Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4167-4181, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
GCD14p, a Repressor of GCN4 Translation, Cooperates
with Gcd10p and Lhp1p in the Maturation of Initiator Methionyl-tRNA
in Saccharomyces cerevisiae
Olga
Calvo,1
Rafael
Cuesta,1
James
Anderson,2
Noelia
Gutiérrez,1
Minerva Teresa
García-Barrio,1,2
Alan G.
Hinnebusch,2 and
Mercedes
Tamame1,*
Instituto de Microbiología
Bioquímica del CSIC/Universidad de Salamanca, 37007 Salamanca,
Spain,1 and Section on Molecular
Genetics of Lower Eukaryotes, Laboratory of Molecular Genetics,
National Institute of Child Health and Human Development, Bethesda,
Maryland 208922
Received 30 October 1998/Returned for modification 23 December
1998/Accepted 3 March 1999
 |
ABSTRACT |
Gcd10p and Gcd14p were first identified genetically as repressors
of GCN4 mRNA translation in Saccharomyces
cerevisiae. Recent findings indicate that Gcd10p and Gcd14p
reside in a nuclear complex required for the presence of
1-methyladenosine in tRNAs. Here we show that Gcd14p is an essential
protein with predicted binding motifs for
S-adenosylmethionine, consistent with a direct function in
tRNA methylation. Two different gcd14 mutants exhibit
defects in cell growth and accumulate high levels of initiator
methionyl-tRNA (tRNAiMet) precursors containing 5' and
3' extensions, suggesting a defect in processing of the primary
transcript. Dosage suppressors of gcd10 mutations, encoding
tRNAiMet (hcIMT1 to hcIMT4; hc
indicates that the gene is carried on a high-copy-number plasmid) or a
homologue of human La protein implicated in tRNA 3'-end formation
(hcLHP1), also suppressed gcd14 mutations. In
fact, the lethality of a GCD14 deletion was suppressed by
hcIMT4, indicating that the essential function of Gcd14p is
required for biogenesis of tRNAiMet. A mutation in
GCD10 or deletion of LHP1 exacerbated the
defects in cell growth and expression of mature
tRNAiMet in gcd14 mutants, consistent with
functional interactions between Gcd14p, Gcd10p, and Lhp1p in vivo.
Surprisingly, the amounts of NME1 and RPR1, the RNA components of
RNases P and MRP, were substantially lower in gcd14
lhp1::LEU2 double mutants than in the corresponding single mutants, whereas 5S rRNA was present at wild-type levels. Our
findings suggest that Gcd14p and Lhp1p cooperate in the maturation of a
subset of RNA polymerase III transcripts.
 |
INTRODUCTION |
Eukaryotic cells respond to
different conditions of starvation and stress by down-regulating the
rates of protein biosynthesis. One aspect of this response in mammalian
cells involves phosphorylation on serine 51 of the alpha subunit of
translation initiation factor 2 (eIF2
) (53). This
phosphorylation event reduces the activity of eIF2B, the guanine
nucleotide exchange factor for eIF2 that recycles eIF2-GDP to the
active form eIF2-GTP (20, 40, 46, 59). Only eIF2-GTP can
bind initiator methionyl-tRNA (tRNAiMet) to produce the
eIF2-GTP-tRNAiMet ternary complex that delivers
initiator tRNA to the 43S preinitiation complex; thus, phosphorylation
of eIF2 inhibits general protein synthesis initiation. In the budding
yeast Saccharomyces cerevisiae, eIF2
becomes
phosphorylated when cells are deprived of an amino acid or purine,
leading to depletion of ternary complex levels, just as occurs in
mammalian cells (19, 31). Interestingly, it also
specifically stimulates translation of the distinctive mRNA encoding
Gcn4p, a transcriptional activator of more than 40 genes involved in
amino acid biosynthesis (29), thereby alleviating the
nutrient limitation conditions that trigger phosphorylation of eIF2
in yeast.
The molecular mechanism that couples GCN4 translation to
amino acid availability has been explored in great detail over past several years (reviewed in references 31 and
32). Four short upstream open reading frames (uORFs)
present in the GCN4 mRNA leader sequence prevent ribosomes
from initiating translation at the GCN4 start codon under
conditions of amino acid sufficiency. Amino acid starvation triggers
activation of the protein kinase Gcn2p, which phosphorylates eIF2
and thereby inhibits eIF2-GTP-tRNAiMet ternary complex
formation. This situation specifically favors GCN4
translation because, after translating uORF1, many ribosomes cannot
acquire the ternary complex in time to recognize the start codons at
uORF2, -3, and -4 and thus continue scanning downstream. The majority
of these ribosomes rebind the ternary complex by the time they reach
the GCN4 AUG codon and reinitiate there instead (19,
20).
Recessive mutations in any of the genes encoding the four essential
subunits of eIF2B, GCD1, GCD2, GCD6,
and GCD7, mimic the effects of eIF2 phosphorylation and
derepress GCN4 mRNA translation in the absence of Gcn2p and
amino acid starvation (29, 30). These gcd
mutations also lead to unconditional slow growth or temperature
sensitivity on nutrient-rich medium, phenotypes that result from
defects in general translation initiation (9, 16, 22, 27).
It is thought that gcd1, gcd2, gcd6,
and gcd7 mutations impair the ability of eIF2B to recycle
eIF2-GDP to eIF2-GTP and thereby decrease the rate of ternary complex
formation in vivo (31, 46). This causes lower rates of
translation initiation on most mRNAs but leads to increased translation
of GCN4 mRNA, which is inversely coupled to the availability
of ternary complexes in the cell (20).
Recessive mutations in GCD10 also lead to
temperature-sensitive growth and constitutive derepression of
GCN4 translation in the absence of Gcn2p (26,
42). GCD10 is an essential gene and was shown to
encode a 62-kDa protein that copurified and coimmunoprecipitated with
subunits of eIF3 (23). eIF3 stimulates several steps of the
initiation pathway in mammalian cells (among others, binding of ternary
complexes to 40S ribosomes [47]). Accordingly, we proposed that gcd10 mutations might derepress
GCN4 translation by decreasing the ability of eIF3 to
promote rebinding of ternary complexes to 40S subunits that have
translated uORF1 and continued scanning downstream on the
GCN4 mRNA leader. This would allow these subunits to skip
uORF4 and reinitiate translation at the GCN4 AUG without any
reduction in the level of ternary complex formation (23).
More recently, we found that gcd10 mutations reduce the
expression of mature tRNAiMet at a posttranscriptional
step and that the phenotypes of gcd10 mutants are suppressed
by multiple copies of the genes IMT1 to IMT4,
encoding tRNAiMet (3). Interestingly,
gcd10 mutants lack 1-methyladenosine (m1A) at
position 58 in tRNAiMet and in all other tRNAs (17 or
more) containing this modified base. The absence of m1A
seems to impair specifically the expression of mature
tRNAiMet through degradation of the unprocessed
precursors containing 5' and 3' extensions (3). The
reduction in mature tRNAiMet levels in gcd10
mutants should diminish ternary complex formation, decreasing the rate
of general translation initiation and producing constitutive
derepression of GCN4 translation (20). Thus, the impaired maturation of tRNAiMet can also explain the
known phenotypes of gcd10 mutants (3).
We previously identified GCD14 and GCD15 as novel
genes in S. cerevisiae that are required for translational
repression of GCN4 mRNA under amino acid-replete conditions
(17). Here we report the molecular cloning of
GCD14 and show that it encodes an essential protein
containing binding motifs for S-adenosylmethionine (S-AdoMet). We found that gcd14 mutants have reduced levels
of mature tRNAiMet and accumulate
tRNAiMet precursors containing 5' and 3' extensions.
Similar to the case for gcd10 mutants, the presence of
IMT1 to IMT4 in high copy number suppresses the
phenotypes of gcd14-1 and gcd14-2 mutants, and overexpression of IMT4 overcomes the lethality of a
gcd14::URA3 deletion. Gcd14p is physically
associated with Gcd10p in cell extracts (3), and we observed
additive effects of gcd14 and gcd10 mutations on
cell growth and expression of mature tRNAiMet.
Interestingly, we found that gcd14 mutations also lead to
reduced expression of other tRNAs and the RNA components of RNases P
(38) and MRP (54) when combined with a deletion
of LHP1, encoding a yeast homologue of the human autoantigen
La. These findings and others (3) suggest that Gcd10p and
Gcd14p functionally cooperate with Lhp1p to promote the maturation of a
subset of RNA polymerase III transcripts.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmids constructed in this work are represented
in Fig. 1. Plasmid pRC5 was isolated from
a yeast genomic library in the low-copy-number vector YCp50
(51) by selecting for complementation of the
3-amino-1,2,4-triazol resistance (3ATr) and
Slg
phenotypes of strain Hm316 (gcd14-2).
Plasmids pRC55 and pRC56 contain, respectively, the 2.3-kb
XbaI and the 2.8-kb SpeI-ClaI fragments from pRC5 subcloned into the corresponding sites of pRS316
(56).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of the GCD14 coding region. A
partial restriction map of the GCD14 region is shown in the
center, indicating the positions of the two ORFs, GCD14 and
SPT10 (44), identified in the plasmid isolated
from the genomic library bearing GCD14 (pRC5). The direction
of transcription is indicated by the arrows. The top line depicts the
genomic DNA insert in pRC5, and below that are depicted the fragments
present in subclones constructed from pRC5 in low-copy-number vector
pRS316 (pRC55 and pRC56). The ability of each subclone to complement
the phenotypes of gcd14-1 and gcd14-2 mutants is
shown on the right. Below the map of the GCD14 region are
shown enlargements of the 2.6-kb SpeI-ClaI region
in plasmid pRC56 and of the 3.2-kb SpeI-ClaI
region in pRC560 bearing the gcd14::URA3 allele,
in which a 1.1-kb URA3 fragment replaces ~730 bp of the
GCD14 coding sequence. Restriction enzyme sites: B,
BamHI; Bg, BglII; C, ClaI; H,
HindIII; Hp, HpaI; S, Sau3A; X,
XbaI; Sp, SpeI.
|
|
Plasmid pRC56 was digested with
HpaI and
BglII to
delete an internal 730-bp fragment of the
GCD14 coding
sequence, and the
BglII end was filled in with Klenow
fragment. The resulting linearized
plasmid was ligated to a blunt-ended
1.1-kb
HindIII-
HindIII fragment
containing the
URA3 gene, generating
pRC560.
Plasmid pRC57 was generated by subcloning into pRS306 a ~2.8-kb
HpaI-
BamHI fragment from pRC5, extending from 1 kb upstream
of the
GCD14 ATG to ~30 nucleotides 5' of the
stop codon. Plasmids
pRC64 and pRC65 were constructed as follows. (i)
The 2.8-kb
SpeI-
ClaI
fragment from pRC56 was
cloned into the corresponding sites of
the SK+ polylinker of Bluescript
M13+ (Stratagene), generating
plasmid pRC6. (ii) A
NotI site
was introduced upstream of the
GCD14 stop codon by in vitro
mutagenesis with a MUTA-GENE in vitro
mutagenesis kit (Bio-Rad), using
plasmid pRC6 and an oligonucleotide
(RC 22) containing a
NotI site
(5'CGATCCACGGAAAAAC
GCGGCCGCTAATTAAATGATTAAC3';
the
NotI site is underlined, and the
GCD14 stop
codon is in boldface).
The resulting plasmid was named pRC61. (To avoid
methylation of
the
ClaI site located downstream of the
GCD14 gene in plasmid
pRC61, it was always amplified in the
dam mutant
Escherichia coli strain GM119.) (iii)
A 2.4-kb
ClaI fragment containing all of
the
GCD14 coding sequences was subcloned in YCp50 or in the
high-copy-number
YEp24 vector (
50), generating plasmids
pRC62 and pRC63, respectively.
(iv) A 115-bp
NotI fragment,
encoding three in-tandem copies of
the hemagglutinin (HA) epitope, was
inserted at the
NotI site
in pRC62 and pRC63, to create
plasmids pRC64 and pRC65, respectively.
Sequence analysis confirmed the
in-frame insertion of the HA-coding
sequence just upstream of the
GCD14 stop
codon.
A 670-bp
HpaI-
EcoRI fragment from the 3' coding
region of the
GCD14 gene was fused in frame to the
trpE coding sequence in
pATH2 (
21) to generate
pTRPC14. Construction of the correct
in-frame fusion was confirmed by
DNA
sequencing.
Plasmid pJA128 was constructed by inserting the ca. 3.5-kb
XbaI-
XhoI fragment bearing
GCD10 from
pMG107 (
23) into YCplac111
(
24). Plasmid pJA103,
containing the
lhp1::hisG::URA3::hisG allele,
was constructed by PCR amplification of 200- and 350-bp
fragments
containing, respectively, the 5' and 3' flanking sequences
at
LHP1 by using the appropriate primers. The 5' PCR product
was
digested with
EcoRI and
BglII and cloned into
EcoRI- and
BglII-digested
pNKY51 (
1)
to create pJA103'. The 3' PCR product was digested
with
BamHI and
SphI and cloned into
BamHI-
and
SphI-digested pJA103'
to create
pJA103.
