Previous Article | Next Article 
Molecular and Cellular Biology, July 1999, p. 4855-4865, Vol. 19, No. 7
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Repressive Effect of Sp1 on the C/EBP
Gene
Promoter: Role in Adipocyte Differentiation
Qi-Qun
Tang,
Man-Shiow
Jiang, and
M. Daniel
Lane*
Department of Biological Chemistry, The Johns
Hopkins University School of Medicine, Baltimore, Maryland 21205
Received 22 October 1998/Returned for modification 6 January
1999/Accepted 21 April 1999
 |
ABSTRACT |
Expression of C/EBP
is required for differentiation of 3T3-L1
preadipocytes into adipocytes. Previous investigations indicated that
transcription of the C/EBP
gene is sequentially activated during
differentiation, initially by C/EBP
and C/EBP
and later by
C/EBP
(autoactivation). These events are mediated by a C/EBP regulatory element in the promoter of the C/EBP
gene. This article presents evidence that members of the Sp family, notably Sp1, act
repressively on the C/EBP
promoter prior to the induction of
differentiation. Sp1 was shown to bind to a GC box at the 5' end of the
C/EBP regulatory element in the C/EBP
promoter and, in so doing, to
competitively prevent binding to and transactivation of the promoter by
the C/EBPs. One of the differentiation inducers methylisobutylxanthine
(a cAMP phosphodiesterase inhibitor) or Forskolin, both of which
increase the cellular cAMP level, causes down-regulation of Sp1. This
decrease in Sp1 level early in the differentiation program appears to
facilitate access of C/EBP
and/or C/EBP
to the C/EBP regulatory
element and, thereby, derepression of the C/EBP
gene.
 |
INTRODUCTION |
C/EBP
plays a pivotal role in
adipocyte differentiation (7, 10, 23). C/EBP
not only is
required for differentiation (18, 24) but is sufficient to
initiate the differentiation program without the hormonal inducers
normally required (19). When differentiation is triggered by
hormonal inducers, growth-arrested preadipocytes reenter the cell cycle
and undergo two to three rounds of mitotic clonal expansion (1,
7). As mitosis ceases, C/EBP
is expressed and then serves as a
pleiotropic transcriptional activator of numerous adipocyte genes
which, when coordinately expressed, contribute to acquisition of the
adipocyte phenotype (3-5, 9, 11, 14).
When it became evident that C/EBP
is an important regulator of
adipogenesis, our efforts were redirected toward identifying the
cis-elements and their cognate trans-acting
factors which control transcription of the C/EBP
gene (4, 13,
20, 27, 29). DNaseI footprinting of the proximal 5' flanking
region of the mouse C/EBP
gene revealed several binding sites for
nuclear factors that are differentially expressed during adipocyte
differentiation (4, 17). Dual repressor binding sites
(26) and a C/EBP binding site (4) were identified
in this region of the promoter. CUP (C/EBP undifferentiated protein), a
nuclear protein that binds to these repressor binding sites, is
expressed by undifferentiated preadipocytes but not by differentiated
adipocytes (26, 28). Purification and characterization of
CUP showed it to be an isoform of the transcription factor AP-2
,
which appears to function as a repressor of the C/EBP
gene.
Consistent with its apparent repressive role in adipocyte
differentiation, expression of CUP/AP-2
is down-regulated
concurrently with the transcriptional activation of the C/EBP
gene
(13). Moreover, CUP/AP-2
was found to transinhibit reporter gene expression mediated by the C/EBP
promoter
(13). With respect to the C/EBP binding site, it was shown
that C/EBP
, C/EBP
, and C/EBP
can bind to and
trans-activate reporter gene expression mediated by the
C/EBP
gene promoter (20-22). Evidence suggests that
C/EBP
and C/EBP
, which are expressed early in the differentiation
program (2, 32), initially activate transcription of the
gene (23) and that C/EBP
, which is expressed later in the
program, autoactivates transcription of the gene as the cells undergo
terminal differentiation (20, 23).
