Previous Article | Next Article 
Molecular and Cellular Biology, June 1999, p. 4516-4524, Vol. 19, No. 6
0270-7306/99/$04.00+0
Two Prion-Inducing Regions of Ure2p Are
Nonoverlapping
Marie-Lise
Maddelein and
Reed B.
Wickner*
Laboratory of Biochemistry and Genetics,
National Institute of Diabetes Digestive and Kidney Diseases,
National Institutes of Health, Bethesda, Maryland 20892-0830
Received 13 January 1999/Returned for modification 2 March
1999/Accepted 9 March 1999
 |
ABSTRACT |
Ure2p of Saccharomyces cerevisiae normally functions in
blocking utilization of a poor nitrogen source when a good nitrogen source is available. The non-Mendelian genetic element [URE3] is a
prion (infectious protein) form of Ure2p, so that overexpression of
Ure2p induces the de novo appearance of infectious [URE3]. Earlier
studies defined a prion domain comprising Ure2p residues 1 to 64 and a
nitrogen regulation domain included in residues 66 to 354. We find that
deletion of individual runs of asparagine within the prion domain
reduce prion-inducing activity. Although residues 1 to 64 are
sufficient for prion induction, the fragment from residues 1 to 80 is a
more efficient inducer of [URE3]. In-frame deletion of a region
around residue 224 does not affect nitrogen regulation but does
eliminate prion induction by the remainder of Ure2p. Larger deletions
removing the region around residue 224 and more of the C-terminal part
of Ure2p restore prion-inducing ability. A fragment of Ure2p lacking
the original prion domain does not induce [URE3], but surprisingly,
further deletion of residues 151 to 157 and 348 to 354 leaves a
fragment that can do so. The region from 66 to 80 and the region around
residue 224 are both necessary for this second prion-inducing activity. Thus, each of two nonoverlapping parts of Ure2p is sufficient to induce
the appearance of the [URE3] prion.
 |
INTRODUCTION |
We discovered that the non-Mendelian
genetic elements [URE3] and [PSI] were infectious protein forms
(prions) of the Saccharomyces cerevisiae Ure2p and Sup35p,
respectively, based on their genetic properties (47). We
proposed three genetic criteria to identify prions: (i) reversible
curability, (ii) induction of prion formation de novo by overexpression
of the normal protein, and (iii) a unique phenotypic relationship
between the presence of a prion and mutation in the chromosomal gene
encoding the protein (47). We noted that [URE3] and
[PSI], two non-Mendelian genetic elements of S. cerevisiae, both satisfy all three of these genetic criteria as prion forms of Ure2p and Sup35p, respectively (47).
Biochemical and further genetic data have supported this proposal
(6, 12, 21, 25, 30, 31, 34-36). For example, fragments of
Ure2p in extracts of [URE3] cells are more resistant to treatment
with proteinase K than are similar extracts of wild-type cells
(31). Recently, these same genetic criteria have been used
to identify another prion, the [Het-s] non-Mendelian genetic element
of the filamentous fungus Podospora anserina
(10).
The discovery that [URE3] and [PSI] were prions showed that
proteins can, like nucleic acids, be informational molecules. Moreover,
their primary sequence is not the only form in which they carry this
information. Although [URE3] and [PSI], like scrapie, are diseases,
[Het-s] appears to be a prion carrying normal information for
Podospora (10; reviewed in reference
48). It is possible that mammals may also have
prions responsible for inherited traits, or that this same or similar
mechanisms operate in certain cases of information transfer within an organism.
The concept of an infectious protein (a prion) originates with studies
of the mammalian transmissible spongiform encephalopathies, such as
scrapie and Creutzfeldt-Jakob disease (1, 22;
reviewed in references 7, 17, and
38). PrP involvement in scrapie was first shown by
genetic (13) and biochemical (2) evidence, the
two brought together by the identification of the mouse Sinc (for scrapie incubation) gene as the structural gene for PrP (5, 8, 33). PrP is necessary for scrapie (4) but has not
yet been shown to be sufficient. Specifically, none of the three
genetic criteria that we proposed for a prion (see above and reference 47) have yet been shown to be satisfied by PrP and scrapie.
To further substantiate [URE3] as a prion, we showed that it is
overexpression of the URE2-encoded protein, and not its
transcript or the gene itself in high copy number, that induces the de
novo formation of [URE3] (30). Moreover, [URE3] was
really arising de novo, not as a mutant form of a previously present
nucleic acid replicon (30, 47). Finally, the presence of
[URE3] can be demonstrated in cells that are not derepressed for
nitrogen metabolism (30), showing that the [URE3] state is
not a stable regulatory state such as has been shown for some other
inheritable traits (32).
Ure2p is a 354-amino-acid protein (9) that can be divided
into two domains, an amino-terminal prion domain of residues 1 to 64 and a carboxyl-terminal nitrogen regulation domain of residues 66 to
354 (30, 31). The N-terminal prion domain, when transiently
overexpressed in a normal cell, induces the de novo appearance of
[URE3] at frequencies 100 times higher than the rate for similarly
overexpressed intact Ure2p and several thousand-fold higher than the
background rate (31). This prion domain can propagate
[URE3] in the complete absence of the C-terminal domain
(30). The C-terminal domain can carry out the nitrogen regulation function of Ure2p in the complete absence of the prion domain, although the regulation is leaky unless this nitrogen regulation domain is overexpressed (9, 31). In a strain with the prion [URE3], the nitrogen regulation function of molecules carrying a prion domain is inactivated, but those lacking this domain
remain active (30, 31).
The prion domain of Ure2p (31) is quite rich in asparagine
(40% of residues) including several runs (9). The prion
domain of Sup35p (12, 44) is likewise rich in asparagine and
glutamine (24, 28, 49), and these residues are important for
[PSI] (11). However, neither PrP (8, 33) nor
the Het-s protein (46) has such regions. It has been
suggested that the expansion of glutamine repeats in several
triplet-repeat diseases is responsible for protein aggregation and the
pathology of these diseases (37, 41). It is thus possible
that the asparagines of Ure2p mediate the prion properties of this protein.
Recent data suggest a biochemical basis for [URE3]. Fusion proteins
of Ure2p and green fluorescent protein are aggregated specifically in
[URE3] cells but not in [ure-o] or cured cells (15).
Synthetic Ure2p1-65 (the prion domain peptide)
spontaneously forms amyloid filaments in vitro (43). These
filaments are essentially all
-sheet, and they give green
birefringence when stained with Congo red. Ure2p1-65 also
induces filament formation by native purified Ure2p, and the latter
filaments can seed further filament formation by Ure2p. All of these
filaments have the properties of amyloid (43). These results
suggest that [URE3] is due to amyloid formation by Ure2p.
