, and all viable spores were Ura
(bearing
GCD14). When the GCD14/gcd14::URA3
diploid, which is homozygous for leu2, was first transformed
with a high-copy-number LEU2 plasmid p1775 bearing
IMT4 (20) and then subjected to tetrad analysis,
20 of 32 tetrads showed a 4+:0
segregation
for cell viability and 2+:2
segregation for
the Ura phenotype. Importantly, all of the Ura+ spores
(bearing gcd14::URA3) were Leu+
(bearing hcIMT4 on p1775) (data not shown). These results
showed that p1775 (hcIMT4) overcame the lethality of the
gcd14::URA3 deletion. The
gcd14::URA3 hcIMT4 and GCD14
hcIMT4 strains derived from one tetrad grew similarly at 28 and 37°C (Fig. 7A, spores 7A to 7D). In
a second tetrad, however, the two gcd14::URA3
hcIMT4 strains grew more slowly than did the
GCD14 hcIMT4 strains, particularly at 37°C
(Fig. 7A, spores 5A to 5D). Thus, at least in certain genetic
backgrounds (e.g., spores 7C and 7D), overexpression of tRNAiMet from IMT4 makes Gcd14p dispensable
for growth at 28 and 37°C.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
GCD14 is not essential in the presence of
hcIMT4. (A) Ascospore clones from two four-spored tetrads
(designated 5 and 7) were obtained from a heterozygous
GCD14/gcd14::URA3 diploid (YNG1) containing
high-copy-number plasmid p1775 (hcIMT4) (20). The
four strains from each tetrad (5A to 5D and 7A to 7D), all containing
hcIMT4, were streaked for single colonies on minimally
supplemented SD medium and incubated at 28 or 37°C for 3 days. The
position of each spore clone and its GCD14 genotype is
indicated adjacent to the appropriate plate sector. +, wild-type
GCD14; , gcd14::URA3. (B) Northern
blot analysis of total RNA (10 µg) isolated from the spore clones of
tetrad 5 (strains 5A to 5D) bearing hcIMT4 (described for
panel A). The strains were grown to mid-logarithmic phase in minimally
supplemented SD medium at 28°C (t = 0 at 37°C) and
shifted to 37°C for 4 h. The blot was probed for
tRNAiMet, tRNAeMet, or
tRNAUAUIle as described for Fig. 5.
|
|
We conducted Northern blot analysis of the eight strains from the two
tetrads just described, all containing hcIMT4. As shown in
Fig. 7B, the gcd14::URA3 hcIMT4 strains
accumulated 3- to 10-fold-higher levels of the
pre-tRNAiMet species, most of which derive from
hcIMT4 (3), than did the congenic
GCD14 hcIMT4 strains. Thus, it appears that
processing of this overproduced precursor is impaired in strains
lacking GCD14. The mature tRNAiMet was
reduced by ca. half at 37°C in only two of the four
gcd14::URA3 hcIMT4 strains (spore
clones 5D and 7D) versus the four GCD14 hcIMT4
strains (Fig. 7B and data not shown). Thus, in certain genetic
backgrounds (spore clones 5B and 7C), overproduction of pre-tRNAiMet from hcIMT4 completely overcame
the requirement for Gcd14p to express high levels of mature
tRNAiMet. However, species migrating faster than mature
tRNAiMet were visible in the two deletion strains in
tetrad 5 (Fig. 7B) and also in tetrad 7 (data not shown), suggesting
that a fraction of the mature fully processed tRNAiMet
present in the gcd14::URA3 hcIMT4
strains may be improperly processed or partially degraded and thus be
nonfunctional in translation. The gcd14::URA3
hcIMT4 strains showed little or no defect in expression of
elongator tRNAMet and the mature form of
tRNAUAUIle (Fig. 7B); however, there was a modest
accumulation of the primary (slower-migrating) precursor for
tRNAUAUIle, particularly at 37°C, reaching at levels
ca. 1.5- to 4-fold higher than those seen in GCD14
hcIMT4 strains (Fig. 7B).
Deletion of LHP1 exacerbates the phenotypes of
gcd14 mutations.
