Previous Article | Next Article 
Molecular and Cellular Biology, July 1999, p. 4788-4797, Vol. 19, No. 7
0270-7306/99/$04.00+0
Upstream Stimulatory Factor Regulates Major Histocompatibility
Complex Class I Gene Expression: the U2
E4 Splice Variant Abrogates
E-Box Activity
T. Kevin
Howcroft,1,*
Charles
Murphy,1
Jocelyn D.
Weissman,1
Sam J.
Huber,1
Michèle
Sawadogo,2 and
Dinah
S.
Singer1
Experimental Immunology Branch, National Cancer Institute,
National Institutes of Health, Bethesda, Maryland
20892-1360,1 and Department of Molecular
Genetics, University of Texas M. D. Anderson Cancer Center, Houston,
Texas 770302
Received 11 February 1999/Returned for modification 24 March
1999/Accepted 19 April 1999
 |
ABSTRACT |
The tissue-specific expression of major histocompatibility complex
class I genes is determined by a series of upstream regulatory elements, many of which remain ill defined. We now report that a distal
E-box element, located between bp 
309 and 314 upstream of
transcription initiation, acts as a cell type-specific enhancer of
class I promoter activity. The class I E box is very active in a
neuroblastoma cell line, CHP-126, but is relatively inactive in the
HeLa epithelial cell line. The basic helix-loop-helix leucine zipper
proteins upstream stimulatory factor 1 (USF1) and USF2 were shown to
specifically recognize the class I E box, resulting in the activation
of the downstream promoter. Fine mapping of USF1 and USF2
amino-terminal functional domains revealed differences in their
abilities to activate the class I E box. Whereas USF1 contained only an
extended activation domain, USF2 contained both an activation domain
and a negative regulatory region. Surprisingly, the naturally occurring
splice variant of USF2 lacking the exon 4 domain, U2
E4, acted as a
dominant-negative regulator of USF-mediated activation of the class I
promoter. This latter activity is in sharp contrast to the known
ability of U2E4 to activate the adenovirus major late promoter.
Class I E-box function is correlated with the relative amount of
U2E4 in a cell, leading to the proposal that U2E4 modulates class
I E-box activity and may represent one mechanism to fine-tune class I
expression in various tissues.
| |
INTRODUCTION |
Class I molecules of the major
histocompatibility complex (MHC) serve as receptors for endogenously
generated peptides and as targets for cytotoxic T lymphocytes.
Consistent with their role as sentinels for the immune response against
malignant and virally infected cells, MHC class I genes are
constitutively expressed on nearly all nucleated somatic cells.
However, the level of class I gene expression varies considerably among
different tissues (22, 37). The number of class I molecules
expressed at the cell surface, in most instances, parallels the amount
of class I RNA in any given tissue, indicating that class I gene
expression is primarily regulated at the level of transcription
(40). The precise mechanism(s) by which class I genes
maintain tissue-appropriate levels of expression is not fully understood.
In general, gene transcription is determined by the action of multiple,
distal regulatory elements which modulate a basal level of
transcription directed by a core promoter region (12). Several studies in which class I transgenic mice were generated by
using truncated class I promoter regions reported aberrant class I
transgene expression that could be corrected by including additional
upstream class I promoter sequences in the targeting vectors (9,
26, 36). Our studies and those of others indicate that the
tissue-specific expression of MHC class I genes is, in part, determined
by regulatory elements which reside upstream of the known proximal
promoter sequences (Fig. 1). Despite
these observations, the regulatory elements which reside upstream of the 5' boundary of the proximal class I promoter (defined as the enhancer A element located approximately 200 bp upstream of the transcriptional start site in most class I genes) and their
contribution to class I expression remain relatively unexplored.
View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
The MHC class I reporter construct -400CAT is shown with
selected regulatory motifs indicated. The E box is located between bp
309 and 314 upstream of the point of transcription initiation. The
proximal promoter extends from bp 203 to 68 and contains an
enhancer, enhancer A, and an overlapping interferon response element
(IRE). The basal promoter extends from bp 68 to +1 and includes the
CCAAT box, promoter elements, and the site of transcription initiation.
The derivation of the 107-bp and 3E oligonucleotide probes used in gel
shift analysis is also shown; there is a detailed description in
Materials and Methods. The core hexamer sequence of the 3E probe is
shown.
|
|
Sequence comparison between the upstream regulatory region of a class I
gene and known DNA binding motifs revealed the presence of a consensus
E-box element upstream of the proximal promoter at bp 309 to 314.
The E box is a highly conserved DNA element (CANNTG) recognized by the
basic helix-loop-helix (bHLH) family of transcription factors. These
proteins are characterized by bDNA binding and HLH protein-protein
interaction domains (16). The various bHLH family members
are segregated into three groups: (i) broadly expressed class A
proteins (E12, E47, E2-2, and Daughterless), (ii) tissue-restricted
class B proteins (MyoD, myogenin, muscle-specific regulatory factor 4, and Achaete-Scute protein), and (iii) the class C proteins (upstream
stimulatory factor [USF], Mad, Max, Myc, activator protein 4, transcription factor E3 [TFE3], TFEB, TFII I, and sterol regulatory
element-binding protein [SREBP]) which contain an additional leucine
zipper (Z) protein-protein interaction motif (21). Precise
DNA binding site selection by individual bHLH family members is
determined both by the central dinucleotide contained in the core
hexamer sequence and the flanking nucleotides (2, 6-8, 10, 13,
18, 28, 31, 32).
The bHLH-Z transcription factor, USF, was originally identified as a
positive trans-acting factor which stimulated adenovirus major late promoter (AdMLP) activity by binding to its upstream activating element, a 12-bp element containing an E-box core (29, 34). Subsequently, two USF proteins were purified from HeLa cells, distinguished by their molecular sizes of 43 and 44 kDa and
referred to as USF1 and USF2, respectively (35, 38, 39). USF
proteins form homo- as well as heterodimers; both partners of the dimer
contribute to DNA binding (5). USF1 or USF2 dimers are
identical in their abilities to bind the 12-bp AdMLP upstream activating element (35, 37). A naturally occurring splice variant of USF2 lacking exon 4, U2E4 (also called USF2b) has been
described previously (23, 41). The relative ratio of wild-type, full-length (FL) USF2 to the alternatively spliced U2E4
species varies among different cell types (41); however, the
functional consequence, if any, of the U2E4 splice variant is unknown.
In this report we demonstrate that (i) USF1 and USF2 are capable of
enhancing class I promoter activity through an upstream E box; (ii)
fine mapping of USF2 reveals the presence of both positive and negative
regulatory domains, whereas USF1 has only trans-activating
regions; and (iii) the U2E4 splice variant of USF2 acts as a
negative regulator of MHC class I E-box activity. Importantly, class I
E-box activity was found to be cell type specific: it is active in
neuroblastoma CHP-126 cells but not in HeLa epithelial cells. These
cell types also differ in the relative abundance of U2E4: CHP-126
cells contain relatively less U2E4 than HeLa cells. Therefore, we
propose that the cell type-specific activity of the E box is a
reflection of the cellular U2E4 content.
| |
MATERIALS AND METHODS |
Cell lines and cultivation.
