Molecular and Cellular Biology, June 1999, p. 4355-4365, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cooperative Interaction between GATA-4 and GATA-6
Regulates Myocardial Gene Expression
Frédéric
Charron,1,2
Pierre
Paradis,1
Odile
Bronchain,1,2
Georges
Nemer,1,3 and
Mona
Nemer1,2,3,*
Laboratoire de Développement et
Différenciation Cardiaques, Institut de Recherches Cliniques de
Montréal,1 Department of Medicine,
Division of Experimental Medicine, McGill
University,2 and Département
de Pharmacologie, Université de
Montréal,3 Montréal, Québec,
Canada
Received 11 December 1998/Returned for modification 12 February
1999/Accepted 10 March 1999
 |
ABSTRACT |
Two members of the GATA family of transcription factors, GATA-4 and
GATA-6, are expressed in the developing and postnatal myocardium and
are equally potent transactivators of several cardiac promoters.
However, several in vitro and in vivo lines of evidence suggest
distinct roles for the two factors in the heart. Since identification
of the endogenous downstream targets of GATA factors would greatly help
to elucidate their exact functions, we have developed an
adenovirus-mediated antisense strategy to specifically inhibit GATA-4
and GATA-6 protein production in postnatal cardiomyocytes. Expression
of several endogenous cardiac genes was significantly down-regulated in
cells lacking GATA-4 or GATA-6, indicating that these factors are
required for the maintenance of the cardiac genetic program.
Interestingly, transcription of some genes like the
- and
-myosin
heavy-chain (
- and
-MHC) genes was preferentially regulated by
GATA-4 due, in part, to higher affinity of GATA-4 for their promoter
GATA element. However, transcription of several other genes, including
the atrial natriuretic factor and B-type natriuretic peptide (ANF and
BNP) genes, was similarly down-regulated in cardiomyocytes lacking one
or both GATA factors, suggesting that GATA-4 and GATA-6 could act
through the same transcriptional pathway. Consistent with this, GATA-4
and GATA-6 were found to colocalize in postnatal cardiomyocytes and to
interact functionally and physically to provide cooperative activation
of the ANF and BNP promoters. The results identify for the first time
bona fide in vivo targets for GATA-4 and GATA-6 in the myocardium. The
data also show that GATA factors act in concert to regulate distinct subsets of genes, suggesting that combinatorial interactions among GATA
factors may differentially control various cellular processes.
 |
INTRODUCTION |
The vertebrate GATA transcription
factors share a highly conserved domain composed of two zinc fingers
(39). This domain is responsible for specific binding to a
consensus WGATAR element. Based on sequence homology and tissue
distribution, the vertebrate GATA family can be divided into two
subgroups. The first subgroup is composed of GATA-1, -2, and -3. These
three GATA factors are expressed in the hematopoietic system and are
essential for normal hematopoiesis (36, 37, 39, 40, 44). The
second subgroup is composed of GATA-4, -5, and -6, which are
differentially expressed in the heart and gut (26). Within
the heart, GATA-5 is restricted to the endocardium (22),
whereas GATA-4 and -6 are expressed in the developing and postnatal
myocardium (14, 18, 21, 33).
Several lines of evidence have implicated GATA-4 in diverse
developmental processes including survival, differentiation, and/or migration of cardiomyocyte precursors. For example, in vitro
experiments using embryonic stem cells showed that GATA-4 is essential
for survival of cardioblasts and terminal cardiomyocyte differentiation (15, 16). In vivo, inactivation of the GATA-4 gene is embryo lethal at day 9.5 postcoitum due to failure of the GATA-4 null mice to
develop a primitive heart tube (25, 31). Unfortunately, the
requirement for GATA-4 at early stages of heart development has
precluded analysis of its role in the postnatal myocardium either in
vitro or in vivo. Nevertheless, two lines of evidence suggest that
GATA-4 may play a critical role in postnatal cardiac transcription:
GATA elements were found to be essential for activation of some cardiac
promoters in adult myocardium (17, 19, 28, 30), and GATA-4
was shown to functionally and physically interact with NFAT-3, which
would implicate it as a mediator of the calcineurin-dependent hypertrophic process in the myocardium (32).
Analyses of GATA-6 in the myocardium have been more limited, but the
available data are consistent with a role for GATA-6 in myocardial
development and gene expression. Thus, axis disruption experiments with
Xenopus frogs showed that transcription of GATA-6, much like
that of GATA-4 and -5, correlates with specification of cardiac
progenitors and ectopic expression of either of those factors activates
the
-myosin heavy-chain (
-MHC) and cardiac
-actin genes
(21). Moreover, cotransfection experiments using heterologous cells showed that GATA-6 is as potent as GATA-4 in transactivating cardiac genes harboring GATA elements in their promoter, such as the cardiac troponin C (cTnC) and atrial natriuretic factor (ANF) genes (9, 33). Interestingly, Gove et al. have reported that in Xenopus embryos, GATA-6 overexpression
blocks differentiation and stimulate proliferation of heart precursors (12). Recently, the inactivation of the GATA-6 gene in mice was reported to be embryo lethal at day 7.5 postcoitum, precluding analysis of its role in the heart (34). Finally, the
inability of GATA-6 to compensate for the GATA-4 deficiency in GATA-4
null mice suggests that GATA-4 and GATA-6 play different roles in vivo.
The molecular basis for the differential roles of GATA-4 and -6 in the
myocardium remains largely unknown but could occur via at least three
nonexclusive mechanisms: differential expression of GATA-4 and GATA-6
in subsets of cardiomyocytes, differential affinity of GATA factors for
GATA elements and therefore different in vivo target genes, or
differential interaction of GATA-4 and -6 with cofactors. Support for
this latter possibility was recently provided by Durocher et al., who
showed functional and physical interaction between GATA-4, but not
GATA-6, and the cardiac homeodomain protein Nkx2-5 (9, 10).
However, the relative affinities of GATA-4 and -6 for their DNA-binding
sites have not been determined, and whether GATA-4 and -6 localize
differentially in the heart and target distinct genes is not known.
To address these issues, we have developed antibodies specific for the
different cardiac GATA factors and analyzed at the cellular level the
localization of GATA-4 and -6 in the myocardium. We also developed an
adenovirus-mediated antisense strategy to specifically inhibit GATA-4
and GATA-6 protein production in neonatal cardiomyocytes and assess its
effect on cardiac gene expression. The results indicate that several
endogenous cardiac genes, including those encoding ANF, B-type
natriuretic peptide (BNP),
-MHC,
-MHC, cTnI, and platelet-derived
growth factor receptor
(PDGFR
), are down-regulated in
cardiomyocytes lacking either GATA-4 or GATA-6, suggesting that these
genes are bona fide targets for both GATA-4 and GATA-6. Interestingly,
the
- and
-MHC genes are preferential targets for GATA-4, likely
due to the higher affinity of GATA-4 for their promoter GATA element.
Remarkably, GATA-4 and GATA-6 colocalize in postnatal cardiomyocytes
and interact functionally and physically to provide cooperative
activation of the ANF and BNP promoters. These results suggest that
GATA factors are involved in the maintenance of the cardiac phenotype and that expression of cardiac genes is controlled by combinatorial interactions of the different GATA proteins.
 |
MATERIALS AND METHODS |
Plasmids and adenovirus vectors.