All other plasmids used in this work have been previously described:
pE107 (
GCD10) (
23); p1775 (
IMT4)
(
20); p2632 (
IMT1),
p2633 (
IMT2),
p2634 (
IMT3), p2635 (
IMT4), and
p2626(
LHP1) (
3);
pNK985 (
1); pRS315
(
56); pRS426 (
13); and pKOIII (
60).
Yeast strain constructions.
The genotypes and origins of all
yeast strains used in this study are summarized in Table
1. Strains Hm295 (gcd14-1),
Hm296 (gcd14-2), and Hm316 (gcd14-2) were
selected as 3ATr and Slg
ascospores from
genetic crosses previously described (17). Isogenic Hm296G
and Hm296g strains were obtained by transforming Hm296 to
Ura+ with the integrating plasmid pRC57, containing an
incomplete copy of GCD14. Depending on the location of the
crossover, integration of pRC57 yielded a nontandem duplication of
wild-type GCD14 and the truncated gcd14 allele,
or the gcd14-2 and truncated gcd14 alleles,
separated by plasmid sequences. The former (in Hm296G) led to a
3AT-sensitive phenotype, whereas the latter (in Hm296g) conferred 3AT
resistance.
A 3.2-kb
SpeI-
ClaI fragment from pRC560
containing
gcd14::URA3 was used for one-step gene
disruptions (
52) of one of the
two
GCD14 alleles
in diploid strain YRC1 or YRC2, constructed
by crossing Hm316 with H753
and F104 with F105, respectively (Table
1). Total DNA was isolated from
Ura
+ transformants and analyzed by Southern blotting to
verify that
replacement by the null allele was successful. Heterozygous
GCD14/gcd14::URA3 or
gcd14/gcd14::URA3 diploids were sporulated, and
tetrad analysis
was conducted as described in
Results.
The diploid strain YNG1 was constructed by crossing W3031A
(
ura3-52 leu2-3,112) with W3031B (
ura3-52
leu2-3,112) (Table
1).
One allele of
GCD14 in YNG1 was
replaced by
gcd14::URA3 (as described
above), and
a Ura
+ Leu

heterozygous
GCD14/
gcd14::URA3 diploid was transformed with
the
high-copy-number
LEU2 plasmid p1775 containing
IMT4 (
20).
A Leu
+ diploid
transformant was sporulated, and tetrad analysis was
conducted with the
following results: a 4:0 segregation for viability
was observed in
ascospores of 7 tetrads of 12 analyzed, showing
that p1775
(
IMT4) rescued the lethality of a
gcd14::URA3 deletion.
To construct strain Hm397, a
gcd10-505 gcd14-2 ascospore
clone was isolated from a tetratype tetrad obtained from a cross
between Hm296 and Hm298 (
23). The genotypes of all four
ascopore
clones from this tetrad were transformed with empty vectors or
low-copy-number plasmids containing
GCD10 or
GCD14, followed by
phenotype testing of the transformants.
The
LEU2 gene was disrupted
in the
gcd10-504
gcd14-2 strain by transforming it with a 6.5-kb
BglII
fragment from pNK985 (
1), containing the 3.8-kb
hisG::URA3::hisG cassette inserted at
the
EcoRI site of the
LEU2 gene, and
Leu

Ura
+ transformants were selected. The
transformants were plated on
SD medium containing 1 mg of
5-fluoro-orotic acid (5-FOA) per
ml (
6) to select the
Ura

derivative Hm397 (see Table
1 for genotypes). Hm397
was transformed
with low-copy-number plasmids containing
GCD10 (pJA128),
GCD14 (pRC56), or empty vectors
(pRS315 or pRS316) to generate the isogenic
transformants with the
genotypes
GCD10 gcd14-2 (Hm420),
gcd10-505 GCD14
(Hm421),
GCD10 GCD14 (Hm422), and
gcd10-505
gcd14-2 (Hm423).
LHP1 was replaced in
GCD14 and
gcd14
strains with a null allele in which the coding sequence was completely
replaced with
LEU2 (
60) as follows. A
Ura

derivative of strain H117 was selected in 5-FOA
medium, and this
strain, named YNG174 (
GCD14), along with
Hm295 (
gcd14-1) and Hm296
(
gcd14-2), was
transformed with the 6.5-kb
BglII fragment from
pNK985
(
1) described above to disrupt the
LEU2 gene in
each
strain with
hisG::URA3::hisG
sequences. Leu

Ura
+ transformants were
selected and transformed with a 4.6-kb
SalI-
XbaI
fragment from pKOIII (
60) containing the null allele
lhp1::LEU2.
Total RNA was isolated from
Leu
+ transformants and analyzed by Northern blotting to
verify the
absence of
LHP1 mRNA in isogenic strains Hm406
(
GCD14 lhp1::LEU2),
Hm407 (
gcd14-1
lhp1::LEU2), and Hm408 (
gcd14-2
lhp1::LEU2).
Strain JAy113 was constructed by transforming H1515 (
MATa
ura3-52 leu2-3,112 trp1
63) to Ura
+ with a
4.3-kb
SphI/
EcoRI fragment isolated from pJA103
containing
lhp1::hisG::URA3::hisG.
Disruption of
LHP1 was confirmed by PCR
amplification of
fragments diagnostic of
lhp1::hisG::URA3::hisG from
JAy113 genomic DNA. Strain JAy206 was constructed by transforming
JAy143 (
3) to Leu
+ with pJA128, bearing
single-copy
GCD10 and
LEU2, and a stable
Ura

derivative exhibiting wild-type growth was isolated
on medium
containing 1 mg of 5-FOA per ml (
6).
Media and genetic techniques.
Sensitivity to 3AT (Sigma;
catalog no. A8056) was tested as previously described (28).
Transformation of yeast strains was carried out as described by Ito et
al. (34). Standard genetic techniques and media were as
previously described (55).
Chromosomal mapping of GCD14.
GCD14 was
physically mapped to chromosome X by using a Chromo-Blot (Clontech), in
which yeast chromosomes were fractionated by clamped homogeneous
electrical field electrophoresis and blotted to a nylon membrane. Two
individual blot lanes were probed, hybridizing a radiolabeled 2.8-kb
HpaI-BamHI fragment from pRC5 that contains most
of the GCD14 coding sequence. The same probe and a
radiolabeled 2.4-kb XbaI fragment from pRC55 were used to
hybridize a set of filters containing an ordered lambda library of
yeast genomic DNA (49). The first probe hybridized to clone
70692, and the second hybridized with the same clone and also with
clone 70091, both bearing inserts corresponding to containing a region
encompassing TIF2 and URA2 sequences on in the
left arm of chromosome X. To map GCD14 genetically, we
crossed H168 (gcn2-101 gcn3-101 gcd14-2 ino1) with H753
(gcn2::LEU2 GCD14 INO1) and analyzed cosegregation of the 3ATr, Slg
, and Ino
phenotypes in 45 tetrads. We observed 32 parental ditype, 0 nonparental ditype, and 13 tetratype asci, thus locating GCD14 at 14.4 centimorgans from INO1.
DNA sequence analysis and cloning of gcd14
alleles.
The nucleotide sequence of a 2.8-kb
SpeI-ClaI fragment in pRC56 was obtained for both
strands by using a Sequenase version 2.0 kit (U.S. Biochemical Corp).
Reverse primer, M13-40 primer, and several oligonucleotides derived
from the previously determined sequences were used as primers, and
pRC56 was used as double-stranded DNA template. The DNA sequence was
analyzed by using the DNAsis sequence analysis program (Hitachi
software), and comparisons of the GCD14 sequence were made
with BLAST programs (2).
The
gcd14-1 and
gcd14-2 alleles were cloned by
PCR with genomic DNAs from strains H160 and H168, respectively, as
templates
and the Expand High Fidelity PCR System (Boehringer
Mannheim).
The primers consisted of oligonucleotides having 20 bases
corresponding
to sequences at the beginning (200 bp upstream of the
ATG) or
the end of the
GCD14 coding sequence. Amplification
products corresponding
to
gcd14-1 or
gcd14-2 were
isolated from two independent PCRs
in each case, subcloned into the
pGEM vector (Promega), and sequenced
on both strands by using the
appropriate oligodeoxynucleotides
derived from the previously
determined
GCD14 sequence as
primers.
Production of Gcd14p-specific antiserum.
The TrpE-Gcd14p
fusion protein encoded in plasmid pTRPC14 was overexpressed in E. coli HB101 and partially purified from the insoluble fraction of
whole-cell extracts by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis as already described (21). Gel slices
containing ~200 µg of the fusion protein were used to inoculate
rabbits. Immunization of the rabbits and collection of the immune
antisera were conducted by Hazelton Laboratories (Vienna, Va.).
RNA isolation and Northern blot analysis.
Total RNA was
isolated as previously described (36). Samples were dried,
resuspended in loading buffer (90% formamide, 1 mM EDTA [pH 8.0],
0.1% bromophenol blue, 0.1% xylene cyanol), and heated to >90°C
for 10 min before separation on a 6 or 8% polyacrylamide-bisacrylamide
(19:1)-8.3 M urea gels by electrophoresis at 250 V for approximately
3.5 h. Gels were run at 250 V for 20 min prior to separation of
RNAs. Following electrophoresis, gels were soaked in 0.5×
Tris-borate-EDTA for 20 min, and RNA was transferred to positively
charged nylon membranes (Boehringer Mannheim) in the same buffer by
electrotransfer (Trans-Blot Cell; Bio-Rad) for 3.5 h at 19 V. RNA
was immobilized on membranes by UV cross-linking with a UV-Stratalinker
2400 (Stratagene) according to the manufacturer's instructions. tRNAs
on the membranes were detected by hybridization with radiolabeled
oligonucleotides in hybridization buffer (0.25 M
Na2HPO4 [pH 7.5], 7% SDS, 1% bovine serum
albumin, 1 mM EDTA) at 50 to 52°C for 12 to 20 h.
Oligonucleotides were radiolabeled at the 5' ends with
[
-32P]ATP (6,000 Ci/mmol) and T4 polynucleotide kinase
(Pharmacia). Following hybridization, membranes were washed once with
2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS
for 30 min at room temperature and once in 1× SSC-0.1% SDS at 60°C for 20 min prior to detection by autoradiography. Direct quantitation of all hybridization signals was conducted by phosphorimager analysis with a BAS-1500 PhosphorImager and MacBAS Ver.2.x software (Fuji Film).
For reprobing, membranes were stripped of radioactive probes by
incubation at 100°C in 1.0% SDS and cooled to room temperature.
The oligonucleotides used as probes in Northern blots and the
corresponding transcript species to which they specifically
hybridize
(RNA) were as follows: (i) 5'-TCGTTTCGATCCCGAGGACATCAGGGTTATGA-3'
(tRNA
iMet), (ii)
5'-TCGGTTTCGATCCCGAGGACATCAGGGTTATGA-3'
(tRNA
eMet), (iii)
5'-TGCTCGAGGTGGGGWTTGAACCCACGACGG-3' (tRNA
UAUIle), (iv)
5'-CAGTTGATCGGACGGGAAAC-3' (5S rRNA), (v)
5'-TGCGTTCTTCATCGATGCGAGAACC-3'
(5.8S rRNA), (vi)
5'-GACGTCCTACGATTGCACTC-3' (RPR1 RNA), (vii)
5'-TCCCCCGGGTGAATCCATGGACCAAGA-3' (NME1 RNA), (viii)
5'-GGTTCATCCTTATGCAGGG-3'
(U6 RNA), (ix)
5'-AGCCGAACTTTTTATTCCATTCG-3'
(pre-tRNA
CGASer) (
61), and (x)
5'-AGCCCAAGAGATTTCGAGTCTCTCG-3' (tRNA
CGASer)
(
61).
Nucleotide sequence accession number.
The EMBL accession
number for the GCD14 nucleotide sequence is Z54149.
 |
RESULTS |
Isolation and characterization of the wild-type GCD14
gene and of the gcd14-1 and gcd14-2 mutant
alleles.