Many adipocyte gene promoters possess functional C/EBP binding sites
that mediate transcriptional activation by C/EBP
(7, 10,
23). It has been shown that these sites are DNaseI footprinted by
nuclear extract from adipocytes, which express C/EBP
, but not by
nuclear extracts from preadipocytes, which do not (5, 11,
14). An exception to this pattern is seen with the C/EBP
promoter, which, as indicated above, also possesses a functional C/EBP
binding site (5, 20). Unexpectedly, this promoter was found
to be footprinted by nuclear extracts from both preadipocytes and
adipocytes (5). However, the footprint by preadipocyte nuclear extract extended further 5' than that by adipocyte nuclear extract. Closer examination of the nucleotide sequence of this binding
site revealed a consensus Sp binding site at the 5' end of the C/EBP
site that is not found in the C/EBP binding sites of other adipocyte
genes (5, 11, 14). In the present article, we show that Sp1
does in fact bind at this site and in so doing obscures the C/EBP
binding site, thereby preventing C/EBP
or C/EBP
from binding.
Evidence which suggests that early in the differentiation program Sp1
is down-regulated, thereby allowing C/EBP
to bind and to
transcriptionally activate the C/EBP
gene, is presented. This and
other evidence suggests that Sp1 may serve to maintain the C/EBP
gene in a repressed state prior to differentiation and thereby prevent
premature expression of the gene.
 |
MATERIALS AND METHODS |
Cell culture and induction of differentiation.
3T3-L1 preadipocytes were propagated and maintained in Dulbecco's
modified Eagle's medium (DMEM) containing 10% (vol/vol) calf serum as
previously described (26). To induce differentiation, 2-day
postconfluent (designated day 0) cells were treated with DMEM
containing 10% (vol/vol) fetal bovine serum (FBS), 1 µg of insulin
(INS) per ml, 1 µM dexamethasone (DEX), and 0.5 mM
3-isobutyl-1-methyl-xanthine (MIX) until day 2. Cells were then fed
DMEM supplemented with 10% FBS and 1 µg of INS per ml for 2 days,
after which they were fed every other day with DMEM containing 10%
FBS. Adipocyte gene expression and acquisition of the adipocyte
phenotype began on day 3 and was maximal by day 8.
EMSAs and DNaseI footprinting.
Nuclei were isolated, and
nuclear extracts were prepared by using 1× NUN buffer (15)
containing 0.3 M NaCl, 1 M urea, 1% Nonidet P-40, 25 mM HEPES (pH
7.9), and 1 mM dithiothreitol. Protein concentration was determined by
the Bradford method (Bio-Rad). An electrophoretic mobility shift assay
(EMSA) was performed essentially as described previously (21,
22), with the following modifications. Reaction mixtures
containing ~0.25 ng of 32P-labeled oligonucleotide, 2 µg of poly(dI-dC), and 10 µg of nuclear extract protein in 30 µl
of buffer (10 mM HEPES, 0.1 mM EDTA, 5% glycerol, 100 mM NaCl, 0.3 M
urea, 0.3% Nonidet P-40) were incubated on ice for 15 min and at room
temperature for 15 min and were then separated electrophoretically on
5% polyacrylamide gels-0.5× TBE (44.5 mM Tris, 44.5 mM boric acid, 1 mM EDTA [pH 8.3]). For competition experiments, a 100-fold excess of
unlabeled competitor oligonucleotide was added to reaction mixtures
prior to the addition of labeled probe. For supershift experiments, 1 µl of antiserum (~5 µg of immunoglobulin G protein) was added to
the reaction mixture prior to the addition of labeled probe. For the
experiments with limiting probe, the amount of labeled oligonucleotide
probe was reduced to ~1/30th of that used above. Recombinant Sp1 and
C/EBP
were obtained from Promega Corporation and S. McKnight
(University of Texas Southwestern Medical Center), respectively. The
labeled double-stranded oligonucleotide probes (derived from the 5'
flanking sequence of the C/EBP
gene) included a, b, c, and a-mut
(probe a with a mutated Sp site) and had the following sequences: probe
a,
(
203) AGGAG T CAG TGGGCG T TGCGCCACGATC TC TCTCCA (
168 ) ;
probe b, (
203)AGGAGTCAGTGGGCGTTGCGCCAC(
