INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Immediate-early genes (IEGs) are a functionally diverse family of genes that have in common induction by growth factors, cytokines, and serum. By definition, they are induced at the transcriptional level in response to a stimulus, and induction is not dependent on new protein synthesis (1, 29, 42, 43, 65). A potentially useful means of subclassifying the growing set of IEGs, and one with apparent mechanistic implications, is to divide the group into genes with fast or slow kinetics of induction. A well-characterized example of a fast-kinetics IEG is c-fos. Serum or platelet-derived growth factor (PDGF) added to quiescent 3T3 cells stimulates transcription of c-fos within 10 min. c-fos expression reaches peak levels within 30 min and returns to baseline levels within 2 h (24, 38). A cluster of three cis-acting regulatory elements contained within the proximal 350 nucleotides (nt) of 5' flanking sequences of c-fos mediate serum- and growth factor-stimulated induction of c-fos and have proven to be of general interest in problems of growth factor signal transduction. The three functionally distinct c-fos elements include a serum response element, a cyclic AMP response element, and an element responsive to platelet-derived growth factor B-B homodimers known as the sis-inducible element (3, 17, 21-23, 30, 67, 70-73). Furthermore, nuclear trans-acting proteins interacting with each of these cis-acting regulatory elements have been isolated and characterized (14, 31-33, 48, 51, 56, 57, 69). By both sequence analysis and functional analysis, the transcriptional regulatory elements defined initially within c-fos have also been detected within other fast-kinetics IEGs (8, 54, 58).

The c-fos gene, however, does not stand as a prototype for all members of the IEG set. A second subgroup of IEGs exists that is induced with slower kinetics than c-fos and by apparently different mechanisms (27, 28). Included in the slow-kinetics subset of IEGs are the clinically important c-myc oncogene (37) and the CC chemokine gene JE/MCP-1 (for monocyte chemoattractant protein 1; hereafter referred to as MCP-1) (5, 9, 25, 61, 63, 64). In contrast to the rapid but transient response exhibited by c-fos, slow IEGs like c-myc and MCP-1 display a greater than 60-min lag time before initiation of transcription (13, 26, 38). Significantly, no fos-like regulatory elements are found within several kilobases of 5' or 3' flanking sequences of the MCP-1 gene or within its coding sequences. The distinct induction kinetics of the MCP-1 gene, and other slow IEGs such as c-myc, therefore reflect the likely action of cis-acting genomic elements distinct from the trio described for c-fos.

We have reported previously that a discontiguous pair of cis-acting elements are both essential for regulated expression of MCP-1. One element, detected initially as a 240-bp fragment found 2.3 kb upstream of the MCP-1 start of transcription, contains four distinct PDGF-regulated elements and acts as a PDGF-regulated enhancer sequence (18-20). The second element required for serum and PDGF induction of MCP-1 was shown to be the seven-base motif TTTTGTA (or heptamer) located in the proximal 3' MCP-1 untranslated sequences. No single control element has been shown to function in regulated expression of both the fast and slow subclasses of IEGs. Interestingly, identical heptamers are found in the proximal 3' untranslated sequences of c-myc and at least 25 additional IEGs (20), suggesting that the heptamer could be a novel regulatory sequence playing an essential role in serum-, growth factor-, and cytokine-stimulated expression of both fast- and slow-kinetics IEGs. Until recently, the mechanism of action of the heptamer was unknown.

We have shown more recently that readdition to two non-MCP-1 reporter genes of (i) the PDGF-regulated distal 5' 240-bp fragment and (ii) a proximal 5' sequence fragment that does not contain the MCP-1 TATA or CAAT box results in a PDGF-inducible construct in transfection experiments in the absence of the heptamer (68a). These data highlight an apparent paradox, namely, that the TTTTGTA motif is essential for PDGF induction of tagged MCP-1 reporter genes (20) but is apparently dispensable for PDGF induction of two different non-MCP-1 reporter genes. One explanation for this paradox would be if the heptamer functioned to remove an inhibition of PDGF induction of MCP-1. The proposed inhibition of induction by PDGF could be maintained by an inhibitory element(s) present within the MCP-1 sequences (coding or flanking). Heterologous reporter genes lacking the inhibitory element sequence(s) would, in this model, not require the presence of the heptamer for induction by PDGF to occur.

