INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

We discovered that the non-Mendelian genetic elements [URE3] and [PSI] were infectious protein forms (prions) of the Saccharomyces cerevisiae Ure2p and Sup35p, respectively, based on their genetic properties (47). We proposed three genetic criteria to identify prions: (i) reversible curability, (ii) induction of prion formation de novo by overexpression of the normal protein, and (iii) a unique phenotypic relationship between the presence of a prion and mutation in the chromosomal gene encoding the protein (47). We noted that [URE3] and [PSI], two non-Mendelian genetic elements of S. cerevisiae, both satisfy all three of these genetic criteria as prion forms of Ure2p and Sup35p, respectively (47). Biochemical and further genetic data have supported this proposal (6, 12, 21, 25, 30, 31, 34-36). For example, fragments of Ure2p in extracts of [URE3] cells are more resistant to treatment with proteinase K than are similar extracts of wild-type cells (31). Recently, these same genetic criteria have been used to identify another prion, the [Het-s] non-Mendelian genetic element of the filamentous fungus Podospora anserina (10).

The discovery that [URE3] and [PSI] were prions showed that proteins can, like nucleic acids, be informational molecules. Moreover, their primary sequence is not the only form in which they carry this information. Although [URE3] and [PSI], like scrapie, are diseases, [Het-s] appears to be a prion carrying normal information for Podospora (10; reviewed in reference 48). It is possible that mammals may also have prions responsible for inherited traits, or that this same or similar mechanisms operate in certain cases of information transfer within an organism.

The concept of an infectious protein (a prion) originates with studies of the mammalian transmissible spongiform encephalopathies, such as scrapie and Creutzfeldt-Jakob disease (1, 22; reviewed in references 7, 17, and 38). PrP involvement in scrapie was first shown by genetic (13) and biochemical (2) evidence, the two brought together by the identification of the mouse Sinc (for scrapie incubation) gene as the structural gene for PrP (5, 8, 33). PrP is necessary for scrapie (4) but has not yet been shown to be sufficient. Specifically, none of the three genetic criteria that we proposed for a prion (see above and reference 47) have yet been shown to be satisfied by PrP and scrapie.

To further substantiate [URE3] as a prion, we showed that it is overexpression of the URE2-encoded protein, and not its transcript or the gene itself in high copy number, that induces the de novo formation of [URE3] (30). Moreover, [URE3] was really arising de novo, not as a mutant form of a previously present nucleic acid replicon (30, 47). Finally, the presence of [URE3] can be demonstrated in cells that are not derepressed for nitrogen metabolism (30), showing that the [URE3] state is not a stable regulatory state such as has been shown for some other inheritable traits (32).

Ure2p is a 354-amino-acid protein (9) that can be divided into two domains, an amino-terminal prion domain of residues 1 to 64 and a carboxyl-terminal nitrogen regulation domain of residues 66 to 354 (30, 31). The N-terminal prion domain, when transiently overexpressed in a normal cell, induces the de novo appearance of [URE3] at frequencies 100 times higher than the rate for similarly overexpressed intact Ure2p and several thousand-fold higher than the background rate (31). This prion domain can propagate [URE3] in the complete absence of the C-terminal domain (30). The C-terminal domain can carry out the nitrogen regulation function of Ure2p in the complete absence of the prion domain, although the regulation is leaky unless this nitrogen regulation domain is overexpressed (9, 31). In a strain with the prion [URE3], the nitrogen regulation function of molecules carrying a prion domain is inactivated, but those lacking this domain remain active (30, 31).

The prion domain of Ure2p (31) is quite rich in asparagine (40% of residues) including several runs (9). The prion domain of Sup35p (12, 44) is likewise rich in asparagine and glutamine (24, 28, 49), and these residues are important for [PSI] (11). However, neither PrP (8, 33) nor the Het-s protein (46) has such regions. It has been suggested that the expansion of glutamine repeats in several triplet-repeat diseases is responsible for protein aggregation and the pathology of these diseases (37, 41). It is thus possible that the asparagines of Ure2p mediate the prion properties of this protein.