The experiments reported here concern the dissection of the molecular
determinants of prion inducibility by Ure2p. We have identified a
second region of the molecule that is necessary for Ure2p to induce de
novo formation of [URE3] but which is not necessary for the
previously determined prion domain (residues 1 to 64) to do so. We find
that prion induction is possible in the absence of the 1-64 region and
requires two other regions. We also explore the role of the runs of
asparagine in the prion domain and the interactions among other sites.
 |
MATERIALS AND METHODS |
Yeast strains and methods.
Diploid strain 3469 (MAT
/MATa kar1/kar1 ura2/ura2 leu2/leu2
+/his
trp1/+ [ure-o]) and haploid strain 3385 (MATa kar1 ura2 leu2 his
[ure-o]) were used to assess induction of [URE3], and strain 3718 (MAT
his3 leu2 ura2 ure2::URA3) was used to
determine complementation of ure2
. SD and SGal are
minimal media with dextrose and galactose, respectively, as carbon
sources (40). Transformation was done by the lithium method
(23).
Plasmid constructions.
Plasmid p646 (YEp351G-URE2) is a
LEU2 2 µm DNA shuttle plasmid with URE2 under
the GAL1 promoter (47). To construct p773, p774,
p776, p778, and p646SD, each bearing one deletion in the URE2 gene, pGAL1::URE2 (p646) was used
as template in the Kunkel method (Bio-Rad Mutagene kit) with the
mutagenic oligonucleotides D18-27, D44-50, D56-62, D66-80, and DSphI
(Table 1), respectively. Constructs p682,
p664, p683, p680, pe2+3, and p725 are detailed in previous publications
(30, 31, 47) and in Table 1. The constructs p725SK, p718N,
pD44L, pD55M, and pD66I, with two deletions in URE2, were
obtained by using p725 as the template with the mutagenic primers
DSphI, D18-27, D44-50, D56-62, and D66-80 (Table 1), respectively.
pD80-1, pD89-4, and p725D80-1 were made by PCR using p646 or p725 (for
p725D80-1) as the template and the 5' primer D3-80 or D3-89 (Table 1)
with the 3' primer LSacII (5'TGCCTTGATGACCGCGGGTCTTCT3').
The fragments obtained were cut with BamHI and
SacII and subcloned into p646 cut with BamHI and SacII and thus lack the part of URE2 3' to the
SacII site within the URE2 open reading frame.
Constructs P409 and NSK18 were obtained by cutting p774 with
ApaI and
SphI or with
NotI and
SphI, respectively, followed by
filling with Klenow DNA
polymerase I and ligation. Plasmids P409,
NSK18, and 679 were cut with
HindIII, and oligonucleotide SPOH
(5'AGCTGCATGCTTAATTAATTAAGCATGC3') was inserted to add
a stop
codon producing P409STO1, K18STO4, and
679STO11.
The constructs pA2 and pB2 were obtained by PCR with the 5' primer Bam2
and the 3' primer N448 on the templates p646 and p774,
respectively.
The product was cut with
BamHI and
XhoI and
ligated
to YEp351G cut with
BamHI and
SalI. The
construct p4B was made
by PCR using p725 as the template with primers
D3-65 and LSacII.
pSKX was made by PCR using p725SK as the template
with primers
D3-65 and LSacII. In each case, the product was cut with
BamHI
and
SacII and ligated with p646 cut with
the same
enzymes.
Construct pML was obtained by the Kunkel method with the mutagenic
primer ML and p646 as the template. Construct pMLS3 was
obtained by
cutting pM44L with
SphI and
NotI, followed by
Klenow
filling and
ligation.
p725D80+5 was made from 725D80-1 by cutting with
HindIII
and religation to the large
HindIII fragment from p646.
Constructs
pCS7 and 682Sc6 were obtained by cutting p4B and p682 with
SacII
and religation. Constructs p4X4-5 and pX4C were made
by PCR using
p774 and p646, respectively, as templates with primers
X448 and
Bam2. Constructs p4X7-7 and pX7D were made by PCR using p774
and
p646, respectively as templates with primers X470 and Bam2. These
PCR fragments were cut by
BamHI and
XhoI and
ligated to 554 cut
with
BamHI and
SalI.
All constructs were checked by sequencing, and at least three isolates
of each construction were transformed into yeast and
assayed for the
ability to induce de novo generation of [URE3].
Western blot analysis.
Transformants of strain 3469 were
grown on SGal plates with uracil for 3 days, then inoculated into
liquid medium composed of 50% YPAD and 50% SGal, and grown for 4 h. Cells were then washed and transferred to liquid SGal medium with
uracil for 12 h. Proteins were extracted as described elsewhere
(29) but without boiling and in the presence of 100 µg of
phenylmethylsulfonyl fluoride per ml. The same amount of protein from
each extract, as determined by the Bio-Rad protein assay, was heated
for 5 min at 96°C and analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (12% gel). Transfer of the
proteins to a polyvinylidene difluoride (Millipore) membrane was done
in 10% methanol-25 mM Tris-192 mM glycine buffer (pH 8.3) for 1 h at 300 mA. The membrane was dried and incubated 2 h in blocking
buffer (TTBS; 0.05% Tween 20, 10 mM Tris borate [pH 7.4] 150 mM
NaCl) with 5% dried milk. After 4 h of incubation with the
primary antibody, the membrane was washed with TTBS and incubated for
1 h with the secondary antibody, a mouse anti-rabbit antibody
conjugated to alkaline phosphatase (Promega Western Blue). Blots were
developed as described previously (39). Primary antibodies
were polyclonal rabbit antisera U2 (47), K1, K2, and K3
(42), made to full-length Ure2p, and C3, made to
Ure2p66-354 (42).
Characterization of [URE3] phenotype: induction, curing, and
propagation assays.
The haploid strain 3385 and the diploid strain
3469 were transformed with YEp351URE2 carrying different deletions in
URE2. Ten transformants selected on Leu-deficient medium
were mixed in water and grown on an SGal plate with uracil for 3 days.
Several dilutions of these cells were made and spread on SD containing 100 µg of USA. USA+ colonies, indicating the development
of the [URE3] state, were counted after 5 days. Each average number
shown in the tables was calculated from at least three repeats of each
experiment. The data in the figures are for the diploid strain 3469. Similar results were obtained with strain 3385, but the induction
frequencies were generally higher.