The recombinant
replication-deficient adenovirus type 5 (Ad5) expressing antisense
regions directed specifically toward GATA-4 or -6 was generated by
using the cloning system developed and generously provided by F. L. Graham (29). Briefly, a 358-bp EcoRI/HindIII fragment encoding the extreme
N-terminal portion of rat GATA-4 and a 359-bp
XbaI/StuI fragment from the 5' untranslated region (UTR) of rat GATA-6 were subcloned into
HindIII/EcoRI and EcoRV/XbaI, respectively, between left-end
adenovirus sequences in Ad5 shuttle vector p
E1sp1B/CMV/BGH, a
plasmid generously provided by B. A. French (1). This
plasmid was constructed by inserting the 1,276-bp
BglII/PvuII fragment (containing the
cytomegalovirus [CMV] immediate-early promoter, polylinker, and
bovine growth hormone polyadenylation signal) from pcDNA3 (Invitrogen
Corp., San Diego, Calif.) between the BglII/Klenow-blunted
ClaI sites of the polylinker in Ad5 shuttle vector
p
E1sp1B (6). Each shuttle vector was cotransfected into
293 embryonic kidney cells with pJM17, which contains a circularized
dl309 adenovirus genome, to generate replication-deficient
viruses with substitution of the Ad5 E1 genes for the antisense GATA-4
and GATA-6 sequences (AS4 and AS6). The virus
Ad5/CMV/NLS-lacZ, carrying an expression cassette in which
the CMV immediate-early promoter transcribes sequences encoding the
simian virus 40 (SV40) large T-antigen nuclear localization signal
(NLS) fused to the Escherichia coli lacZ reporter gene, was
used as control (Ctl; a generous gift from B. A. French)
(11). Putative Ad5 clones were plaque purified, screened for
antisense inserts, propagated, isolated, and titered according to the
protocol of Graham and Prevec (13), to produce viral stocks
with titers of >2 × 109 PFU/ml.
Wild-type rat ANF and BNP reporter plasmids and the wild-type rat
GATA-4 expression vector (pCG-GATA-4) were described previously (14). The various deletions or mutations of the ANF promoter and GATA-4 cDNA were performed by PCR or by the Altered Sites in vitro
mutagenesis system (Promega Corp., Madison, Wis.) as described by the
manufacturer. The polyhistidine-tagged GATA-4 constructs used for in
vitro transcription and translation were generated by insertion of the
XbaI-BamHI fragment of the corresponding pCG-GATA-4 construct into the NheI-BamHI or
NheI-BglII sites of pRSETA (Invitrogen Corp.).
The rat GATA-6 cDNA was cloned by PCR and subcloned into the pcDNA3
expression vector. All constructs were confirmed by sequencing.
Neonatal cardiomyocyte preparation, infection, and
transfection.
Primary cultures of cardiac myocytes were prepared
from 4-day-old Sprague-Dawley rats as previously described
(4), with minor modifications. Essentially, ventricles and
atria of ~60 to 72 hearts were digested four to five times, for 15 min each time, in Joklik's modified Eagle's medium (Canadian Life
Technologies Inc.) containing 18 mM HEPES (pH 7.4), 0.1% collagenase
(~250 U/ml; Worthington Biochemical Corp.), and DNase I (5 µg/ml;
~2,000 U/mg; Boehringer Mannheim Canada). The enzymatic digestion was stopped with fetal bovine serum (FBS, qualified grade; Canadian Life
Technologies Inc.), and the undigested tissue was removed by filtration
through nylon mesh (pore size, 100 µm). Cardiomyocytes were purified
by three preplatings of 20 min each to remove residual nonmyocytes by
differential adhesiveness, then plated at a density of 0.5 × 106 cells/35-mm-diameter dish (Primeria; Falcon), and
cultured for 16 to 24 h in Dulbecco's modified Eagle's medium
(DMEM; Canadian Life Technologies Inc.) containing 10% FBS. The
following day, the medium was exchanged for serum-free hormonally
defined medium (SFHD) as previously described (4).
Transfections were carried out by using calcium phosphate precipitation
24 h after plating. For assay of basal ANF promoter activity,
cardiomyocytes were transfected with 6 µg of a wild-type or mutant
ANF-luciferase reporter. At 36 h posttransfection, cells were
harvested and luciferase activity was assayed with a Berthold LB 953 luminometer.
Serial dilutions of recombinant Ad5 (Ctl, AS4, or AS6) were prepared in
OptiMEMI (Canadian Life Technologies Inc.). Cardiomyocytes were exposed
to 200 µl of OptiMEMI containing 0.5 × 106, 2 × 106, or 8 × 106 PFU of recombinant Ad5
for 30 min at 25°C, and 2 ml of SFHD was added to each petri dish.
The medium was replaced 16 h later with fresh SFHD. The cells were
kept for 3 to 5 days, with the medium replaced every 24 h with
fresh SFHD. Just before replacement, aliquots of the medium were taken
for determination of ANF concentration.
-Galactosidase detection.
One day after infection,
cardiomyocytes were fixed in 0.5% glutaraldehyde-phosphate-buffered
saline (PBS) for 10 min, washed twice for 30 min each time with PBS
containing 0.02% Nonidet P-40, and stained with a mixture of 5 mM
K4Fe(CN)6, 5 mM
K3Fe(CN)6, 2 mM MgCl2, 1 mg of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal;
Boehringer Mannheim Corp.) per ml, 0.01% deoxycholic acid, and 0.02%
Nonidet P-40 in PBS for 1 to 2 h at 25°C in the dark. The
stained cardiomyocytes were washed with PBS, and 2 ml of 70% glycerol
was added to each petri dish. The stained cells were kept at 4°C
until photographed.
RNA extraction and Northern blotting.
Total RNA was isolated
from cardiomyocytes by the guanidium thiocyanate-phenol-chloroform
method as previously described (3). RNA was denatured with
formaldehyde and formamide, size fractionated on a 1.2% agarose gel,
transferred to a nylon membranes (MSI, Westborough, Mass.) by capillary
blotting with 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate), and cross-linked to the membrane with a UV Stratalinker 2400 (120 mJ; Stratagene). Blots were hybridized with random prime-labeled
rat cDNA probes for GATA-4, GATA-6, ANF, and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). The GATA-4 and -6 cDNA fragments are the same
ones used to generate the AS4 and AS6 adenoviruses. The ANF cDNA was
described previously (5), and the GAPDH cDNA was generously
provided by P. Jolicoeur. Blots were exposed in a PhosphorImager
cassette and analyzed with ImageQuant (Molecular Dynamics).
Cell cultures and transfections.
HeLa or L cells were grown
in DMEM supplemented with 10% FBS. Transfections were carried out by
using calcium phosphate precipitation 24 h after plating. For
overexpressions, 800,000 L cells were plated per 100-mm-diameter petri
dish and transfected with 40 µg of pCG, pCG-GATA-4, pCG-GATA-4
mutant, or pCDNA3-GATA-6 expression vector. At 36 h
posttransfection, cells were harvested and nuclear extracts were
prepared as previously described (14). Nuclear extract
protein concentrations were quantitated by the Bradford assay (Bio-Rad
Laboratories, Hercules, Calif.).
For ANF promoter transactivation assays, 100,000 HeLa cells were plated
per 35-mm-diameter petri dish and transfected with 3 µg of
ANF-luciferase reporter plasmid and 1 µg of GATA expression vector.
For synergy, 200 ng of GATA-6 and 200 ng of wild-type or mutant GATA-4
expression vector were used. The total amount of DNA was kept constant
at 4 µg. At 36 h posttransfection, cells were harvested and
luciferase activity was assayed.
Electrophoretic mobility shift assays (EMSAs).