In this report, we demonstrate that (i) a pair of distinct and independently acting inhibitory elements are present within the MCP-1 5' flanking sequences, (ii) inhibition of PDGF induction of MCP-1 is maintained by an inhibitory element in the absence of the heptamer, and (iii) the more potent of the inhibitory elements is present within a 59-nt portion of MCP-1 5' sequences and binds a single multiprotein regulatory complex. We demonstrate further that the inhibitory element-binding complex contains the Sp3 transcription factor, an Sp1-like protein, and an apparently novel DNA-binding protein that bind to two distinct DNA-binding sequences within the overall 59-nt inhibitory element sequence. We propose to call the multiprotein, multi-DNA-binding site inhibitory element-binding complex a repressosome.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Growth factors and reagents. The recombinant B-B isoform of PDGF was obtained from Intergen. RNase A was from Pharmacia. Proteinase K, RNase T1, calf intestinal phosphatase, and poly(dI-dC) were from Boehringer Mannheim Biochemicals. Bovine calf serum was obtained from Hyclone. Human defibrinogenated platelet-poor plasma was prepared as previously described (55). Recombinant Sp1 was obtained from Promega. A monoclonal antibody to Sp1 (1C6, designated anti-Sp1-2 in Fig. 6) and polyclonal antibodies to Sp1 (PEP2, designated anti-Sp1-1 in Fig. 6), Sp2, Sp3, and Sp4 were obtained from Santa Cruz Biotechnology. Rabbit immunoglobulin G was obtained from Sigma. Synthetic oligonucleotides were obtained from Life Technologies.

Cell culture, DNA transfections, stimulation assays, and RNA preparation and analysis. NIH 3T3 cells were maintained in Dulbecco's modified Eagle medium (GIBCO Laboratories) supplemented with 10% bovine calf serum. NIH 3T3 cells were used for transient transfections because of their significantly greater transfection efficiency compared with BALB/c-3T3 cells and were transfected as previously described (18, 19). Transfection mixtures included 4 to 5 µg of tagged MCP-1 reporter constructs together with 4 µg of an -globin reference construct (pSV-1) per 15-cm-diameter tissue culture plate. After transfection, cells were maintained for 40 to 44 h in 5% platelet-poor plasma and then exposed to the B-B isoform of PDGF (30 ng/ml) for the times indicated in the figure legends. Total RNA was prepared by using Tripure reagent (Boehringer Mannheim) and following the manufacturer's instructions.

Oligonucleotides. Double-stranded oligonucleotides containing 5' overhanging GG (top strand) and CC (bottom strand) ends were used. All of the sequences shown are of the top strand. Mutations of the I*, I*5', and I*3' sequences are underlined. The I*m1 and I*5'm oligonucleotides include the 12-nt mutation discussed in Results. The I*m2 and I*3'm oligonucleotides include the 8-nt mutation discussed in Results. The sequences are as follows: I*, GCACCAGCCCCACCCCCACCCCGTGTCACCTGTGTTACCTATGGGTAATTAGGTTTTTG; I*m1, GCACCAATGAAGTTGATCCCCCGTGTCACCTGTGTTACCTATGGGTAATTAGGTTTTTG; I*m2, GCACCAGCCCCACCCCCACCCCGTTGGCTAGTTGTTACCTATGGGTAATTAGGTTTTTG; I*5', GCACCAGCCCCACCCCCACCCCGTG; I*5'm, GCACCAATGAAGTTGATCCCCCGTG; I*3', ACCCCGTGTCACCTGTGTTACCTA; I*3'm, ACCCCGTTGGCTAGTTGTTACCTA; 4×7, 5'-TTTTGTATTTTGTATTTTGTATTTTGTA.

Preparation of nuclear extracts, electrophoretic mobility shift assays, and DNase I footprinting. Nuclear extracts from BALB/c-3T3 (clone A31) and NIH 3T3 fibroblasts were prepared as described by Dignam et al. (16). Chemically synthesized oligonucleotides were annealed and labeled with ³²P-labeled nucleotides by filling in with the Klenow fragment of DNA polymerase I. Radiolabeled double-stranded oligonucleotides were gel purified prior to use as probes in electrophoretic mobility shift assays. Electrophoretic mobility shift assays were performed as previously described (18, 19). Following 30-min incubations on ice, DNA-protein complexes were electrophoresed on 4% native polyacrylamide gels at 150 V in 0.25× Tris-borate-EDTA buffer for 4.5 h at 4°C. For antibody supershift or competition experiments, antibodies or the indicated excesses of unlabeled double-stranded oligonucleotides were added for a 30-min incubation on ice prior to the addition of a radiolabeled oligonucleotide probe. DNase I footprinting was performed as previously described (19).

Immunoprecipitation and Western blot analysis. Immunodepletions were performed in the presence of protease inhibitors on ice. After supernatants were cleared, supernatant was transferred to a fresh tube containing 15 µl of a rabbit polyclonal anti-Sp3 antibody. After incubation for 1 h at 4°C, 50 µl of preincubated 10% protein A-Sepharose (Zymed) was added and the mixture was rotated at 4°C for 30 to 60 min. Samples were then centrifuged, and the supernatant was removed for further analysis. Immunoblot analysis, using 30 µg of protein per lane and transfer to Immobilon polyvinylidene difluoride membranes (Millipore), was performed as previously described (68).