Samples of USA
+ colonies were assayed for the ability to
propagate [URE3] and to be cured by guanidine HCl. The ability to
again form single colonies on USA medium, indicating propagation
of the
trait, but inability to grow on USA medium after growth
on YPAD
supplemented with 5 mM guanidine HCl, indicating curing
of the trait,
was taken as evidence that the tested strain carried
[URE3].
Complementation assay.
Strain 3718 (ure2
) was
transformed with YEp351G-URE2 carrying different deletions in
URE2. The transformants selected on Leu-deficient medium
were streaked on SGal with uracil and histidine. After 3 days, colonies
were replica plated to SD with USA and histidine. Failure to grow on SD
with USA and histidine indicates complementation of the nitrogen
regulation function of URE2.
 |
RESULTS |
Asparagine-rich subregions are necessary for the minimal prion
domain.
The minimal prion domain was within residues 1 to 64, based on the ability of this fragment to efficiently induce [URE3]
when overexpressed and the inability of a C-terminal fragment lacking residues 1 to 65 to induce [URE3] (31) (Fig.
1). We have made smaller deletions within
this prion domain and tested the ability of the overexpressed remainder
to induce [URE3] in a strain with a normal copy of URE2
(Fig. 1). Each of three deletions of asparagine-rich regions within the
prion domain (773, 774, and 776) resulted in loss of most of the
prion-inducing activity of the remainder of the molecule. Deletion of
the asparagine-rich residues 66 to 80 also reduces prion-inducing
activity, a first indication that this region can be involved in prion
induction (Fig. 1, 778).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
Asparagine runs are important for prion-inducing
activity of Ure2p. A diploid strain (3469) was transformed with each
plasmid and grown on galactose for 3 days to overproduce the indicated
part of Ure2p; cells were plated on SD with ureidosuccinate in place of
uracil, selective for [URE3] cells. , active in prion induction;
, inactive in prion induction. The top line shows low prion
induction activity. The N-terminal part of the Ure2p sequence is shown
below, with the regions deleted in p773, p774, p776, and p778
underlined. comple, complementation.
|
|
Residues 66 to 80 enhance the prion-inducing activity of residues 1 to 64.
Although overexpression of residues 1 to 64 induces
[URE3] formation at rates 100-fold higher than rates for the intact
protein and comparable to those for C-terminal deletions, we find that including through residues 80 or 89 increases prion induction a further
10-fold (Fig. 2). Further extension
results in a consistent severalfold decrease in inducing activity (Fig.
2, 672STO11). These results suggest that residues 66 to 80 can
cooperate with residues 1 to 64 in the prion generation process,
consistent with our finding (Fig. 1) that deletion of residues 66 to 80 reduces prion-inducing activity in the otherwise intact protein. Our
results also suggest that there is a region downstream of residue 89 that modestly hinders the induction process.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Residues 66 to 80 enhance prion induction. , active
in prion induction; , inactive in prion induction. The top line
shows low prion induction activity. comple, complementation.
|
|
Deletion of residues 45 to 54 from the 1-64 prion domain or the
extended prion domains from 1 to 89 or 1 to 153 again lowered
the
prion-inducing activity. However, unlike the effect on the
intact
protein, the deletion of residues 45 to 54 did not eliminate
prion-inducing activity of these smaller fragments (Fig.
2).
A region outside the 1-89 region is necessary for prion induction
by intact Ure2p.
In-frame deletion of residues 151 to 158 or
deletion of seven residues from the C-terminal extremity (348 to 354)
results in a 100-fold increase in [URE3]-inducing activity and
loss of ability to complement ure2
for nitrogen
regulation (31) (Fig. 3, 725;
Fig. 4, S1).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Ure2p residues 221 to 227 are needed for optimal
[URE3] induction by intact Ure2p. , active in prion induction;
, inactive in prion induction. The top line shows low prion
induction activity. comple, complementation.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 4.
A fragment of Ure2p lacking the 1-64 prion domain
induces [URE3]. , active in prion induction; , inactive in
prion induction. The top line shows low prion induction activity.
comple, complementation.
|
|
In contrast, deletion of residues 221 to 227 results in loss of ability
to induce [URE3] and retention of ability to complement
ure2
(Fig.
3, 646SD). This region is not necessary for
prion
induction by the 1-64 prion domain or by the longer 1-89 prion
domain, as both fragments lack the 221-227 region. Combining the
221-227 deletion with the 151-158 deletion shows that the latter
is
epistatic: the doubly deleted molecule has the properties of
the
single 151-158 deletion (Fig.
3,
725SK).
A second prion domain.
Although the N-terminal 64 residues are
sufficient to induce [URE3] at high frequency, deletion of either the
151-158 region or the C-terminal seven residues of Ure2p dramatically
enhance prion induction by the remainder of the molecule (Fig. 4).
Moreover, we have presented evidence above that the 221-227 region is
necessary for prion induction by the whole Ure2p and that residues 66 to 80 enhance the activity of the N-terminal 64 residues. Starting with
a fragment lacking the 1-65 prion domain (Fig. 4, D1-3), deletion of
either the 151-158 region (p4B) or the C-terminal 7 residues (p682Sc6)
did not give a fragment showing substantial [URE3] induction.
However, deletion of both of these small regions resulted in
substantial prion induction, even though it completely lacks the 1-65
segment (Fig. 4, pCS7).
Our two leading candidates for the parts of the molecule important in
this second prion domain of Ure2p were the 221-227 and
66-80 regions,
since each is necessary for prion induction by
the full-length Ure2p
(Fig.
1 and
3). Deletion of the 66-80 segment
from pCS7 dramatically
reduces prion induction (compare pCS7 and
p725D80 in Fig.
4). Likewise,
deleting the 221-227 region eliminates
prion-inducing activity
(compare pCS7 and pSKX in Fig.
4). These
results suggest that both the
221-227 region and the 66-80 segment
have roles in the second prion
domain. Other constructs (not shown)
support our interpretation that
the second prion domain is active
only after deletion of both the
151-157 and 348-354 regions and
disappears after further deletion of
either the 66-80 or 221-227
region.
Asparagine-rich regions are less critical in derepressed Ure2p
fragments.
Deletion of any of four asparagine-rich segments within
the 1-80 region resulted in nearly complete elimination of
prion-inducing activity of the otherwise intact molecule (Fig. 1). We
tested the effect of deleting the same asparagine-rich segments on the very high activity seen with Ure2p fragments lacking the 151-158 region (Fig. 5). Although deletion of
residues 56 to 62 decreased [URE3] induction in one strain, it did
not impair induction in another (not shown). In smaller fragments, a
decrease in prion induction by deletion of residues 44 to 50 is also
seen (Fig. 2). Overall, the results indicate that the individual
asparagine-rich regions are less critical for prion induction by the
fragments derepressed for prion induction than they are in the
intact molecule. Nonetheless, elimination of all of these regions by
the 3-80 deletion does eliminate all known prion-inducing activity
(Fig. 4, 725Hd+5).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Asparagine runs are important but not essential for
prion induction by derepressed Ure2p fragments. Note that C3, B2, and
A2 all have identical C-terminal tails. The C-terminal tail of 679 differs from those of P215 and P408. , active in prion induction;
, inactive in prion induction. The top line shows low prion
induction activity. comple, complementation.
|
|
C-terminal tails affect prion-inducing activity.