Mutations in GCD14 were isolated as
suppressors of the 3AT phenotype of a gcn2-101 gcn3-101
double mutant (17). All gcn mutations confer
sensitivity to 3AT because they impair derepression of GCN4,
and of histidine biosynthetic genes regulated by Gcn4p, in response to
histidine starvation imposed by 3AT (28). gcd14 mutations restore derepression of GCN4 translation and thus
confer 3AT resistance in a gcn2 gcn3 background. In
addition, recessive gcd14 mutations lead to a slow-growth
phenotype (Slg
) on rich media at 28°C which is
exacerbated at both lower and higher temperatures (18 and 37°C)
(Ts
phenotype) (data not shown). We cloned the wild-type
allele of GCD14 from a yeast genomic library on plasmid pRC5
(Fig. 1) by complementing the 3ATr and Slg
phenotypes conferred by gcd14-2 in the gcn2-101
gcd14-2 strain Hm316. To prove that we had cloned authentic
GCD14, we mapped the chromosomal location of the genomic
insert in pRC5 to chromosome X of S. cerevisiae. A
radiolabeled 2.8-kb HpaI-BamHI fragment obtained
from pRC5 hybridized exclusively to chromosome X in a yeast Chromo-Blot
(see Materials and Methods). The cloned sequence was mapped to the left
arm of chromosome X, in a region close to SPT10/PBS2/TRK1,
by hybridizing the same HpaI-BamHI fragment to
filters containing an ordered lambda library of yeast genomic clones
(see Materials and Methods). From tetrad analysis we estimated that
gcd14-2 is about 14.4 centimorgans from INO1 (see
Materials and Methods). The fact that INO1 is located 50 kb
from the cloned sequence on the left arm of chromosome X verifies that
the insert in pRC5 contains the wild-type allele of GCD14.
To define the boundaries of
GCD14, subclones of the genomic
insert in pRC5 were constructed in low-copy-number plasmids and
tested
for complementation of the
gcd14-1 and
gcd14-2
mutations
(Fig.
1). The results of this analysis localized
GCD14 to the
2.8-kb
SpeI-
ClaI fragment
in pRC56 (Fig.
1 and data not shown),
since deletions that remove
sequences from the 5' or the 3' end
(pRC55) of that fragment completely
abolished complementation
activity (Fig.
1). The
SpeI-
ClaI fragment was sequenced on both
strands
and found to contain a single ORF of 1,149 bp that is
predicted to
encode a protein of 383 amino acids with a molecular
mass of 43,917 Da.
(Fig.
2). Comparison of the deduced amino
acid
sequence of Gcd14p with protein sequences in the GenBank, EMBL,
and SWIS-PROT databases revealed that the gene had 60% similarity
and
47.5% identity with
Schizosaccharomyces pombe CPD1, a gene
proposed to encode the 42-kDa subunit of DNA polymerase

(
62).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Deduced amino acid sequence of Gcd14p. The predicted
amino acid sequence of S. cerevisiae Gcd14p is given in
single-letter code. Two regions of sequence similarity observed in
several S-AdoMet-dependent methyltransferases are boxed and indicated
as motif I and motif II (35). The conserved G residue at
position 5 of motif I is G118 in Gcd14p. A glutamate residue commonly
located 17 to 19 residues C terminal to motif I is found 17 residues C
terminal to motif I in Gcd14p, at position 139 (*), and a cluster of
hydrophobic residues, hhXh (D/E), at positions 135 to 138 (underlined,
LFSF) precedes the E element. The central invariant aspartate in motif
II is conserved at position 209 in Gcd14p. Motifs I and II are
separated by 83 residues in Gcd14p. A putative nuclear localization
signal (7) (shaded box) is located between residues K282
R294 in the Gcd14p sequence.
|
|
The predicted polypeptide sequence of Gcd14p contains two regions of
sequence similarity described for several S-AdoMet-dependent
methyltransferases (
35). These motifs always occur in the
same
order separated by intervals of similar lengths, and it was
suggested
that they contribute to binding of the substrate S-AdoMet or
the
product
S-adenosylhomocysteine of S-AdoMet-dependent
methyltransferases.
Motif I (VIEAGTGSG), located between residues
114 and 122 in Gcd14p
(Fig.
2), is similar to conserved regions
described for DNA adenine
and cytosine methyltransferases
(
33) and was also found in 69
of 84 non-DNA
methyltransferases (
35). Gcd14p also contains
a conserved
glutamate (E) residue located 17 residues C terminal
to motif I and a
cluster of hydrophobic residues, LFSF, at positions
135 to 138 preceding the E element, thus matching the established
consensus hhXh
(D/E). Motif II (APWDAIPH), located between amino
acid
residues 206 and 213 in Gcd14p (Fig.
2), is present in 46
of the 84 enzyme sequences analyzed (
35), including one bacterial
tRNA
methyltransferase (
33). Generally, motifs I and II are
separated by 57 ± 13 amino acids, whereas in Gcd14p the
separation
is 82 residues; however, the RNA methyltransferases and
porphyrin
precursor methyltransferases are known exceptions to this
rule.
We identified the mutations in
gcd14-1 and
gcd14-2 by PCR amplification of both alleles from genomic
DNAs of H160 and H168,
respectively, followed by automatic DNA
sequencing (see Materials
and Methods). The
gcd14-1 allele
contains a single point mutation,
consisting of a transversion from G
to C at nucleotide 265, replacing
a histidine codon (GAC) with an
aspartate codon (CAC) at amino
acid residue 89. This mutation falls in
a region of ca. 23 amino
acid residues that is very well conserved
between
CPD1 of
S. pombe and
GCD14;
however, it does not alter the predicted S-AdoMet binding
motifs in
Gcd14p. The
gcd14-2 allele contains a single G-to-T
transversion in nucleotide 3 of the
GCD14 coding sequence,
replacing
the
GCD14 methionine start codon ATG (Met) with
ATT
(Ile).
Immunoblot analysis of whole-cell extracts with antibodies against
Gcd14p (see Materials and Methods) showed that the
gcd14-1 product was expressed at a level greater than or equal to that
of the
wild type, whereas the
gcd14-2 product was substantially
diminished in abundance (data not shown). Presumably, a low level
of
gcd14-2 protein can be produced by inefficient translation
initiation at the ATT start
codon.
GCD14 is an essential gene.
The slow-growth
phenotype of the gcd14-1 and gcd14-2 mutations
suggests that Gcd14p has an essential function beyond its role in
GCN4-specific translational control. To test this
possibility, we constructed a deletion-insertion null allele,
gcd14::URA3, in plasmid pRC560 (Fig. 1) and used
it to replace one allele of GCD14 in
ura3-52/ura3-52 diploid strains YRC1 (gcn2/gcn2
GCD14/gcd14-2 ura3-52/ura3-52) and YRC2 (GCN2/GCN2
GCD14/GCD14 ura3-52/ura3-52) (see Materials and Methods). We
verified by Southern blot analysis that the
gcd14::URA3 allele replaced one of the two copies
of GCD14 in the Ura+ transformants of YRC1 and
YRC2 that were obtained (data not shown). Tetrad analysis of these
transformants revealed that in 24 asci from each diploid, only two of
the four spores formed colonies on rich medium after 4 days at 28°C
(data not shown). All viable spores were Ura
(ura3-52) (and thus contain GCD14), and those
from the YRC1 transformant were also 3ATs (ura3-52
gcn2 GCD14), indicating that the gcd14-2 allele
had been replaced by gcd14::URA3. These results
demonstrate that GCD14 is essential for growth.
To confirm that
GCD14 was the only essential gene whose
function had been disrupted, a Ura

derivative of the
heterozygous
gcd14::URA3/GCD14 transformant
of
diploid strain YRC2 was isolated by growth on 5-FOA medium
(
6), transformed with a
URA3 low-copy-number
plasmid containing
only the
GCD14 coding region (pRC56
[Fig.
1]), and induced to
sporulate. Tetrads that contained four
viable ascospores were
dissected, showing that
GCD14
complements the lethal phenotype
of haploid spores bearing the
gcd14::URA3 mutation.
gcd14-2 cells exhibit a modest defect in general
translation initiation.
The essential nature of the
GCD14 gene together with its role as a repressor of
GCN4 mRNA translation (17) suggested to us that
Gcd14p could be required for general initiation of translation. To
investigate that possibility, we analyzed total polysome profiles from
wild-type and mutant gcd14-2 strains by fractionating
whole-cell extracts on sucrose gradients by velocity sedimentation. The
gcd14-2 mutants do not form colonies at 37°C; however,
they exhibited little or no growth defect in liquid medium after
several hours at 37°C (data not shown). Quantitation of total
polysome profiles for gcd14-2 and GCD14 strains
grown at 23°C to mid-logarithmic phase and then incubated for 4 h at 37°C revealed no significant differences in the
polysome/monosome (P/M) ratio. Accordingly, we next examined polysome
profiles for the isogenic strains Hm296g (gcd14-2) and
Hm296G (GCD14) grown at 39°C, where the gcd14-2 mutant exhibits a more detectable growth defect in liquid medium. As
shown in Fig. 3, the P/M ratio was
considerably lower in the gcd14-2 mutant (P/M ratio, 2.4)
than in its isogenic GCD14 parent strain (P/M ratio, 5.7)
after 1.5 h at 39°C. There was also a small reduction in the
average size of the polysomes in the gcd14-2 mutant at
39°C (see Fig. 3 legend). Although these differences in polysome size
and content are not dramatic, they were consistently observed in three
independent experiments (see Fig. 3 legend). These data suggest that
the gcd14-2 mutants exhibit a modest defect in general
translation initiation. The magnitude of this defect is less than that
observed in gcd1 or gcd2 mutants, consistent with
the lesser derepression of GCN4 translation associated with gcd14 versus gcd1 or gcd2 mutations
(17, 26).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Polysome profiles of isogenic gcd14-2 and
GCD14 strains. Isogenic strains Hm296g and Hm296G were
cultured overnight in yeast extract-peptone-dextrose at 23°C and used
to inoculate two flasks containing 300 ml of yeast
extract-peptone-dextrose to an optical density at 600 nm of ~0.1.
Cultures were incubated at room temperature in a rotary shaker at 250 rpm. At an optical density at 600 nm of ~4.0, cells were collected
and resuspended in the appropriate volume of yeast
extract-peptone-dextrose prewarmed to 39°C and grown to an optical
density at 600 nm of ~2.0. From both flasks, 150 ml was collected
immediately for the 39°C, t = 0 samples, and 150 ml
of fresh prewarmed yeast extract-peptone-dextrose was added back to
each flask. Samples of 150 ml were collected from both flasks after
1.5 h and processed for polysome analysis by velocity
sedimentation of whole-cell extracts on sucrose gradients
(22). Gradients were fractionated while being scanned at 254 nm, and the resulting absorbance profiles are shown, with the tops of
the gradients on the left. The positions of 40S, 60S, and 80S ribosomal
species are indicated by arrows. For each strain, the top two gradients
correspond to samples incubated at 39°C for 0 h (t = 0) and the two bottom gradients contain samples obtained after
1.5 h of incubation at 39°C. Areas delimited inside the profiles
correspond to the fractions of the total absorbance profiles
represented by 2-mer and 3-mer polysomes. In the gcd14-2
strain, the 2-mers and 3-mers represented 26% of the polysome mass at
the permissive temperature but comprised 32% of the polysomes after
1.5 h at 39°C. In contrast, 2-mers and 3-mers represented 24 and
25% of the polysome mass at 23°C and after 1.5 h at 39°C,
respectively, in the wild-type strain Hm296G. The P/M ratios were
calculated at t = 0 and t = 1.5 h for
three independent experiments, and the following mean values and
standard errors (in parentheses) were obtained: at t = 0, P/M = 4.2 (0.83) for GCD14 and 2.8 (0.44) for
gcd14-2; at t = 1.5 h, P/M = 5.2 (0.35)
for GCD14 and 3.5 (0.72) for gcd14-2.
|
|
Genes encoding initiator tRNAMet or Lhp1p are dosage
suppressors of the Gcd
and Slg
phenotypes
of gcd14 mutants.
gcd10 and gcd14
mutations lead to constitutive derepression of GCN4
translation in the absence of Gcn2p (Gcd
phenotype),
conferring resistance to 3AT in a gcn2 strain background (17, 26). We found recently (3) that the
3ATr and Ts
phenotypes conferred by
gcd10 mutations in a gcn2 background can be fully
suppressed by the presence in high copy number of any of the four
genes, IMT1 to IMT4, encoding
tRNAiMet (11, 14) and can be partially
suppressed by high-copy-number LHP1 (39, 60). In
view of the physical interaction found between Gcd10p and Gcd14p
(3), we asked whether the dosage suppressors of
gcd10 mutations could also suppress the 3ATr and
Slg
phenotypes conferred by gcd14 mutations.
Each of the four IMT genes on high-copy-number
plasmids (hcIMT) suppressed the 3ATr (data not
shown) and Slg
(Fig. 4)
phenotypes in gcd14-1 gcn2-101 and gcd14-2
gcn2-101 mutants to about the same extent as did a
low-copy-number plasmid containing GCD14, whereas
high-copy-number LHP1 (hcLHP1) only partially
suppressed the mutant Slg
phenotype (Fig. 4 and
data not shown). hcGCD10 had no suppressor activity in
the gcd14 mutants (Fig. 4), and neither single-copy GCD14 nor hcGCD14 suppressed the phenotypes of
mutants containing different gcd10 alleles (data not shown).
Furthermore, suppression by hcIMT and hcLHP1
seems to be specific for gcd10 and gcd14, as
temperature-sensitive mutations in genes encoding subunits of
translation initiation factors eIF2 and eIF3 (sui2-1 and
prt1-1, respectively) were not suppressed by these dosage
suppressors (3).