Recent data suggest a biochemical basis for [URE3]. Fusion proteins of Ure2p and green fluorescent protein are aggregated specifically in [URE3] cells but not in [ure-o] or cured cells (15). Synthetic Ure2p^1-65 (the prion domain peptide) spontaneously forms amyloid filaments in vitro (43). These filaments are essentially all -sheet, and they give green birefringence when stained with Congo red. Ure2p^1-65 also induces filament formation by native purified Ure2p, and the latter filaments can seed further filament formation by Ure2p. All of these filaments have the properties of amyloid (43). These results suggest that [URE3] is due to amyloid formation by Ure2p.

The experiments reported here concern the dissection of the molecular determinants of prion inducibility by Ure2p. We have identified a second region of the molecule that is necessary for Ure2p to induce de novo formation of [URE3] but which is not necessary for the previously determined prion domain (residues 1 to 64) to do so. We find that prion induction is possible in the absence of the 1-64 region and requires two other regions. We also explore the role of the runs of asparagine in the prion domain and the interactions among other sites.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast strains and methods. Diploid strain 3469 (MAT/MATa kar1/kar1 ura2/ura2 leu2/leu2 +/his trp1/+ [ure-o]) and haploid strain 3385 (MATa kar1 ura2 leu2 his [ure-o]) were used to assess induction of [URE3], and strain 3718 (MAT his3 leu2 ura2 ure2::URA3) was used to determine complementation of ure2. SD and SGal are minimal media with dextrose and galactose, respectively, as carbon sources (40). Transformation was done by the lithium method (23).

Plasmid constructions. Plasmid p646 (YEp351G-URE2) is a LEU2 2 µm DNA shuttle plasmid with URE2 under the GAL1 promoter (47). To construct p773, p774, p776, p778, and p646SD, each bearing one deletion in the URE2 gene, pGAL1::URE2 (p646) was used as template in the Kunkel method (Bio-Rad Mutagene kit) with the mutagenic oligonucleotides D18-27, D44-50, D56-62, D66-80, and DSphI (Table 1), respectively. Constructs p682, p664, p683, p680, pe2+3, and p725 are detailed in previous publications (30, 31, 47) and in Table 1. The constructs p725SK, p718N, pD44L, pD55M, and pD66I, with two deletions in URE2, were obtained by using p725 as the template with the mutagenic primers DSphI, D18-27, D44-50, D56-62, and D66-80 (Table 1), respectively. pD80-1, pD89-4, and p725D80-1 were made by PCR using p646 or p725 (for p725D80-1) as the template and the 5' primer D3-80 or D3-89 (Table 1) with the 3' primer LSacII (5'TGCCTTGATGACCGCGGGTCTTCT3'). The fragments obtained were cut with BamHI and SacII and subcloned into p646 cut with BamHI and SacII and thus lack the part of URE2 3' to the SacII site within the URE2 open reading frame.

Western blot analysis. Transformants of strain 3469 were grown on SGal plates with uracil for 3 days, then inoculated into liquid medium composed of 50% YPAD and 50% SGal, and grown for 4 h. Cells were then washed and transferred to liquid SGal medium with uracil for 12 h. Proteins were extracted as described elsewhere (29) but without boiling and in the presence of 100 µg of phenylmethylsulfonyl fluoride per ml. The same amount of protein from each extract, as determined by the Bio-Rad protein assay, was heated for 5 min at 96°C and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% gel). Transfer of the proteins to a polyvinylidene difluoride (Millipore) membrane was done in 10% methanol-25 mM Tris-192 mM glycine buffer (pH 8.3) for 1 h at 300 mA. The membrane was dried and incubated 2 h in blocking buffer (TTBS; 0.05% Tween 20, 10 mM Tris borate [pH 7.4] 150 mM NaCl) with 5% dried milk. After 4 h of incubation with the primary antibody, the membrane was washed with TTBS and incubated for 1 h with the secondary antibody, a mouse anti-rabbit antibody conjugated to alkaline phosphatase (Promega Western Blue). Blots were developed as described previously (39). Primary antibodies were polyclonal rabbit antisera U2 (47), K1, K2, and K3 (42), made to full-length Ure2p, and C3, made to Ure2p^66-354 (42).