Human HeLa epithelial cells and
CHP-126 neuroblastoma cell lines were grown in Dulbecco's modified
Eagle's medium supplemented with 2 mM L-glutamine, HEPES
(pH 7.2), gentamicin sulfate (10 µg/ml), and 10% fetal bovine serum
and maintained in a humidified incubator at 37°C with 7%
CO2.
Plasmids and cloning strategies.
The MHC class I promoter
used in these studies derived from the swine class I gene PD1
(15). The -294CAT and -400CAT constructs were previously
described (19). Control pSG5 and USF expression plasmids
were also previously described (24), and the AdMLP E-box
reporter construct U2E1bCAT and its control (E1bCAT) were provided by
R. Roeder (Rockefeller University, New York, N.Y.) and described in
reference 14. The class I E-box sequence (three copies)
5'-TCGAGGGCCACGTGAGGGGCCACGTGAGGGGCCACGTGT-3'
was subcloned into the XhoI/XbaI site in
E1bCAT (directly upstream of the TATA box in the control construct
E1bCAT) to generate 3E E1bCAT. The -342CAT construct was generated by
PCR amplification with the oligonucleotide primers
GGTTCTAGAGAAATCGCTGGG and GAGAAGCTTGAGCAGAGC and
cloned into the XbaI/HindIII site of pSV3CAT
as previously described (19). Wild-type and mutant class I
E-box sequences were cloned into the XbaI site upstream of
-294CAT to generate -294(WT E-box)CAT and -294(Mut E-box)CAT
constructs, respectively. Oligonucleotide sequences for WT E box and
Mut E box are CTAGATGGGCCACGTGAGGCACTGGAGACAT and
CTAGATGGGCGGATCCAGGCACTGGAGACAT (the E-box
hexamer sequence is shown in boldface type).
Transfections.
Transient transfections were performed by
using a total of 20 µg of DNA; final concentrations were adjusted to
20 µg with pUC19 supercoiled DNA, as needed. Twenty-four hours prior
to transfection 106 HeLa or CHP-126 cells were seeded in
100-mm-diameter tissue culture dishes. Transfections utilized standard
calcium phosphate precipitation as previously described
(19). The medium was replaced 24 h after transfection
with fresh medium, and cells were harvested after an additional 24 h. Chloramphenicol acetyltransferase (CAT) activity was normalized to
luciferase activity by cotransfecting an internal plasmid control,
pSV2LUC. CAT activity was determined by using an AMBIS 4000 radioanalytic imaging detector. All CAT enzyme assays were measured in
the linear range; control [14C]chloramphenicol values
ranged between 20 to 80%, among the different experiments.
Gel shift mobility assays.
HeLa and CHP-126 whole-cell
extracts (WCE) were prepared as previously described (42).
The probes used in gel shift mobility assays included a 107-bp fragment
encompassing the DdeI fragment from the 398 to 291 base
pairs (relative to the point of initiation) of the class I gene PD1 or
class I E-box oligonucleotides. Sense sequences for the double-stranded
oligonucleotides used in gel shift analysis were as follows: for the
class I E box (3E),
5'-TCGAGGGCCACGTGAGGGGCCACGTGAGGGGCCACGTGT-3' (the E-box hexamer sequence is underlined), and for the
nonspecific (NS) probe, 5'-AGCTTCATCGTCCCATCCTGACTGAGG-3'.
For gel shift mobility assays, 4.5 µg of WCE was added to 1.5 fmol of end-labeled probe. The extract, probe, and specific antibodies
were combined and incubated on ice for 30 min. Specific antibodies were
obtained from Santa Cruz Biotechnology. The binding buffer consisted of 12 mM HEPES (pH 7.9), 10% glycerol, 5 mM MgCl2, 60 mM KCl,
1 mM dithiothreitol, 50 µg of bovine serum albumin per ml, 0.5 mM
EDTA, 0.05% Nonidet P-40, and 3 µg of poly(dG-dC). DNA-protein
complexes were separated from the unbound free probe by electrophoresis through a nondenaturing 4% acrylamide gel in a 0.5× Tris-borate-EDTA running buffer run at 160 V.
Western blotting.
USF proteins present in CHP-126 and HeLa
WCE (150 µg) were analyzed by sodium dodecyl sulfate (SDS)-12.5%
polyacrylamide gel electrophoresis (PAGE) followed by electrophoretic
transfer to nitrocellulose membranes. Membranes were blocked in Blotto
A (5% milk, 10 mM Tris-HCl [pH 8.0], 150 mM NaCl) for 12 to 16 h at 4°C. Subsequently, an antiserum directed against either USF1 or USF2 (Santa Cruz Biotechnology) was added and incubated in Blotto A-0.05% Tween 20 for 60 min at room temperature. Blots were washed twice in Tris-buffered saline (10 mM Tris-HCl [pH 8.0], 150 mM NaCl)-0.05% Tween 20. A sufficient amount of a secondary antibody (anti-rabbit immunoglobulin G horseradish peroxidase-conjugated antibody; Santa Cruz Biotechnology) was added to Blotto A-0.05% Tween
20 and incubated for a further 60 min. Blots were then extensively washed in Tris-buffered saline-0.05% Tween 20; specific proteins were
detected by chemiluminescence with SuperSignal substrate (Pierce).
| |
RESULTS |
USF proteins bind the class I E-box element.
The MHC class I
gene PD1 (15) contains a canonical E box (CACGTG)
at bp 309 to 314, relative to the major start site of transcription (Fig. 1). The central CG dinucleotide, found in the class
I E box, has been associated with binding by bHLH-Z proteins such as
Myc, Max, and USF (3, 11). As a first step to determine
whether this sequence contributes to MHC class I gene expression we
performed gel shift analyses by using the extended class I E box,
consisting of 12 bp, as a probe. HeLa WCE generated two major complexes
with a double-stranded oligonucleotide probe containing three tandem
class I E-box elements (Fig. 1 and 2A, lane 2). The slower-mobility complex was specific for the E box, since
unlabeled wild-type oligonucleotide competed this complex, whereas an
irrelevant oligonucleotide did not (Fig. 2A, lanes 3 and 4). The
faster-mobility complex was not specific, since it was competed by both
oligonucleotides.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 2.
The MHC class I E box forms complexes with USF proteins.