180); probe
c, (
191)GCGTTGCGCCACGATCTCTC(
172); and probe a-mut,
(
203)AGGAGTCAGTAGATCTTGCGCCACGATCTCTCTCCA(
168) (mutated nucleotides are underlined).
DNaseI footprinting.
Mouse 3T3-L1 preadipocytes were
maintained and differentiated as described above. A 204-bp
SmaI-StyI fragment of the C/EBP
gene
(nucleotides [nt]
348 to
144) was 5' end labeled on the noncoding
strand. Nuclear extracts were prepared by the NUN method (described
above) and desalted by passage through a PD-10 column (Pharmacia)
previously equilibrated with buffer containing Sp1 storage buffer
(Promega). DNaseI footprinting was performed in accordance with a
protocol obtained from Promega (23a).
Gene constructs, mutations, and transfection.
The p468
C/EBP
gene promoter-reporter construct was prepared as previously
described (27). Briefly, a 468-bp segment of the 5' region
of the C/EBP
gene (from nt
343 to +125) containing 343 bp of 5'
flanking sequence and the entire 5' untranslated region was excised
from pC/EBP9.7 (4) with SmaI and NcoI
and inserted into the same sites of the pGL3-BA luciferase expression vector. The Sp site mutant in which the core Sp binding site sequence (GGGCG) was mutated to AGATC (mutated bases are
underlined) was generated by PCR as previously described
(6). The C/EBP site mutant, in which the core C/EBP binding
site sequence (TTGCGC) was mutated to AGATCT, was
generated by PCR as described above. The authenticity of the mutations
was verified by sequencing. The C/EBP
expression vector (pMSV) was
provided by S. McKnight (University of Texas Southwestern Medical
Center). The cDNAs for C/EBP
and Sp1 (provided by D. Nathans, Johns
Hopkins University School of Medicine) were inserted into the pMT2
expression vector. The TK promoter-luciferase construct (pRL-TK) was
from Promega Corp. The obese gene promoter (700 bp of 5'
flanking sequence)-luciferase construct was as previously described
(11).
Transient transfections were performed on proliferating preconfluent
(at 60 to 70% of confluent cell density) 3T3-L1 preadipocytes with 2 µg of the C/EBP
promoter-reporter construct (wild type or mutant)
without or with 2 µg of the C/EBP
or C/EBP
expression vector
and without or with different amounts of the Sp1 expression vector.
Transfections were performed by the calcium phosphate coprecipitation
method (6). After 48 h, at which time the cells had
reached confluence, cell extracts were prepared and assayed for
luciferase activity.
Immunoblotting and alkaline phosphatase treatment.
To follow
changes in the level of Sp1 protein following various treatments 2-day
postconfluent (day 0) 3T3-L1 preadipocytes, cell extracts were
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) followed by immunoblotting. Treatments with various agents
(alone or in combination), including 0.5 mM MIX, 1 µM DEX, 1 µg of
INS/ml, or 100 µM Forskolin alone or in combination, were performed.
At various times thereafter, cell monolayers (6-cm dishes) were washed
once with cold phosphate-buffered saline (pH 7.4) and then scraped into
lysis buffer containing 1% SDS and 60 mM Tris-Cl (pH 6.8). Lysates
were heated at 100°C for 10 min, clarified by centrifugation, and
then subjected to immunoblotting with Sp1 antibody (Santa Cruz). To
ascertain whether Sp1 undergoes phosphorylation or dephosphorylation
when 3T3-L1 preadipocytes are induced to differentiate, cell lysates
from day 0 (undifferentiated) cells or day 8 (fully differentiated) were subjected to alkaline phosphatase treatment. Cell lysates (~200
µg of protein) were incubated for 30 min at 37°C without or with
100 U of calf intestinal alkaline phosphatase (Boehringer Mannheim) in
a final volume of 60 µl, followed by the addition of 100 U of
phosphatase and incubation for another 30 min under the same
conditions. The reaction mixtures were then subjected to immunoblotting
with anti-Sp1 antibody.
 |
RESULTS |
DNaseI footprinting of the C/EBP binding site in the C/EBP
promoter.
Many adipocyte gene promoters possess C/EBP binding