Characterization of [URE3] phenotype: induction, curing, and propagation assays. The haploid strain 3385 and the diploid strain 3469 were transformed with YEp351URE2 carrying different deletions in URE2. Ten transformants selected on Leu-deficient medium were mixed in water and grown on an SGal plate with uracil for 3 days. Several dilutions of these cells were made and spread on SD containing 100 µg of USA. USA⁺ colonies, indicating the development of the [URE3] state, were counted after 5 days. Each average number shown in the tables was calculated from at least three repeats of each experiment. The data in the figures are for the diploid strain 3469. Similar results were obtained with strain 3385, but the induction frequencies were generally higher.

Complementation assay. Strain 3718 (ure2) was transformed with YEp351G-URE2 carrying different deletions in URE2. The transformants selected on Leu-deficient medium were streaked on SGal with uracil and histidine. After 3 days, colonies were replica plated to SD with USA and histidine. Failure to grow on SD with USA and histidine indicates complementation of the nitrogen regulation function of URE2.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Asparagine-rich subregions are necessary for the minimal prion domain. The minimal prion domain was within residues 1 to 64, based on the ability of this fragment to efficiently induce [URE3] when overexpressed and the inability of a C-terminal fragment lacking residues 1 to 65 to induce [URE3] (31) (Fig. 1). We have made smaller deletions within this prion domain and tested the ability of the overexpressed remainder to induce [URE3] in a strain with a normal copy of URE2 (Fig. 1). Each of three deletions of asparagine-rich regions within the prion domain (773, 774, and 776) resulted in loss of most of the prion-inducing activity of the remainder of the molecule. Deletion of the asparagine-rich residues 66 to 80 also reduces prion-inducing activity, a first indication that this region can be involved in prion induction (Fig. 1, 778).

View larger version (38K): [in this window] [in a new window]   FIG. 1.   Asparagine runs are important for prion-inducing activity of Ure2p. A diploid strain (3469) was transformed with each plasmid and grown on galactose for 3 days to overproduce the indicated part of Ure2p; cells were plated on SD with ureidosuccinate in place of uracil, selective for [URE3] cells. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. The N-terminal part of the Ure2p sequence is shown below, with the regions deleted in p773, p774, p776, and p778 underlined. comple, complementation.

Residues 66 to 80 enhance the prion-inducing activity of residues 1 to 64. Although overexpression of residues 1 to 64 induces [URE3] formation at rates 100-fold higher than rates for the intact protein and comparable to those for C-terminal deletions, we find that including through residues 80 or 89 increases prion induction a further 10-fold (Fig. 2). Further extension results in a consistent severalfold decrease in inducing activity (Fig. 2, 672STO11). These results suggest that residues 66 to 80 can cooperate with residues 1 to 64 in the prion generation process, consistent with our finding (Fig. 1) that deletion of residues 66 to 80 reduces prion-inducing activity in the otherwise intact protein. Our results also suggest that there is a region downstream of residue 89 that modestly hinders the induction process.

View larger version (18K): [in this window] [in a new window]   FIG. 2.   Residues 66 to 80 enhance prion induction. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. comple, complementation.

A region outside the 1-89 region is necessary for prion induction by intact Ure2p. In-frame deletion of residues 151 to 158 or deletion of seven residues from the C-terminal extremity (348 to 354) results in a 100-fold increase in [URE3]-inducing activity and loss of ability to complement ure2 for nitrogen regulation (31) (Fig. 3, 725; Fig. 4, S1).

View larger version (16K): [in this window] [in a new window]   FIG. 3.   Ure2p residues 221 to 227 are needed for optimal [URE3] induction by intact Ure2p. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. comple, complementation.

View larger version (27K): [in this window] [in a new window]   FIG. 4.   A fragment of Ure2p lacking the 1-64 prion domain induces [URE3]. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. comple, complementation.

A second prion domain. Although the N-terminal 64 residues are sufficient to induce [URE3] at high frequency, deletion of either the 151-158 region or the C-terminal seven residues of Ure2p dramatically enhance prion induction by the remainder of the molecule (Fig. 4). Moreover, we have presented evidence above that the 221-227 region is necessary for prion induction by the whole Ure2p and that residues 66 to 80 enhance the activity of the N-terminal 64 residues. Starting with a fragment lacking the 1-65 prion domain (Fig. 4, D1-3), deletion of either the 151-158 region (p4B) or the C-terminal 7 residues (p682Sc6) did not give a fragment showing substantial [URE3] induction. However, deletion of both of these small regions resulted in substantial prion induction, even though it completely lacks the 1-65 segment (Fig. 4, pCS7).