The 3E oligonucleotide was end labeled, and DNA binding assay mixtures
were incubated for 30 min at 4°C prior to the separation of bound and
free probe in native 4% PAGE. Each lane contains 4.5 µg of HeLa WCE
and competitor oligonucleotides or antisera (1 µg), as indicated, in
a total volume of 20 µl. (A) A specific complex (indicated by the
arrowhead) was shown to be bound to the class I E box. Lane 1, probe
alone; lane 2, HeLa WCE; lanes 3 and 4, HeLa WCE (WT) and a 1,000-fold
excess of self and nonspecific (NS) oligonucleotide competitors,
respectively. (B) Antibody supershift examination of the 3E specific
complex (represented by the arrowhead). Lane 1, probe alone; lane 2, HeLa WCE; lane 3, HeLa WCE and control (C) antisera (directed against
the p50 subunit of NF- B); lanes 4 to 6, antisera against USF1, USF2,
and USF1 plus USF2, respectively, were added to DNA binding assay
mixtures. Anti-USF1 antisera generated two supershifted complexes
(indicated by the circles). Antisera to USF2 generated only one
supershifted complex (closed circle). Combining anti-USF1 and anti-USF2
antisera together resulted in a further supershift of the USF2
containing complex (arrow).
|
|
We next determined the identity of factors that specifically bind to
the class I E box by adding to the DNA binding reactions
antisera to
known E-box binding proteins. Antisera recognizing
bHLH family members,
such as Myc, Max, and SREBP-1 and antisera
against unrelated
transcription factors, such as activating transcription
factor 2, c-
jun, or the p50 subunit of NF-
B, had no effect on
either complex formation or complex mobility (Fig.
2B, lane 3,
and data
not shown). In marked contrast, the addition of anti-USF1
antiserum
generated two distinct supershifted complexes (Fig.
2B, lane 4). This
observation is consistent with the known ability
of USF1 to generate
DNA binding complexes with distinct mobilities
in gel shift analyses
depending on whether the 43-kDa USF1 binds
as a homodimer or as a
heterodimer with the 44-kDa USF2. Therefore,
the possible presence of
USF2 in either of the two class I E-box
complexes was assessed with
anti-USF2 antiserum. The addition
of anti-USF2 antiserum alone
generated a faint supershifted complex
(Fig.
2B, lane 5). The addition
of both USF1 and USF2 antisera
together had no effect on the appearance
of the more rapidly migrating
supershifted complex (Fig.
2B, lane 6),
whereas the faint slower-migrating
complex was further supershifted
(Fig.
2B, lane 6). Anti-USF2
appears to preferentially eliminate, not
supershift, USF2-containing
complexes. These results are consistent
with the interpretation
that the rapidly migrating supershifted complex
is generated by
homodimers of USF1, while the slower-migrating
supershifted complex
contains heterodimers composed of USF1 and USF2. A
complex of
USF1 bound to the class I E box in a 107-bp DNA fragment of
the
native promoter was also observed in supershift assays (data not
shown). Taken together, these data demonstrate that USF1 homodimers
and
USF1-USF2 heterodimers associate with the class I E box and
are the
primary bHLH proteins in HeLa cells to do
so.
USF activates the class I promoter.
Since USF binds the class
I E box in vitro, the ability of USF to regulate class I expression in
vivo was examined. HeLa cells were cotransfected with an MHC class I
reporter construct (-400CAT), which contains the E box (Fig. 1),
together with either USF1 or USF2 expression construct. Ectopically
expressed USF1 and USF2 each activated -400CAT three- to fivefold (Fig.
3). This activation was mediated through
the E box, since the introduction of the class I E box upstream of a
heterologous E1b promoter (3E E1bCAT) rendered it responsive to
exogenous USF1 and USF2 (Table 1); in the
absence of an upstream E box, the E1b promoter was unresponsive. These
data indicate that the class I E box is a target for USF regulation.
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
USF1 and USF2 activate the class I promoter. HeLa cells
were cotransfected with 10 µg of -400CAT class I reporter construct
(Fig. 1) and 3 µg of the vector control, pSG5, or the indicated USF
expression plasmids. Representative maps of the expressed USF sequences
and deleted regions are given on the left-hand side of the figure:
upstream regulatory region (USR), binding region (BR), and HLH-Z
interaction domain (HLH-LZ). Numbers in parentheses refer to deleted
amino acids. Basal -400CAT activity (cotransfected with pSG5) is shown
at the top of each panel. (A) The ability of USF1 and derivative
truncations to trans-activate MHC class I promoter
expression. (B) The ability of USF2 and truncated derivatives to
activate class I expression. Data are expressed as relative percentages
of acetylation normalized to the transfection control, pSV2LUC. Error
bars indicate standard errors.
|
|
Although USF1 and USF2 are highly homologous in their carboxy termini
(which contain the DNA-binding and dimerization domains),
their amino
termini (which contain the activation domains) are
quite divergent
(
39). Therefore, the effect of various amino-terminal
deletions on the ability of USF1 or USF2 to activate class I promoter
activity was examined (Fig.
3). The truncation of the amino terminus
of
USF1 resulted in successively decreasing levels of activation
of the
class I promoter, consistent with an extended activation
domain within
this segment (Fig.
3A). Interestingly, a construct
that expressed only
the dimerization and DNA-binding domains (U1
N)
still activated the
promoter approximately twofold, indicating
the presence of weak
activation signals within the carboxy terminus
of
USF1.
A completely different pattern was observed for USF2. The removal of
sequences between residues 6 and 186 significantly increased
the
ability of the USF2 variants to activate the class I promoter
(Fig.
3B). These observations indicate that an inhibitory autoregulatory
domain exists in the USF2 amino terminus. The further deletion
of
residues 186 to 199 resulted in a dramatic loss of activity,
indicating
the presence of an activation domain in this segment.
As in the case of
USF1, residual activity remained in constructs
containing only the
carboxy terminus (U2
N and U2
[1-199]), suggesting
that a minor
activation domain is present in this
region.
U2E4 binds to the class I E box but fails to activate the class
I promoter.
In most tissues, normal in vivo alternative splicing
gives rise to a variant of USF2 from which exon 4 has been deleted
(U2E4). However, U2E4 still contains intact DNA-binding and
dimerization domains as well as the activation domains encoded by exons
5 and 6 (USR). Surprisingly, the U2E4 variant was unable to activate the class I promoter (Fig. 3B). The failure to activate the class I
promoter does not reflect a global activation defect, since U2E4
activates the AdMLP E box-containing construct, U2E1bCAT (Fig.
4).
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
U2E4 activates an AdMLP E box-containing reporter
construct. The AdMLP E-box construct U2E1bCAT contains two copies of
the AdMLP E box upstream of the E1b TATA promoter. HeLa cells were
cotransfected with 3 µg of control or USF expression vectors and 10 µg of reporter construct. Data are expressed as relative percentages
of acetylation normalized to the transfection control, pSV2LUC. Error
bars indicate standard errors.
|
|
We considered the possibility that the failure of U2
E4 to activate
the class I promoter is due to an inability to enter into
functional
complexes capable of binding the class I E box. However,
in
vitro-translated U2
E4 protein bound to the class I E box (Fig.