Plasmid construction and site-directed mutagenesis. Site-directed mutagenesis was performed by using a commercially available kit (Quik Change; Stratagene) in accordance with the manufacturer's instructions. Construct 1 (see Fig. 1, 2, 4, and 5), a 33-bp-tagged MCP-1 reporter gene containing 2.8 kb of MCP-1 5' flanking sequences and 104 bp of MCP-1 3' untranslated sequences, has been described previously (20). Construct 2 (see Fig. 1) was created by site-directed mutagenesis of the heptamer into the 3' untranslated sequences of construct 1 (104 bp 3' to the translational stop codon). Constructs 3 to 5 (see Fig. 1) were derived from construct 1 following AocI digestion and removal of the 5' 707-bp AocI-EcoRI, 1,402-bp AocI-SpeI, and 1,936-bp AocI-HincII fragments, respectively, with subsequent religation. Constructs 3 and 4 (see Fig. 2A) are derived from construct 2 by removal of the 1,936-bp AocI-HincII fragment as described above, followed by ligation of the 707-bp AocI-EcoRI and 695-bp SpeI-EcoRI MCP-1 5' sequence fragments, respectively, into the opened AocI site. Constructs 5 and 6 (see Fig. 2A and B) were created by insertion of the heptamer into construct 4 by site-directed mutagenesis into the 3' untranslated sequences (104 bp 3' to the translational stop codon) or 5' flanking sequences (at 2766 relative to the start of transcription), respectively. Constructs 5m1, m2, and m3 (see Fig. 2B) were created by insertion of mutant heptamer sequences into construct 4 by site-directed mutagenesis into the 3' untranslated sequences (104 bp 3' to the translational stop codon). Constructs 5m1 and 5m2 (see Fig. 4) were created by site-directed mutation of nonoverlapping 12- and 8-nt portions of the 695-bp SpeI-EcoRI fragment in construct 3, respectively. The sequences of the 12- and 8-nt mutations are given in the oligonucleotide paragraph. Constructs 4, 5, and 6 (see Fig. 5A) are derived from construct 2 by removal of the 1,936-bp AocI-HincII fragment (see Fig. 1) (construct 5), followed by ligation of the oligonucleotides shown into the opened AocI site. Construct 4(7) (see Fig. 5B) was created by insertion of the wild-type heptamer into construct 4 by site-directed mutagenesis into the 3' untranslated sequences (104 bp 3' to the translational stop codon). All constructs were checked for accuracy by DNA sequencing (66).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

PDGF induction of MCP-1 involves interactions between the heptamer TTTTGTA and two 5' inhibitory elements. Progressive deletion of portions of a 1,936-bp AocI-HincII segment of MCP-1 5' flanking sequences results in heptamerless tagged MCP-1 reporter constructs that are PDGF inducible in transfection experiments (Fig. 1). Deletion of a 707-bp EcoRI-AocI 5' sequence fragment or readdition of the heptamer to a heptamerless, non-PDGF-inducible MCP-1 reporter gene results in a PDGF-inducible construct in these transfection experiments (compare the PDGF inducibilities of constructs 3 and 2, respectively, with that of construct 1 in Fig. 1). Deletion of an additional 695-bp SpeI-EcoRI 5' fragment significantly increases the PDGF inducibility of the resulting deletion construct (compare the PDGF inducibilities of constructs 4 and 3 in Fig. 1). In contrast, further deletion of a 534-bp SpeI-HincII 5' fragment only slightly increases the PDGF inducibility of the resulting deletion construct (compare the PDGF inducibilities of constructs 5 and 4 in Fig. 1). The deletions created did not include portions of any PDGF-regulated cis-acting elements that we have reported previously (18-20).

View larger version (34K): [in this window] [in a new window]   FIG. 1.   Deletion of 5' flanking sequences results in heptamerless PDGF-inducible MCP-1 reporter genes. At the top is a schematic of the structures of five tagged MCP-1 reporter constructs. Open rectangles represent exons, and introns are represented by the dark lines between the exons. The lengths of 5' flanking MCP-1 sequences contained within constructs are given in kilobases. The start of transcription is shown by the bent arrow. The 33-bp tag is represented by the dark band in the third exon. Constructs 1, 3, 4, and 5 contain 104 bp of 3' untranslated sequences (that include the polyadenylation signal but not the heptamer). Only construct 2 contains the heptamer within its 3' untranslated sequences. The relative positions of AocI (A), EcoRI (E), SpeI (S), and HincII (H) sites, located in the MCP-1 5' flanking sequences and defining the endpoints of three MCP-1 5' sequence fragments, are shown. The overall AocI-HincII 5' fragment includes 1,936 bp. Construct 2 is derived from construct 1 by readdition of the heptamer TTTTGTA to the 3' untranslated sequences of construct 1. Construct 3 is derived from construct 1 by deletion of the 707-bp EcoRI-AocI fragment. Construct 4 is derived from construct 3 by deletion of the 695-bp SpeI-EcoRI fragment. Construct 5 is derived from construct 4 by deletion of the 534-bp HincII-SpeI fragment. The PDGF-regulated 5' I* elements are indicated. The PDGF inducibilities of the five constructs in transfection experiments are summarized on the right. In the middle are RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 5 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs diagrammed at the top. The positions of the 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are shown. The experiment was performed four times with similar results. The PDGF inductions obtained with constructs 4 and 5 were 2.6 to 4.0 and 3.0 to 8.1 times greater, respectively, than those obtained with construct 1 in these transfections. The PDGF induction increases observed with constructs 2, 3, 4, and 5, compared to construct 1, are all significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe.