Binding
reactions were performed in 20-µl reaction mixtures containing 3 µg
of nuclear extracts from L cells overexpressing GATA-4 or GATA-6 in a
buffer containing 12 mM HEPES (pH 7.9), 5 mM MgCl2, 60 mM
KCl, 4 mM Tris-HCl (pH 7.9), 0.6 mM EDTA, 0.6 mM dithiothreitol, 0.5 mg
of bovine serum albumin (BSA) per ml, 1 µg of poly(dI-dC), 12%
glycerol, 20,000 cpm of radiolabeled double-stranded
120 ANF GATA
probe, and increasing amounts of the appropriate unlabeled competitor
for 20 min at room temperature. Reactions were then loaded on a 4%
polyacrylamide gel and run at 200 V at room temperature in 0.25×
Tris-borate-EDTA. The gel was then dried and exposed to a
PhosphorImager (Molecular Dynamics) cassette for quantitative analysis.
Relative bindings were quantitated and plotted as a function of the
unlabeled competitor amount. Probes used were, from 5' to 3' (only the
coding strand is shown), rat ANF
120 (proximal;
GATCTCGCTGGACTGATAACTTTAAAAGG), rat ANF
120mut
(TGACAAGCTTCGCTGGACTCCTAACTTTAAAAG),
rat ANF
280 (distal;
GATCTCCCAGGAAGATAACCAAGGACTCG), and rat
-MHC
265 bp (GATCCTCCTCTATCTGCCCATCA), where the
WGATAR consensus motifs are underlined and the mutations are in boldface.
For DNA-binding affinity measurement, EMSAs were performed as described
above but with increasing amounts of radiolabeled ANF proximal or
distal GATA probe with a constant amount (3 µg) of nuclear extracts
from L cells overexpressing GATA-4 or GATA-6. Scatchard analysis was
then performed on the binding data by plotting the bound/free DNA ratio
as a function of the bound DNA. The resulting dissociation constant
(Kd) was calculated by using Microsoft Excel.
Western blots.
Three days after infection, cardiomyocytes
were harvested and nuclear extracts were prepared; then 20 µg of
cardiomyocyte nuclear extracts and 2 µg of GATA-4 or
GATA-6-overexpressing L-cell nuclear extracts were boiled in Laemmli
buffer and resolved by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). Proteins were transferred to a Hybond
polyvinylidene difluoride membrane and immunoblotted by using the
Renaissance chemiluminescence system (NEN Life Sciences, Boston, Mass.)
as described by the manufacturer. Goat GATA-4 supershift antibody
(Santa Cruz Biotechnology, Santa Cruz, Calif.) was used at a dilution
of 1/1,000 and was revealed with an anti-goat horseradish
peroxidase-conjugated antibody (Sigma, St. Louis, Mo.) at a dilution of
1/100,000. The GATA-6 antibody was made in rabbits by injection of a
GATA-6-specific peptide linked to keyhole limpet hemocyanin as
described elsewhere (2). The purified GATA-6 antibody was
used at a dilution of 1/1,000 and was revealed with an anti-rabbit
horseradish peroxidase-conjugated antibody (Sigma) at a dilution of
1/100,000.
RIA.
Immunoreactive ANF (irANF) concentration was determined
in the cardiomyocyte culture medium by radioimmunoassay (RIA) as
previously described (3).
Pull-down assays.
Polyhistidine-tagged GATA-4 and wild-type
GATA-6 were in vitro cotranscribed and cotranslated in the presence of
radiolabeled methionine according to the manufacturer's protocol (TNT
reticulocyte lysate kit; Promega Corp.). The proteins were then allowed
to interact at 4°C with agitation in 400 µl of binding buffer (150 mM NaCl, 50 mM Tris-Cl [pH 7.5], 0.3% Nonidet P-40, 10 mM
ZnCl2, 1 mM dithiothreitol, 0.25% BSA) as described
previously (9). After 2 h, 50 µl of nickel resin
(ProBond resin; Invitrogen Corp.) was added, and the reaction mixture
was incubated further for 2 h at 4°C. The resin was then washed
three times with binding buffer and twice with binding buffer minus
BSA. Interacting proteins were resolved by SDS-PAGE (15% gel). The gel
was dried and exposed to a PhosphorImager cassette.
Cross-linking.
Cardiomyocyte whole-cell extracts were
prepared in radioimmunoprecipitation assay (RIPA) buffer (PBS, 1%
NP-40, 0.5% sodium deoxycholate, 0.1% SDS, cocktail of protease
inhibitors) by repeated aspiration through a syringe needle, followed
by centrifugation to pellet cellular debris. The supernatant was then
incubated on ice for increasing amounts of time in the presence of
0.02% glutaraldehyde, and the reaction was blocked by the addition of 1 M glycine (pH 7.6). To reduce nonspecific binding, the cellular extracts were preincubated at 4°C for 30 min with 1 µg of normal goat serum and 20 µl of protein A/G PLUS-Agarose (Santa Cruz
Biotechnology). GATA-4/GATA-6 complexes were immunoprecipitated with 1 µl of anti-GATA-4 antibody (Santa Cruz Biotechnology) and 20 µl of
protein A/G PLUS-Agarose at 4°C overnight with agitation.
Subsequently, the immunoprecipitates were washed four times in RIPA
buffer, resolved by SDS-PAGE, and transferred to a polyvinylidene
difluoride membrane. The presence of the GATA-4/GATA-6 complexes was
revealed by Western blotting using an anti-GATA-6 antibody.
Immunofluorescence.
Paraformaldehyde-fixed heart sections
from neonatal mice were processed for immunofluorescence as described
elsewhere (41). The GATA-4 antibody was used at a dilution
of 1/500 and was revealed with a biotinylated anti-goat antibody
(1/200; Vector Laboratories Inc., Burlingame, Calif.) followed by
avidin-rhodamine (1/200; Vector Laboratories). The purified GATA-6
antibody was used at a dilution of 1/50 and was revealed with a
fluorescein isothiocyanate-conjugated anti-rabbit antibody (1/200; Sigma).
 |
RESULTS |
In vivo target genes for GATA-4 and GATA-6 in postnatal atrial and
ventricular cardiomyocytes.
To analyze the consequence of
inhibiting GATA-4 or GATA-6 expression for endogenous myocardial gene
expression, we used adenovirus-mediated delivery of antisense gene
regions to cardiomyocytes in primary culture. For this, we initially
determined the dose of adenovirus that would efficiently infect
ventricular cardiomyocytes isolated from 4-day neonatal rats, using a
replication-deficient adenovirus expressing a lacZ gene
fused to an SV40 NLS (Ctl adenovirus). At a multiplicity of infection
(MOI) of 1, all the cardiomyocytes showed
-galactosidase activity
(blue staining) in the nucleus, with staining intensity increasing in a
dose-dependent manner up to an MOI of 16 (Fig.
1B to D). No staining was observed in mock-infected cardiomyocytes (Fig. 1A). Similar results were obtained with atrial neonatal cardiomyocytes (data not shown). Higher dose of
the Ctl adenovirus led to cytotoxicity (data not shown). Thus, MOIs
ranging from 1 to 16, which achieve efficient infection without any
apparent cytotoxicity (Fig. 1), were used in subsequent experiments.

View larger version (135K):
[in this window]
[in a new window]
|
FIG. 1.
Cardiomyocytes are efficiently infected by adenovirus.
Ventricular cardiomyocytes isolated from 4-day neonatal rats were mock
infected (A) or infected at MOIs of 1 (B), 4 (C), and 16 (D) with the
Ctl adenovirus, which expresses an NLS-lacZ gene. Twenty
hours later, cells were assayed for -galactosidase activity.
|
|
To specifically inhibit GATA-4 or GATA-6 protein production,
replication-deficient adenoviruses expressing an antisense cDNA directed specifically toward GATA-4 or GATA-6 were generated. A 358-bp
fragment from the extreme N-terminal portion of GATA-4 was used for the
AS4 production (Fig. 2A). For AS6, a 359-bp fragment from the 5' UTR of
GATA-6 was used. These regions were chosen because of their low overall
homology with other GATA factors, and as shown in Fig.