5). Individual USF proteins, translated
in vitro, were combined
with radiolabeled class I E-box probe, and the
bound complexes
were resolved in a nondenaturing acrylamide gel (Fig.
5A). USF2
complexes migrated slightly slower than USF1 complexes (Fig.
5A;
compare lanes 2 and 5), consistent with the higher molecular weight
of USF2. Notably, the splice variant U2
E4 also bound the class
I E
box as efficiently as either USF1 or USF2 (Fig.
5A, lane 8);
the faster
mobility of U2
E4 reflects its decreased molecular
weight due to the
loss of exon 4. The specificity of binding was
determined by the
addition of an anti-USF1 or anti-USF2 antiserum.
Complexes containing
in vitro-translated USF1 were supershifted
by the anti-USF1 antiserum,
whereas the anti-USF2 antiserum had
no effect (Fig.
5A, lanes 3 and 4).
Likewise, complexes containing
in vitro-translated USF2 were
supershifted by the anti-USF2 antiserum
but not by the anti-USF1
antiserum (Fig.
5A, lanes 6 and 7). Complexes
containing U2
E4 were
recognized by the anti-USF2 antiserum, but
not anti-USF1, in supershift
analysis (Fig.
5A, lanes 8 to 10).
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5.
U2E4 can bind the class I E box. Equivalent amounts
of in vitro-translated USF proteins (determined by SDS-PAGE of
35S-labeled proteins; data not shown) were added to
end-labeled class I E-box probe, and binding reactions were analyzed as
described in the legend to Fig. 2 and in Materials and Methods. (A)
Homodimer of U2E4 can bind the class I E box. Lane 1, probe alone;
lanes 2 to 4, USF1; lanes 5 to 7, USF2; lanes 8 to 10, U2E4.
Antisera against USF1 or USF2 were included to verify the identities of
the translated proteins and demonstrate the specificity of the
individual antisera. Lanes 3, 6, and 9 contain the anti-USF1 antiserum.
Lanes 4, 7, and 10 contain the anti-USF2 antiserum. Specific
supershifted complexes are present in lanes 3 (USF1), 7 (USF2), and 10 (U2E4). Note the slower mobility of USF2 (due to its higher
molecular weight) than that of USF1 and the faster mobility of U2E4.
(B) U2E4 can generate class I E box-binding dimers with USF1 and
USF2. U2E4 was cotranslated with either USF1 or USF2, and the
specific binding complexes generated were examined by antibody
supershift analyses. Lane 1, probe alone; lanes 2 to 5, U2E4 and
USF1; lanes 6 to 9, U2E4 and USF2. The antiserum against either USF2
or USF1 was added to distinguish homodimers from heterodimers. Control
(C) antisera against the p50 subunit of NF-B was added to the
binding reaction mixtures shown in lanes 3 and 7. The antiserum against
either USF1 or USF2 was added to the binding reaction mixtures shown in
lanes 4 and 8 and 5 and 9, respectively.
|
|
Furthermore, the cotranslation of U2
E4 with either USF1 or USF2
generated heteromeric complexes capable of binding the class
I E box
(Fig.
5B). The cotranslation of USF1 and U2
E4 generated
three major
complexes in gel shift analyses (Fig.
5B, lane 2)
that could be
distinguished by their mobilities and through the
addition of either
the anti-USF1 or anti-USF2 antiserum. The slowest-migrating
complex migrated to the same position in the gel as USF1 homodimers
(data not shown). Also, this complex was supershifted by the
anti-USF1
antiserum, but not by the anti-USF2 antiserum (Fig.
5B, lanes
4 and 5), indicating that it is composed only of USF1. In contrast,
the
fastest-migrating complex contained only U2
E4, since this
complex
was supershifted by the anti-USF2 antiserum, but not anti-USF1
(Fig.
5B; compare lanes 4 and 5). The intermediate complex was
supershifted
by both anti-USF1 and anti-USF2 antisera, indicating
that it contained
both USF1 and U2
E4. Although the antisera do
not distinguish between
USF2 and U2
E4, a comparison of the mobilities
of complexes generated
by cotranslated USF2 and U2
E4 (Fig.
5B,
lanes 6 to 9) to those of
USF1 and U2
E4 (Fig.
5B, lanes 2 to
5) indicated that USF2 and
U2
E4 can also form stable class I
E box binding complexes. These
data indicate that defective-U2
E4
activation of the class I promoter
is not due to its inability
to enter into multimeric complexes or to
bind
DNA.
The ability of U2
E4 to dimerize with USF1 or USF2 and bind DNA,
despite its failure to enhance class I promoter activity
directly,
suggested the possibility that it may function as a
dominant-negative
regulator of USF-mediated, class I E box-dependent
enhancer activity.
Many transcription factors are known to have
their activities regulated
by the production of sterile, alternatively
spliced gene products which
allow protein-protein interactions,
and even DNA binding, but block
trans activation (
4,
17,
20,
27,
33). In order to
determine whether U2
E4 inhibits
USF activation of the class I
promoter, the following experiment
was conducted. The class I promoter
construct -400CAT, which responds
to USF, was transfected with constant
amounts of either the USF2
or USF1 expression construct and increasing
amounts of the U2
E4
construct. In the absence of U2
E4, both USF1
and USF2 activated
class I promoter activity (Fig.
6). The addition of increasing
amounts of
U2
E4 resulted in an increased inhibition of USF1 and
USF2 activation
of -400CAT. At the highest concentrations, U2
E4
completely blocked
the effects of USF1 and USF2. These data reveal
a novel regulatory
activity of the U2
E4 protein, in which it
regulates activation by
either USF1 or USF2. Thus, we propose
that one of the in vivo functions
of U2
E4 is to modulate USF
activation of responsive genes, such as
class I genes.
View larger version (9K):
[in this window]
[in a new window]
|
FIG. 6.
U2E4 abrogates USF activation of MHC class I E-box
activity. HeLa cells were cotransfected with 10 µg of -400CAT class I
reporter construct (Fig. 1) and 3 µg of either USF1 (right panel) or
USF2 (left panel) expression construct. Fold stimulation of the class I
reporter, relative to the control and in the absence of added U2E4,
is indicated on the ordinate. Increasing amounts of the U2E4
expression construct were included (shown on the abscissa as 1, 3, and
9 µg). All assays were normalized to the cotransfected internal
control plasmid pSV2LUC.
|
|
The class I E box regulates promoter function in CHP-126
cells.
The above-mentioned findings suggest that the relative
cellular concentrations of U2E4 and FL USF2 may regulate the
activity of the class I promoter in different tissues and cells.