View larger version (43K): [in this window] [in a new window]   FIG. 2.   PDGF induction of MCP-1 involves interactions between the heptamer TTTTGTA and a 5' I* element. (A) At the top is a schematic of the structures of six tagged MCP-1 reporter constructs. Constructs 1 through 4 and 6 contain 104 bp of 3' untranslated sequences (that include the polyadenylation signal but not the heptamer). Only construct 5 contains the heptamer within its 3' untranslated sequences. The details of the MCP-1 schematics are otherwise as described in the legend to Fig. 1. Constructs 1 and 2 in this figure are identical to constructs 1 and 5, respectively, in Fig. 1. Construct 3 is derived from construct 2 by readdition of the 707-bp EcoRI-AocI fragment. Construct 4 is derived from construct 2 by readdition of the 695-bp SpeI-EcoRI fragment. Construct 5 is derived from construct 4 by readdition of the heptamer to the proximal 3' untranslated sequences. Construct 6 is derived from construct 4 by readdition of the heptamer to the distal 5' flanking sequences. The PDGF-regulated 5' I* elements are indicated. The PDGF inducibilities of the six constructs in transfection experiments are summarized on the right. At the middle are RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 5 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs diagrammed at the top. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) or endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed four times with similar results. The PDGF inductions obtained with constructs 3 and 4 were 10 to 64 and 10 to 15%, respectively, of those obtained with construct 2 in these transfections. The PDGF inductions obtained with construct 5 were 2.1 to 9.7 times greater than those obtained with construct 4 in these transfections. The PDGF induction decreases observed with constructs 3 and 4, compared to construct 2, are both statistically significant (P < 0.05 by the Wilcoxon two-sample test). The PDGF induction increases observed with construct 5, compared to construct 4, are significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe. (B) At the top are RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 4 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs described at the top, except for constructs 5m1, 5m2, and 5m3. The latter constructs are derived from construct 4 by addition of the mutant heptamers TTTTATG, GGGGGTA, and TTTTGGA, respectively, to the 3' untranslated sequences. Mutations of the wild-type heptamer sequence are underlined. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed four times with similar results. The decreased PDGF inductions obtained with constructs 5m1, 5m2, and 5m3 varied from 6 to 15%, 8 to 25%, and 50 to 60% of those obtained with construct 5, respectively, in these transfections. The PDGF induction differences obtained with constructs 5m1, 5m2, and 5m3, compared to construct 5, are all statistically significant (P < 0.05 by the Wilcoxon two-sample test). The PDGF induction increases observed with constructs 5 and 6, compared to construct 4, are statistically significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe.

A single DNase I-protected sequence is detected within the 695-bp SpeI-EcoRI inhibitory fragment. DNase I footprinting assays were performed to locate a potential I* element sequence(s) within the 695-bp SpeI-EcoRI inhibitory fragment. A single footprinted region was detected in these assays (Fig. 3). The overall footprint, with endpoints at 1468 and 1434 relative to the start of transcription of the MCP-1 gene, consists of two DNase I-protected regions separated by an apparent DNase I-hypersensitive site (arrow in Fig. 3). The distal (5') and proximal (3') protected subregions will be referred to here as the 5' and 3' (footprinted) subregions, respectively. Similar footprinted regions are observed with extracts prepared from quiescent and PDGF-treated 3T3 cells (Fig. 3). No additional DNase I-protected sequences are apparent within the rest of the 695-bp fragment (data not shown). A similar footprint was detected by using a bottom-strand labeled probe (data not shown).