To investigate the role of Lhp1p in
processing of tRNAiMet precursors in gcd14
mutants, we disrupted LHP1 with the LEU2 gene in
wild-type GCD14 and gcd14 mutant strains (see
Materials and Methods). The lhp1::LEU2 mutation
did not affect the growth rate of the wild-type strain H117, in
agreement with previous results (60); however, it greatly
exacerbated the Slg
phenotypes of the gcd14-1
and gcd14-2 mutants (Fig. 8A).
In addition, we observed additive effects of the
lhp1::LEU2 and gcd14 mutations on the
levels of mature tRNAiMet. Whereas the
lhp1::LEU2 allele reduced mature
tRNAiMet by only ca. 27% in GCD14 cells, it
caused reductions of ca. 60% in gcd14-1 and
gcd14-2 cells (Fig. 8B; Table
4). The levels of tRNAiMet precursors also were greatly diminished by the
lhp1::LEU2 mutation in all three backgrounds, with
reductions of 77, 86, and 68% in the GCD14,
gcd14-1, and gcd14-2 strains, respectively (Fig.
8B; Table 4). Lhp1p has been implicated in stabilizing precursors and
promoting correct 3' end processing of certain tRNAs (61). Thus, to account for the reduced amounts of mature
tRNAiMet seen in the double mutants, we suggest that
deletion of LHP1 leads to degradation of a substantial
fraction of the tRNAiMet precursors and that this
degradation is more extensive in the gcd14 mutants than in
the GCD14 strain.



View larger version (141K):
[in this window]
[in a new window]
|
FIG. 8.
Synthetic interactions of gcd14 and
lhp1::LEU2 mutations. (A) Strains YNG174
(GCD14), YNG175 (gcd14-1), and YNG176
(gcd14-2) and the isogenic
lhp1::LEU2-containing derivatives Hm406
(GCD14 lhp1::LEU2), Hm407 (gcd14-1
lhp1::LEU2), and Hm408 (gcd14-2
lhp1::LEU2) were streaked for single colonies on
minimally supplemented SD plates and incubated at 28 or 37°C for 2 days. The locations of the strains are indicated by their relevant
genotypes in the schematic at the top. (B) Northern blot analysis of
total RNA (20 µg) isolated from the strains described for panel A and
separated by electrophoresis in a 6% polyacrylamide-8.3 M urea gel.
Strains were grown in minimally supplemented SD at 28°C. The blot was
probed for tRNAiMet, tRNAUAUIle,
tRNAeMet, and tRNACGASer by using the
appropriate oligonucleotides (see Materials and Methods). Indicated on
the right of the top panel are the positions of various precursor and
processed forms of tRNAiMet, as described in the legend
to Fig. 5. The positions of precursor and mature
tRNACGASer species are indicated on the right of
the bottom panel: a primary precursor containing 5' and 3' extensions
(g), a processing intermediate containing only the 3' extension (h), a
5'- and 3'-end-processed intron-containing precursor (i), and mature
tRNACGASer (j). (C) The Northern blot in panel B was
probed for RPR1 RNA, NME1 RNA, 5S rRNA, and U6 RNA by using the
appropriate oligonucleotides (see Materials and Methods). The positions
of precursor and mature RPR1 species are indicated on the left.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Effects of combining gcd14 and
lhp1::LEU2 mutations on expression of
tRNAiMet, tRNAeMet,
tRNAUAUIle, tRNACGASer, and RPR1,
NME1, and U6 RNAsa
|
|
In contrast to the findings for tRNAiMet, there were
relatively small effects of deletion of LHP1 on the levels
of the precursor and mature forms of tRNAUAUIle in all
three strains, and there was little indication that the lhp1::LEU2 and gcd14 mutations
had additive effects on expression of the fully processed form of
this tRNA (Fig. 8B; Table 4). Thus, similar to our findings for
gcd10 gcd14 double mutants (Fig. 6), expression
of tRNAUAUIle was relatively insensitive to
mutations which showed strong additive effects on the production of
mature tRNAiMet. No defects whatsoever in expression of
elongator tRNAMet in the single or double mutants relative
to that in the wild type were observed (Fig. 8B; Table 4). However, we
observed a substantial reduction (70%) in the level of mature
tRNACGASer in the gcd14-1
lhp1::LEU2 double mutant compared to the
corresponding gcd14-1 single mutant and an additive effect
of a lesser degree for this tRNA in the gcd14-2
lhp1::LEU2 double mutant (Fig. 8B; Table 4). Unlike
the situation for tRNAiMet, the amounts of
tRNACGASer precursors were decreased, rather than
increased, by the gcd14 single mutations; however, for both
tRNAs, deletion of LHP1 greatly reduced the amounts of
precursors in both GCD14 and gcd14 backgrounds. Thus, Gcd14p and Lhp1p may both function in stabilizing the
tRNACGASer precursors. It is unknown whether
tRNACGASer contains m1A at position 58 (57).