Therefore, we examined the U2E4/FL ratio of two cell lines known to
have markedly different patterns of class I expression: human HeLa epithelial cells, which express moderate levels of class I genes, and a
human neuroblastoma line, CHP-126, which expresses very low levels of
class I. Since U2E4 appears to
function as a dominant-negative regulator of class I expression, we
expected it to be relatively more abundant in CHP-126 cells than in
HeLa cells. Western analysis of the USF protein content of the two cell
lines revealed that both contain similar amounts of USF1 and FL USF2
(Fig. 7). In contrast, the U2E4/FL ratio was much lower in CHP-126
cells than in HeLa cells (Fig. 7). Inconsistent with the above
prediction, the class I-expressing HeLa cell line contained sixfold
more dominant-negative U2E4 splice product than the CHP-126 line,
which expresses barely detectable levels of class I genes (Fig. 7).
This surprising result led us to compare the role of the E box in class
I expression in these two cell lines.
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
CHP-126 neuroblastoma cell line contains less U2E4
relative to HeLa epithelial cells. Approximately 150 µg of either
CHP-126 or HeLa WCE was separated by SDS-12.5% PAGE and transferred
to nitrocellulose membranes, and USF proteins were distinguished by
Western blotting with antisera against USF1 and USF2. Densitometric
values to quantitate the relative ratios of USF1 and USF2 to U2E4
between the two cell lines are provided to the right.
|
|
Consistent with the low level of endogenous class I expression in
CHP-126 cells, an FL class I promoter construct containing
1,000 bp of
upstream sequences transfected into CHP-126 cells
is not expressed
(
30). The interval between bp
1000 and
400
contains a
series of tissue-specific silencer elements which specifically
represses class I expression in CHP-126 neuroblastoma cells
(
30).
However, a promoter construct containing only the
proximal 400
bp of upstream class I sequences is actively transcribed
in both
CHP-126 cells and HeLa cells (Fig.
8). The class I E box is contained
within
this 400-bp upstream segment (at bp
309 to
314), allowing
an
analysis of its relative role in class I promoter activity
in both
CHP-126 and HeLa cells. Removing the region of the promoter
between
positions
400 and
342 had no effect on class I promoter
activity in
either cell type (compare -400CAT to -342CAT [Fig.
8]). However, a
truncation to position
294 (-294CAT), which removes
the E box,
reduced promoter activity 10-fold in CHP-126 cells,
whereas only a
modest reduction was observed in HeLa cells. These
data demonstrate the
presence of a strong tissue-specific enhancer
element in the segment
between positions
342 and
294 that functions
preferentially in
CHP-126 neuroblastoma cells, relative to HeLa
cells. However, the
activity of the enhancer in CHP-126 cells
is revealed only in the
truncated class I promoter construct which
is completely dependent upon
the E box for activity.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 8.
A region of the class I promoter containing the E box is
active in the CHP-126 neuroblastoma cell line but is inactive in HeLa
epithelial cells. HeLa epithelial cells and CHP-126 neuroblastoma cell
lines were transfected with 10 µg of the indicated MHC class I
reporter constructs, and promoter function was assessed. Note that the
actual class I promoter activities in HeLa and CHP-126 cells were
normalized to facilitate this comparison; class I expression in the
CHP-126 cell line (although significant) is approximately 40-fold less
than in HeLa cells.
|
|
To determine whether the E box accounted for the strong
CHP-126-specific enhancer activity present in this gene fragment,
wild-type (WT) and mutant (Mut) class I E boxes (Fig.
9) were
individually cloned upstream of
-294CAT to generate the -294(WT)
E-boxCAT and -294(Mut) E-boxCAT
constructs, respectively. The
mutant E box had no effect on basal class
I promoter activity
in either CHP-126 or HeLa cells (Fig.
9). In
contrast, placement
of the WT E box upstream of -294CAT (in either the
sense or antisense
orientation) stimulated its promoter activity in
CHP-126 cells
approximately fivefold, to a level equal to that of
-400CAT. The
E box had no significant effect on basal class I promoter
activity
in HeLa cells. However, as shown in Fig.
3 and
6, the
overexpression
of exogenous USF1 or USF2 does activate class I promoter
activity
in transiently transfected HeLa cells consistent with a
titration
of the dominant-negative effect of U2
E4. Taken together,
these
results support the proposal that U2
E4 functions as a
dominant-negative
regulator of class I E-box enhancer activity. In HeLa
cells, the
relative abundance of U2
E4 suppresses enhancer activity.
In CHP-126
cells the lower U2
E4/FL ratio enables the E box to act as
a strong
enhancer of class I promoter activity in the absence of
upstream
tissue-specific silencers.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 9.
The ability of the class I E box to stimulate
transcription is cell type specific. Wild-type (WT) or mutant (Mut)
class I E boxes, in sense and antisense orientations, were cloned
upstream of -294CAT (which lacks an E box). HeLa and CHP-126 cell lines
were transfected with 10 µg of the indicated reporter construct, and
promoter activity was determined.
|
|
| |
DISCUSSION |
Cell-surface MHC class I expression, in any given tissue, is
largely determined at the level of transcription and consists of both
tissue-specific and dynamic control mechanisms. Tissue-specific transcriptional mechanisms define a characteristic "set-point" level of gene expression (for example, class I expression is high in
lymphoid tissue, moderate to low in most other tissues, and very low in
the brain) and depends on a number of distinct positive and negative
regulatory elements. Whether a common set of regulatory elements
variably regulate gene expression in different tissues or different
tissues utilize unique sets of regulatory elements to establish
tissue-appropriate levels of expression is not clear. While the control
mechanisms (regulatory elements and their cognate DNA binding factors)
responsible for dynamic modulation of class I expression have been
extensively examined, those elements responsible for the maintenance of
tissue-appropriate levels of expression remain relatively uncharacterized.
We have identified a DNA sequence element, referred to as an E box, and
have demonstrated that it is a cell type-specific regulator of class I
promoter activity. The extended class I E-box element,
G
6G5C4C3A2C1G+1T+2G+3A+4G+5G+6, spans 12 bases. Although it contains a canonical binding site for
bHLH-Z proteins, the class I E box shows a marked specificity in its
interactions. USF proteins bind to the E box, either as in
vitro-translated proteins or from WCE, whereas other bHLH-Z proteins,
such as c-Myc and Max, do not (data not shown). Consistent with this
discrimination of binding, only USF1 and USF2 activate the class I E
box; c-Myc does not (data not shown). USF proteins are not known to be
inducible, suggesting that the E box regulates the constitutive and not
dynamic control of class I expression. The contribution of the E box to
class I expression is determined by the ratio of USF1 and USF2 to the
splice variant U2E4. Both USF1 and USF2 can activate the class I
promoter, whereas U2E4 acts as a specific dominant-negative
repressor of E-box function. All three USF proteins can enter into
heteromeric complexes and appear to bind the class I E box with
approximately equal affinities. Therefore, the ability of the E box to
enhance class I expression, in the absence of ectopically expressed
USF1 or USF2, is determined by the cellular ratio of endogenous U2E4
splice variant to FL USF proteins. In neuroblastoma cells where there
is relatively less U2E4, the E box can function as a potent enhancer
increasing class I promoter activity approximately fivefold. In
contrast, in HeLa cells where U2E4 is relatively more abundant, the
E box does not function as a strong enhancer. However, E-box activity can be evoked in HeLa cells by overexpressing either USF1 or USF2 in a
transient transfection, thereby disrupting the WT balance of U2E4/FL
USF protein and skewing in favor of FL USF dimers and an active E box.