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
Phenotypes of gcd14 dosage suppressors. Eight
independent transformants of strains Hm295 (gcd14-1) and
Hm296 (gcd14-2) carrying empty vector pRS426
(gcd14), a low-copy-number plasmid bearing GCD14
(pRC56), or high-copy-number plasmids bearing IMT1 (p2632),
IMT2 (p2633), IMT3 (p2634), IMT4
(p2635), GCD10 (pE107), or LHP1 (p2636) were
streaked for single colonies on minimally supplemented SD plates and
incubated at 28°C (top plates) or 37°C (bottom plates) for 2 days.
The locations of the transformants on plates are indicated inside the
central schematic.
|
|
gcd14 mutants are defective in processing the primary
precursors of the initiator tRNAMet.
High-copy-number
IMT1, -2, -3, and -4 and
LHP1 suppress the phenotypes of gcd10 mutants
because these mutants contain reduced amounts of mature
tRNAiMet, and the dosage suppressors compensate for
this defect by increasing mature tRNAiMet to nearly
wild-type (hcLHP1) or higher-than-wild-type
(hcIMT) levels (3). Accordingly, we used Northern
analysis to investigate whether steady-state levels of mature
tRNAiMet were also reduced in gcd14 mutants
H160 (gcd14-1) and H168 (gcd14-2) compared to
that in their parental wild-type strain (H117). The probe for
tRNAiMet, containing sequences complementary to
nucleotides 33 to 64 in tRNAiMet, hybridizes to both
mature tRNAiMet and different precursor
tRNAiMet species bearing unique 5'-3' extensions
encoded by the different IMT genes (3) (see
Materials and Methods). The Northern data in Fig.
5 were quantified with a phosphorimager,
and the results are given in Table 2.
Relative to the level of elongator tRNAMet
(tRNAeMet), we calculated that the amounts of mature
tRNAiMet in the mutant strains were ca. half of that in
the wild-type strain both at 28°C and after 1.5 h at 37°C
(Fig. 5A; Table 2). In addition, the levels of tRNAiMet
precursors were 2.3- and 3.2-fold higher at 28 and 37°C,
respectively, leading to a fivefold increase in the ratio of precursor
to mature tRNAiMet in the gcd14 mutants
versus the wild type (Fig. 5A; Table 2). These data strongly suggest
that Gcd14p is required for efficient processing of the nascent
tRNAiMet transcripts. It is noteworthy that
tRNAiMet species migrating faster than the wild-type
mature form were detected in both gcd14 mutants under all
conditions (species f in Fig. 5A), suggesting that fully
5'-3'-processed tRNAiMet is either unstable or
incorrectly processed in these mutants. Similar results were obtained
for a gcd14-2 mutant by Anderson et al. (3),
although the accumulation of pre-tRNAiMet at 37°C was
less extensive than that observed here.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
gcd14 mutants are defective in processing the
primary precursors of initiator tRNAMet and
tRNAUAUIle. Northern blot analysis of total RNA (10 µg) isolated from strains H117 (GCD14), H160
(gcd14-1), and H168 (gcd14-2) grown in yeast
extract-peptone-dextrose medium at 28°C to mid-exponential phase (0 h
at 37°C) and shifted to 37°C for 1.5 h is shown. The blot was
probed with a radiolabeled oligonucleotide that specifically hybridized
to tRNAiMet (A) and then was stripped and reprobed with
radiolabeled oligonucleotides specific for tRNAeMet (B)
or tRNAUAUIle (C) (see Materials and Methods). The
positions of pre-tRNAiMet species, mature
tRNAiMet, tRNAeMet, and primary (upper
band) and 5'- and 3'-end-processed intron-containing (lower band)
pre-tRNAUAUIle and mature tRNAUAUIle
are indicated on the left. Indicated on the right are the positions of
pre-tRNAiMet containing 5' and 3' extensions encoded by
IMT2 and IMT3 (b), pre-tRNAiMet
containing 5' and 3' extensions encoded by IMT1 and
IMT4 (c), mature tRNAiMet (e), and
aberrantly processed tRNAiMet species (f) (see text for
details).
|
|
As described for
gcd10-504 (
3), the
gcd14-1 and
gcd14-2 mutations had little or no
effect on the size or steady-state amount
of elongator
tRNA
Met (Fig.
5B; Table
2). In the case of
tRNA
UAUIle, the
gcd14-1 and
gcd14-2 mutations led to small increases in
the amounts of
the primary transcript containing both 5' and 3'
extensions plus the
intron (slower-migrating species of pretRNA
UAUIle) and
possibly a small reduction in the levels of mature
tRNA
UAUIle in the mutant strains (Fig.
5C; Table
2).
Consequently, the
precursor tRNA/mature tRNA ratios for this tRNA were
slightly
elevated in the mutant versus the wild-type strain (Table
2),
albeit not to the extent observed for tRNA
iMet. A
similar result was obtained for tRNA
GTATyr (data not
shown). These results raise the possibility that Gcd14p
is
required primarily for efficient removal of 5' and 3' extensions
from
initiator tRNA
Met but may make a small contribution to the
processing of certain
other tRNAs besides the
initiator.
We confirmed by Northern analysis that the presence of hc
IMT
or hc
LHP1 plasmids in the
gcd14 mutants led to
increased levels
of mature tRNA
iMet, accounting for
their suppressor phenotypes. Transformants of
the
gcd14-1
strain containing hc
IMT1, hc
IMT2,
hc
IMT3, or hc
IMT4 had levels of mature
tRNA
iMet that were 3- to 7-fold higher than that
observed in a vector
transformant and 1.5- to 3.5-fold higher than that
seen in the
wild-type
GCD14 transformant (data not shown).
High-copy
LHP1 led to only a 1.5-fold increase in the level
of mature tRNA
iMet in the
gcd14-1 mutant
Hm295 at 37°C, reaching a level slightly
below that observed in the
GCD14 strain (data not shown). This
last finding is in
accordance with the fact that hc
LHP1 is a relatively
weak
suppressor of the Gcd

(data not shown) and
Slg

(Fig.
4) phenotypes of
gcd14-1.
Additive effects of gcd10-504 and gcd14-2
mutations on processing and accumulation of
tRNAiMet.
In view of the similar phenotypes of
gcd14 and gcd10 mutations, we investigated
possible genetic interactions between them. The gcd10-505
gcd14-2 double mutant Hm397 was transformed with low-copy-number
plasmids containing GCD10, GCD14, or empty
vectors to generate four isogenic transformants with the following
genotypes: (i) gcd10-505 gcd14-2, (ii) GCD10
gcd14-2, (iii) gcd10-505 GCD14, and (iv) GCD10
GCD14. As shown in Fig. 6A, the
gcd10-505 gcd14-2 double mutant grew more slowly at 28 and
34°C than did either single mutant, indicating additivity of the
growth defects conferred by these mutations. Northern analysis of the
transformants grown at 37°C showed that the gcd14-2 single
mutant contained high levels of tRNAiMet precursors and
a modest reduction in mature tRNAiMet levels relative
to the wild-type strain (Fig. 6B; Table
3), similar to the results described
above. Compared to the gcd14-2 mutant, the
gcd10-505 single mutant at 37°C showed a similar
accumulation of the precursors but a somewhat greater reduction
in mature tRNAiMet expression at 37°C (Fig. 6B,
lanes 6 to 8). Both mutants showed 7- to 10-fold increases in the
precursor tRNA/mature tRNA ratios for tRNAiMet (Table
3). These last findings are interesting because they suggest that
Gcd10p is also required for efficient end processing of
tRNAiMet. The gcd10-505 gcd14-2 double
mutant at 37°C showed a greater reduction in mature
tRNAiMet levels than did either single mutant,
exhibiting levels only 30% of that seen in the wild-type transformant
(Fig. 6B, lanes 5 to 8; Table 3). The additivity of these defects
in mature tRNAiMet expression suggests that
Gcd10p and Gcd14p participate in the same process involved in
pre-tRNAiMet processing.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Exacerbation of gcd14-2 phenotypes by a
gcd10-505 mutation. (A) The double mutant Hm423
(gcd10-505 gcd14-2) and isogenic GCD10 gcd14-2
(Hm420), gcd10-505 GCD14 (Hm421), and GCD10 GCD14
(Hm422) strains were streaked for single colonies on minimally
supplemented SD plates and incubated at 28, 34, or 37°C for 2 days.
The genotypes of the transformants are indicated adjacent to the
appropriate sectors of the 28°C plate. (B) Northern blot analysis of
total RNA (10 µg) isolated from the same strains analyzed in panel A,
conducted as described for Fig. 5 except that cells were grown in
minimally supplemented SD at 28°C (t = 0) (lanes 1 to
4) and then shifted to 37°C for 4 h (lanes 5 to 8). The blot was
probed for 5S rRNA, tRNAiMet, and
tRNAUAUIle as described for Fig. 5.
|
|
Following the temperature shift, the double-mutant culture increased in
mass by only about 30% (data not shown), whereas the
level of mature
tRNA
iMet was reduced by ca. 69% (Table
3). Therefore,
it appears that
the reduction in mature tRNA
iMet levels
cannot be accounted for by dilution of the preexisting
mature molecules
during cell growth following the temperature
shift. This implies that a
substantial fraction of the mature
tRNA
iMet was
degraded at 37°C in the double mutant. It is noteworthy that
the
level of tRNA
iMet precursors in the double mutant at
37°C, while higher than that
in the wild-type strain, was lower than
that seen in the single
mutants. This may indicate that the unprocessed
tRNA
iMet precursors which accumulate in the double
mutant also are degraded
more rapidly at 37°C than in the single
mutants. Finally, it is
interesting that the single and double mutants
showed ca. 10-fold-higher
levels of the tRNA
iMet
precursors at 28°C compared to the wild-type strain, even though
there was little or no reduction in mature tRNA
iMet
expression under these conditions (Table
3). Perhaps processing
of
tRNA
iMet is slower in the mutants at all temperatures
but this leads to
a deficit in mature tRNA
iMet levels
relative to other stable RNAs only at the high growth
rates occurring
at elevated
temperatures.
Similar to the results shown above for the
gcd14 single
mutants (Fig.
5), we observed modest (15 to 35%) reductions in mature
tRNA
UAUIle expression in the single and double mutants
analyzed in Fig.
6B; however, we did not observe additive reductions in
the levels
of mature tRNA
UAUIle upon combining
gcd14-2 and
gcd10-505 mutations (Table
3). There
were also small increases in the amounts of the
tRNA
UAUIle primary transcript in the single and double
mutants at 28°C and
in the single mutants at 37°C (Fig.
6B),
suggesting that processing
of this precursor occurred more slowly in
the mutants. Interestingly,
the primary
tRNA
UAUIle precursor did not accumulate in the
double mutant at 37°C, perhaps
indicating that it is more
susceptible to degradation, as suggested
above for
pre-tRNA
iMet. Thus, as concluded above, the
gcd10 and
gcd14 mutations have
considerably
smaller effects on the maturation of pre-tRNA
UAUIle
versus pre-tRNA
iMet, particularly in the
gcd10-505 gcd14-2 double mutant (Table
3).
In fact, as
shown next, maturation of tRNA
iMet appears to be the
only essential function of
Gcd14p.
GCD14 is dispensable in yeast strains overexpressing
initiator tRNAMet.
Having shown that GCD14
is essential and that gcd14 mutations impair the maturation
of pre-tRNAiMet, we asked whether overexpression of an
IMT gene would allow cells to survive in the absence of
Gcd14p. To test this possibility, we replaced one of the two
GCD14 alleles in the wild-type diploid strain YNG1 with the
gcd14::URA3 deletion-insertion allele and verified
the gene replacement by Southern blot analysis (data not shown).