Asparagine-rich regions are less critical in derepressed Ure2p fragments. Deletion of any of four asparagine-rich segments within the 1-80 region resulted in nearly complete elimination of prion-inducing activity of the otherwise intact molecule (Fig. 1). We tested the effect of deleting the same asparagine-rich segments on the very high activity seen with Ure2p fragments lacking the 151-158 region (Fig. 5). Although deletion of residues 56 to 62 decreased [URE3] induction in one strain, it did not impair induction in another (not shown). In smaller fragments, a decrease in prion induction by deletion of residues 44 to 50 is also seen (Fig. 2). Overall, the results indicate that the individual asparagine-rich regions are less critical for prion induction by the fragments derepressed for prion induction than they are in the intact molecule. Nonetheless, elimination of all of these regions by the 3-80 deletion does eliminate all known prion-inducing activity (Fig. 4, 725Hd+5).

View larger version (20K): [in this window] [in a new window]   FIG. 5.   Asparagine runs are important but not essential for prion induction by derepressed Ure2p fragments. Note that C3, B2, and A2 all have identical C-terminal tails. The C-terminal tail of 679 differs from those of P215 and P408. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. comple, complementation.

C-terminal tails affect prion-inducing activity. The effect of the presence of a C-terminal tail consisting of vector sequences or out-of-frame URE2 sequences was tested in comparison with constructs with a termination codon at the indicated site (Fig. 6). In each case, the presence of the tail increased prion-inducing activity 4- to 10-fold compared to the tail-less construct.

View larger version (16K): [in this window] [in a new window]   FIG. 6.   C-terminal tails can affect prion induction efficiency. , active in prion induction; , inactive in prion induction. The top line shows low prion induction activity. comple, complementation.

Steady-state levels of Ure2p fragments. The data presented above concerning the roles of various segments in the induction of [URE3] do not distinguish effects on protein function from effects on protein stability. It is particularly important to determine whether the deletion mutants that lack prion-inducing activity are present at levels comparable to those of the normal protein. However, since fragments of Ure2p are the best inducers of [URE3] appearance, protein instability does not necessarily explain failure to induce [URE3].

View larger version (68K): [in this window] [in a new window]   FIG. 7.   Steady-state levels of mutant Ure2 proteins measured by Western blotting. Construct names are as in Table 1 and Fig. 1 to 6. 554 is the vector alone, and 646 expresses full-length Ure2p. Anti-Ure2p antibodies used were U2 and affinity-purified K1, K2, K3, and C3 (A), affinity-purified U2 (B), U2, K2, and C3 (C and D), U2 (E), and affinity-purified U2, K1, K2, K3, and C3 (F). SD is 646SD. Positions of selected size markers are shown in kilodaltons. Equal amounts of total protein were analyzed.

Residue 44 is not critical for [URE3] induction. Deletion of one base in codon 44 to change the reading frame of URE2 eliminates prion induction without reducing the amount of mRNA (30). We show here that there is no unique function of the base deleted in this experiment, since deletion of the entire codon (encoding Asn), which maintains the reading frame, does not lower the prion-inducing activity of the remainder of Ure2p. The vector gave 22 [URE3] colonies per 10⁶ cells, while full-length Ure2p produced 303 colonies and two mutants lacking only codon 44 produced 350 and 398 colonies. Similarly, the 1-64 segment lacking codon 44 gave 1,360 colonies, while the 1-64 segment with codon 44 intact gave 1,304 colonies in the same experiment.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The N-terminal 64 amino acid residues of Ure2p are necessary for prion-inducing activity by the whole protein and are sufficient to carry out this function at higher efficiency than the intact Ure2p (31) (Fig. 1). Furthermore, the C-terminal part of Ure2p, lacking residues 3 to 65, is not inactivated on introduction of [URE3] (30). This work has given a picture of two protein domains interacting with each other, but each able to carry out its function in the absence of the other. The N-terminal domain can propagate [URE3] in the absence of the C-terminal part and the C-terminal part can regulate nitrogen metabolism in the absence of the N-terminal part (30, 31). However, the C-terminal part appears less efficient in performing the nitrogen regulatory function, and the N terminus is more efficient at inducing [URE3] in the absence of the other part, indicating that each domain stabilizes the other.