We next considered the possibility that expression of other RNA
polymerase III transcripts was also reduced in the gcd14
lhp1::LEU2 double mutants. As shown in Fig. 8C, the
levels of 5S rRNA were nearly indistinguishable among the
gcd14 and lhp1::LEU2 single and double
mutants. In contrast, we observed strong additive effects of
gcd14-1 and lhp1::LEU2 on expression of
both the RPR1 and NME1 transcripts. These are the RNA components of
RNase P and RNase MRP, which are involved in the processing of tRNAs
and rRNA, respectively (38, 54). We observed a similar
interaction between gcd14-2 and
lhp1::LEU2 for NME1 RNA, but a lesser effect for
RPR1 RNA, in this double mutant versus the gcd14-1
lhp1::LEU2 strain (Table 4). It is interesting that
deletion of LHP1 reduced the amount of RPR1 precursor in all
three strains, and this effect was especially marked in the
gcd14-1 background. As suggested above for
tRNAiMet, Lhp1p may increase the stability of pre-RPR1
RNA, and this function may be critically required for production of
mature RPR1 in gcd14-1 mutants. Finally, U6 RNA showed
modest reductions in both gcd14 lhp1::LEU2 double
mutants compared to that in the corresponding single mutants, similar
in magnitude to those described above for tRNAUAUIle
(Fig. 8B; Table 4). Taken together, the results in Fig. 8B and C
strongly suggest that Gcd14p and Lhp1p cooperate in maturation and
accumulation of a subset of RNA polymerase III transcripts. In the case
of tRNAiMet, a requirement for Gcd14p can be readily
observed in mutants defective for only this protein, whereas for
tRNACGASer, NME1, and RPR1, a strong
dependence on Gcd14p is revealed only in the absence of Lhp1p.
We showed previously that Gcd14p copurified with a polyhistidine-tagged
form of Gcd10p on nickel affinity resin and that neither protein was
stably associated with the PRT1-encoded subunit of eIF3
(3). Moreover, Gcd10p and Gcd14p were not detected in a
highly purified eIF3 complex (48), and both proteins showed prominent nuclear localization (3). Thus, it appears that
Gcd10p and Gcd14p reside in a nuclear protein complex distinct from
eIF3. In view of the genetic interactions between gcd14
mutations and the lhp1::LEU2 allele, it was of
interest to determine whether Lhp1p is tightly associated with the
Gcd10p-Gcd14p complex. To answer this question, we investigated whether
Lhp1p could be coimmunoprecipitated from cell extracts with an
HA-tagged form of Gcd10p. It was shown previously that the
GCD10-HA allele employed for this study and wild-type
GCD10 were indistinguishable in the ability to complement the lethal phenotype of a gcd10::URA3 mutation
(3). Whole-cell extracts were prepared from isogenic
GCD10-HA or GCD10 strains containing either a
high-copy-number plasmid bearing LHP1 or an empty vector and
were immunoprecipitated with monoclonal anti-HA antibodies. As
expected, comparable proportions of Gcd14p and HA-Gcd10p were
immunoprecipitated with anti-HA antibodies from the extracts prepared
from strains containing GCD10-HA, but neither protein was
immunoprecipitated from the GCD10 extract (Fig.
9A, lanes 4, 6, and 8). No detectable
Lhp1p was coimmunoprecipitated with HA-Gcd10p and Gcd14p, even when
Lhp1p was greatly overexpressed (Fig. 9A, lanes 4 and 6, and B, lane
6). In accordance with this finding, no Lhp1p was detectable in a
preparation of the Gcd10p-Gcd14p complex purified to homogeneity
(48a). We conclude that Lhp1p is not tightly associated with
the Gcd10p-Gcd14p complex in cell extracts.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 9.