After sporulation of the resulting
GCD14/gcd14::URA3 diploid, tetrad analysis
revealed the expected 2+:2
segregation for
cell viability, and all viable spores were Ura
(bearing
GCD14). When the GCD14/gcd14::URA3
diploid, which is homozygous for leu2, was first transformed
with a high-copy-number LEU2 plasmid p1775 bearing
IMT4 (20) and then subjected to tetrad analysis,
20 of 32 tetrads showed a 4+:0
segregation
for cell viability and 2+:2
segregation for
the Ura phenotype. Importantly, all of the Ura+ spores
(bearing gcd14::URA3) were Leu+
(bearing hcIMT4 on p1775) (data not shown). These results
showed that p1775 (hcIMT4) overcame the lethality of the
gcd14::URA3 deletion. The
gcd14::URA3 hcIMT4 and GCD14
hcIMT4 strains derived from one tetrad grew similarly at 28 and 37°C (Fig. 7A, spores 7A to 7D). In
a second tetrad, however, the two gcd14::URA3
hcIMT4 strains grew more slowly than did the
GCD14 hcIMT4 strains, particularly at 37°C
(Fig. 7A, spores 5A to 5D). Thus, at least in certain genetic
backgrounds (e.g., spores 7C and 7D), overexpression of tRNAiMet from IMT4 makes Gcd14p dispensable
for growth at 28 and 37°C.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
GCD14 is not essential in the presence of
hcIMT4. (A) Ascospore clones from two four-spored tetrads
(designated 5 and 7) were obtained from a heterozygous
GCD14/gcd14::URA3 diploid (YNG1) containing
high-copy-number plasmid p1775 (hcIMT4) (20). The
four strains from each tetrad (5A to 5D and 7A to 7D), all containing
hcIMT4, were streaked for single colonies on minimally
supplemented SD medium and incubated at 28 or 37°C for 3 days. The
position of each spore clone and its GCD14 genotype is
indicated adjacent to the appropriate plate sector. +, wild-type
GCD14; , gcd14::URA3. (B) Northern
blot analysis of total RNA (10 µg) isolated from the spore clones of
tetrad 5 (strains 5A to 5D) bearing hcIMT4 (described for
panel A). The strains were grown to mid-logarithmic phase in minimally
supplemented SD medium at 28°C (t = 0 at 37°C) and
shifted to 37°C for 4 h. The blot was probed for
tRNAiMet, tRNAeMet, or
tRNAUAUIle as described for Fig. 5.
|
|
We conducted Northern blot analysis of the eight strains from the two
tetrads just described, all containing hc
IMT4. As shown
in
Fig.
7B, the
gcd14::URA3 hc
IMT4 strains
accumulated 3- to 10-fold-higher
levels of the
pre-tRNA
iMet species, most of which derive from
hc
IMT4 (
3), than did the
congenic
GCD14 hc
IMT4 strains. Thus, it appears that
processing
of this overproduced precursor is impaired in strains
lacking
GCD14. The mature tRNA
iMet was
reduced by ca. half at 37°C in only two of the four
gcd14::URA3 hc
IMT4 strains (spore
clones 5D and 7D) versus the four
GCD14 hc
IMT4
strains (Fig.
7B and data not shown). Thus, in certain
genetic
backgrounds (spore clones 5B and 7C), overproduction of
pre-tRNA
iMet from hc
IMT4 completely overcame
the requirement for Gcd14p to
express high levels of mature
tRNA
iMet. However, species migrating faster than mature
tRNA
iMet were visible in the two deletion strains in
tetrad 5 (Fig.
7B)
and also in tetrad 7 (data not shown), suggesting
that a fraction
of the mature fully processed tRNA
iMet
present in the
gcd14::URA3 hc
IMT4
strains may be improperly processed
or partially degraded and thus be
nonfunctional in translation.
The
gcd14::URA3
hc
IMT4 strains showed little or no defect in expression
of
elongator tRNA
Met and the mature form of
tRNA
UAUIle (Fig.
7B); however, there was a modest
accumulation of the primary
(slower-migrating) precursor for
tRNA
UAUIle, particularly at 37°C, reaching at levels
ca. 1.5- to 4-fold
higher than those seen in
GCD14
hc
IMT4 strains (Fig.
7B).
Deletion of LHP1 exacerbates the phenotypes of
gcd14 mutations.
To investigate the role of Lhp1p in
processing of tRNAiMet precursors in gcd14
mutants, we disrupted LHP1 with the LEU2 gene in
wild-type GCD14 and gcd14 mutant strains (see
Materials and Methods). The lhp1::LEU2 mutation
did not affect the growth rate of the wild-type strain H117, in
agreement with previous results (60); however, it greatly
exacerbated the Slg
phenotypes of the gcd14-1
and gcd14-2 mutants (Fig. 8A).
In addition, we observed additive effects of the
lhp1::LEU2 and gcd14 mutations on the
levels of mature tRNAiMet. Whereas the
lhp1::LEU2 allele reduced mature
tRNAiMet by only ca. 27% in GCD14 cells, it
caused reductions of ca. 60% in gcd14-1 and
gcd14-2 cells (Fig. 8B; Table
4). The levels of tRNAiMet precursors also were greatly diminished by the
lhp1::LEU2 mutation in all three backgrounds, with
reductions of 77, 86, and 68% in the GCD14,
gcd14-1, and gcd14-2 strains, respectively (Fig.
8B; Table 4). Lhp1p has been implicated in stabilizing precursors and
promoting correct 3' end processing of certain tRNAs (61). Thus, to account for the reduced amounts of mature
tRNAiMet seen in the double mutants, we suggest that
deletion of LHP1 leads to degradation of a substantial
fraction of the tRNAiMet precursors and that this
degradation is more extensive in the gcd14 mutants than in
the GCD14 strain.



View larger version (141K):
[in this window]
[in a new window]
|
FIG. 8.
Synthetic interactions of gcd14 and
lhp1::LEU2 mutations. (A) Strains YNG174
(GCD14), YNG175 (gcd14-1), and YNG176
(gcd14-2) and the isogenic
lhp1::LEU2-containing derivatives Hm406
(GCD14 lhp1::LEU2), Hm407 (gcd14-1
lhp1::LEU2), and Hm408 (gcd14-2
lhp1::LEU2) were streaked for single colonies on
minimally supplemented SD plates and incubated at 28 or 37°C for 2 days. The locations of the strains are indicated by their relevant
genotypes in the schematic at the top. (B) Northern blot analysis of
total RNA (20 µg) isolated from the strains described for panel A and
separated by electrophoresis in a 6% polyacrylamide-8.3 M urea gel.
Strains were grown in minimally supplemented SD at 28°C. The blot was
probed for tRNAiMet, tRNAUAUIle,
tRNAeMet, and tRNACGASer by using the
appropriate oligonucleotides (see Materials and Methods). Indicated on
the right of the top panel are the positions of various precursor and
processed forms of tRNAiMet, as described in the legend
to Fig. 5. The positions of precursor and mature
tRNACGASer species are indicated on the right of
the bottom panel: a primary precursor containing 5' and 3' extensions
(g), a processing intermediate containing only the 3' extension (h), a
5'- and 3'-end-processed intron-containing precursor (i), and mature
tRNACGASer (j). (C) The Northern blot in panel B was
probed for RPR1 RNA, NME1 RNA, 5S rRNA, and U6 RNA by using the
appropriate oligonucleotides (see Materials and Methods). The positions
of precursor and mature RPR1 species are indicated on the left.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Effects of combining gcd14 and
lhp1::LEU2 mutations on expression of
tRNAiMet, tRNAeMet,
tRNAUAUIle, tRNACGASer, and RPR1,
NME1, and U6 RNAsa
|
|
In contrast to the findings for tRNA
iMet, there were
relatively small effects of deletion of
LHP1 on the levels
of the precursor
and mature forms of tRNA
UAUIle in all
three strains, and there was little indication that the
lhp1::LEU2 and
gcd14 mutations
had additive effects on expression
of the fully processed form of
this tRNA (Fig.
8B; Table
4).
Thus, similar to our findings for
gcd10 gcd14 double mutants (Fig.
6), expression
of tRNA
UAUIle was relatively insensitive to
mutations which showed strong additive
effects on the production of
mature tRNA
iMet. No defects whatsoever in expression of
elongator tRNA
Met in the single or double mutants relative
to that in the wild
type were observed (Fig.
8B; Table
4). However, we
observed a
substantial reduction (70%) in the level of mature
tRNA
CGASer in the
gcd14-1
lhp1::LEU2 double mutant compared to the
corresponding
gcd14-1 single mutant and an additive effect
of a lesser degree
for this tRNA in the
gcd14-2
lhp1::LEU2 double mutant (Fig.
8B;
Table
4). Unlike
the situation for tRNA
iMet, the amounts of
tRNA
CGASer precursors were decreased, rather than
increased, by the
gcd14 single mutations; however, for both
tRNAs, deletion of
LHP1 greatly
reduced the amounts of
precursors in both
GCD14 and
gcd14 backgrounds.
Thus, Gcd14p and Lhp1p may both function in stabilizing the
tRNA
CGASer precursors. It is unknown whether
tRNA
CGASer contains m
1A at position 58 (
57).
We next considered the possibility that expression of other RNA
polymerase III transcripts was also reduced in the
gcd14
lhp1::LEU2 double mutants. As shown in Fig.
8C, the
levels of 5S rRNA were
nearly indistinguishable among the
gcd14 and
lhp1::LEU2 single
and double
mutants. In contrast, we observed strong additive effects
of
gcd14-1 and
lhp1::LEU2 on expression of
both the RPR1 and NME1
transcripts. These are the RNA components of
RNase P and RNase
MRP, which are involved in the processing of tRNAs
and rRNA, respectively
(
38,
54). We observed a similar
interaction between
gcd14-2 and
lhp1::LEU2 for NME1 RNA, but a lesser effect for
RPR1 RNA,
in this double mutant versus the
gcd14-1
lhp1::LEU2 strain (Table
4). It is interesting that
deletion of
LHP1 reduced the amount
of RPR1 precursor in all
three strains, and this effect was especially
marked in the
gcd14-1 background. As suggested above for
tRNA
iMet, Lhp1p may increase the stability of pre-RPR1
RNA, and this function
may be critically required for production of
mature RPR1 in
gcd14-1 mutants. Finally, U6 RNA showed
modest reductions in both
gcd14 lhp1::LEU2 double
mutants compared to that in the corresponding
single mutants, similar
in magnitude to those described above
for tRNA
UAUIle
(Fig.
8B; Table
4). Taken together, the results in Fig.
8B and
C
strongly suggest that Gcd14p and Lhp1p cooperate in maturation
and
accumulation of a subset of RNA polymerase III transcripts.
In the case
of tRNA
iMet, a requirement for Gcd14p can be readily
observed in mutants
defective for only this protein, whereas for
tRNA
CGASer, NME1, and RPR1, a strong
dependence on Gcd14p is revealed only
in the absence of
Lhp1p.
We showed previously that Gcd14p copurified with a polyhistidine-tagged
form of Gcd10p on nickel affinity resin and that neither
protein was
stably associated with the
PRT1-encoded subunit of
eIF3
(
3). Moreover, Gcd10p and Gcd14p were not detected in
a
highly purified eIF3 complex (
48), and both proteins showed
prominent nuclear localization (
3). Thus, it appears that
Gcd10p
and Gcd14p reside in a nuclear protein complex distinct from
eIF3.
In view of the genetic interactions between
gcd14
mutations and
the
lhp1::LEU2 allele, it was of
interest to determine whether
Lhp1p is tightly associated with the
Gcd10p-Gcd14p complex. To
answer this question, we investigated whether
Lhp1p could be coimmunoprecipitated
from cell extracts with an
HA-tagged form of Gcd10p. It was shown
previously that the
GCD10-HA allele employed for this study and
wild-type
GCD10 were indistinguishable in the ability to complement
the lethal phenotype of a
gcd10::URA3 mutation
(
3). Whole-cell
extracts were prepared from isogenic
GCD10-HA or
GCD10 strains
containing either a
high-copy-number plasmid bearing
LHP1 or an
empty vector and
were immunoprecipitated with monoclonal anti-HA
antibodies. As
expected, comparable proportions of Gcd14p and
HA-Gcd10p were
immunoprecipitated with anti-HA antibodies from
the extracts prepared
from strains containing
GCD10-HA, but neither
protein was
immunoprecipitated from the
GCD10 extract (Fig.
9A,
lanes 4, 6, and 8). No detectable
Lhp1p was coimmunoprecipitated
with HA-Gcd10p and Gcd14p, even when
Lhp1p was greatly overexpressed
(Fig.
9A, lanes 4 and 6, and B, lane
6). In accordance with this
finding, no Lhp1p was detectable in a
preparation of the Gcd10p-Gcd14p
complex purified to homogeneity
(
48a). We conclude that Lhp1p
is not tightly associated with
the Gcd10p-Gcd14p complex in cell
extracts.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 9.