View larger version (62K): [in this window] [in a new window]   FIG. 3.   A single DNase I-protected sequence is detected within the 695-bp SpeI-EcoRI inhibitory fragment. A top-strand-labeled probe corresponding to the 695-bp inhibitory element-containing SpeI-EcoRI MCP-1 5' fragment was used in DNase I footprinting assays. Nuclear protein extracts for these assays were prepared from two groups of quiescent fibroblasts (lanes Q) and fibroblasts treated with 30 ng of the B-B isoform of PDGF per ml for 2 h (lanes B). Lanes 0 contained no protein, and lane G+A contained the purine sequence of the top-strand-labeled probe. The nucleotide sequence of the overall protected region is given on the right. The arrow highlights a DNase I-hypersensitive site separating the 5' and 3' protected subregions. The 12-nt (m1) and 8-nt (m2) sequences mutated in this study are highlighted by the bars on the right.

A 59-nt sequence is sufficient for inhibition of MCP-1 induction and contains an I* element. Mutation of 12 nt within the 5' subregion or 8 nt within the 3' subregion (bars in Fig. 3) reverses the inhibition maintained by the wild-type SpeI-EcoRI fragment (compare the PDGF inducibilities of constructs 3 and 5m1 or 5m2 in Fig. 4A and B). MCP-1 reporter genes containing either the heptamer within their 3' untranslated sequences or the 12-nt mutation within the 695-bp inhibitory fragment exhibit similar PDGF inducibilities in these transfection experiments (compare the PDGF inducibilities of constructs 4 and 5m1 in Fig. 4A). Introduction of an identical 12-nt mutation within the 5' subregion of construct 1 (i.e., a minimally PDGF-inducible reporter gene containing both inhibitory fragments in their proper contexts within the MCP-1 5' sequences, Fig. 4A) partially reverses the inhibition of PDGF induction observed with wild-type construct 1 (data not shown). In the latter experiments, the reversal of inhibition of PDGF induction is only partial, likely due to the presence and unopposed action of the second (EcoRI-AocI) inhibitory fragment in mutated construct 1. 

View larger version (29K): [in this window] [in a new window]   FIG. 4.   Necessity of 12-nt (5') and 8-nt (3') footprinted sequences for inhibition of MCP-1 induction. (A) At the top is a schematic of the structures of five tagged MCP-1 reporter constructs. Constructs 1 through 3 and 5 contain 104 bp of 3' untranslated sequences (that include the polyadenylation signal but not the heptamer). Only construct 4 contains the heptamer within its 3' untranslated sequences. The details of the MCP-1 schematics are otherwise as described in the legend to Fig. 1. Construct 2 is derived from construct 1 by removal of the 1,936-bp AocI-HincII 5' fragment. Construct 3 is derived from construct 2 by readdition of the 695-bp SpeI-EcoRI fragment. Construct 4 is derived from construct 3 by addition of the heptamer TTTTGTA to the 3' untranslated sequences. Constructs 5m1 and m2 are derived from construct 3 by site-directed mutation of nonoverlapping 12-nt (5' subregion) and 8-nt (3' subregion) portions, respectively, of the footprinted region shown in Fig. 3 (i.e., mutating the 12-base sequence GCCCCACCCCCA to ATGAAGTTGATC and the 8-base sequence GTCACCTG to TGGCTAGT within the otherwise unaltered 695-bp SpeI-EcoRI fragment). The PDGF-regulated 5' inhibitory I* elements are indicated. The PDGF inducibilities of the constructs in transfection experiments are summarized on the right. At the middle are RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 5 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs described at the top. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed four times with similar results. The PDGF inductions obtained with construct 5m1 were 1.6 to 5.2 times greater than those obtained with construct 3 in these transfections. The PDGF induction increases observed with construct 5m1, compared to construct 3, are statistically significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe. (B) At the top are RNase protection assays of 40 µg of total cellular RNA prepared from NIH 3T3 fibroblasts transiently transfected with 4 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs described at the top. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed four times with similar results. The PDGF inductions obtained with construct 5m2 were 1.8 to 2.7 times greater than those obtained with construct 3 in these transfections. The PDGF induction increases observed with construct 5m2, compared to construct 3, are statistically significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe.