The effect of
the presence of a C-terminal tail consisting of vector sequences or
out-of-frame URE2 sequences was tested in comparison with
constructs with a termination codon at the indicated site (Fig.
6). In each case, the presence of the
tail increased prion-inducing activity 4- to 10-fold compared to the
tail-less construct.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
C-terminal tails can affect prion induction efficiency.
, active in prion induction; , inactive in prion induction. The
top line shows low prion induction activity. comple, complementation.
|
|
Steady-state levels of Ure2p fragments.
The data presented
above concerning the roles of various segments in the induction of
[URE3] do not distinguish effects on protein function from effects on
protein stability. It is particularly important to determine whether
the deletion mutants that lack prion-inducing activity are present at
levels comparable to those of the normal protein. However, since
fragments of Ure2p are the best inducers of [URE3] appearance,
protein instability does not necessarily explain failure to induce
[URE3].
We examined the steady-state levels of a number of the constructs used
here by Western blot analysis of extracts of cells
grown on galactose.
The antibody used in our earlier studies (
31)
reacts mostly
with the N-terminal region (
16). We also used
other
polyclonal antibodies made to the full-length protein or
the C-terminal
nitrogen regulation domain (
42). Although the
1-80 fragment
gave the highest induction of [URE3] observed, it
was not detected by
our antibody specific for the N-terminal domain
(data not shown).
Constructs derived from the intact Ure2p by
deletion of the 44-50
region, residues 56 to 62, or residues 66
to 80 each gave poor
induction of [URE3] but showed levels of
protein comparable to those
of the intact protein (Fig.
7, constructs
774, 776, and 778). Likewise,
deletion of the 221-227 region resulted
in absence of prion induction
by the remainder of Ure2p, but this
fragment was present at levels
similar to or greater than those
of the intact protein (Fig.
7A, construct SD).

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 7.
Steady-state levels of mutant Ure2 proteins measured by
Western blotting. Construct names are as in Table 1 and Fig. 1 to 6.
554 is the vector alone, and 646 expresses full-length Ure2p.
Anti-Ure2p antibodies used were U2 and affinity-purified K1, K2, K3,
and C3 (A), affinity-purified U2 (B), U2, K2, and C3 (C and D), U2 (E),
and affinity-purified U2, K1, K2, K3, and C3 (F). SD is 646SD.
Positions of selected size markers are shown in kilodaltons. Equal
amounts of total protein were analyzed.
|
|
Deletion of residues 3 to 65 or 3 to 89 did appear to decrease the
steady-state levels of Ure2p, but this appearance may be
partly due to
some specificity of the polyclonal antibodies for
the N-terminal
region. Among constructs lacking residues 1 to
65, CS7, which was
active in [URE3] induction, had the same apparently
low steady-state
level as D1-3, D89.4, and 7C, all of which were
inactive (Fig.
7D). Constructs 4C and D80-1 showed particularly
low levels, suggesting
that they were
unstable.
Deletion of the 151-158 region did not result in higher levels of
protein, although the prion-inducing activity was dramatically
increased (Fig.
7B). Further deletion of the asparagine-rich 18-27,
44-50, or 66-80 segment did not substantially alter steady-state
levels (Fig.
7B and
C).
In conclusion, the prion-inducing activity is not consistently
correlated with the steady-state levels of the various fragments
of
Ure2p. This suggests that for most constructs, it is the tendency
of
these fragments to undergo the prion change and their ability
to
transmit that change to normal molecules, rather than their
relative
stability, that are being measured in these experiments.
On the
contrary, it remains possible that it is specific breakdown
products of
the full-length Ure2p, rather than the intact molecule,
that actually
induce [URE3].
Residue 44 is not critical for [URE3] induction.
Deletion of
one base in codon 44 to change the reading frame of URE2
eliminates prion induction without reducing the amount of mRNA
(30). We show here that there is no unique function of the
base deleted in this experiment, since deletion of the entire codon
(encoding Asn), which maintains the reading frame, does not lower the
prion-inducing activity of the remainder of Ure2p. The vector gave 22 [URE3] colonies per 106 cells, while full-length Ure2p
produced 303 colonies and two mutants lacking only codon 44 produced
350 and 398 colonies. Similarly, the 1-64 segment lacking codon 44 gave 1,360 colonies, while the 1-64 segment with codon 44 intact gave
1,304 colonies in the same experiment.
 |
DISCUSSION |
The N-terminal 64 amino acid residues of Ure2p are necessary for
prion-inducing activity by the whole protein and are sufficient to
carry out this function at higher efficiency than the intact Ure2p
(31) (Fig. 1). Furthermore, the C-terminal part of Ure2p, lacking residues 3 to 65, is not inactivated on introduction of [URE3] (30). This work has given a picture of two protein
domains interacting with each other, but each able to carry out its
function in the absence of the other. The N-terminal domain can
propagate [URE3] in the absence of the C-terminal part and the
C-terminal part can regulate nitrogen metabolism in the absence of the
N-terminal part (30, 31). However, the C-terminal part
appears less efficient in performing the nitrogen regulatory function,
and the N terminus is more efficient at inducing [URE3] in the
absence of the other part, indicating that each domain stabilizes the other.
The second prion domain.
We find that there are parts of the
protein lacking residues 3 to 65 which are capable of prion induction.
The first clue was that deletion of the 66-80 or the 221-227 region
reduced the prion-inducing activity of the intact protein dramatically.
In addition, the prion-inducing activity of residues 1 to 80 was actually 10-fold higher than that of the 1-64 fragment. This suggested that either of these regions could have a positive role in initiation or propagation of the prion state.
Deletion of the 151-158 region or the C-terminal seven residues
dramatically increases the prion-inducing ability of Ure2p
(
31). We find that together, these two deletions make
prion-inducing
activity reappear in a construct lacking residues 3 to
65. Removing
residues 66 to 80 from the doubly deleted construct
eliminates
prion-inducing activity. This finding suggests that the
asparagine-glutamine-rich
66-80 region has a role in this second
prion-inducing activity.
Deletion of the 221-227 region has a similar
effect. Note that
the 221-227 region has no asparagine or glutamine
residues.