Gcd14p, but not Lhp1p, is tightly associated with Gcd10p
in cell extracts. (A) Whole-cell extracts were prepared as described
previously (47) from strains H1515 (LHP1) and
YJA113 (lhp1) and from transformants of YJA142
(GCD10HA) or YJA143 (GCD10) bearing
high-copy-number plasmid p2626 containing LHP1 or empty
vector YEp24. Aliquots containing 200 µg of total cell protein were
mixed with 2 to 4 µg of anti-HA monoclonal antibody HA.11 (Babco),
which was prebound to protein A-Sepharose for 2 h on ice, and the
mixture was incubated for 1 h at 4°C. After three washes with
lysis buffer (20 mM Tris-HCl [pH 7.4], 100 mM KCl, 1.0 mM Mg acetate,
0.1% [vol/vol] Triton X-100) containing one complete protease
inhibitor tablet (Boehringer Mannheim) per 25 ml, immunoprecipitates
were collected by centrifugation and proteins were eluted by boiling in
Laemmli buffer (37). The total proteins immunoprecipitated
from 200 µg (pellet [P]; lanes 4, 6, and 8) or 50 µg of the
starting whole-cell extracts (input [I]; lanes 3, 5, and 7) were
separated by SDS-polyacrylamide gel electrophoresis (36) and
transferred to a nitrocellulose membrane (Millipore) in 25 mM Tris-192
mM glycine-0.1% SDS containing 20% (vol/vol) methanol. Lanes 1 and 2 contain 50 µg of the starting whole-cell extracts from strains H1515
and YJA113, respectively, which were included to establish the identity
of Lhp1p. The membrane was blocked overnight at 4°C in BLOTTO (5%
[wt/vol] nonfat dry milk, 10 mM Tris-HCl [pH 7.4], 150 mM NaCl,
0.05% [vol/vol] Tween 20). A single immunoblot was probed with 3 µg of rabbit anti-HA antibody HA.11 (Babco) per ml, stripped,
reprobed with a 1:1,000 dilution of anti-Gcd14p antibodies (see
Materials and Methods), and reprobed with a 1:1,000 dilution of
anti-Lhp1p antibodies (60). Immune complexes were detected
with horseradish peroxidase-conjugated sheep antimouse (Amersham) or
donkey antirabbit (Amersham) secondary antibodies and an enhanced
chemiluminescence kit (ECL; Amersham). (B) A longer exposure of lanes 5 and 6 of the blot in panel A probed with anti-Lhp1p antibodies,
included to detect small amounts of Lhp1p in the immunoprecipitates.
|
|
 |
DISCUSSION |
Evidence that Gcd14p is required for efficient processing of
tRNAiMet.
Recessive gcd14 mutations
confer constitutive derepression of GCN4 mRNA translation in
the absence of eIF2
phosphorylation (17), a phenotype
generally indicating reduced formation of the
eIF2-GTP-tRNAiMet ternary complex (20).
gcd14 mutants also have a Slg
phenotype, and
we found that general translation initiation is slightly impaired in
these mutants, at least at elevated temperatures (Fig. 3). In addition,
deletion of GCD14 is lethal. These findings suggest that
Gcd14p has an essential function required for ternary complex formation
in vivo. In agreement with this conclusion, we found that
gcd14 mutants contain approximately 50% lower steady-state levels of mature tRNAiMet than are present in isogenic
wild-type strains (Tables 2 to 4). They also contain processed
tRNAiMet molecules that appear to be smaller than
wild-type mature tRNAiMet (Fig. 5 to 7, species f) and
thus may be defective in aminoacylation or ternary complex formation.
The Gcd
and Slg
phenotypes of the
gcd14 mutants were fully suppressed by introducing multiple
copies of the IMT genes encoding tRNAiMet,
which restored expression of mature tRNAiMet to
greater-than-wild-type levels. Moreover, the presence of
hcIMT4 overcame the lethality of a gcd14
deletion. The phenotypes of nonlethal gcd14 mutations also
were partially suppressed by hcLHP1, which increased the
level of mature tRNAiMet to just below wild-type
levels. Together, these findings indicate that the essential function
of Gcd14p is required for efficient and accurate production of mature
tRNAiMet.