2B, the DNA fragments used to generate
AS4 and AS6 show no cross-hybridization with each other's mRNA.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Characterization of AS4 and AS6. (A) Schematic
representation of the constructs used to generate the recombinant
adenoviruses. NLS-lacZ, a 358-bp fragment from the extreme
N-terminal portion of GATA-4, or a 359-bp fragment from the 5' UTR of
GATA-6 was cloned downstream of the CMV promoter and upstream of an
SV40 poly(A) sequence in order to generate the recombinant
adenoviruses. (B) Transgene expression is dose dependent. Ventricular
cardiomyocytes were infected at MOIs of 16, 4, and 1 (corresponding to
the progressively narrowing triangle) with Ctl, AS4, and AS6. RNA was
isolated 3 days postinfection. Northern blot analysis showed that both
antisense transgenes were efficiently expressed in a dose-dependent
manner. (C) AS4 and AS6 are specific and efficient at decreasing GATA-4
and GATA-6 protein levels. Ventricular cardiomyocytes were infected as
described above, and nuclear extracts were isolated 3 days
postinfection and analyzed by Western blotting. L cells overexpressing
GATA-4 or GATA-6 were used as controls for the specificity of the
antibodies. (D) Quantification of the effects of AS4 and AS6 on GATA-4
and GATA-6 protein levels. The data represent the means of two
independent Western blots performed as described for panel C and
quantified by densitometry. At an MOI of 4, GATA-4 levels were
decreased specifically by AS4 (80% reduction), while GATA-6 levels
were reduced specifically by AS6 (60% reduction).
|
|
Ventricular neonatal cardiomyocytes were infected at MOIs of 1, 4, and
16 with Ctl, AS4, and AS6, and RNA was isolated 3 days postinfection.
Northern blot analysis showed that both antisense transgenes were
efficiently expressed in a dose-dependent manner, to a level exceeding
100-fold that of endogenous GATA-4 or -6 (Fig. 2B). AS4 and AS6 were
also specific and efficient at reducing GATA-4 and GATA-6 protein
levels in a dose-dependent manner, as evidenced by Western blot
analysis (Fig. 2C). As shown in Fig. 2D, AS4 reduced GATA-4 levels by
80% whereas AS6 reduced GATA-6 levels by 60% at an MOI of 4. The
effect of AS4 and AS6 extended also to GATA-binding activity as
assessed by EMSA; a 50% decrease in GATA binding over the ANF
120
GATA probe was observed with AS4 or AS6, indicating that indeed both
GATA-4 and GATA-6 contribute to the GATA-binding activity in postnatal
cardiomyocytes (data not shown). Moreover, AS4 and AS6 had no effect on
GATA-5 mRNA levels, suggesting that GATA-5 does not compensate for the
lack of GATA-4 or GATA-6 in postnatal cardiomyocytes (data not shown).
To assess the effects of reduced GATA-4 or GATA-6 activity on
endogenous gene expression, we initially analyzed changes in ANF mRNA
and protein levels. The ANF promoter contains two conserved GATA
elements (see Fig. 4A) and was previously shown to be transactivated by
GATA-4 and GATA-6 in heterologous cells (9, 14). In
ventricular neonatal cardiomyocytes with reduced GATA-4 or GATA-6
activity, irANF secretion was decreased in a time-dependent manner
(Fig. 3A). The effect was first observed
at 3 days postinfection (50% decrease), and irANF secretion was
decreased by 60 to 80% at 5 days postinfection. The decrease of
secreted irANF was dose dependent (Fig. 3B). Interestingly, the
reduction of both GATA-4 and GATA-6 activities (AS4 plus AS6) had the
same effect on irANF secretion as reduction of GATA-4 (AS4) or GATA-6
(AS6) activity alone (Fig. 3B), suggesting that either a maximal
threshold is reached or GATA-4 and GATA-6 are in the same
transcriptional pathway. The effect of attenuation of GATA-4 or GATA-6
on ANF expression extended to the transcript level (Fig. 3C). Similar
results were obtained with atrial cardiomyocytes (data not shown) and
indicate that the ANF gene is an in vivo transcriptional target for
GATA-4 and GATA-6 in postnatal cardiomyocytes.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
In vivo transcriptional targets for GATA-4 and GATA-6 in
postnatal cardiomyocytes. (A) irANF secretion is decreased in a
time-dependent manner by AS4 and AS6. Ventricular cardiomyocytes were
infected at an MOI of 4 with Ctl, AS4, and AS6. Secreted irANF was
assayed in the cardiomyocyte culture medium after a 24-h accumulation
period at 2, 3, and 5 days postinfection. Since the effect of the
antisense DNA on irANF secretion is clearly visible at 3 days
postinfection, subsequent analyses were performed at this time point.
(B) irANF secretion is decreased in a dose-dependent manner by AS4,
AS6, and AS4 plus AS6. Ventricular cardiomyocytes were infected at MOIs
of 16, 4, and 1 (corresponding to the progressively narrowing triangle)
with Ctl, AS4, AS6, and AS4 plus AS6. (C) ANF mRNA levels are decreased
in a dose-dependent manner by AS4, AS6, and AS4 plus AS6. Ventricular
cardiomyocytes were infected as for panel B, and total RNA was analyzed
by Northern blotting. The ANF mRNA levels are expressed relative to
that of Ctl-infected cardiomyocytes. The GAPDH mRNA levels were
unaffected. (D) Many cardiac genes are decreased by AS4 and AS6.
Ventricular cardiomyocytes were infected at an MOI of 4 with Ctl, AS4,
and AS6, and Northern blot analysis was performed on
poly(A)+ RNA (left). Relative mRNA levels were quantified
with a PhosphorImager (right). Note how -MHC and -MHC mRNAs were
preferentially down-regulated by AS4, whereas cardiac (c.) -actin,
myosin light-chain 1 (MLC1), and GAPDH mRNA levels were not affected by
AS4 or AS6.
|
|
We also verified that other cardiac genes were affected by the decrease
in GATA-4 or GATA-6. BNP,
-MHC,
-MHC, cTnI, and PDGFR
mRNA
levels were down-regulated by AS4 and AS6 (Fig. 3D). Interestingly,
-MHC and
-MHC were preferentially down-regulated by AS4,
suggesting that these genes are preferential targets for GATA-4. The
lack of GATA factors did not affect all cardiac genes; for example,
cardiac
-actin, myosin light-chain 1, and GAPDH mRNA levels were not
altered by AS4 or AS6 (Fig. 3C and D and data not shown). Similar
results were obtained by semiquantitative reverse transcription-PCR
analysis (data not shown). Thus, GATA-4 and GATA-6 are involved in
regulating specific subsets of cardiac genes in postnatal cardiomyocytes.
ANF is a direct transcriptional target for both GATA-4 and
GATA-6.
To determine if ANF is a direct transcriptional target for
both GATA-4 and GATA-6, a detailed analysis of the ANF promoter was
performed. Comparison of the ANF promoter sequences available in the
database (from human, rat, mouse, sheep, and bovine genomes) shows that two consensus WGATAR elements, a proximal one at
120 bp and a distal one at
280 bp, are entirely conserved across species (Fig. 4A), suggesting that these
GATA elements may play important evolutionarily conserved functions in
ANF gene regulation. Indeed, deletion or point mutation of the proximal
or the distal GATA element decreased by about 50% ANF promoter
activity in postnatal cardiomyocytes (Fig. 4B). A more drastic effect
was observed when both elements were mutated, leaving only 30% of
wild-type promoter activity. Similar results were observed for all
constructs in 1-day ventricular or atrial cardiomyocytes. Thus, both
proximal and distal GATA elements are major contributors of ANF
promoter activity in postnatal cardiomyocytes.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
ANF is a direct transcriptional target for both GATA-4
and GATA-6. (A) Alignment of sequences of human, rat, mouse, sheep, and
bovine (for which only a partial sequence is available) ANF promoters.