We show here that the lack of prion-inducing activity by some
constructs is not in general due to degradation of the protein.
While
this distinction is critical if one is considering, for
example, an
enzymatic or other function that requires an essentially
intact
protein, it is not so clear for prion induction. Because
small
fragments of Ure2p can induce [URE3] 100 times more efficiently
than
the intact protein, instability may be an advantage rather
than a
disadvantage.
What does it mean that two nonoverlapping regions of Ure2p can each
induce [URE3] at high efficiency? No natural enzyme can
be cut in two
and have each half carry out the very same reaction.
We can guess that
the [URE3] induction by these two different
parts of Ure2p must be in
some way different reactions. Different
strains of scrapie are well
documented with different forms of
PrP (
3), and genetically
distinct forms of [PSI] have also
been observed (
12).
Perhaps the two different parts of Ure2p
induce different forms of
[URE3]. If [URE3] consists of a self-propagating
amyloid formed of
Ure2p (
15,
43), it is not difficult to imagine
how different
parts of Ure2p could initiate aggregation, perhaps
by formation of
aggregates with different symmetry properties
or different
conformations of Ure2p, or with the aggregation due
to interactions of
different parts of the Ure2p
molecule.
One essential part of the second prion domain is residues 66 to 80, adjacent to the originally defined first prion domain.
One could view
residues 1 to 80 as a single prion domain, arbitrarily
divided in the
earlier studies by an
EagI site. The interesting
point,
however, is that Ure2p could be so divided and still leave
activity in
each of the nonoverlapping parts. Moreover, the 66-80
segment is not
sufficient for
activity.
Asparagine-rich regions and prion induction.
The 1-64 region
first found to induce the [URE3] prion change is rich in asparagine
residues, including several runs of asparagine (31). The
prion-inducing domain of Sup35p is likewise rich in glutamine and
asparagine residues (44), and these residues are indeed
important for [PSI] (11). Our studies show that three asparagine-rich regions in the N-terminal part of Ure2p are important in prion induction. Further, the asparagine-rich residues 66 to 80 are
essential for the second prion-inducing fragment. Moreover, the
asparagine-rich regions each contribute to the frequency of prion induction.
Ure2p has modest similarity to glutathione
S-transferases
from about residue 110 to near the C terminus (
9). A
Schizosaccharomyces pombe protein with 53% identity
throughout its length to Ure2p
lacks the N-terminal 110 residues of the
S. cerevisiae protein
(
50). Thus, the
S. pombe protein appears to have the nitrogen
regulation domain but
to lack the prion domains of Ure2p (Fig.
8).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Prion-promoting and -inhibiting domains of Ure2p
compared to the glutathione S-transferase homology region
and the nitrogen regulation domain.
|
|
Deletion of residues 3 to 80 of Ure2p leaves a fragment that is
apparently unable to induce [URE3] formation even with the
151-158
and C-terminal deletions. However, it is clear that the
prion induction
process is more complicated than simply the presence
of runs of
asparagine. Deletion of the 221-227 region does not
change the
asparagine content of Ure2p and yet it eliminates the
prion-inducing
activity of the remainder of the molecule. Other
deletions in the
C-terminal domain also do not change the asparagine
content of Ure2p
but dramatically increase the prion-inducing
activity of Ure2p and make
it less dependent on single runs of
asparagine residues. Perutz and
colleagues have suggested that
expanded runs of glutamine in certain
inherited neurodegenerative
diseases can produce aggregation of
proteins mediated by

-sheet
formation (
37,
41). It is
possible that this is a component
of the mechanism of [URE3]
propagation, but understanding of prion
induction will require a
detailed analysis of the structure of
normal and prion forms and
studies of their interaction with each
other.
How do deletions in the C-terminal domain enhance prion
induction?
Deletion of residues 151 to 158 or of seven residues
at the extreme C terminus enhances induction of [URE3] about
100-fold (Fig. 4). Each of these deletions results in
inactivation of the nitrogen regulation function of Ure2p, but it is
unlikely that this inactivation is the cause of the enhanced prion
induction. The relationships of nitrogen regulation with prion
induction and propagation have been explored previously and found to be unconnected (30). The C-terminal mutations might enhance
[URE3] induction by disrupting interaction of Ure2p with another
protein factor, such as Gln3p, its main target of regulation. This
question has not yet been adequately explored.
We suggest that the C-terminal domain both carries out the nitrogen
regulation function and stabilizes the N-terminal prion
domains in
their normal form, perhaps by interacting with these
domains. Indeed,
there is recent two-hybrid evidence for interaction
of N-terminal and
C-terminal domains (
18). Presumably, these
mutations disrupt
both functions of the C-terminal
domain.
Parallels with scrapie, [PSI], and [Het-s].
None of the
other prion proteins has been examined in sufficient detail to
determine whether nonoverlapping domains can induce the prion form.
Mutations distributed throughout the length of the Prnp gene
encoding PrP result in dominant inherited human spongiform
encephalopathy (38). Many deletions in Ure2p dramatically increase the frequency with which [URE3] arises but are outside either of the prion domains. We suggest that these mutations eliminate stabilizing interactions with the prion domains. Likewise, many Creutzfeldt-Jakob disease mutations may produce a PrP molecule in which
internal interactions are replaced by intermolecular (aggregative)
interactions, favoring prion development.
Sup35p has been divided into an N-terminal prion domain, a middle
region whose function is not apparent, and a C-terminal
domain
essential for translation termination and for growth (
12,
14,
44,
45). The essential character of the C-terminal domain
complicates
the type of studies reported here, but it has been
shown that, as for
Ure2p, mutations in the C-terminal domain of
Sup35p result in a
dramatic increase in the frequency with which
the N-terminal domain
induces the prion change (
27). The
Podospora het-s protein has not yet been examined in
detail.
Comparison with mammalian amyloidoses.