View larger version (32K): [in this window] [in a new window]   FIG. 5.   A 59-nt sequence is sufficient for inhibition of PDGF induction of MCP-1. (A) At the top is a schematic of the structures of six tagged MCP-1 reporter constructs. All of the constructs contain 104 bp of 3' untranslated sequences (that include the polyadenylation signal but not the heptamer). The details of the MCP-1 schematics are otherwise as described in the legend to Fig. 1. Construct 2 is derived from construct 1 by removal of the 1,936-bp AocI-HincII 5' fragment. Construct 3 is derived from construct 2 by readdition of the 695-bp SpeI-EcoRI fragment. Constructs 4 and 5 are derived from construct 2 by readdition of a 59-nt subfragment of the 695-bp SpeI-EcoRI fragment in the in vivo (construct 4) and reverse (construct 5) orientations. The 59-nt subfragment includes the complete footprinted region shown in Fig. 3 and a short stretch of additional MCP-1 sequences immediately 3' to the footprinted region. Construct 6 is derived from construct 2 by readdition of a 25-nt oligonucleotide (I*5') containing the 5' footprinted subregion shown in Fig. 3. The 25-nt sequence is entirely contained within the 59-nt sequences. The PDGF-regulated 5' I* elements are indicated. The PDGF inducibilities of the six constructs in transfection experiments are summarized on the right. Below the schematic are results from RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 4 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs described at the top. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed three times with similar results. The PDGF inductions obtained with constructs 3, 4, and 5 varied from 3.5 to 24% of those obtained with construct 2 in these transfections. Differences among the PDGF inductions observed with constructs 3, 4, and 5 are not statistically significant (P = 0.49 by the Kruskal-Wallis test). The PDGF induction decreases observed with constructs 3, 4, and 5, compared to construct 2, are all statistically significant (P < 0.05 by the Wilcoxon two- sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe. (B) At the top are RNase protection assays of 40 µg of total cellular RNA that was prepared from NIH 3T3 fibroblasts transiently transfected with 4 µg of the constructs shown, allowed to become quiescent, and then not exposed () or exposed (+) to the B-B isoform of PDGF (30 ng/ml) for 3 h. The numbers refer to the tagged MCP-1 constructs described at the top, except for construct 4(7), which is derived from construct 4 by addition of the heptamer TTTTGTA to the 3' untranslated sequences. The 305- and 241-nt protected fragments corresponding to expression of the transfected and tagged (T) and endogenous (E) MCP-1 genes, respectively, are indicated. The experiment was performed four times with similar results. The PDGF inductions obtained with construct 4(7) were 2.5 to 4.2 times greater than those obtained with construct 4 in these transfections. The PDGF induction increases observed with construct 4(7), compared to construct 4, are statistically significant (P < 0.05 by the Wilcoxon two-sample test). At the bottom are RNase protection assays of 15 µg of total cellular RNA taken from the transfections shown above and analyzed with an alpha-globin riboprobe.

A slowly migrating protein complex binds to the I* element. To detect and characterize potential regulatory proteins binding to the I* element, we performed a series of mobility shift assays using seven oligonucleotide probes. The sequences of the probes and their relative positions within the overall 59-nt I* element are shown in Fig. 6G. A predominant and constitutively binding protein complex was found to bind to a radiolabeled I* probe in mobility shift assays (lanes 1 and 2 in Fig. 6A). Significantly, mutant I* probes containing either of the nonoverlapping 12-nt (5') or 8-nt (3') mutations described in Fig. 4 do not bind the slowly migrating complex (compare the greatly diminished binding in lanes 3 and 4 or 5 and 6, respectively, with that in lanes 1 and 2 in Fig. 6B). The all-or-nothing binding exhibited by the wild-type and mutant I* probes suggests that cooperative interactions between the two sites altered in these mutant probes are involved in the formation of the complex on the wild-type I* sequence. Furthermore, since both mutations significantly decreased the inhibition of PDGF induction maintained by the wild-type 695-bp fragment in transfection experiments (constructs 5m1 and 5m2 in Fig. 4), these data suggest that a causal relationship exists between formation of the I* element-binding complex and inhibition of PDGF-stimulated expression of MCP-1 in intact cells.