sites that are DNaseI footprinted by nuclear extracts from adipocytes but not by those from preadipocytes (5, 9, 11, 14). This is
consistent with the fact that C/EBP
is expressed by adipocytes but
not preadipocytes and functions as a transactivator of these gene
promoters during the adipocyte differentiation program (7, 23). In contrast, the C/EBP
gene promoter, which also
possesses a functional C/EBP binding site, is footprinted by both
preadipocyte and adipocyte nuclear extracts (Fig.
1 and reference 4).
However, the footprint with preadipocyte nuclear extract (nt
203 to
176) differs from that (nt
198 to
176) with adipocyte nuclear
extract in that it extends ~5 bp further 5' of the C/EBP binding site (Fig. 1). These findings suggested that another nuclear factor present
in preadipocyte nuclear extract might at least in part be responsible
for this footprinting pattern.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequences in the C/EBP gene promoter
protected from DNaseI digestion (footprinted) by nuclear proteins from
3T3-L1 preadipocytes and adipocytes. Nuclear extracts were prepared
from 3T3-L1 cells either maintained in the undifferentiated state
(UNDIFF) as preadipocytes or induced to differentiate into adipocytes
(DIFF). A 204-bp SmaI-StyI fragment (nt 348 to
144) of the C/EBP gene promoter was incubated with increasing
amounts (20 to 80 µg of protein) of nuclear extract and then
subjected to digestion with DNaseI. The footprinted regions are
indicated by vertical hatched boxes indicating the number of
nucleotides from the transcriptional start site (determined by a
sequencing gel run in parallel).
|
|
EMSA with oligonucleotides that contain the overlapping C/EBP and
Sp binding sites present in the C/EBP
promoter.
Unlike the
C/EBP binding sites in other adipocyte gene promoters examined to date,
the C/EBP binding site in the C/EBP
gene promoter possesses an
overlapping Sp consensus sequence near its 5' end (see Fig. 2). The
possibility was considered, therefore, that the unique footprinting
pattern with preadipocyte nuclear extract might be due to Sp1. To
determine whether the factor present in preadipocyte nuclear extract
that footprints the C/EBP binding site is Sp1, a 36-bp oligonucleotide
(with excess oligonucleotide probe a; Fig.
2) encompassing this region was subjected
to an EMSA with preadipocyte and adipocyte nuclear extracts. An array of nuclear protein-oligonucleotide complexes was produced (Fig. 3A, lanes 1 and 2), most of which are due
to members of the C/EBP and Sp families of transcription factors.
Consistent with previous findings (4, 21), a rather diffuse
group of complexes (labeled C/EBP in Fig. 3A), attributable largely to
homo- and heterodimers of the two C/EBP
isoforms (p42 and p30
[20]), is produced with adipocyte, but not
preadipocyte, nuclear extract. This is indicated by the fact that most
of these complexes were supershifted by anti-C/EBP
antibody (lanes 5 and 6). This region of the gel also contains small amounts of C/EBP
heterodimers with the two isoforms (LAP and LIP) of C/EBP
(21). The slowest-moving complex (lanes 1 and 2 in Fig. 3A)
is formed with both preadipocyte and adipocyte nuclear extract and is
due primarily (70 to 80%) to Sp1, as most of this complex is
supershifted by anti-Sp1 antibody (lanes 3 and 4). A smaller fraction
of this complex and all of two other complexes contain Sp3, as judged
by the fact that the equivalent complexes (with a probe containing the
Sp site but lacking the C/EBP binding site) are partially or totally
supershifted, respectively, by antibody against Sp3 (Fig. 3C).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide sequence encompassing the C/EBP and Sp
binding sites in the C/EBP gene promoter. The consensus Sp core
binding site and the consensus C/EBP core sequence for members of the
C/EBP family are indicated. Lines labeled a, b, and c indicate the
lengths of the labeled oligonucleotide probes used in the EMSAs.
|
|