Recent evidence
suggests that [URE3] is due to amyloid formation by Ure2p. Ure2p is
aggregated in cells carrying [URE3] but is evenly distributed in
cells not carrying the prion (15). Native Ure2p, purified
from normal yeast, is a stable, soluble dimer (42). Residues
1 to 65 of Ure2p spontaneously form amyloid in vitro and initiate
amyloid formation by the native Ure2p (43). This parallels
the 100-fold-higher efficiency of in vivo prion induction by
overproduced Ure2p1-65 than by the same amount of the
intact protein. The fact that fragments of Ure2p are far more efficient
than the intact protein at inducing de novo [URE3] suggests that
proteolytic fragments of Ure2p may be involved in its spontaneous
generation even when only the full-length gene is present. Alzheimer's
disease plaques contain the A
peptide, a 40- or 42-residue fragment
derived by proteolysis from a large precursor protein (19,
26). It is possible that only proteolytic fragments can become
part of these plaques. In vitro amyloid formation by the monoclonal
light chains produced by some multiple myelomas occurs only after
partial proteolysis (20). However, it has been pointed out
that these amyloids have been in the tissues for months or years, and
so proteolytic digestion may occur after amyloid formation rather than
before. There are little data for mammals comparable to those provided
by our yeast prion (amyloid) induction experiments. Our finding that
fragments have far higher prion (amyloid)-inducing activity than the
intact protein provides evidence that fragments may play a dominant
role in the initiation of amyloid formation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Bldg. 8, Room
225, NIH, 8 Center Dr. MSC 0830, Bethesda, MD 20892-0830. Phone: (301) 496-3452. Fax: (301) 402-0240. E-mail:
wickner{at}helix.nih.gov.
 |
REFERENCES |
| 1.
|
Alper, T.,
W. A. Cramp,
D. A. Haig, and M. C. Clarke.
1967.
Does the agent of scrapie replicate without nucleic acid?
Nature
214:764-766[Medline].
|
| 2.
|
Bolton, D. C.,
M. P. McKinley, and S. B. Prusiner.
1982.
Identification of a protein that purifies with the scrapie prion.
Science
218:1309-1311[Abstract/Free Full Text].
|
| 3.
|
Bruce, M. E.,
I. McConnell,
H. Fraser, and A. G. Dickinson.
1991.
The disease characteristics of different strains of scrapie in Sinc congenic mouse lines: implications for the nature of the agent and host control of pathogenesis.
J. Gen. Virol.
72:595-603[Abstract/Free Full Text].
|
| 4.
|
Bueler, H.,
A. Aguzzi,
A. Sailer,
R.-A. Greiner,
P. Autenried,
M. Aguet, and C. Weissmann.
1993.
Mice devoid of PrP are resistant to scrapie.
Cell
73:1339-1347[Medline].
|
| 5.
|
Carlson, G. A.,
D. T. Kingsbury,
P. A. Goodman,
S. Coleman,
S. T. Marshall,
S. DeArmond,
D. Westaway, and S. B. Prusiner.
1986.
Linkagae of prion protein and scrapie incubation time genes.
Cell
46:503-511[Medline].
|
| 6.
|
Chernoff, Y. O.,
S. L. Lindquist,
B.-I. Ono,
S. G. Inge-Vechtomov, and S. W. Liebman.
1995.
Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+].
Science
268:880-884[Abstract/Free Full Text].
|
| 7.
|
Chesebro, B.
1998.
BSE and prions: uncertainties about the agent.
Science
279:42-43[Free Full Text].
|
| 8.
|
Chesebro, B.,
R. Race,
K. Wehrly,
J. Nishio,
M. Bloom,
D. Lechner,
S. Bergstrom,
K. Robbins,
L. Mayer,
J. M. Keith,
C. Garon, and A. Hasse.
1985.
Identification of scrapie prion protein-specific mRNA in scrapie-infected brain.
Nature
315:331-333[Medline].
|
| 9.
|
Coschigano, P. W., and B. Magasanik.
1991.
The URE2 gene product of Saccharomyces cerevisiae plays an important role in the cellular response to the nitrogen source and has homology to glutathione S-transferases.
Mol. Cell. Biol.
11:822-832[Abstract/Free Full Text].
|
| 10.
|
Coustou, V.,
C. Deleu,
S. Saupe, and J. Begueret.
1997.
The protein product of the het-s heterokaryon incompatibility gene of the fungus Podospora anserina behaves as a prion analog.
Proc. Natl. Acad. Sci. USA
94:9773-9778[Abstract/Free Full Text].
|
| 11.
|
DePace, A. H.,
A. Santoso,
P. Hillner, and J. S. Weissman.
1998.
A critical role for amino-terminal glutamine/asparagine repeats in the formation and propagation of a yeast prion.
Cell
93:1241-1252[Medline].
|
| 12.
|
Derkatch, I. L.,
Y. O. Chernoff,
V. V. Kushnirov,
S. G. Inge-Vechtomov, and S. W. Liebman.
1996.
Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae.
Genetics
144:1375-1386[Abstract].
|
| 13.
|
Dickinson, A. G.,
V. M. H. Meikle, and H. Fraser.
1968.
Identification of a gene which controls the incubation period of some strains of scrapie in mice.
J. Comp. Pathol.
78:293-299[Medline].
|
| 14.
|
Doel, S. M.,
S. J. McCready,
C. R. Nierras, and B. S. Cox.
1994.
The dominant PNM2-mutation which eliminates the [PSI] factor of Saccharomyces cerevisiae is the result of a missense mutation in the SUP35 gene.
Genetics
137:659-670[Abstract].
|
| 15.
|
Edskes, H. K.,
V. T. Gray, and R. B. Wickner.
1999.
The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments.
Proc. Natl. Acad. Sci. USA
96:1498-1503[Abstract/Free Full Text].
|
| 16.
| Edskes, H. K., and K. L. Taylor.
Unpublished data.
|
| 17.
|
Farquhar, C. F.,
R. A. Somerville, and M. E. Bruce.
1998.
Straining the prion hypothesis.
Nature
391:345-346[Medline].
|
| 18.
|
Fernandez-Bellot, E.,
E. Guillemet,
A. Baudin-Baillieu,
S. Gaumer,
A. A. Komar, and C. Cullin.
1999.
Characterization of the interaction domains of Ure2p, a prion-like protein of yeast.
Biochem. J.
338:403-407.
|
| 19.
|
Glenner, G. G.
1980.
Amyloid deposits and amyloidosis: the beta-fibrillosa.
N. Engl. J. Med.
302:1333-1343[Medline].
|
| 20.
|
Glenner, G. G.,
D. Ein,
E. D. Eanes,
H. A. Bladen,
W. Terry, and D. L. Page.
1971.
Creation of "amyloid" fibrils from Bence Jones proteins in vitro.
Science
174:712-714[Abstract/Free Full Text].
|
| 21.
|
Glover, J. R.,
A. S. Kowal,
E. C. Shirmer,
M. M. Patino,
J.-J. Liu, and S. Lindquist.
1997.
Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae.
Cell
89:811-819[Medline].
|
| 22.
|
Griffith, J. S.
1967.
Self-replication and scrapie.
Nature
215:1043-1044[Medline].
|
| 23.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 24.
|
Kikuchi, Y.,
H. Shimatake, and A. Kikuchi.
1988.