View larger version (73K): [in this window] [in a new window]   FIG. 6.   A slowly migrating protein complex binds to the 59-nt I* element-containing sequence. (A) Nuclear extracts (20 µg) prepared from quiescent fibroblasts () or fibroblasts treated with the B-B isoform of PDGF (30 ng/ml) for 2 h (+) were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. The large arrowhead highlights the predominant complex that binds to the 59-nt fragment (I*) probe. The small arrowhead highlights an additional protein complex, of unclear significance, that also binds to the 59-nt fragment probe. (B) Nuclear extracts (15 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. The arrowhead highlights the predominant complex that binds to the I* probe. (C) Nuclear extracts (15 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probe shown. Unlabeled double-stranded oligonucleotides (300-fold excesses) were used as competitors where indicated. The 4×7 competitor is a double-stranded oligonucleotide containing four copies of the heptamer TTTTGTA. The arrow highlights the predominant complex that binds to the I* probe. Compet, competitor. (D) Nuclear extracts (15 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. Unlabeled double-stranded oligonucleotides (300-fold excesses) were used as competitors where indicated. The arrowhead highlights the predominant complex that binds to the 59-nt fragment (I*) probe. The upper and lower arrows show the positions of two complexes that bind specifically to the I*5' probe. (E) Nuclear extracts (20 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. Unlabeled double-stranded oligonucleotides (200-fold excesses) were used as competitors where indicated. The arrowhead highlights the predominant complex that binds to the 59-nt fragment (I*) probe. The arrow shows the position of a complex that binds specifically to the I*3' probe. (F) Nuclear extracts (15 µg) prepared from quiescent fibroblasts (Q) and recombinant Sp1 (rSp1, 1fpu) were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. Antibodies specific for individual members of the Sp1 family of transcription factors (5 µg) were added where indicated. The Sp1-1 and Sp1-2 antibodies bind to distinct, nonoverlapping portions of the Sp1 transcription factor (amino acids 436 to 454 and 520 to 538, respectively). Prot, protein. The arrowhead on the left highlights the predominant complex that binds specifically to the 59-nt fragment (I*) probe. The arrows on the left show the positions of the two complexes that bind specifically to the 5' subregion (I*5') probe. The arrows on the right show the positions of complexes supershifted by the anti-Sp1 and anti-Sp3 antibodies (Ab). (G) The sequences of seven oligonucleotides and the relative position of each oligonucleotide within the overall 59-nt footprinted (I*) region are shown. These oligonucleotides were used as double-stranded probes or competitors in the six mobility shift assays whose results are shown here and correspond to the 25-nt (5' subregion), 24-nt (3' subregion), and 59-nt (full-length) footprinted regions shown in Fig. 3 (designated I*5', I*3', and I*, respectively). Mutant 25- and 24-nt probes, containing the 12- and 8-nt mutations described in the legend to Fig. 4 are designated I*5'm and I*3'm, respectively. Mutant I* probes containing the same 12- and 8-nt mutations are designated I*m1 and I*m2, respectively. The mutated sequences are boldfaced and underlined for each oligonucleotide. Free probe is not shown in these mobility shift assays. No complexes were observed with any of the probes alone in the absence of extract (data not shown).

The I* element-binding complex appears to contain both the Sp3 transcription factor and the Sp1-like protein. All of the mobility shift assays in this study were performed under conditions of free probe excess (data not shown). Hence, the identification of Sp3 and an Sp1-like protein as both binding to the 5' subregion (I*5') probe, but only a single more slowly migrating complex binding to the I* probe (Fig. 6A), suggests that Sp3 and the Sp1-like protein are both contained within the larger complex. Were this not the case, one would have expected to observe either three complexes binding to the I* probe or a single complex binding to the 5' subregion probe. To address this question further, antibody supershift mobility shift assays were performed to determine the effects of the anti-Sp1 family antibodies on binding to the I* probe. Only the addition of the anti-Sp1-1 antibody greatly diminished the binding of the single complex to the I* element probe (compare binding in lane 2 with that in lane 1 or lanes 3 to 6 in Fig. 7A), consistent with steric hindrance of the formation of the complex or its binding to the I* element in the setting of antibody binding to the Sp1-like protein. The anti-Sp1-1 result was reversed by concurrent addition of the peptide used to generate the antibody (data not shown).

View larger version (33K): [in this window] [in a new window]   FIG. 7.   The I* element-binding complex contains the Sp3 transcription factor and an Sp1-like protein. (A) Nuclear extracts (12.5 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probe shown. The sequence of the probe is given in Fig. 6G. Antibodies (Ab) specific for individual members of the Sp1 family of transcription factors (2 µg) were added where indicated. The Sp1-1 and Sp1-2 antibodies are as described in the legend to Fig. 6F. The arrowhead on the left highlights the predominant complex that binds specifically to the I* probe. Free probe is not shown. No complexes were observed with the probe alone in the absence of extract (data not shown). (B) Nuclear extracts (12.5 µg) prepared from quiescent fibroblasts were used in mobility shift assays along with the radiolabeled double-stranded oligonucleotide probes shown. The sequences of the probes are given in Fig. 6G. Extracts were immunodepleted initially with anti-Sp3 antibodies (+), mock immunodepleted with rabbit immunoglobulin G (M), or not treated (). The arrowhead on the left highlights the predominant complex that binds specifically to the I* probe. The arrows on the right highlight the positions of the two complexes that bind specifically to the 5' subregion (I*5') probe. Free probe is not shown. No complexes were observed with the probes alone in the absence of extract (data not shown). (C) Immunoblot of an aliquot (30 µg) of the extracts used for panel B with the anti-Sp3 antibody. The designations +, M, and  are as described for panel B. Molecular sizes are given in kilodaltons.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

A pair of I* elements are present in the MCP-1 5' flanking sequences and are heptamer regulated. We have shown previously that PDGF induction of the MCP-1 IEG requires the presence of the 7-nt motif TTTTGTA within the 3' untranslated sequences of MCP-1. Moreover, MCP-1 reporter genes lacking the heptamer were not PDGF inducible in previous transfection experiments (20). In this study, we have created MCP-1 reporter genes lacking the heptamer that are strongly PDGF inducible through the deletion of a 1,936-bp segment of the MCP-1 5' flanking sequences (Fig. 1). Hence, while the heptamer is essential for PDGF induction of an intact MCP-1 reporter gene (20), the function of the heptamer is dispensable upon the removal of a defined stretch of 5' flanking MCP-1 sequences. These data suggest that the apparent positive effect on PDGF inducibility of readdition of the heptamer to the 3' untranslated sequences results from the heptamer functioning to remove an inhibition of PDGF induction of MCP-1 maintained by what we have termed an inhibitory element(s) present within the 5' sequences.