View larger version (164K):
[in this window]
[in a new window]
|
FIG. 3.
EMSA of oligonucleotides corresponding to the Sp and/or
C/EBP binding sites in the C/EBP gene promoter. (A) EMSA of
preadipocyte (P) and adipocyte (A) nuclear extract and
32P-labeled oligonucleotide a (nt 203 to 168; see Fig.
2) encompassing both the Sp and C/EBP binding sites. In lanes 3 and 4, nuclear extracts were supershifted with antibody directed against Sp1
and in lanes 5 and 6 extracts were supershifted with antibody directed
against C/EBP . (B) EMSA of preadipocyte (P) and adipocyte (A)
nuclear extract and 32P-labeled oligonucleotide b (nt 203
to 180, which encompass the Sp core binding site; Fig. 2) or
oligonucleotide c (nt 191 to 172, which encompass the C/EBP binding
site; Fig. 2). In lanes 3 and 4, nuclear extracts were supershifted
with antibody directed against Sp1 and in lanes 7 and 8 the extracts
were supershifted with antibody directed against C/EBP . (C) EMSA of
preadipocyte (P) and adipocyte (A) nuclear extract and
32P-labeled oligonucleotide b (nt 203 to 180, which
encompass the Sp core binding site; Fig. 2). In lanes 3 and 4, nuclear
extracts were supershifted with antibody directed against Sp1, in lanes
5 and 6, extracts were supershifted with antibody directed against Sp3,
and in lanes 7 and 8, extracts were supershi with antibody directed
against both Sp1 and Sp3. In all cases, a 100-fold excess of unlabeled
oligonucleotide probes a, b, and c effectively competed away virtually
all detectable protein-32P-labeled oligonucleotide
complexes on the gels shown above (results not shown).
|
|
To verify these assignments, an EMSA was also performed with
oligonucleotide probes for each of the overlapping Sp and C/EBP
binding
sites in the C/EBP