Note that two consensus WGATAR elements, a proximal one at 120 bp and
a distal one at 280 bp, are entirely conserved across species. (B)
The proximal and distal GATA elements are major contributors of ANF
promoter activity in neonatal cardiomyocytes. Wild-type and mutated ANF
promoters fused to the luciferase (luc) reporter gene were transiently
transfected into ventricular cardiomyocytes isolated from 4-day
neonatal rats. Luciferase activity was assayed 36 h
posttransfection. The results are expressed relative to the 700 bp
ANF promoter activity. (C) GATA-4 and GATA-6 transactivate the ANF
promoter. HeLa cells were cotransfected with a GATA-4 or GATA-6
expression vector and wild-type or mutated ANF promoters fused to the
luciferase reporter gene. Luciferase activity was assayed 36 h
posttransfection. The results are expressed as fold activation by
GATA-4 or GATA-6. In all cases, the data represent the mean ± standard deviation of two or three independent experiments carried out
in duplicate.
|
|
Since both GATA-4 and GATA-6 are present in neonatal cardiomyocytes, we
tested their relative efficiencies at transactivating the ANF promoter.
The results indicate that both GATA factors are potent activators of
the ANF promoter, exhibiting about 25- to 30-fold activation (Fig. 4C).
However, while mutation of the proximal or distal GATA element reduced
GATA-4 transactivation by approximately 50%, mutation of the proximal
GATA element fully abrogated GATA-6 transactivation.
To test whether this was due to differential affinity of GATA-4 and -6 for certain GATA elements, we analyzed the binding affinities of GATA-4
and GATA-6 for both ANF GATA elements. EMSAs were performed with
increasing amounts of radiolabeled probes and a constant amount of
nuclear extracts from L cells overexpressing GATA-4 or GATA-6 (Fig.
5A). Scatchard analysis revealed that
GATA-4 has similar relative affinities for the proximal and distal GATA elements (relative Kds of 1.41 and 2.73 nM,
respectively). However, the relative affinity of GATA-6 for the distal
element was 8-fold lower than that for the proximal GATA element
(relative Kds of 6.4 and 0.81 nM, respectively).
Similar Kds were obtained with bacterially
expressed proteins (data not shown). These results show for the first
time that GATA-4 and GATA-6 possess differential affinities for
naturally occurring sites.


View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
GATA-4 and GATA-6 bind GATA elements with different
affinities. (A) EMSAs were performed with increasing amounts of
radiolabeled probe ( 120-bp GATA or 280-bp GATA) and a constant
amount of nuclear extracts from L cells overexpressing GATA-4 or
GATA-6. GATA binding is shown in the upper panel. Scatchard analysis
were performed on the binding data, and the relative affinities
(Kd values) are shown. (B) GATA-4 has higher
affinity than GATA-6 for the 265-bp -MHC GATA element. EMSAs were
performed with nuclear extracts from L cells overexpressing GATA-4 or
GATA-6 incubated with a radiolabeled 120-bp ANF GATA element and
increasing amounts of an unlabeled competitor ( 120-bp ANF GATA,
120-bp ANF GATAmut, or 265-bp -MHC GATA; top right panel).
Relative bindings were quantitated and plotted as a function of the
amount of unlabeled competitor (left).
|
|
Since differential activation of the ANF promoter GATA elements by
GATA-4 and -6 correlated well with the relative affinities for these
sites, we tested whether the preferential regulation of
-MHC by
GATA-4 was due to differential affinities of GATA factors for the
-MHC GATA element (30). As shown in Fig. 5B, the
-MHC
GATA element was more efficient at competing GATA-4 than GATA-6
binding. Thus, the higher affinity of GATA-4 for this element may
explain the preferential regulation of the
-MHC gene by GATA-4.
GATA-4 and GATA-6 functionally and physically interact to
cooperatively activate cardiac promoters.
The fact that the
reduction of both GATA-4 and GATA-6 protein levels had the same effect
on ANF gene expression as the reduction of either factor alone suggests
that GATA-4 and GATA-6 are members of a single functional complex and
that ablation of GATA-4 or GATA-6 in that complex is sufficient to
disrupt its transcriptional activity.
To test whether GATA-4 and GATA-6 act cooperatively, the
700-bp ANF
promoter fused to luciferase was cotransfected with various doses of
GATA-4 and GATA-6 expression vectors. At a low dose of expression
vector where neither GATA-4 nor GATA-6 could activate transcription by
itself, synergistic activation of the ANF promoter was achieved when
both GATA factors were added (Fig. 6A).
Interestingly, cooperative activation by GATA-4 and -6 occurred through
a single GATA-binding site, as evidenced by the activation of the
135-bp ANF promoter construct. In fact, the proximal GATA element was necessary and sufficient for synergy, and the distal GATA element (
700-bp ANF
GATA
120 bp) could not mediate cooperative
activation. Synergistic activation by GATA-4 and GATA-6 was also
observed on the BNP promoter but not on a shorter ANF promoter lacking GATA elements (
106-bp ANF).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 6.
GATA-4 and GATA-6 functionally and physically interact
to activate cardiac promoters. (A) GATA-4 and GATA-6 cooperatively
activate cardiac promoters. ANF and BNP reporter vectors were
cotransfected with 200 ng of GATA-4 and GATA-6 expression vectors in
HeLa cells. Luciferase activity was assayed 36 h posttransfection.
The results are expressed as fold activation by GATA-4 and/or GATA-6.
(B) DNA binding by the GATA-4 mutants. EMSAs were performed on the
120-bp ANF GATA element, using various GATA-4 mutants overexpressed
in L cells. The results are summarized in Fig. 7. (C) Mapping of the
domain(s) required for synergy between GATA-4 and GATA-6. HeLa cells
were cotransfected with GATA-6 and various GATA-4 mutant expression
vectors. Luciferase activity was assayed 36 h posttransfection.
The results are expressed as fold synergy of the 135-bp ANF promoter,
which is defined by the activation of the 135-bp ANF promoter by both
GATA-4 and GATA-6 divided by the sum of the activation by GATA-4 and
GATA-6 alone. (D) The zinc fingers and the basic region of GATA-4 are
sufficient for physical interaction with GATA-6. Polyhistidine-tagged
GATA-4 and wild-type GATA-6 were in vitro cotranscribed and
cotranslated in the presence of radiolabeled methionine. The reaction
mixture was then incubated with a nickel resin in order to pull down
His-tagged GATA-4 from the mixture. Interacting proteins were resolved
by SDS-PAGE. Luciferase (luc) was used as a negative control for
interaction. The various His-tagged GATA-4 proteins are indicated with
asterisks, and the interacting GATA-6 proteins are marked by arrows.