The fact that gcd14 mutants exhibit tRNAiMet
precursor tRNA/mature tRNA ratios 5- to 10-fold higher than wild type
(Fig. 5; Table 2) is most easily explained by a defect in
pre-tRNAiMet processing. The precursor molecules that
accumulate in gcd14 mutants contain both 5' and 3'
extensions, indicating that both cleavage of the 5' extension by RNase
P (18) and removal of the 3' extension by endo- or
exonucleases occur less efficiently in gcd14 mutants. The
accumulation of molecules shorter than wild-type mature
tRNAiMet in gcd14 mutants could indicate
that a portion of the 5'- and 3'-processed tRNAiMet
lacks the CCA triplet added posttranscriptionally to the 3' ends of all
tRNAs (18). Alternatively, these shorter molecules could be
degradation intermediates.
Evidence that Gcd14p and Gcd10p function together to promote
maturation of tRNAiMet in vivo.
Nonlethal
gcd10 mutations lead to reduced expression of mature
tRNAiMet and can be suppressed by hcIMT and
hcLHP1 (3), just as shown here for
gcd14 mutations (Fig. 4). Moreover, the lethal effect of
deleting GCD10 also could be suppressed by overexpression of tRNAiMet from high-copy-number IMT4
(3). Thus, the essential functions of both proteins, at
least at low growth temperatures, are required only for expression of
mature tRNAiMet. In addition to these genetic
similarities, we found that Gcd10p and Gcd14p can be
coimmunoprecipitated (Fig. 9) and copurified (3) from
whole-cell extracts. The physical association between these two
proteins has been confirmed by using a polyhistidine-tagged form of
Gcd10p to isolate a Gcd10p-Gcd14p complex from whole-cell extracts by
affinity chromatography (3) and by yeast two-hybrid analysis
(4). In addition, epitope-tagged forms of both proteins Gcd10p and Gcd14p were shown by immunofluorescence to exhibit prominent
nuclear localization in yeast cells (3). These findings strongly suggest that Gcd10p and Gcd14p reside in a nuclear complex that functions directly in the maturation of tRNAiMet.
Here we provided additional in vivo evidence for this conclusion by
showing that gcd14-2 and gcd10-505 mutations had
additive effects on cell growth and expression of mature
tRNAiMet. The double mutant at 28°C accumulated
higher levels of pre-tRNAiMet than did either single
mutant, suggesting compounded defects in processing. Moreover, the
gcd10-505 single mutant accumulated tRNAiMet
precursors concomitant with diminished amounts of mature
tRNAiMet (Fig. 6B), implicating Gcd10p in
pre-tRNAiMet processing. In a previous study we showed
that expression of mature tRNAiMet was reduced by ca.
fivefold after several hours at 37°C in a gcd10-504
mutant; however, we observed no accumulation of
pre-tRNAiMet at the restrictive temperature
in that strain (3). This could be explained by proposing
that the gcd10-504 and gcd10-505 (studied here)
mutations both lead to defects in processing of
pre-tRNAiMet but that the unprocessed molecules are
more susceptible to degradation in the gcd10-504 mutant than
in the gcd10-505 or gcd14 strains analyzed here.
In accordance with this explanation, we obtained evidence that both
precursor and mature tRNAiMet were highly susceptible
to degradation in the gcd10-505 gcd14-1 double mutant at
37°C (Fig. 6B), similar to our previous findings for the
gcd10-504 single mutant (3).
Thus far, we have observed no defect in pre-tRNAiMet
synthesis or processing in cell extracts prepared from gcd10
or gcd14 mutants (3a). Therefore, Gcd10p and
Gcd14p do not appear to be essential components of the processing
machinery. Our discovery that Gcd14p contains two sequence motifs
conserved among S-AdoMet-dependent methyltransferases, including at
least one tRNA methyltransferase (35), raised the
possibility that one or more nucleotides in pre-tRNAiMet is undermethylated in gcd14
mutants. This could alter the conformation of
pre-tRNAiMet in a way that impairs removal of the 5' or
3' extensions or addition of the CCA triplet to the 3' end. Consistent
with this possibility, we recently found that m1A is
lacking in total tRNA isolated from gcd10
cells
(3). This base modification occurs at position 58 in the
initiator and elongator forms of tRNAMet, in
tRNAGTATyr (also examined here), and in 15 other tRNAs
but is not found at any other positions in yeast tRNAs (57).
In the initiator, the m1A58 residue is involved in a unique
tertiary substructure not observed in any e