Gcd14p, but not Lhp1p, is tightly associated with Gcd10p
in cell extracts. (A) Whole-cell extracts were prepared as described
previously (47) from strains H1515 (LHP1) and
YJA113 (lhp1) and from transformants of YJA142
(GCD10HA) or YJA143 (GCD10) bearing
high-copy-number plasmid p2626 containing LHP1 or empty
vector YEp24. Aliquots containing 200 µg of total cell protein were
mixed with 2 to 4 µg of anti-HA monoclonal antibody HA.11 (Babco),
which was prebound to protein A-Sepharose for 2 h on ice, and the
mixture was incubated for 1 h at 4°C. After three washes with
lysis buffer (20 mM Tris-HCl [pH 7.4], 100 mM KCl, 1.0 mM Mg acetate,
0.1% [vol/vol] Triton X-100) containing one complete protease
inhibitor tablet (Boehringer Mannheim) per 25 ml, immunoprecipitates
were collected by centrifugation and proteins were eluted by boiling in
Laemmli buffer (37). The total proteins immunoprecipitated
from 200 µg (pellet [P]; lanes 4, 6, and 8) or 50 µg of the
starting whole-cell extracts (input [I]; lanes 3, 5, and 7) were
separated by SDS-polyacrylamide gel electrophoresis (36) and
transferred to a nitrocellulose membrane (Millipore) in 25 mM Tris-192
mM glycine-0.1% SDS containing 20% (vol/vol) methanol. Lanes 1 and 2 contain 50 µg of the starting whole-cell extracts from strains H1515
and YJA113, respectively, which were included to establish the identity
of Lhp1p. The membrane was blocked overnight at 4°C in BLOTTO (5%
[wt/vol] nonfat dry milk, 10 mM Tris-HCl [pH 7.4], 150 mM NaCl,
0.05% [vol/vol] Tween 20). A single immunoblot was probed with 3 µg of rabbit anti-HA antibody HA.11 (Babco) per ml, stripped,
reprobed with a 1:1,000 dilution of anti-Gcd14p antibodies (see
Materials and Methods), and reprobed with a 1:1,000 dilution of
anti-Lhp1p antibodies (60). Immune complexes were detected
with horseradish peroxidase-conjugated sheep antimouse (Amersham) or
donkey antirabbit (Amersham) secondary antibodies and an enhanced
chemiluminescence kit (ECL; Amersham). (B) A longer exposure of lanes 5 and 6 of the blot in panel A probed with anti-Lhp1p antibodies,
included to detect small amounts of Lhp1p in the immunoprecipitates.
|
|
 |
DISCUSSION |
Evidence that Gcd14p is required for efficient processing of
tRNAiMet.
Recessive gcd14 mutations
confer constitutive derepression of GCN4 mRNA translation in
the absence of eIF2
phosphorylation (17), a phenotype
generally indicating reduced formation of the
eIF2-GTP-tRNAiMet ternary complex (20).
gcd14 mutants also have a Slg
phenotype, and
we found that general translation initiation is slightly impaired in
these mutants, at least at elevated temperatures (Fig. 3). In addition,
deletion of GCD14 is lethal. These findings suggest that
Gcd14p has an essential function required for ternary complex formation
in vivo. In agreement with this conclusion, we found that
gcd14 mutants contain approximately 50% lower steady-state levels of mature tRNAiMet than are present in isogenic
wild-type strains (Tables 2 to 4). They also contain processed
tRNAiMet molecules that appear to be smaller than
wild-type mature tRNAiMet (Fig. 5 to 7, species f) and
thus may be defective in aminoacylation or ternary complex formation.
The Gcd
and Slg
phenotypes of the
gcd14 mutants were fully suppressed by introducing multiple
copies of the IMT genes encoding tRNAiMet,
which restored expression of mature tRNAiMet to
greater-than-wild-type levels. Moreover, the presence of
hcIMT4 overcame the lethality of a gcd14
deletion. The phenotypes of nonlethal gcd14 mutations also
were partially suppressed by hcLHP1, which increased the
level of mature tRNAiMet to just below wild-type
levels. Together, these findings indicate that the essential function
of Gcd14p is required for efficient and accurate production of mature
tRNAiMet.
The fact that
gcd14 mutants exhibit tRNA
iMet
precursor tRNA/mature tRNA ratios 5- to 10-fold higher than wild type
(Fig.
5; Table
2) is most easily explained by a defect in
pre-tRNA
iMet processing. The precursor molecules that
accumulate in
gcd14 mutants contain both 5' and 3'
extensions, indicating that both
cleavage of the 5' extension by RNase
P (
18) and removal of
the 3' extension by endo- or
exonucleases occur less efficiently
in
gcd14 mutants. The
accumulation of molecules shorter than wild-type
mature
tRNA
iMet in
gcd14 mutants could indicate
that a portion of the 5'- and
3'-processed tRNA
iMet
lacks the CCA triplet added posttranscriptionally to the 3' ends
of all
tRNAs (
18). Alternatively, these shorter molecules could
be
degradation
intermediates.
Evidence that Gcd14p and Gcd10p function together to promote
maturation of tRNAiMet in vivo.
Nonlethal
gcd10 mutations lead to reduced expression of mature
tRNAiMet and can be suppressed by hcIMT and
hcLHP1 (3), just as shown here for
gcd14 mutations (Fig. 4). Moreover, the lethal effect of
deleting GCD10 also could be suppressed by overexpression of tRNAiMet from high-copy-number IMT4
(3). Thus, the essential functions of both proteins, at
least at low growth temperatures, are required only for expression of
mature tRNAiMet. In addition to these genetic
similarities, we found that Gcd10p and Gcd14p can be
coimmunoprecipitated (Fig. 9) and copurified (3) from
whole-cell extracts. The physical association between these two
proteins has been confirmed by using a polyhistidine-tagged form of
Gcd10p to isolate a Gcd10p-Gcd14p complex from whole-cell extracts by
affinity chromatography (3) and by yeast two-hybrid analysis
(4). In addition, epitope-tagged forms of both proteins Gcd10p and Gcd14p were shown by immunofluorescence to exhibit prominent
nuclear localization in yeast cells (3). These findings strongly suggest that Gcd10p and Gcd14p reside in a nuclear complex that functions directly in the maturation of tRNAiMet.
Here we provided additional in vivo evidence for this conclusion by
showing that
gcd14-2 and
gcd10-505 mutations had
additive
effects on cell growth and expression of mature
tRNA
iMet. The double mutant at 28°C accumulated
higher levels of pre-tRNA
iMet than did either single
mutant, suggesting compounded defects
in processing. Moreover, the
gcd10-505 single mutant accumulated
tRNA
iMet
precursors concomitant with diminished amounts of mature
tRNA
iMet (Fig.
6B), implicating Gcd10p in
pre-tRNA
iMet processing. In a previous study we showed
that expression of
mature tRNA
iMet was reduced by ca.
fivefold after several hours at 37°C in a
gcd10-504
mutant; however, we observed no accumulation of
pre-tRNA
iMet at the restrictive temperature
in that strain (
3). This could
be explained by proposing
that the
gcd10-504 and
gcd10-505 (studied
here)
mutations both lead to defects in processing of
pre-tRNA
iMet but that the unprocessed molecules are
more susceptible to degradation
in the
gcd10-504 mutant than
in the
gcd10-505 or
gcd14 strains
analyzed here.
In accordance with this explanation, we obtained
evidence that both
precursor and mature tRNA
iMet were highly susceptible
to degradation in the
gcd10-505 gcd14-1 double mutant at
37°C (Fig.
6B), similar to our previous findings
for the
gcd10-504 single mutant (
3).
Thus far, we have observed no defect in pre-tRNA
iMet
synthesis or processing in cell extracts prepared from
gcd10
or
gcd14 mutants
(
3a). Therefore, Gcd10p and
Gcd14p do not appear to be essential
components of the processing
machinery. Our discovery that Gcd14p
contains two sequence motifs
conserved among S-AdoMet-dependent
methyltransferases, including at
least one tRNA methyltransferase
(
35), raised the
possibility that one or more nucleotides in
pre-tRNA
iMet is undermethylated in
gcd14
mutants. This could alter the conformation
of
pre-tRNA
iMet in a way that impairs removal of the 5' or
3' extensions or addition
of the CCA triplet to the 3' end. Consistent
with this possibility,
we recently found that m
1A is
lacking in total tRNA isolated from
gcd10
cells
(
3).
This base modification occurs at position 58 in the
initiator
and elongator forms of tRNA
Met, in
tRNA
GTATyr (also examined here), and in 15 other tRNAs
but is not found
at any other positions in yeast tRNAs (
57).
In the initiator,
the m
1A58 residue is involved in a unique
tertiary substructure not
observed in any elongator tRNAs, involving
three residues unique
to eukaryotic initiators, A60, A54, and A20
(
5). Thus, the
lack of methylation at position 58 could
perturb the structure
of initiator tRNA
Met, and impair its
processing and stability, without similarly affecting
elongator
tRNA
Met or other tRNAs bearing m
1A58. It is
unknown whether tRNA
UAUIle and
tRNA
CGASer, whose processing and accumulation were
slightly impaired in
gcd14 mutants, contain
m
1A58.
It remains to be determined whether the Gcd14p-Gcd10p complex is
directly responsible for m
1A58 formation in yeast tRNA and
whether Gcd14p has methylase activity,
as predicted from the presence
of S-AdoMet binding motifs. Considering
that Gcd10p has RNA binding
activity (
23), it might have a chaperone
function that would
facilitate methylation of pre-tRNA
iMet by Gcd14p in
wild-type cells. The results in Fig.
6B seem to
indicate that the
gcd10-505 mutation leads to degradation of the
unprocessed
precursors that accumulate in
GCD10 gcd14-2 cells.
Thus,
Gcd10p may also be required to protect hypomethylated
pre-tRNA
iMet from exonucleolytic degradation. If Gcd10p
performs a chaperone
function, it could conceivably interact with
mature tRNA
iMet in the cytoplasm and promote formation
of the ternary complex
with eIF2 and GTP. This hypothetical function
might explain why
Gcd10p copurified with eIF3 activity (
23),
as stabilizing the
ternary complex is a function ascribed to eIF3
(
47).
Evidence that Lhp1p is required to protect tRNAiMet
from degradation in gcd14 mutants.
In otherwise
wild-type cells, deletion of LHP1 led to substantially
decreased levels of precursor tRNAiMet and to only a
small reduction in mature tRNAiMet levels (Fig. 8B;
Table 4). This could be explained by postulating a role for Lhp1p in
transcription of the IMT genes. However, in view of the
allele-specific interactions between gcd14 mutations and the
lhp1::LEU2 deletion (Fig. 8B), plus the evidence
that Gcd14p functions in methylation and processing of
pre-tRNAiMet, we favor the idea that Lhp1p affects
tRNAiMet expression posttranscriptionally. As suggested
for other yeast tRNAs (61), binding of Lhp1p to the poly(U)
stretch at the 3' end of pre-tRNAiMet could stabilize
the conformation needed for precise endonucleolytic 3' cleavage and
block access by 3'-5' exonucleases. In the absence of Lhp1p, a
significant fraction of the pre-tRNAiMet would be
incorrectly trimmed at the 3' end and subsequently degraded, reducing
the yield of mature tRNAiMet.
Deletion of
LHP1 in the
gcd14 mutants led to
larger reductions in both precursor and mature tRNA
iMet
than in
GCD14 cells (Fig.
8B), suggesting a greater need for
the putative chaperone function of Lhp1p in
gcd14 versus
GCD14 cells. It was shown previously that a mutation in
yeast tRNA
CGASer makes its processing completely
dependent on Lhp1p, and the processing
intermediates appear to be
rapidly degraded when Lhp1p is depleted
from cells (
61). It
was proposed that Lhp1p was essential to
stabilize the conformation of
the mutant tRNA
CGASer to permit correct endonucleolytic
cleavage removal of the 3'
trailer. Similarly, the absence of
m
1A at position 58 could perturb the structure of the
initiator
tRNA
Met in
gcd14 mutants and create a
stronger requirement for binding
of Lhp1p to the 3' trailer to achieve
precise endonucleolytic
3' end processing. When Lhp1p was overexpressed
in
gcd14-1 cells,
it led to increased steady-state levels of
both precursor and
mature full-length tRNA
iMet and of
an intermediate precursor transcribed from
IMT2 and
IMT3 at 37°C containing the 3' extension (data not shown).
Through
increased binding to the 3' trailers of these precursors, the
overproduced Lhp1p could promote correct endonucleolytic cleavage,
as
suggested above, accounting for the ability of hc
LHP1 to
increase
expression of mature tRNA
iMet in
gcd14 mutants at elevated temperatures. This type of
functional
interaction between Gcd14p and Lhp1p in the maturation of
tRNA
iMet is consistent with the lack of strong physical
interaction between
these two proteins (Fig.
9).
Combining the deletion of
LHP1 with the
gcd14-1
mutation led unexpectedly to large reductions in the expression of NME1
RNA,
RPR1 RNA, and tRNA
CGASer, in addition to
tRNA
iMet. The
gcd14-2 lhp1::LEU2
mutant also contained substantially reduced
amounts of NME1 RNA. The
double mutants exhibited small reductions
in levels of
tRNA
UAUIle and U6 RNA compared to the corresponding
single mutants and had
wild-type levels of elongator
tRNA
Met and 5S rRNA (Fig.
8B). Thus, it appears that Gcd14p
and Lhp1p
cooperate in the maturation of a subset of RNA polymerase III
transcripts. Of the transcripts analyzed thus far, only
tRNA
iMet shows a strong requirement for Gcd14p in cells
containing Lhp1p.
The removal of Lhp1p reveals additional strong
requirements for
Gcd14p in the production of mature RPR1 RNA, NME1 RNA,
and tRNA
CGASer and a lesser requirement in U6
expression. Similarly to the tRNAs,
RPR1 RNA is transcribed as a
369-nucleotide precursor RNA with
84 nucleotides of 5' leader and up to
30 nucleotides of 3' trailing
sequences (
38). An intriguing
possibility is that Gcd14p is
required for methylation of pre-RPR1 RNA
and that the hypomethylated
RPR1 RNA present in
gcd14-2
mutants would be highly susceptible
to degradation in cells lacking
Lhp1p, as postulated above for
tRNA
iMet. It remains to
be determined whether RPR1 RNA is methylated.