USF1 and USF2 have both been shown to inhibit cell proliferation,
raising the possibility that the observed effects on class I promoter
activity may be an indirect result of cell growth effects (1,
25). This is unlikely because (i) the effects on the class I
promoter depend on the presence of the E box and (ii) USF mutants,
including U2E4 and U2(7-186), do not affect cell growth
(25a) but differentially affect the class I promoter.
U2E4 does not activate the MHC class I promoter, but it has been
shown to directly activate a variety of natural and artificial promoters, including the AdMLP (24), the pyruvate kinase
promoter (41), and a promoter containing two copies of the
AdMLP E box upstream of the E1b TATA box (23). Although
U2E4 alone does not repress basal class I promoter activity in HeLa
cells, it effectively inhibits the ability of either USF1 or USF2 to
activate class I expression. These data indicate that U2E4 acts as a
dominant-negative regulator of USF-mediated activation of the class I
promoter, presumably by forming heteromeric complexes with other USF
proteins which can bind E-box elements but fail to activate.
Importantly, U2E4 directly activates a promoter construct consisting
of three copies of the class I E box upstream of the E1b TATA box (data not shown). Therefore, the repressive effect of U2E4 is not
intrinsic to the class I E box. These findings support the hypothesis
that the differential activities of U2E4 and USF2 are either
determined by promoter context or influenced by regulatory elements
situated downstream of the E box. Differences in the AdMLP and class I core promoter regions may determine the trans-acting
potential of U2E4. Luo and Sawadogo demonstrated that a core
promoter initiator-like sequence is required for optimal
trans activation by U2E4, as well as U2(7-186)
(24). Whereas U2E4 and U2(7-186) minimally activated
U2E1bCAT (which contains only the E1b TATA box), the insertion of an
initiator-like sequence downstream of the TATA box allowed U2E4 and
U2(7-186) to activate almost to the level of USF2. However, whether
U2E4 or U2(7-186) could act as a dominant repressor of USF2
activation of U2E1bCAT activity was not investigated in that study.
Although U2E4 did not activate class I promoter activity,
U2(7-186) was a very potent activator of class I expression. Therefore, the contribution of class I core promoter structures to the
ability of USF to activate is unclear.
Exon 4 in U2E4 contains at least two regulatory elements, as
revealed by the fine mapping. One is a negative regulatory element between amino acids 123 and 148. After the deletion of this region, the
resulting USF2 protein has an enhanced ability to activate class I
promoter activity. The other element in exon 4 appears to be an
activation domain. However, this domain does not directly activate but
rather appears to inhibit the activity of a repression domain, located
between amino acids 7 and 76. This is best appreciated by comparing the
two constructs U2(7-148) and U2E4. U2(7-148), which has the
sequences between amino acids 7 and 76 as well as exon 4 deleted, is
the most active of the USF2 constructs. Thus, exon 4 itself is not
necessary for maximal activity. In contrast, U2E4, which is devoid
of only exon 4, has no activity. Since the only difference between
these two mutants is the presence of amino-terminal residues 7 to 76, it is concluded that this region contains a suppressive autoregulatory
domain which is blocked in the presence of exon 4.
Consistent with the model of USF-regulating tissue-specific class I
expression, the class I E box functions as a cell type-specific enhancer. Both USF1 and USF2 are ubiquitously expressed: extracts from
HeLa (adenocarcinoma), Jurkat (T lymphocyte), and CHP-126 (neuroblastoma) cells all give rise to similar complexes with E-box
probes (Fig. 2 and data not shown). However, the relative ratios of USF
homo- and heterodimers are known to vary in different cell lines
(41). As detailed here and also reported by others, HeLa
cells primarily express USF1-USF2 heterodimers and some USF1 homodimers
(39). Whether the different compositions of USF dimers affects their abilities to activate different promoters has not been
examined. However, it is likely that the relative level of U2E4 in a
cell determines the activity of the class I E box as an enhancer. The E
box is active in the CHP-126 neuroblastoma cell line, where the
relative abundance of U2E4 is low, compared to HeLa cells, where the
E box is much less active.
The finding that the E box is an active enhancer in CHP-126
neuroblastoma cells, whose class I expression is actively repressed by
upstream silencers, would appear to be paradoxical. However, previous
studies have demonstrated that these silencers are labile, and class I
expression is readily induced in the face of infections and interferon
(30, 42). Thus, it is tempting to speculate that the active
E-box enhancer maintains the endogenous class I gene poised for active
transcription, to allow the rapid development of an immune response.
In conclusion, the present studies suggest that the E box contributes
to the tissue-specific regulation of class I gene expression, through
the actions of USF1, USF2, and U2E4. Together, these factors
modulate enhancer activity, providing a mechanism to fine-tune the
level of class I expression in different tissues.
| |
ACKNOWLEDGMENTS |
We gratefully acknowledge Carol Thiele, Stephen Straus, Barbara
L. Rellahan, Shelby Berger, and Julie Brown for valuable suggestions and discussions. We thank Robert Roeder for providing the U2E1bCAT reporter construct.
S.J.H. was supported by the HHMI Summer Research Program.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Experimental
Immunology Branch, National Cancer Institute, National Institutes of
Health, Building 10, Room 4B-17, 10 Center Dr. MSC 1360, Bethesda, MD 20892-1360. Phone: (301) 496-9097. Fax: (301) 480-8499. E-mail: Howcrofk{at}Exchange.nih.gov.
| |
REFERENCES |
| 1.
|
Aperlo, C.,
K. E. Boulukos, and P. Pognonec.
1996.
The basic region/helix-loop-helix/leucine repeat transcription factor USF interferes with Ras transformation.
Eur. J. Biochem.
241:249-253[Medline].
|
| 2.
|
Beckman, H.,
L.-K. Su, and T. Kadesch.
1989.
TFE3: a helix-loop-helix protein that activates transcription through the immunoglobulin enhancer uE3 motif.
Genes Dev.