Note that due to the His tag, GATA-4 has a slightly lower
electrophoretic mobility than GATA-6. (E) GATA-4 and GATA-6 interact in
vivo in postnatal cardiomyocytes. Cardiomyocyte whole-cell extracts
were cross-linked by using glutaraldehyde for 15, 30, and 150 min,
followed by immunoprecipitation (IP) with an anti-GATA-4 antibody. The
immunoprecipitates were resolved by SDS-PAGE, and the GATA-4/GATA-6
complexes were revealed by Western blotting using an anti-GATA-6
antibody. Positions of molecular weight standards (in kilodaltons) are
indicated on the left. The strong signal is due to the GATA-4 antibody
immunoglobulin G (IgG) heavy chains. Note that the GATA-4/GATA-6
complex migrates at about 110 kDa, which corresponds to the sum of the
molecular masses of GATA-4 and GATA-6.
|
|
The domain(s) of GATA-4 required for synergy with GATA-6 was mapped by
cotransfection in HeLa cells of GATA-6 and various GATA-4 mutant
expression vectors (Fig. 6C; summarized in Fig. 7). All mutants were tested for
expression and nuclear localization. The mutants used in transfection
assays were expressed at similar levels, as evidenced by EMSAs and
Western blot analysis (Fig. 6B and data not shown). Progressive
deletion of the N-terminal (127 to 443 and 201 to 443) activation
domain of GATA-4 did not drastically affect synergy with GATA-6.
However, deletion of the C-terminal activation domain of GATA-4 (1 to
332) or GATA-4 mutants harboring no transcriptional activation domain
(201 to 332 and 242 to 332) did not exhibit synergy with GATA-6. DNA
binding by GATA-4 was not required since G4m, a GATA-4 mutant in the
second zinc finger bearing no DNA-binding activity (but that still
localizes to the nucleus) was able to provide synergistic activation
with GATA-6. Thus, while the N-terminal activation domain of GATA-4 and
GATA-4 DNA-binding ability are dispensable, the C-terminal activation
domain of GATA-4 is required for synergy with GATA-6.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 7.
Summary of GATA-4 functional domains. The GATA-4
constructs used in this study are shown, along with some of their
functional properties. ND, not determined.
|
|
To test whether this functional cooperation between GATA-4 and -6 involves direct interaction, polyhistidine-tagged GATA-4 and wild-type
GATA-6 were in vitro cotranscribed and cotranslated in presence of
radiolabeled methionine. As shown in Fig. 6D and summarized in Fig. 7,
GATA-4 interacted specifically with GATA-6, and this interaction
required the zinc fingers and the basic region of GATA-4. The ability
of GATA-4 and GATA-6 to contact each other was further confirmed in
vivo by chemical cross-linking of cardiomyocyte extracts followed by
immunoprecipitation with a GATA-4 antibody and Western blotting with a
GATA-6 antibody. As shown in Fig. 6E, this resulted in
immunoprecipitation of a heterodimer composed of endogenous GATA-4 and
GATA-6 proteins.
GATA-4 expression and GATA-6 expression colocalize in postnatal
cardiomyocytes.
To ascertain that the immunoprecipitated GATA-4
and -6 complex reflects the ability of these proteins to associate with
each other intracellularly, we verified the coexpression of GATA-4 and
GATA-6 in cardiomyocytes. Immunofluorescence studies using specific
anti-GATA-4 and anti-GATA-6 antibodies were performed on sections from
neonatal mouse hearts and on primary rat cardiomyocyte cultures (Fig.
8 and data not shown). These studies
revealed that GATA-4 and GATA-6 colocalize in most postnatal
ventricular cardiomyocytes.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 8.
GATA-4 and GATA-6 colocalize in postnatal
cardiomyocytes. Immunofluorescence studies were performed on heart
sections from neonatal mice, using a specific anti-GATA-4 antibody (A)
and a specific anti-GATA-6 antibody (B). (C) Superposition of panels A
and B indicates that GATA-4 and GATA-6 colocalize in most postnatal
cardiomyocytes.
|
|
 |
DISCUSSION |
Members of the GATA family of transcription factors play critical
roles in diverse cellular processes. Although some members are
coexpressed in specific cell types, each family member appears to
fulfill essential, nonredundant functions during development. However,
the mechanisms by which GATA factors control gene expression and cell
fate as well as the molecular basis for their specificity remain poorly understood.
The data presented in this paper provide evidence for the existence of
specific in vivo downstream targets for two members of the GATA family,
GATA-4 and -6, which are coexpressed in myocardial cells. The results
also show that GATA factors act in concert to regulate transcription of
subsets of cellular genes, suggesting that combinatorial interactions
among GATA factors may differentially control various cellular processes.
Identification of in vivo targets for GATA factors in
cardiomyocytes.
Regulatory elements containing GATA-binding sites
have been identified in many cardiac promoters, including BNP,
-MHC,
cTnI, and cTnC, and GATA-4 was shown to transactivate several of these promoters (8, 14, 20, 28, 30, 35, 38, 42). However, several
cardiac markers examined which were previously proposed to be GATA-4
targets were still expressed at high levels in GATA-4 null hearts,
raising the possibility that these genes are not bona fide GATA-4
targets or that other cardiac factors, including GATA-6, whose
expression is up-regulated in GATA-4 null mice, provide compensatory
pathways (25, 31). Thus, determining the in vivo targets for
GATA-4 and GATA-6 is crucial for understanding their role in the heart.
The data obtained in this study indicate that while some cardiac genes
are regulated preferentially by GATA-4, others are targets for both
GATA-4 and GATA-6. This is consistent with a specialized role for each
factor in heart development and the requirement for both in normal
heart formation. At present, GATA-6 has been linked to cardioblast
proliferation whereas GATA-4 has been associated with terminal
differentiation (12, 15). In this respect, it is noteworthy
that markers of later stages of cardiomyocyte
differentiation
- and
-MHC genes
appear to be
preferential GATA-4 targets whereas genes expressed in
precardiomyocytes prior to the beating stage, such the natriuretic
peptide (ANF and BNP) and PDGFR genes (16, 24), are targeted
by both GATA-4 and GATA-6. Since the adenovirus-mediated antisense
strategy revealed that GATA-4 and GATA-6 are required for maintenance
of the differentiated phenotype in postnatal cardiomyocytes, it could
now be used to determine the role of these factors in embryonic
myocytes. Finally, in light of recent reports suggesting a role for
GATA-4 in mediating hypertrophic signals (17, 19), it will
be interesting to use the adenovirus tools developed in this study to
directly test the implication of GATA-4 or GATA-6 in cardiomyocyte hypertrophy.
Transcriptional mechanisms of GATA factors.
The data presented
here show that a subset of cellular genes may be bona fide targets for
more than one GATA factor, whereas others are under the control of a
specific GATA factor. It may be significant that this is the first time
that specific in vivo targets for cardiac GATA factors have been reported.
Differential affinity could be one of the mechanisms by which GATA
factors target distinct downstream genes. In the case of the
hematopoietic GATA-1, -2, and -3 proteins, in vitro binding site
selection experiments have shown differences in DNA-binding specificity, although they have not yet been correlated with natural GATA elements present on hematopoietic promoters (23).
In this study, we show that GATA-4 and GATA-6 bind to the two ANF GATA
elements with different relative affinities that correlate well with
their ability to transactivate the ANF promoter. The results also show
that the higher affinity of GATA-4 for the
-MHC GATA element
correlates with the finding that the endogenous
-MHC gene is a
preferential GATA-4 target. Interestingly, the ANF and
-MHC
sequences that are preferential GATA-4 binding sites have an A residue
at the W position of the consensus WGATAR. While ascertainment of the
generality of this observation awaits additional studies, it is
noteworthy that at least one other natural AGATAA site present on the
BNP promoter (at
30 bp) also appears to be a preferential
GATA-4-binding site (6a). The results raise the possibility
of finding specific targets for GATA-4 or -6 based on differential
affinities for their DNA sequences.