One I* element is contained within a 59-nt MCP-1 sequence and binds a multiprotein complex including Sp3 and an Sp1-like protein. Evidence presented in this report demonstrates that a 59-nt portion of MCP-1 5' flanking sequences recapitulates the properties of the full-length 695-bp inhibitory fragment, strongly suggesting that the 59-nt sequence contains one of the I* elements detected in our initial experiments. Significantly, the 59-nt I*-containing sequence was demonstrated to bind a single predominant protein complex with greatly decreased binding or formation of the single complex observed to either of two mutant 59-nt oligonucleotides. Since both mutations significantly decrease the repression of PDGF induction maintained by the wild-type 695-bp fragment in transfection experiments (Fig. 4), these data strongly suggest that a causal relationship exists between the formation or binding of the 59-nt I* element-binding complex and repression of PDGF-stimulated transcription of MCP-1 in intact cells. Note that the 59-nt I* element-binding complex is competed by oligonucleotides corresponding to either the 5' footprinted subregion alone, a 59-nt oligonucleotide containing a mutation of just the 5' subregion (I*m1), or the 3' footprinted subregion alone (Fig. 6C). In total, these data suggest that at least two distinct DNA sequences, contained within the 5' and 3' footprinted subregions, comprise the overall 59-nt I* element. By extension, regulatory or architectural proteins binding to the two DNA sites would be predicted to be components of the 59-nt I*-binding complex. In the remainder of this discussion, the designation I* element will refer to the 59-nt oligonucleotide.

Repressosome model of inhibition of PDGF induction of MCP-1. The experiments presented in this report are consistent with the existence of a multiprotein complex binding to the I* element that represses PDGF-stimulated transcription of MCP-1 in the absence of the heptamer. Furthermore, the evidence suggests that (i) at least three distinct proteins comprise the I*-binding complex and (ii) regulatory or architectural proteins binding to at least two distinct DNA-binding sites are involved in the formation of the I*-binding complex. We propose that the formation of the I*-binding complex creates a multiprotein repressor surface that maintains inhibition of MCP-1 transcription. Upon PDGF stimulation of cells, and in the presence of the heptamer TTTTGTA, repression of MCP-1 transcription is relieved. A growing body of literature is lending elegant experimental support to the concept of an enhanceosome, i.e., a multiprotein complex formed in a cooperative manner, in which the component proteins bind to independent sites on a short segment of DNA. This results in the formation of a multiprotein activation surface that effectively increases the transcription of a given gene (6, 39, 47, 49). We propose that the I*-binding complex is the first example of the opposite of an enhanceosome, i.e., a multiprotein complex mediating repression of MCP-1 transcription, in which the component proteins bind to distinct sites within the overall I* element. Our results suggest that cooperative interactions occur among the I*-binding proteins and binding sites both in vitro (Fig. 6B) and in vivo (Fig. 5A). We propose that the I*-binding complex be called a repressosome. Our current model of the PDGF-regulated MCP-1 repressosome is shown in Fig. 8.

View larger version (38K): [in this window] [in a new window]   FIG. 8.   Repressosome model of inhibition of PDGF induction of MCP-1. (A) A multiprotein complex (repressosome) binds to the I* element. At least three proteins form the repressosome and bind to two distinct sites on the I* element, designated I and II and corresponding to the I*5' and I*3' sequences, respectively. The proteins include the Sp3 transcription factor, an Sp1-like protein, and an apparently novel regulatory protein that binds to site II (represented by oval Y). The net effect is the creation on the I* element of a repressor surface that represses MCP-1 transcription in the absence of the heptamer TTTTGTA (denoted by the multiple minus signs). PDGF stimulation does not result in MCP-1 expression in the absence of the heptamer due to the unopposed action of the repressosome. (B) After PDGF stimulation and in the presence of the heptamer, the effect of the repressor surface is relieved or neutralized and MCP-1 transcription proceeds. An assumption inherent in this model is that the heptamer-binding protein(s) (represented by rectangle X) is altered after PDGF stimulation, thereby allowing it to interact with the repressor surface formed on the I* element. Although Sp3 and the Sp1-like protein are drawn as interacting, this does not have to obtain. This model does not exclude the possibility that additional regulatory or architectural proteins are involved in the formation of the repressosome.