A yeast gene required for the G1 to S transition encodes a protein containing an A kinase target site and GTPase domain.
EMBO J.
7:1175-1182[Medline].
|
| 25.
|
King, C.-Y.,
P. Tittmann,
H. Gross,
R. Gebert,
M. Aebi, and K. Wuthrich.
1997.
Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments.
Proc. Natl. Acad. Sci. USA
94:6618-6622[Abstract/Free Full Text].
|
| 26.
|
Kisilevsky, R., and P. E. Fraser.
1997.
A amyloidogenesis: unique, or variation on a systemic theme?
Crit. Rev. Biochem. Mol. Biol.
32:361-404[Medline].
|
| 27.
|
Kochneva-Pervukhova, N. V.,
A. I. Poznyakovski,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1998.
C-terminal truncation of the Sup35 protein increases the frequency of de novo generation of a prion-based [PSI+] determinant in Saccharomyces cerevisiae.
Curr. Genet.
34:146-151[Medline].
|
| 28.
|
Kushnirov, V. V.,
M. D. TerAvanesyan,
M. V. Telckov,
A. P. Surguchov,
V. N. Smirnov, and S. G. Inge-Vechtomov.
1988.
Nucleotide sequence of the SUP2(SUP35) gene of Saccharomyces cerevisiae.
Gene
66:45-54[Medline].
|
| 29.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 30.
|
Masison, D. C.,
M.-L. Maddelein, and R. B. Wickner.
1997.
The prion model for [URE3] of yeast: spontaneous generation and requirements for propagation.
Proc. Natl. Acad. Sci. USA
94:12503-12508[Abstract/Free Full Text].
|
| 31.
|
Masison, D. C., and R. B. Wickner.
1995.
Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells.
Science
270:93-95[Abstract/Free Full Text].
|
| 32.
|
Novick, A., and M. Weiner.
1957.
Enzyme induction as an all-or-none phenomenon.
Proc. Natl. Acad. Sci. USA
43:553-566[Free Full Text].
|
| 33.
|
Oesch, B.,
D. Westaway,
M. Walchli,
M. P. McKinley,
S. B. Kent,
R. Aebersold,
R. A. Barry,
P. Tempst,
D. B. Templow,
L. E. Hood,
S. B. Prusiner, and C. Weissmann.
1985.
A cellular gene encodes scrapie PrP 27-30 protein.
Cell
40:735-746[Medline].
|
| 34.
|
Patino, M. M.,
J.-J. Liu,
J. R. Glover, and S. Lindquist.
1996.
Support for the prion hypothesis for inheritance of a phenotypic trait in yeast.
Science
273:622-626[Abstract].
|
| 35.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1997.
In vitro propagation of the prion-like state of yeast Sup35 protein.
Science
277:381-383[Abstract/Free Full Text].
|
| 36.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1996.
Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor.
EMBO J.
15:3127-3134[Medline].
|
| 37.
|
Perutz, M. F.,
T. Johnson,
M. Suzuki, and J. T. Finch.
1994.
Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases.
Proc. Natl. Acad. Sci. USA
91:5355-5358[Abstract/Free Full Text].
|
| 38.
|
Prusiner, S. B.
1996.
Prions, p. 2901-2950.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Raven Publishers, Philadelphia, Pa.
|
| 39.
|
Ribas, J. C.,
T. Fujimura, and R. B. Wickner.
1994.
Essential RNA binding and packaging domains of the Gag-Pol fusion protein of the L-A double-stranded RNA virus of Saccharomyces cerevisiae.
J. Biol. Chem.
269:28420-28428[Abstract/Free Full Text].
|
| 40.
|
Sherman, F.
1991.
Getting started with yeast, p. 3-21.
In
C. Guthrie, and G. R. Fink (ed.), Guide to yeast genetics and molecular biology, vol. 194. Academic Press, San Diego, Calif.
|
| 41.
|
Stott, K.,
J. M. Blackburn,
P. J. G. Butler, and M. Perutz.
1995.
Incorporation of glutamine repeats makes protein oligomerize: implications for neurodegenerative diseases.
Proc. Natl. Acad. Sci. USA
92:6509-6513[Abstract/Free Full Text].
|
| 42.
| Taylor, K., and R. B. Wickner. Unpublished
data.
|
| 43.
|
Taylor, K. L.,
N. Cheng,
R. W. Williams,
A. C. Stevens, and R. B. Wickner.
1999.
Prion domain initiation of amyloid formation in vitro from native Ure2p.
Science
283:1339-1343[Abstract/Free Full Text].
|
| 44.
|
TerAvanesyan, A.,
A. R. Dagkesamanskaya,
V. V. Kushnirov, and V. N. Smirnov.
1994.
The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae.
Genetics
137:671-676[Abstract].
|
| 45.
|
TerAvanesyan, M. D.,
V. V. Kushnirov,
A. R. Dagkesamanskaya,
S. A. Didichenko,
Y. O. Chernoff,
S. G. Inge-Vechtomov, and V. N. Smirnov.
1993.
Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein.
Mol. Microbiol.
7:683-692[Medline].
|
| 46.
|
Turcq, B.,
C. Deleu,
M. Denayrolles, and J. Begueret.
1991.
Two allelic genes responsible for vegetative incompatibility in the fungus Podospora anserina are not essential for cell viability.
Mol. Gen. Genet.
288:265-269.
|
| 47.
|
Wickner, R. B.
1994.
Evidence for a prion analog in S. cerevisiae: the [URE3] non-Mendelian genetic element as an altered URE2 protein.
Science
264:566-569[Abstract/Free Full Text].
|
| 48.
|
Wickner, R. B.
1997.
A new prion controls fungal cell fusion incompatibility.
Proc. Natl. Acad. Sci. USA
94:10012-10014[Free Full Text].
|
| 49.
|
Wilson, P. G., and M. R. Culbertson.
1988.
SUF12 suppressor protein of yeast: a fusion protein related to the EF-1 family of elongation factors.
J. Mol. Biol.
199:559-573[Medline].
|
| 50.
| Wood, V., M. A. Rajandream, B. G. Barrell, and
M. Rieger. 1998. Direct submission to Genbank, accession no.
3136036; EMBL accession no. AL023590.
|
Molecular and Cellular Biology, June 1999, p. 4516-4524, Vol. 19, No. 6
0270-7306/99/$04.00+0
This article has been cited by other articles:
-
Ross, C. D., McCarty, B. R., Hamilton, M., Ben-Hur, A., Ross, E. D.
(2009). A Promiscuous Prion: Efficient Induction of [URE3] Prion Formation by Heterologous Prion Domains. Genetics
183: 929-940
[Abstract]
[Full Text]
-
Gancedo, C., Flores, C.-L.