Obviously, we cannot rule
out the possibility that combining the
gcd14 and
lhp1::LEU2 mutations in the same strains leads to
an
unforeseen indirect effect on transcription or maturation of NME1
RNA, RPR1 RNA, or tRNA
CGASer.
The fact that
gcd14 mutations alone lead to 30 to 40%
reductions in the levels of mature RPR1 RNA (Fig.
8B; Table
4) raises
the possibility that a reduction in RNase P activity contributes
to the
defect in processing of tRNA
iMet in
gcd14
single mutants. Perhaps the absence of m
1A58, with the
attendant defects in tertiary structure, renders
tRNA
iMet more susceptible than other tRNAs to
reductions in RNase P activity.
By the same token, it could be proposed
that the dramatic reductions
in RPR1 RNA levels observed in the
gcd14-1 lhp1::LEU2 double mutant
could largely
account for the additive effects of these mutations
in reducing mature
tRNA
iMet levels. However, it was shown previously that
depletion of Rpp1p,
a protein subunit of RNase P (
12,
58),
or a mutation in the
POP1-encoded subunit of RNase P
(
41) leads to accumulation of
unprocessed tRNA precursors
concomitant with reduced amounts of
the mature tRNAs. The fact that
both precursors and mature tRNA
iMet were greatly
diminished in the
gcd14-1 lhp1::LEU2 double mutant
(Fig.
8B) suggests that the unprocessed tRNA precursors, which
should
accumulate in response to reduced RNase P levels, are rapidly
degraded
in the absence of both Lhp1p and wild-type
Gcd14p.
It will be interesting to identify the complete role of the
Gcd10p-Gcd14p complex in modification and processing of different
RNA
polymerase III transcripts and to investigate further functional
molecular interactions between this complex and Lhp1p. We recently
found that deletion of
CPD1, the
GCD14 homologue
in fission yeast,
is not lethal but leads to accumulation of
tRNA
iMet precursors (
11a). Thus, it appears
that the function of Gcd14p
in tRNA
iMet maturation is
evolutionarily
conserved.
 |
ACKNOWLEDGMENTS |
Rafael Cuesta and Olga Calvo equally contributed to this work.
This work was supported by grants PB94-1103 and PB97-1122 from the
Spanish Dirección General de Enseñanza Superior (DGES) awarded to M.T. and by Collaborative Research Grant 920605 from NATO,
awarded to A.G.H. and M.T. O.C. and R.C. acknowledge support from
respective fellowships granted by the Spanish Ministerio de
Educación y Ciencia (MEC), through the Consejo Superior de Investigaciones Científicas (CSIC).
We thank Francisco Antequera and Dionisio Martín-Zanca for
helpful discussions regarding this work and José G. Castaño for critical reading and comments on the manuscript. We are also grateful to S. Wolin for the gift of the pKOIII plasmid and the Lhp1p antibodies.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Instituto de
Microbiología Bioquímica del CSIC/Universidad de
Salamanca, Edificio Departamental de Biología, Campus Miguel de
Unamuno, 37007 Salamanca, Spain. Phone: 34-923-121673. Fax:
34-923-224876. E-mail: tamame{at}gugu.usal.es.
M.T. dedicates this paper to the memory of Tomás Santos.
 |
REFERENCES |
| 1.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 2.
|
Altschul, S. F.,
M. S. Boguski,
W. Gish, and J. C. Wootton.
1994.
Issues in searching molecular sequence databases.
Nat. Genet.
6:119-129[Medline].
|
| 3.
|
Anderson, J.,
L. Phan,
R. Cuesta,
B. A. Carlson,
M. Pak,
K. Asano,
G. R. Björk,
M. Tamame, and A. G. Hinnebusch.
1998.
The essential Gcd10p-Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA.
Genes Dev.
12:3650-3662[Abstract/Free Full Text].
|
| 3a.
| Anderson, J., and A. G. Hinnebusch.
Unpublished observations.
|
| 4.
|
Asano, K.,
L. Phan,
J. Anderson, and A. G. Hinnebusch.
1998.
Complex formation by all five homologues of mammalian translation initiation factor 3 subunits from yeast Saccharomyces cerevisiae.
J. Biol. Chem.
273:18573-18585[Abstract/Free Full Text].
|
| 5.
|
Basavappa, R., and P. B. Sigler.
1991.
The 3 Å crystal structure of yeast initiator tRNA: functional implications in initiator/elongator discrimination.
EMBO J.
10:3105-3111[Medline].
|
| 6.
|
Boeke, J. D.,
J. Trueheart,
G. Natsoulis, and G. R. Fink.
1987.
5-Fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol.
154:164-175[Medline].
|
| 7.
|
Boulikas, T.
1993.
Nuclear localization signals (NLS).
Crit. Rev. Eukaryot. Gene Expr.
3:193-227[Medline].
|
| 8.
|
Brow, D. A., and C. Guthrie.
1990.
Transcription of a yeast U6 snRNA gene requires a polymerase III promoter element in a novel position.
Genes Dev.
4:1345-1356[Abstract/Free Full Text].
|
| 9.
|
Bushman, J. L.,
A. I. Asuru,
R. L. Matts, and A. G. Hinnebusch.
1993.
Evidence that GCD6 and GCD7, translational regulators of GCN4, are subunits of the guanine nucleotide exchange factor for eIF-2 in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:1920-1932[Abstract/Free Full Text].
|
| 10.
|
Bushman, J. L.,
M. Foiani,
A. M. Cigan,
C. J. Paddon, and A. G. Hinnebusch.
1993.
Guanine nucleotide exchange factor for eukaryotic translation initiation factor 2 in Saccharomyces cerevisiae: interactions between the essential subunits GCD2, GCD6, and GCD7 and the regulatory subunit GCN3.
Mol. Cell. Biol.
13:4618-4631[Abstract/Free Full Text].
|
| 11.
|
Byström, A. S., and G. R. Fink.
1989.
A functional analysis of the repeated methionine initiator tRNA genes (IMT) in yeast.
Mol. Gen. Genet.
216:276-286[Medline].
|
| 11a.
| Calvo, O., N. Gutiérrez, S. A. MacNeill, and
M. Tamame. Unpublished observations.
|
| 12.
|
Chamberlain, J. R.,
Y. Lee,
W. S. Lane, and R. Engelke.
1998.
Purification and characterization of the nuclear RNAse P holoenzyme complex reveals extensive subunit overlap with RNAse MRP.
Genes Dev.
12:1678-1690[Abstract/Free Full Text].
|
| 13.
|
Christianson, T. W.,
R. S. Sikorski,
M. Dante,
J. H. Shero, and P. Hieter.
1992.
Multifunctional yeast high-copy-number shuttle vectors.
Gene
110:119-122[Medline].
|
| 14.
|
Cigan, A. M., and T. F. Donahue.
1986.
The methionine initiator tRNA genes of yeast.
Gene
41:43-348.
|
| 15.
|
Cigan, A. M.,
E. K. Pabich,
L. Feng, and T. F. Donahue.
1989.
Yeast translation initiation suppressor sui2 encodes the subunit of eukaryotic initiation factor 2 and shares sequence identity with the human subunit.
Proc. Natl. Acad. Sci. USA
86:2784-2788[Abstract/Free Full Text].
|
| 16.
|
Cigan, A. M.,
M. Foiani,
E. M. Hannig, and A. G. Hinnebusch.
1991.
Complex formation by positive and negative translational regulators of GCN4.
Mol. Cell. Biol.
11:3217-3228[Abstract/Free Full Text].
|
| 17.
|
Cuesta, R.,
A. G. Hinnebusch, and M. Tamame.
1998.
Identification of GCD14 and GCD15, novel genes required for translational repression of GCN4 mRNA in Saccharomyces cerevisiae.
Genetics
148:1007-1020[Abstract/Free Full Text].
|
| 18.
|
Deutscher, M. P.
1995.
tRNA processing nucleases, p. 51-65.
In
D. Söll, and U. L. Rajbhandary (ed.), tRNA structure, biosynthesis, and function. ASM Press, Washington, D.C.
|
| 19.
|
Dever, T. E.,
L. Feng,
R. C. Wek,
A. M. Cigan,
T. D. Donahue, and A. G. Hinnebusch.
1992.
Phosphorylation of initiation factor 2 by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast.
Cell
68:585-596[Medline].
|
| 20.
|
Dever, T. E.,
W. Yang,
S. Astrom,
A. S. Bystrom, and A. G. Hinnebusch.
1995.
Modulation of tRNAiMet, eIF-2, and eIF-2B expression shows that GCN4 translation is inversely coupled to the level of eIF-2 · GTP · Met-tRNAiMet ternary complexes.
Mol. Cell. Biol.
15:6351-6363[Abstract].
|
| 21.
|
Dieckmann, C. L., and A. Tzagoloff.
1985.
Assembly of the mitochondrial membrane system.
J. Biol. Chem.
260:1513-1520[Abstract/Free Full Text].
|
| 22.
|
Foiani, M.,
A. M. Cigan,
C. J. Paddon,
S. Harashima, and A. G. Hinnebusch.
1991.
GCD2, a translational repressor of the GCN4 gene, has a general function in the initiation of protein synthesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:3203-3216[Abstract/Free Full Text].
|
| 23.
|
García-Barrio, M. T.,
T. Naranda,
C. R. Vázquez de Aldana,
R. Cuesta,
A. G. Hinnebusch,
J. W. B. Hershey, and M. Tamame.
1995.
GCD10, a translational repressor of GCN4, is the RNA-binding subunit of eukaryotic translation initiation factor-3.
Genes Dev.
9:1781-1796[Abstract/Free Full Text].
|
| 24.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[Medline].
|
| 25.
|
Hannig, E. M.,
A. M. Cigan,
B. A. Freeman, and T. G. Kinzy.
1993.
GCD11, a negative regulator of GCN4 expression, encodes the gamma subunit of eIF-2 in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:506-520[Abstract/Free Full Text].
|
| 26.
|
Harashima, S., and A. G. Hinnebusch.
1986.
Multiple GCD genes required for repression of GCN4, a transcriptional activator of amino acid biosynthetic genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
6:3990-3998[Abstract/Free Full Text].
|
| 27.
|
Hill, D. E., and K. Struhl.
1988.
Molecular characterization of GCD1, a yeast gene required for general control of amino acid biosynthesis and cell-cycle initiation.
Nucleic Acids Res.
16:9253-9265[Abstract/Free Full Text].
|
| 28.
|
Hinnebusch, A. G., and G. R. Fink.
1983.
Positive regulation in the general amino acid control of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
80:5374-5378[Abstract/Free Full Text].
|
| 29.
|
Hinnebusch, A. G.
1988.
Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae.
Microbiol. Rev.
52:248-273[Free Full Text].
|
| 30.
|
Hinnebusch, A. G.
1992.
General and pathway-specific regulatory mechanism controlling the synthesis of amino acid biosynthetic enzymes in Saccharomyces cerevisiae, p. 319-414.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces: gene expression, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Hinnebusch, A. G.
1996.
Translational control of GCN4: gene-specific regulation by phosphorylation of eIF2, p. 199-244.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Hinnebusch, A. G.
1997.
Translational regulation of yeast GCN4: a window on factors that control initiator-tRNA binding to the ribosome.
J. Biol. Chem.
272:21661-21664[Free Full Text].
|
| 33.
|
Ingrosso, D.,
A. V. Fowler,
J. Bleibaum, and S. Clarke.
1989.
Sequence of the D-aspartyl/L-isoaspartyl protein methyltransferases from human erythrocytes: common sequence motifs for protein, DNA, RNA and small molecule S-adenosylmethionine-dependent methyltransferase.
J. Biol. Chem.
264:20130-20139.
|
| 34.
|
Ito, H.,
Y. Fukada,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 35.
|
Kagan, R. M., and S. Clarke.
1994.
Widespread occurrence of three sequence motifs in diverse S-adenosylmethionine-dependent methyltransferases suggests a common structure for these enzymes.
Arch. Biochem. Biophys.
310:417-427[Medline].
|
| 36.
|
Kohrer, K., and H. Domdey.
1991.
Preparation of high molecular weight RNA.
Methods Enzymol.
194:398-405[Medline].
|
| 37.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 38.
|
Lee, J. Y.,
C. E. Rohlman,
L. A. Molony, and D. R. Engelke.
1991.
Characterization of RPR1, an essential gene encoding the RNA component of Saccharomyces cerevisiae nuclear RNase P.
Mol. Cell. Biol.
11:721-730[Abstract/Free Full Text].
|
| 39.
|
Lin-Marq, N., and S. G. Clarkson.
1995.
A yeast RNA binding protein that resembles the human autoantigen La.