4:1730-1740[Abstract/Free Full Text].
|
| 3.
|
Bendall, A. J., and P. L. Molloy.
1994.
Base preferences for DNA binding by the bHLH-Zip protein USF: effects of MgCl2 on specificity and comparison with binding of Myc family members.
Nucleic Acids Res.
22:2801-2810[Abstract/Free Full Text].
|
| 4.
|
Bodor, J., and J. F. Habener.
1998.
Role of transcriptional repressor ICER in cyclic AMP-mediated attenuation of cytokine gene expression in human thymocytes.
J. Biol. Chem.
273:9544-9551[Abstract/Free Full Text].
|
| 5.
|
Bresnick, E. H., and G. Felsenfeld.
1994.
The leucine zipper is necessary for stabilizing a dimer of the helix-loop-helix transcription factor USF but not for maintenance of an elongated conformation.
J. Biol. Chem.
269:21110-21116[Abstract/Free Full Text].
|
| 6.
|
Cai, M., and R. W. Davis.
1990.
Yeast centromere binding protein CBF1, of the helix-loop-helix protein family, is required for chromosome stability and methionine prototrophy.
Cell
61:437-446[Medline].
|
| 7.
|
Carr, C. S., and P. A. Sharp.
1990.
A helix-loop-helix protein related to immunoglobulin E box-binding proteins.
Mol. Cell. Biol.
10:4384-4388[Abstract/Free Full Text].
|
| 8.
|
Carthew, R. W.,
L. A. Chodosh, and P. A. Sharp.
1985.
An RNA polymerase II transcription factor binds to an upstream element in the adenovirus major late promoter.
Cell
43:439-448[Medline].
|
| 9.
|
Chamberlain, J. W.,
H. A. Vasavada,
S. Ganguly, and S. M. Weissman.
1991.
Identification of cis sequences controlling efficient position-independent tissue-specific expression of human major histocompatibility complex class I genes in transgenic mice.
Mol. Cell. Biol.
11:3564-3572[Abstract/Free Full Text].
|
| 10.
|
Corneliussen, B.,
A. Thornell,
B. Hallberg, and T. J. Grundstrom.
1991.
Helix-loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers.
J. Virol.
65:6084-6093[Abstract/Free Full Text].
|
| 11.
|
Dang, C. V.,
C. Dolde,
M. L. Gillison, and G. J. Kato.
1992.
Discrimination between related DNA sites by a single amino acid residue of Myc-related basic-helix-loop-helix proteins.
Proc. Natl. Acad. Sci. USA
89:599-602[Abstract/Free Full Text].
|
| 12.
|
Das, G.,
C. S. Hinkley, and W. Herr.
1995.
Basal promoter elements as a selective determinant of transcriptional activator function.
Nature
374:657-660[Medline].
|
| 13.
|
Davis, R. L.,
P.-F. Cheng,
A. B. Lassar, and H. Weintraub.
1990.
The MyoD DNA binding domain contains a recognition code for muscle-specific gene activation.
Cell
60:733-746[Medline].
|
| 14.
|
Du, H.,
A. L. Roy, and R. G. Roeder.
1993.
Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters.
EMBO J.
12:501-511[Medline].
|
| 15.
|
Ehrlich, R.,
J. Maguire, and D. Singer.
1988.
Identification of negative and positive regulatory elements associated with a class I major histocompatibility complex gene.
Mol. Cell. Biol.
8:695-703[Abstract/Free Full Text].
|
| 16.
|
Ferre-D'Amare, A. R.,
P. Pognonec,
R. G. Roeder, and S. K. Burley.
1994.
Structure and function of the b/HLH/Z domain of USF.
EMBO J.
13:180-189[Medline].
|
| 17.
|
Girardet, C.,
W. H. Walker, and J. F. Habener.
1996.
An alternatively spliced polycistronic mRNA encoding cyclic adenosine 3',5'-monophosphate (cAMP)-responsive transcription factor CREB (cAMP response element-binding protein) in human testis extinguishes expression of an internally translated inhibitor CREB isoform.
Mol. Endocrinol.
10:879-891[Abstract/Free Full Text].
|
| 18.
|
Gregor, P. D.,
M. Sawadogo, and R. G. Roeder.
1990.
The adenovirus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer.
Genes Dev.
4:1730-1740.
|
| 19.
|
Howcroft, T. K.,
J. C. Richardson, and D. S. Singer.
1992.
MHC class I gene expression is negatively regulated by the proto-oncogene, c-jun.
EMBO J.
12:3163-3169[Medline].
|
| 20.
|
Jones, N.
1990.
Transcriptional regulation by dimerization: two sides to an incestuous relationship.
Cell
61:9-11[Medline].
|
| 21.
|
Kim, J. B.,
G. D. Spotts,
Y.-D. Halvorsen,
H.-M. Shih,
T. Ellenberger,
H. C. Towle, and B. M. Spiegelman.
1995.
Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acid in the basic helix-loop-helix domain.
Mol. Cell. Biol.
15:2582-2588[Abstract].
|
| 22.
|
LeBouteiller, P.
1994.
HLA class I chromosomal region, genes, and products: facts and questions.
Crit. Rev. Immunol.
14:89-129[Medline].
|
| 23.
|
Lin, Q.,
X. Luo, and M. Sawadogo.
1994.
Archaic structure of the gene encoding transcription factor USF.
J. Biol. Chem.
269:23894-23903[Abstract/Free Full Text].
|
| 24.
|
Luo, X., and M. Sawadogo.
1996.
Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains.
Mol. Cell. Biol.
16:1367-1375[Abstract].
|
| 25.
|
Luo, X., and M. Sawadogo.
1996.
Antiproliferative properties of the USF family of helix-loop-helix transcription factors.
Proc. Natl. Acad. Sci. USA
93:1308-1313[Abstract/Free Full Text].
|
| 25a.
| Luo, X., and M. Sawadogo. Unpublished observation.
|
| 26.
|
Maguire, J. E.,
W. I. Frels,
J. C. Richardson,
J. D. Weissman, and D. S. Singer.
1992.
In vivo function of regulatory DNA sequence elements of a major histocompatibility complex class I gene.
Mol. Cell. Biol.
12:3078-3086[Abstract/Free Full Text].
|
| 27.
|
Maniatis, T.
1991.
Mechanisms of alternative pre-mRNA splicing.
Science
251:33-34[Free Full Text].
|
| 28.
|
Mellor, J.,
W. Jiang,
M. Funk,
J. Rathjen,
C. A. Barnes,
T. Hinz,
J. H. Hegemann, and P. Philippsen.
1990.
CPF1, a yeast protein which functions in centromeres and promoters.
EMBO J.
9:4017-4026[Medline].
|
| 29.
|
Miyamoto, N. G.,
V. Moncollin, and P. Chambon.
1985.