An important outcome of this study is the demonstration that some
cardiac genes such as the ANF and BNP genes are bona fide targets for
both GATA-4 and GATA-6 and that the two GATA factors form
transcriptionnally active complexes over a single GATA element. Several
lines of evidence supporting the existence of functional interaction
between GATA-4 and GATA-6 are presented. First, the reduction of both
GATA-4 and GATA-6 protein levels had the same effect on ANF expression
as that of either factor alone, suggesting that GATA-4 and GATA-6 are
members of a single functional complex and that the ablation of GATA-4
or GATA-6 in that complex is sufficient to disrupt its transcriptional
activity. Second, when GATA-4 and GATA-6 are cotransfected in
heterologous cells, they cooperatively activate ANF and BNP reporter
genes. The presence of a functional complex between GATA-4 and GATA-6
is further supported by the finding that GATA-4 and GATA-6 physically
interact in vitro and in vivo in postnatal cardiomyocytes.
Finally, the colocalization of GATA-4 and GATA-6 in postnatal
cardiomyocytes lends further credibility to the likelihood of in vivo
relevance of a GATA-4 and GATA-6 interaction.
Homotypic (for GATA-1) and heterotypic interactions between
hematopoietic GATA factors (GATA-1 and GATA-2 or GATA-3) via the DNA-binding domain of GATA-1 have also been reported (7, 27, 43). In the case of GATA-4 and GATA-6, physical interaction also
occurs via the DNA-binding zinc finger domain; however, functional cooperativity requires the C-terminal activation domain of GATA-4, suggesting that the transcriptionally active complex includes additional cofactors that are involved in specific protein-protein interactions with one but not the other GATA member. In the case of
ANF, such a cofactor may be Nkx2-5, which was shown to specifically interact with GATA-4 but not GATA-6 (9, 10). Thus,
heterotypic interactions may be an intrinsic property of GATA factors,
and the combinatorial interaction of different GATA factors present in
various cell types with each other and with other cellular cofactors
may contribute to their cell-specific mode of action. The finding that
GATA-4 and GATA-6 cooperatively target the ANF and BNP genes in
neonatal cardiomyocytes provides biological relevance for these
heterotypic interactions.
 |
ACKNOWLEDGMENTS |
We are grateful to Gaétan Thibault for assistance with the
ANF RIA, to Brent French for the Ctl adenovirus and the
p
E1sp1B/CMV/BGH shuttle vector, to Tony Antakly for production of
the GATA-6 antibody, to Lynda Robitaille for technical assistance, to
Lise Laroche for secretarial assistance, and to members of the Nemer
laboratory for discussions and critical reading of the manuscript.
This work was supported by grants from the Canadian Medical Research
Council (MRC). F.C. and O.B. are recipients of research traineeships
from the Heart and Stroke Foundation of Canada, G.N. holds a GIBCO-IRCM
studentship, and M.N. is an MRC Scientist.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut de
Recherches Cliniques de Montréal, Laboratoire de
Développement et Différenciation Cardiaques,
110, des Pins Ouest, Montréal, Québec, Canada H2W 1R7.
Phone: (514) 987-5680. Fax: (514) 987-5575. E-mail:
nemerm{at}ircm.qc.ca.
 |
REFERENCES |
| 1.
|
Agah, R.,
P. A. Frenkel,
B. A. French,
L. H. Michael,
P. A. Overbeek, and M. D. Schneider.
1997.
Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo.
J. Clin. Investig.
100:169-179[Medline].
|
| 2.
|
Antakly, T.,
D. Raquidan,
D. O'Donnel, and L. Katnick.
1990.
Regulation of glucocorticoid receptor expression. I. Use of a specific radioimmunoassay and antiserum to a synthetic peptide of the N-terminal domain.
Endocrinology
126:1821-1828[Abstract].
|
| 3.
|
Ardati, A., and M. Nemer.
1993.
A nuclear pathway for 1-adrenergic receptor signaling in cardiac cells.
EMBO J.
12:5131-5139[Medline].
|
| 4.
|
Argentin, S.,
A. Ardati,
S. Tremblay,
I. Lihrmann,
L. Robitaille,
J. Drouin, and M. Nemer.
1994.
Developmental stage-specific regulation of atrial natriuretic factor gene transcription in cardiac cells.
Mol. Cell. Biol.
14:777-790[Abstract/Free Full Text].
|
| 5.
|
Argentin, S.,
Y.-L. Sun,
I. Lihrmann,
T. J. Schmidt,
J. Drouin, and M. Nemer.
1991.
Distal cis-acting promoter sequences mediate glucocorticoid stimulation of cardiac atrial natriuretic factor gene transcription.
J. Biol. Chem.
266:23315-23322[Abstract/Free Full Text].
|
| 6.
|
Bett, A. J.,
W. Haddara,
L. Prevec, and F. L. Graham.
1994.
An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3.
Proc. Natl. Acad. Sci. USA
91:8802-8806[Abstract/Free Full Text].
|
| 6a.
| Charron, F., and M. Nemer. Unpublished data.
|
| 7.
|
Crossley, M.,
M. Merika, and S. H. Orkin.
1995.
Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains.
Mol. Cell. Biol.
15:2448-2456[Abstract].
|
| 8.
|
Di Lisi, R.,
C. Millino,
E. Calabria,
F. Altruda,
S. Schiaffino, and S. Ausoni.
1998.
Combinatorial cis-acting elements control tissue-specific activation of the cardiac troponin I gene in vitro and in vivo.
J. Biol. Chem.
273:25371-25380[Abstract/Free Full Text].
|
| 9.
|
Durocher, D.,
F. Charron,
R. Warren,
R. J. Schwartz, and M. Nemer.
1997.
The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors.
EMBO J.
16:5687-5696[Medline].
|
| 10.
|
Durocher, D., and M. Nemer.
1998.
Combinatorial interactions regulating cardiac transcription.
Dev. Genet.
22:250-262[Medline].
|
| 11.
|
French, B. A.,
W. Mazur,
N. M. Ali,
R. S. Geske,
J. P. Finnigan,
G. P. Rodgers,
R. Roberts, and A. E. Raizner.
1994.
Percutaneous transluminal in vivo gene transfer by recombinant adenovirus in normal porcine coronary arteries, atherosclerotic arteries, and two models of coronary restenosis.
Circulation
90:2402-2413[Abstract/Free Full Text].
|
| 12.
|
Gove, C.,
M. Walmsley,
S. Nijjar,
D. Bertwistle,
M. Guille,
G. Partington,
A. Bomford, and R. Patient.
1997.
Over-expression of GATA-6 in Xenopus embryos blocks differentiation of heart precursors.
EMBO J.
16:355-368[Medline].
|
| 13.
|
Graham, F. L., and L. Prevec.
1991.
Gene transfer and expression protocols, p. 109-128.
In
E. J. Murray (ed.), Manipulation of adenovirus vectors.Methods in molecular biology. Humana Press, Clifton, N.J.
|
| 14.
|
Grépin, C.,
L. Dagnino,
L. Robitaille,
L. Haberstroh,
T. Antakly, and M. Nemer.
1994.
A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.
Mol. Cell. Biol.
14:3115-3129[Abstract/Free Full Text].
|
| 15.
|
Grépin, C.,
G. Nemer, and M. Nemer.
1997.
Enhanced cardiogenesis in embryonic stem cells overexpressing the GATA-4 transcription factor.
Development
124:2387-2395[Abstract].
|
| 16.
|
Grépin, C.,
L. Robitaille,
T. Antakly, and M. Nemer.
1995.
Inhibition of transcription factor GATA-4 expression blocks in vitro cardiac muscle differentiation.
Mol. Cell. Biol.