J. Mol. Biol.
245:81-85[Medline].
|
| 40.
|
London, I. M.,
D. H. Levin,
R. L. Matts,
N. S. B. Thomas,
R. Petryshyn, and J. J. Chen.
1987.
Regulation of protein synthesis, p. 359-380.
In
P. D. Boyer, and E. G. Krebs (ed.), The enzymes, vol. 18. Academic Press, New York, N.Y.
|
| 41.
|
Lygerou, Z.,
P. Mitchell,
P. Petfalski,
B. Seraphin, and D. Tollervey.
1994.
The POP1 gene encodes a protein component common to the RNAse MRP and RNAse P ribonucleoproteins.
Genes Dev.
8:1423-1433[Abstract/Free Full Text].
|
| 42.
|
Mueller, P. P.,
S. Harashima, and A. G. Hinnebusch.
1987.
A segment of GCN4 mRNA containing the upstream AUG codons confers translational control upon a heterologous yeast transcript.
Proc. Natl. Acad. Sci. USA
84:2863-2867[Abstract/Free Full Text].
|
| 43.
|
Naranda, T.,
S. E. MacMillan, and J. W. B. Hershey.
1994.
Purified yeast translational initiation factor eIF-3 is an RNA-binding protein complex that contains the PRT1 protein.
J. Biol. Chem.
269:32286-32292[Abstract/Free Full Text].
|
| 44.
|
Natsoulis, G.,
F. Winston, and J. F. Boeke.
1994.
The SPT10 and SPT21 genes of Saccharomyces cerevisiae.
Genetics
136:93-105[Abstract].
|
| 45.
|
O'Connor, J. P., and C. L. Peebles.
1991.
In vivo pre-tRNA processing in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:425-439[Abstract/Free Full Text].
|
| 46.
|
Pavitt, G. D.,
W. Yang, and A. G. Hinnebusch.
1997.
Homologous segments in three subunits of the guanine nucleotide exchange factor eIF2B mediate translational regulation by phosphorylation of eIF2.
Mol. Cell. Biol.
17:1298-1313[Abstract].
|
| 47.
|
Peterson, D. T.,
W. C. Merrick, and B. Safer.
1979.
Binding and release of radiolabeled eukaryotic initiation factors 2 and 3 during 80S initiation complex formation.
J. Biol. Chem.
254:2509-2510[Abstract/Free Full Text].
|
| 48.
|
Phan, L.,
X. Zhang,
K. Asano,
J. Anderson,
H. P. Vornlocher,
J. R. Greenberg,
J. Qin, and A. G. Hinnebusch.
1998.
Identification of a translation initiation factor 3 (eIF3) core complex, conserved in yeast and mammals, that interacts with eIF5.
Mol. Cell. Biol.
18:4935-4946[Abstract/Free Full Text].
|
| 48a.
| Phan, L., J. Anderson, and A. G. Hinnebusch.
Unpublished observations.
|
| 49.
|
Riles, R.,
J. E. Dutchik,
A. Baktha,
B. K. McCauley,
E. C. Thayer,
M. P. Leckie,
V. V. Braden,
J. E. Depke, and M. V. Olson.
1993.
Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae.
Genetics
134:81-150[Abstract].
|
| 50.
|
Rose, M. D.,
P. Grisafi, and D. Botstein.
1984.
Structure and function of the yeast URA3 gene: expression in Escherichia coli.
Gene
29:113-124[Medline].
|
| 51.
|
Rose, M. D.,
P. Novick,
J. H. Thomas,
D. Botstein, and G. R. Fink.
1987.
A Saccharomyces cerevisiae genomic plasmid bank based on centromere-containing shuttle vector.
Gene
60:237-243[Medline].
|
| 52.
|
Rothstein, R. J.
1983.
One-step gene disruption in yeast.
Methods Enzymol.
101:202-211[Medline].
|
| 53.
|
Rowlands, A. G.,
R. Panniers, and E. C. Henshaw.
1988.
The catalytic mechanism of guanine-nucleotide-exchange factor action and competitive inhibition by phosphorylated eukaryotic initiation factor 2.
J. Biol. Chem.
263:5526-5533[Abstract/Free Full Text].
|
| 54.
|
Schmitt, M. E., and D. A. Clayton.
1992.
Yeast site-specific ribonucleoprotein endoribonuclease MRP contains an RNA component homologous to mammalian RNase MRP RNA and essential for cell viability.
Genes Dev.
6:1975-1985[Abstract/Free Full Text].
|
| 55.
|
Sherman, F.,
G. R. Fink, and C. W. Lawrence.
1974.
Methods of yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 56.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designated for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 57.
|
Sprinzl, M.,
C. Steegborn,
F. Hübel, and S. Steinberg.
1996.
Compilation of tRNA sequences and sequences of tRNA genes.
Nucleic Acids Res.
24:68-72[Free Full Text].
|
| 58.
|
Stolc, V., and S. Altman.
1997.
Rpp1, an essential protein subunit of nuclear RNase P required for processing of precursor tRNA and 35S precursor rRNA in Saccharomyces cerevisiae.
Genes Dev.
11:2414-2425[Abstract/Free Full Text].
|
| 59.
|
Yang, W., and A. G. Hinnebusch.
1996.
Identification of a regulatory subcomplex in the guanine nucleotide exchange factor eIF-2B that mediates inhibition by phosphorylated eIF-2.
Mol. Cell. Biol.
16:6603-6616[Abstract].
|
| 60.
|
Yoo, C. J., and S. L. Wolin.
1994.
La proteins from Drosophila melanogaster and Saccharomyces cerevisiae: a yeast homolog of the La autoantigen is dispensable for growth.
Mol. Cell. Biol.
14:5412-5424[Abstract/Free Full Text].
|
| 61.
|
Yoo, C. J., and S. L. Wolin.
1997.
The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors.
Cell
89:393-402[Medline].
|
| 62.
|
Zuo, S.,
E. Gibbs,
Z. Kelman,
Teresa S.-F. Wang,
M. O'Donnell,
S. A. Macneill, and J. Hurwitz.
1997.
DNA polymerase isolated from Schizosaccharomyces pombe contain five subunits.
Proc. Natl. Acad. Sci. USA
94:11244-11249[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 1999, p. 4167-4181, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Copela, L. A., Fernandez, C. F., Sherrer, R. L., Wolin, S. L.
(2008). Competition between the Rex1 exonuclease and the La protein affects both Trf4p-mediated RNA quality control and pre-tRNA maturation. RNA
14: 1214-1227
[Abstract]
[Full Text]
-
Ozanick, S. G., Bujnicki, J. M., Sem, D. S., Anderson, J. T.
(2007). Conserved amino acids in each subunit of the heteroligomeric tRNA m1A58 Mtase from Saccharomyces cerevisiae contribute to tRNA binding. Nucleic Acids Res
35: 6808-6819
[Abstract]
[Full Text]
-
Martin-Marcos, P., Hinnebusch, A. G., Tamame, M.
(2007). Ribosomal Protein L33 Is Required for Ribosome Biogenesis, Subunit Joining, and Repression of GCN4 Translation. Mol. Cell. Biol.
27: 5968-5985
[Abstract]
[Full Text]
-
COPELA, L. A., CHAKSHUSMATHI, G., SHERRER, R. L., WOLIN, S. L.
(2006). The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability.. RNA
12: 644-654
[Abstract]
[Full Text]
-
KADABA, S., WANG, X., ANDERSON, J. T.
(2006). Nuclear RNA surveillance in Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated tRNA and an aberrant form of 5S rRNA. RNA
12: 508-521
[Abstract]
[Full Text]
-
Park, J.-M., Kohn, M. J., Bruinsma, M. W., Vech, C., Intine, R. V., Fuhrmann, S., Grinberg, A., Mukherjee, I., Love, P. E., Ko, M. S., DePamphilis, M. L., Maraia, R. J.
(2006). The Multifunctional RNA-Binding Protein La Is Required for Mouse Development and for the Establishment of Embryonic Stem Cells. Mol. Cell. Biol.
26: 1445-1451
[Abstract]
[Full Text]
-
WOLIN, S.L., WURTMANN, E.J.
(2006). Molecular Chaperones and Quality Control in Noncoding RNA Biogenesis. Cold Spring Harb Symp Quant Biol
71: 505-511
[Abstract]
-
Conesa, C., Ruotolo, R., Soularue, P., Simms, T. A., Donze, D., Sentenac, A., Dieci, G.
(2005). Modulation of Yeast Genome Expression in Response to Defective RNA Polymerase III-Dependent Transcription. Mol. Cell. Biol.
25: 8631-8642
[Abstract]
[Full Text]
-
OZANICK, S., KRECIC, A., ANDERSLAND, J., ANDERSON, J. T.
(2005). The bipartite structure of the tRNA m1A58 methyltransferase from S. cerevisiae is conserved in humans. RNA
11: 1281-1290
[Abstract]
[Full Text]
-
Huang, Y., Intine, R. V., Mozlin, A., Hasson, S., Maraia, R. J.
(2005). Mutations in the RNA Polymerase III Subunit Rpc11p That Decrease RNA 3' Cleavage Activity Increase 3'-Terminal Oligo(U) Length and La-Dependent tRNA Processing. Mol. Cell. Biol.
25: 621-636
[Abstract]
[Full Text]
-
Arhin, G. K., Shen, S., Irmer, H., Ullu, E., Tschudi, C.
(2004). Role of a 300-Kilodalton Nuclear Complex in the Maturation of Trypanosoma brucei Initiator Methionyl-tRNA. Eukaryot Cell
3: 893-899
[Abstract]
[Full Text]
-
Kadaba, S., Krueger, A., Trice, T., Krecic, A. M., Hinnebusch, A. G., Anderson, J.
(2004). Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes Dev.
18: 1227-1240
[Abstract]
[Full Text]
-
Varshney, U., Ramesh, V., Madabushi, A., Gaur, R., Subramanya, H. S., RajBhandary, U. L.
(2004). Mycobacterium tuberculosis Rv2118c codes for a single-component homotetrameric m1A58 tRNA methyltransferase. Nucleic Acids Res
32: 1018-1027
[Abstract]
[Full Text]
-
Inada, M., Guthrie, C.
(2004). Identification of Lhp1p-associated RNAs by microarray analysis in Saccharomyces cerevisiae reveals association with coding and noncoding RNAs. Proc. Natl. Acad. Sci. USA
101: 434-439
[Abstract]
[Full Text]
-
Gu, W., Jackman, J. E., Lohan, A. J., Gray, M. W., Phizicky, E. M.
(2003). tRNAHis maturation: An essential yeast protein catalyzes addition of a guanine nucleotide to the 5' end of tRNAHis. Genes Dev.
17: 2889-2901
[Abstract]
[Full Text]
-
Cohen, A., Reiner, R., Jarrous, N.
(2003). Alterations in the intracellular level of a protein subunit of human RNase P affect processing of tRNA precursors. Nucleic Acids Res
31: 4836-4846
[Abstract]
[Full Text]
-
Droogmans, L., Roovers, M., Bujnicki, J. M., Tricot, C., Hartsch, T., Stalon, V., Grosjean, H.
(2003). Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures. Nucleic Acids Res
31: 2148-2156
[Abstract]
[Full Text]
-
Wu, L., Pan, J., Thoroddsen, V., Wysong, D. R., Blackman, R. K., Bulawa, C. E., Gould, A. E., Ocain, T. D., Dick, L. R., Errada, P., Dorr, P. K., Parkinson, T., Wood, T., Kornitzer, D., Weissman, Z., Willis, I. M., McGovern, K.
(2003). Novel Small-Molecule Inhibitors of RNA Polymerase III. Eukaryot Cell
2: 256-264
[Abstract]
[Full Text]
-
Hopper, A. K., Phizicky, E. M.
(2003). tRNA transfers to the limelight. Genes Dev.
17: 162-180
[Full Text]
-
Maraia, R. J.
(2001). La Protein and the Trafficking of Nascent RNA Polymerase III Transcripts. JCB
153: F13-F18
[Abstract]
[Full Text]
-
Maraia, R. J., Intine, R. V. A.
(2001). Recognition of Nascent RNA by the Human La Antigen: Conserved and Divergent Features of Structure and Function. Mol. Cell. Biol.
21: 367-379
[Full Text]
-
Qiu, H., Hu, C., Anderson, J., Björk, G. R., Sarkar, S., Hopper, A. K., Hinnebusch, A. G.
(2000). Defects in tRNA Processing and Nuclear Export Induce GCN4 Translation Independently of Phosphorylation of the alpha Subunit of Eukaryotic Translation Initiation Factor 2. Mol. Cell. Biol.
20: 2505-2516
[Abstract]
[Full Text]
-
Anderson, J., Phan, L., Hinnebusch, A. G.
(2000). The Gcd10p/Gcd14p complex is the essential two-subunit tRNA(1-methyladenosine) methyltransferase of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA
97: 5173-5178
[Abstract]
[Full Text]