The second prion domain. We find that there are parts of the protein lacking residues 3 to 65 which are capable of prion induction. The first clue was that deletion of the 66-80 or the 221-227 region reduced the prion-inducing activity of the intact protein dramatically. In addition, the prion-inducing activity of residues 1 to 80 was actually 10-fold higher than that of the 1-64 fragment. This suggested that either of these regions could have a positive role in initiation or propagation of the prion state.

Asparagine-rich regions and prion induction. The 1-64 region first found to induce the [URE3] prion change is rich in asparagine residues, including several runs of asparagine (31). The prion-inducing domain of Sup35p is likewise rich in glutamine and asparagine residues (44), and these residues are indeed important for [PSI] (11). Our studies show that three asparagine-rich regions in the N-terminal part of Ure2p are important in prion induction. Further, the asparagine-rich residues 66 to 80 are essential for the second prion-inducing fragment. Moreover, the asparagine-rich regions each contribute to the frequency of prion induction.

View larger version (18K): [in this window] [in a new window]   FIG. 8.   Prion-promoting and -inhibiting domains of Ure2p compared to the glutathione S-transferase homology region and the nitrogen regulation domain.

How do deletions in the C-terminal domain enhance prion induction? Deletion of residues 151 to 158 or of seven residues at the extreme C terminus enhances induction of [URE3] about 100-fold (Fig. 4). Each of these deletions results in inactivation of the nitrogen regulation function of Ure2p, but it is unlikely that this inactivation is the cause of the enhanced prion induction. The relationships of nitrogen regulation with prion induction and propagation have been explored previously and found to be unconnected (30). The C-terminal mutations might enhance [URE3] induction by disrupting interaction of Ure2p with another protein factor, such as Gln3p, its main target of regulation. This question has not yet been adequately explored.

Parallels with scrapie, [PSI], and [Het-s]. None of the other prion proteins has been examined in sufficient detail to determine whether nonoverlapping domains can induce the prion form. Mutations distributed throughout the length of the Prnp gene encoding PrP result in dominant inherited human spongiform encephalopathy (38). Many deletions in Ure2p dramatically increase the frequency with which [URE3] arises but are outside either of the prion domains. We suggest that these mutations eliminate stabilizing interactions with the prion domains. Likewise, many Creutzfeldt-Jakob disease mutations may produce a PrP molecule in which internal interactions are replaced by intermolecular (aggregative) interactions, favoring prion development.

Comparison with mammalian amyloidoses. Recent evidence suggests that [URE3] is due to amyloid formation by Ure2p. Ure2p is aggregated in cells carrying [URE3] but is evenly distributed in cells not carrying the prion (15). Native Ure2p, purified from normal yeast, is a stable, soluble dimer (42). Residues 1 to 65 of Ure2p spontaneously form amyloid in vitro and initiate amyloid formation by the native Ure2p (43). This parallels the 100-fold-higher efficiency of in vivo prion induction by overproduced Ure2p^1-65 than by the same amount of the intact protein. The fact that fragments of Ure2p are far more efficient than the intact protein at inducing de novo [URE3] suggests that proteolytic fragments of Ure2p may be involved in its spontaneous generation even when only the full-length gene is present. Alzheimer's disease plaques contain the A peptide, a 40- or 42-residue fragment derived by proteolysis from a large precursor protein (19, 26). It is possible that only proteolytic fragments can become part of these plaques. In vitro amyloid formation by the monoclonal light chains produced by some multiple myelomas occurs only after partial proteolysis (20). However, it has been pointed out that these amyloids have been in the tissues for months or years, and so proteolytic digestion may occur after amyloid formation rather than before. There are little data for mammals comparable to those provided by our yeast prion (amyloid) induction experiments. Our finding that fragments have far higher prion (amyloid)-inducing activity than the intact protein provides evidence that fragments may play a dominant role in the initiation of amyloid formation.