15:4095-4102[Abstract].
|
| 17.
|
Hasegawa, K.,
S. J. Lee,
S. M. Jobe,
B. E. Markham, and R. N. Kitsis.
1997.
cis-acting sequences that mediate induction of beta-myosin heavy chain gene expression during left ventricular hypertrophy due to aortic constriction.
Circulation
96:3943-3953[Abstract/Free Full Text].
|
| 18.
|
Heikinheimo, M.,
J. M. Scandrett, and D. B. Wilson.
1994.
Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development.
Dev. Biol.
164:361-373[Medline].
|
| 19.
|
Herzig, T. C.,
S. M. Jobe,
H. Aoki,
J. D. Molkentin,
A. W. Cowley, Jr.,
S. Izumo, and B. E. Markham.
1997.
Angiotensin II type 1a receptor gene expression in the heart: AP- 1 and GATA-4 participate in the response to pressure overload.
Proc. Natl. Acad. Sci. USA
94:7543-7548[Abstract/Free Full Text].
|
| 20.
|
Ip, H. S.,
D. B. Wilson,
M. Heikinheimo,
Z. Tang,
C. N. Ting,
M. C. Simon,
J. M. Leiden, and M. S. Parmacek.
1994.
The GATA-4 transcription factor transactivates the cardiac muscle-specific troponin C promoter-enhancer in nonmuscle cells.
Mol. Cell. Biol.
14:7517-7526[Abstract/Free Full Text].
|
| 21.
|
Jiang, Y. M., and T. Evans.
1996.
The Xenopus GATA-4/5/6 genes are associated with cardiac specification and can regulate cardiac-specific transcription during embryogenesis.
Dev. Biol.
174:258-270[Medline].
|
| 22.
|
Kelley, C.,
H. Blumberg,
L. I. Zon, and T. Evans.
1993.
GATA-4 is a novel transcription factor expressed in endocardium of the developing heart.
Development
118:817-827[Abstract].
|
| 23.
|
Ko, L. J., and J. D. Engel.
1993.
DNA-binding specificities of the GATA transcription factor family.
Mol. Cell. Biol.
13:4011-4022[Abstract/Free Full Text].
|
| 24.
|
Kohtz, D. S.,
N. R. Dische,
T. Inagami, and B. Goldman.
1989.
Growth and partial differentiation of presumptive human cardiac myoblasts in culture.
J. Cell Biol.
108:1067-1078[Abstract/Free Full Text].
|
| 25.
|
Kuo, C. T.,
E. E. Morrisey,
R. Anandappa,
K. Sigrist,
M. M. Lu,
M. S. Parmacek,
C. Soudais, and J. M. Leiden.
1997.
GATA4 transcription factor is required for ventral morphogenesis and heart tube formation.
Genes Dev.
11:1048-1060[Abstract/Free Full Text].
|
| 26.
|
Laverriere, A. C.,
C. MacNeill,
C. Mueller,
R. E. Poelmann,
J. B. Burch, and T. Evans.
1994.
GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut.
J. Biol. Chem.
269:23177-23184[Abstract/Free Full Text].
|
| 27.
|
Mackay, J. P.,
K. Kowalski,
A. H. Fox,
R. Czolij,
G. F. King, and M. Crossley.
1998.
Involvement of the N-finger in the self-association of GATA-1.
J. Biol. Chem.
273:30560-30567[Abstract/Free Full Text].
|
| 28.
|
McGrew, M. J.,
N. Bogdanova,
K. Hasegawa,
S. H. Hughes,
R. N. Kitsis, and N. Rosenthal.
1996.
Distinct gene expression patterns in skeletal and cardiac muscle are dependent on common regulatory sequences in the MLC1/3 locus.
Mol. Cell. Biol.
16:4524-4538[Abstract].
|
| 29.
|
McGrory, W. J.,
D. S. Bautista, and F. L. Graham.
1988.
A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5.
Virology
163:614-617[Medline].
|
| 30.
|
Molkentin, J. D.,
D. V. Kalvakolanu, and B. E. Markham.
1994.
Transcription factor GATA-4 regulates cardiac muscle-specific expression of the -myosin heavy-chain gene.
Mol. Cell. Biol.
14:4947-4957[Abstract/Free Full Text].
|
| 31.
|
Molkentin, J. D.,
Q. Lin,
S. A. Duncan, and E. N. Olson.
1997.
Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis.
Genes Dev.
11:1061-1072[Abstract/Free Full Text].
|
| 32.
|
Molkentin, J. D.,
J. R. Lu,
C. L. Antos,
B. Markham,
J. Richardson,
J. Robbins,
S. R. Grant, and E. N. Olson.
1998.
A calcineurin-dependent transcriptional pathway for cardiac hypertrophy.
Cell
93:215-228[Medline].
|
| 33.
|
Morrisey, E. E.,
H. S. Ip,
M. M. Lu, and M. S. Parmacek.
1996.
GATA-6 a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm.
Dev. Biol.
177:309-322[Medline].
|
| 34.
|
Morrisey, E. E.,
Z. Tang,
K. Sigrist,
M. M. Lu,
F. Jiang,
H. S. Ip, and M. S. Parmacek.
1998.
GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo.
Genes Dev.
12:3579-3590[Abstract/Free Full Text].
|
| 35.
|
Murphy, A. M.,
W. R. Thompson,
L. F. Peng, and L. Jones, II.
1997.
Regulation of the rat cardiac troponin I gene by the transcription factor GATA-4.
Biochem. J.
322:393-401.
|
| 36.
|
Pandolfi, P. P.,
M. E. Roth,
A. Karis,
M. W. Leonard,
E. Dzierzak,
F. G. Grosveld,
J. D. Engel, and M. H. Lindenbaum.
1995.
Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis.
Nat. Genet.
11:40-44[Medline].
|
| 37.
|
Pevny, L.,
M. C. Simon,
E. Robertson,
W. H. Klein,
S. F. Tsai,
V. D'Agati,
S. H. Orkin, and F. Costantini.
1991.
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1.
Nature
349:257-260[Medline].
|
| 38.
|
Rosoff, M. L., and N. M. Nathanson.
1998.
GATA factor-dependent regulation of cardiac m2 muscarinic acetylcholine gene transcription.
J. Biol. Chem.
273:9124-9129[Abstract/Free Full Text].
|
| 39.
|
Simon, M. C.
1995.
Gotta have GATA.
Nat. Genet.
11:9-11[Medline].
|
| 40.
|
Tsai, F. Y.,
G. Keller,
F. C. Kuo,
M. Weiss,
J. Chen,
M. Rosenblatt,
F. W. Alt, and S. H. Orkin.
1994.
An early haematopoietic defect in mice lacking the transcription factor GATA-2.
Nature
371:221-226[Medline].
|
| 41.
|
Viger, R. S.,
C. Mertineit,
J. M. Trasler, and M. Nemer.
1998.
Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Müllerian inhibiting substance promoter.
Development
125:2665-2675[Abstract].
|
| 42.
|
Wang, G. F.,
W. Nikovits, Jr.,
M. Schleinitz, and F. E. Stockdale.
1998.
A positive GATA element and a negative vitamin D receptor-like element control atrial chamber-specific expression of a slow myosin heavy-chain gene during cardiac morphogenesis.
Mol. Cell. Biol.
18:6023-6034[Abstract/Free Full Text].
|
| 43.
|
Yang, H. Y., and T. Evans.
1995.
Homotypic interactions of chicken GATA-1 can mediate transcriptional activation.
Mol. Cell. Biol.
15:1353-1363[Abstract].
|
| 44.
|
Zheng, W., and R. A. Flavell.
1997.
The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells.
Cell
89:587-596[Medline].
|
Molecular and Cellular Biology, June 1999, p. 4355-4365, Vol. 19, No. 6
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.