(2008). Moonlighting Proteins in Yeasts. Microbiol. Mol. Biol. Rev.
72: 197-210
[Abstract]
[Full Text]
-
Fay, N., Redeker, V., Savistchenko, J., Dubois, S., Bousset, L., Melki, R.
(2005). Structure of the Prion Ure2p in Protein Fibrils Assembled in Vitro. J. Biol. Chem.
280: 37149-37158
[Abstract]
[Full Text]
-
Ross, E. D., Edskes, H. K., Terry, M. J., Wickner, R. B.
(2005). Primary sequence independence for prion formation. Proc. Natl. Acad. Sci. USA
102: 12825-12830
[Abstract]
[Full Text]
-
Talarek, N., Maillet, L., Cullin, C., Aigle, M.
(2005). The [URE3] Prion Is Not Conserved Among Saccharomyces Species. Genetics
171: 23-34
[Abstract]
[Full Text]
-
Ross, E. D., Baxa, U., Wickner, R. B.
(2004). Scrambled Prion Domains Form Prions and Amyloid. Mol. Cell. Biol.
24: 7206-7213
[Abstract]
[Full Text]
-
Wickner, R. B., Edskes, H. K., Roberts, B. T., Baxa, U., Pierce, M. M., Ross, E. D., Brachmann, A.
(2004). Prions: proteins as genes and infectious entities. Genes Dev.
18: 470-485
[Full Text]
-
WICKNER, R.B., EDSKES, H.K., ROSS, E.D., PIERCE, M.M., SHEWMAKER, F., BAXA, U., BRACHMANN, A.
(2004). Prions of Yeast Are Genes Made of Protein: Amyloids and Enzymes. Cold Spring Harb Symp Quant Biol
69: 489-496
[Abstract]
-
Baxa, U., Taylor, K. L., Wall, J. S., Simon, M. N., Cheng, N., Wickner, R. B., Steven, A. C.
(2003). Architecture of Ure2p Prion Filaments: THE N-TERMINAL DOMAINS FORM A CENTRAL CORE FIBER. J. Biol. Chem.
278: 43717-43727
[Abstract]
[Full Text]
-
Baudin-Baillieu, A., Fernandez-Bellot, E., Reine, F., Coissac, E., Cullin, C.
(2003). Conservation of the Prion Properties of Ure2p through Evolution. Mol. Biol. Cell
14: 3449-3458
[Abstract]
[Full Text]
-
Rai, R., Tate, J. J., Cooper, T. G.
(2003). Ure2, a Prion Precursor with Homology to Glutathione S-Transferase, Protects Saccharomyces cerevisiae Cells from Heavy Metal Ion and Oxidant Toxicity. J. Biol. Chem.
278: 12826-12833
[Abstract]
[Full Text]
-
Baxa, U., Speransky, V., Steven, A. C., Wickner, R. B.
(2002). Inaugural Article: Mechanism of inactivation on prion conversion of the Saccharomyces cerevisiae Ure2 protein. Proc. Natl. Acad. Sci. USA
99: 5253-5260
[Abstract]
[Full Text]
-
Pierce, M. M., Maddelein, M.-L., Roberts, B. T., Wickner, R. B.
(2001). A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA
10.1073/pnas.181486098v1
[Abstract]
[Full Text]
-
Schlumpberger, M., Prusiner, S. B., Herskowitz, I.
(2001). Induction of Distinct [URE3] Yeast Prion Strains. Mol. Cell. Biol.
21: 7035-7046
[Abstract]
[Full Text]
-
Speransky, V. V., Taylor, K. L., Edskes, H. K., Wickner, R. B., Steven, A. C.
(2001). Prion Filament Networks in [Ure3] Cells of Saccharomyces cerevisiae. JCB
153: 1327-1336
[Abstract]
[Full Text]
-
Umland, T. C., Taylor, K. L., Rhee, S., Wickner, R. B., Davies, D. R.
(2001). The crystal structure of the nitrogen regulation fragment of the yeast prion protein Ure2p. Proc. Natl. Acad. Sci. USA
10.1073/pnas.041607898v1
[Abstract]
[Full Text]
-
Michelitsch, M. D., Weissman, J. S.
(2000). A census of glutamine/asparagine-rich regions: Implications for their conserved function and the prediction of novel prions. Proc. Natl. Acad. Sci. USA
97: 11910-11915
[Abstract]
[Full Text]
-
Wickner, R. B., Taylor, K. L., Edskes, H. K., Maddelein, M.-L., Moriyama, H., Roberts, B. T.
(1999). Prions in Saccharomyces and Podospora spp.: Protein-Based Inheritance. Microbiol. Mol. Biol. Rev.
63: 844-861
[Abstract]
[Full Text]
-
Coustou, V., Deleu, C., Saupe, S. J., Bégueret, J.
(1999). Mutational Analysis of the [Het-s] Prion Analog of Podospora anserina: A Short N-Terminal Peptide Allows Prion Propagation. Genetics
153: 1629-1640
[Abstract]
[Full Text]
-
Goodman, L.
(1999). Celebrating Similarities---Embracing Differences. Genome Res
9: 797-800
[Full Text]
-
Cox, K. H., Rai, R., Distler, M., Daugherty, J. R., Coffman, J. A., Cooper, T. G.
(2000). Saccharomyces cerevisiae GATA Sequences Function as TATA Elements during Nitrogen Catabolite Repression and When Gln3p Is Excluded from the Nucleus by Overproduction of Ure2p. J. Biol. Chem.
275: 17611-17618
[Abstract]
[Full Text]
-
Kulkarni, A. A., Abul-Hamd, A. T., Rai, R., El Berry, H., Cooper, T. G.
(2001). Gln3p Nuclear Localization and Interaction with Ure2p in Saccharomyces cerevisiae. J. Biol. Chem.
276: 32136-32144
[Abstract]
[Full Text]
-
Umland, T. C., Taylor, K. L., Rhee, S., Wickner, R. B., Davies, D. R.
(2001). The crystal structure of the nitrogen regulation fragment of the yeast prion protein Ure2p. Proc. Natl. Acad. Sci. USA
98: 1459-1464
[Abstract]
[Full Text]
-
Edskes, H. K., Wickner, R. B.
(2000). A protein required for prion generation: [URE3] induction requires the Ras-regulated Mks1 protein. Proc. Natl. Acad. Sci. USA
97: 6625-6629
[Abstract]
[Full Text]
-
Pierce, M. M., Maddelein, M.-L., Roberts, B. T., Wickner, R. B.
(2001). A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA
98: 13213-13218
[Abstract]
[Full Text]