Specific interaction between a transcription factor and the upstream element of the adenovirus-2 major late promoter.
EMBO J.
4:3563-3570[Medline].
|
| 30.
|
Murphy, C.,
D. Nikodem,
K. Howcroft,
J. D. Weissman, and D. S. Singer.
1996.
Active repression of major histocompatibility complex class I genes in a human neuroblastoma cell line.
J. Biol. Chem.
271:30992-30999[Abstract/Free Full Text].
|
| 31.
|
Murre, C.,
P. S. McCaw, and D. Baltimore.
1989.
A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins.
Cell
56:777-783[Medline].
|
| 32.
|
Murre, C.,
P. S. McCaw,
H. Vaessin,
M. Caudy,
L. Y. Jan,
Y. N. Jan,
C. V. Cabrera,
J. N. Buskin,
S. D. Hauschka,
A. B. Lassar,
H. Weintraub, and D. Baltimore.
1989.
Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence.
Cell
58:537-544[Medline].
|
| 33.
|
Oettgen, P.,
Y. Akbarali,
J. Boltax,
J. Best,
C. Kunsch, and T. A. Libermann.
1996.
Characterization of NERF, a novel transcription factor related to the Ets factor ELF-1.
Mol. Cell. Biol.
16:5091-5106[Abstract].
|
| 34.
|
Sawadogo, M., and R. G. Roeder.
1985.
Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region.
Cell
43:165-175[Medline].
|
| 35.
|
Sawadogo, M.,
M. W. VanDykes,
P. D. Gregor, and R. G. Roeder.
1988.
Multiple forms of the human gene-specific transcription factor USF.
J. Biol. Chem.
263:11985-11993[Abstract/Free Full Text].
|
| 36.
|
Schmidt, C. M.,
R. G. Ehlenfeldt,
M. C. Athanasiou,
L. A. Duvick,
H. Heinrichs,
C. S. David, and H. T. Orr.
1993.
Extraembryonic expression of the human MHC class I gene HLA-G in transgenic mice. Evidence for a positive regulatory region located 1 kilobase 5' to the start site of transcription.
J. Immunol.
151:2633-2645[Abstract].
|
| 37.
|
Singer, D., and J. Maguire.
1990.
Regulation of the expression of class I MHC genes.
Crit. Rev. Immunol.
10:235-257[Medline].
|
| 38.
|
Sirito, M.,
S. Walker,
Q. Lin,
M. T. Kozlowski,
W. H. Klein, and M. Sawadogo.
1992.
Members of the USF family of helix-loop-helix proteins bind DNA as homo- as well as heterodimers.
Gene Expr.
2:231-240[Medline].
|
| 39.
|
Sirito, M.,
Q. Lin,
T. Maity, and M. Sawadogo.
1994.
Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells.
Nucleic Acids Res.
22:427-433[Abstract/Free Full Text].
|
| 40.
|
Ting, J. P.-Y., and A. S. Baldwin.
1993.
Regulation of MHC gene expression.
Curr. Biol.
5:8-16.
|
| 41.
|
Viollet, B.,
A. M. Lefrancois-Martinez,
A. Henrion,
A. Kahn,
M. Raymondjean, and A. Martinez.
1996.
Immunochemical characterization and transacting properties of upstream stimulatory factor isoforms.
J. Biol. Chem.
271:1405-1415[Abstract/Free Full Text].
|
| 42.
|
Weissman, J. D., and D. S. Singer.
1991.
A complex regulatory DNA element associated with a major histocompatibility complex class I gene consists of both a silencer and an enhancer.
Mol. Cell. Biol.
11:4217-4227[Abstract/Free Full Text].
|
Molecular and Cellular Biology, July 1999, p. 4788-4797, Vol. 19, No. 7
0270-7306/99/$04.00+0
This article has been cited by other articles:
-
Grassadonia, A., Tinari, N., Fiorentino, B., Nakazato, M., Chung, H.-K., Giuliani, C., Napolitano, G., Iacobelli, S., Howcroft, T. K., Singer, D. S., Kohn, L. D., on behalf of Consorzio Interuniversitario Nazional,
(2007). Upstream Stimulatory Factor Regulates Constitutive Expression and Hormonal Suppression of the 90K (Mac-2BP) Protein. Endocrinology
148: 3507-3517
[Abstract]
[Full Text]
-
Lee, M. P., Howcroft, K., Kotekar, A., Yang, H. H., Buetow, K. H., Singer, D. S.
(2005). ATG deserts define a novel core promoter subclass. Genome Res
15: 1189-1197
[Abstract]
[Full Text]
-
Ge, Y., Jensen, T. L., Matherly, L. H., Taub, J. W.
(2003). Physical and Functional Interactions between USF and Sp1 Proteins Regulate Human Deoxycytidine Kinase Promoter Activity. J. Biol. Chem.
278: 49901-49910
[Abstract]
[Full Text]
-
Rodriguez, C. I., Girones, N., Fresno, M.
(2003). Cha, a Basic Helix-Loop-Helix Transcription Factor Involved in the Regulation of Upstream Stimulatory Factor Activity. J. Biol. Chem.
278: 43135-43145
[Abstract]
[Full Text]
-
Howcroft, T. K., Raval, A., Weissman, J. D., Gegonne, A., Singer, D. S.
(2003). Distinct Transcriptional Pathways Regulate Basal and Activated Major Histocompatibility Complex Class I Expression. Mol. Cell. Biol.
23: 3377-3391
[Abstract]
[Full Text]
-
Chen, W. G., West, A. E., Tao, X., Corfas, G., Szentirmay, M. N., Sawadogo, M., Vinson, C., Greenberg, M. E.
(2003). Upstream Stimulatory Factors Are Mediators of Ca2+-Responsive Transcription in Neurons. J. Neurosci.
23: 2572-2581
[Abstract]
[Full Text]
-
Yang, X.-P., Freeman, L. A., Knapper, C. L., Amar, M. J. A., Remaley, A., Brewer, H. B. Jr., Santamarina-Fojo, S.
(2002). The E-box motif in the proximal ABCA1 promoter mediates transcriptional repression of the ABCA1 gene. J. Lipid Res.
43: 297-306
[Abstract]
[Full Text]
-
Heckert, L. L., Sawadogo, M., Daggett, M. A. F., Chen, J. k.
(2000). The USF Proteins Regulate Transcription of the Follicle-Stimulating Hormone Receptor but Are Insufficient for Cell- Specific Expression. Mol. Endocrinol.
14: 1836-1848
[Abstract]
[Full Text]
-
Weissman, J. D., Howcroft, T. K., Singer, D. S.
(2000). TAFII250-independent Transcription Can Be Conferred on a TAFII250-dependent Basal Promoter by Upstream Activators. J. Biol. Chem.
275: 10160-10167
[Abstract]
[Full Text]
Top
Abstract
Introduction