promoter, i.e., probes b and c (Fig.
2),
respectively. As shown in Fig.
3B (lanes 1 and 2 versus lanes
3 and 4)
most of the major (i.e., lowest-mobility) protein complex
with the Sp
site probe (probe b) was supershifted by anti-Sp1
antibody, the
remainder being supershifted by anti-Sp3 antibody
(Fig.
3C). The
amounts of the Sp1- and Sp3-containing protein
complexes did not differ
significantly in preadipocyte and adipocyte
nuclear extracts. In
contrast, the amount of protein-oligonucleotide
complex formed with the
C/EBP-site probe (probe c) increased dramatically
in terminally
differentiated adipocytes (Fig.
3B; compare lanes
5 and 6), almost all
of which was supershifted with anti-C/EBP
antibody (Fig.
3B; compare
lanes 6 and 8). It can be concluded
that Sp1, and to a lesser extent
Sp3, can account for the binding
observed at the Sp site (nt

203 to

180) which overlaps the 5'
end of the C/EBP binding site in the
C/EBP
promoter.
Sp1 competes with members of the C/EBP family for binding to the
C/EBP
gene promoter.
Since the Sp and C/EBP binding sites in
the C/EBP
gene promoter overlap (Fig. 2), it seemed likely that
binding of Sp1 and members of the C/EBP family would be mutually
exclusive. Experiments in which the level of probe a (containing both
binding sites) was reduced to a limiting concentration were conducted.
Preadipocytes express Sp1 but not C/EBP
, while adipocytes
express both Sp1 (as well as a smaller amount of Sp3) and C/EBP
.
Therefore, the relative amount of Sp-containing protein-oligonucleotide
complex should be lower with adipocyte than with preadipocyte nuclear extract, since the former contains "competitor" C/EBP
. Lowering the concentration of probe a by 30-fold while maintaining the level of
preadipocyte and adipocyte nuclear extract constant markedly reduced
the relative amount of Sp-containing complex (compare lane 1 relative
to lane 2 and lane 3 relative to lane 4 in Fig. 4A). These findings suggested that
C/EBP
competes with Sp1 and possibly Sp3 for binding to probe a and
is dominant in nuclear extracts from the adipocyte.



View larger version (98K):
[in this window]
[in a new window]
|
FIG. 4.
Bindings of C/EBP , C/EBP , and Sp1 at the C/EBP and
Sp sites in the C/EBP gene promoter are mutually exclusive. (A) EMSA
of preadipocyte (P) and adipocyte (A) nuclear extract and differing
amounts (the standard level, 0.25 ng or the "limiting" level, 0.008 ng) of 32P-labeled oligonucleotide a (nt 203 to 168;
see Fig. 2) which encompasses both the Sp and C/EBP binding sites.
Exposure of film for lanes 1 and 2 was 12 h and for lanes 3 and 4 exposure was 96 h. (B) Effect of rC/EBP on the binding of rSp1
to oligonucleotide a. EMSA was conducted with a limiting amount (see
above) of probe a, the amount of rSp1 was held constant (10 ng), and
the amount of C/EBP (8.25 ng per µl) was increased as shown. The
inset shows the autoradiograms for gels, corresponding to the 0, 1, and
10 µl levels of rC/EBP . (C) Effect of rSp1 on the binding of
rC/EBP to oligonucleotide a. EMSA was conducted with a limiting
amount (see above) of probe a, the amount of C/EBP was held constant
(8.25 ng) and the amount of rSp1 (10 ng per µl) was increased as
shown. The inset shows the autoradiograms for gels corresponding to the
0-, 1-, and 10-µl levels of rSp1 added.
|
|
To directly determine whether Sp1 interferes with binding of C/EBP

to the C/EBP

gene promoter, the effect of rC/EBP

on
the binding
of rSp1 to an oligonucleotide containing both the
C/EBP and Sp binding
sites, i.e., probe a, was tested by an EMSA.
The effect of rSp1 on the
binding of rC/EBP

to the same oligonucleotide
was also tested. As
shown in Fig.
4B and C, increasing the concentration
of either
transcription factor caused decreased binding of the
other. Similar
results were obtained with rC/EBP

(results not
shown). (It should be
noted that C/EBP

, -

, and -

all bind to
the C/EBP binding sites
in the 422/aP2 and C/EBP

gene promoters
[
21,
22].)
In other experiments, a 4-base mutation in the
Sp regulatory element of
probe a eliminated its activity as a
competitor and prevented the
formation of a protein-oligonucleotide
complex with Sp1 or Sp3 (see
below). Together, these findings
demonstrate that members of the C/EBP
family and Sp1 compete with
one another for binding to probe
a.
DNaseI footprinting experiments were conducted with recombinant Sp1 to
verify that Sp1 per se binds to the Sp binding site
at the 5' end of
the C/EBP regulatory element in the C/EBP

promoter.
A segment of the
proximal 5' flanking region of the gene containing
the overlapping Sp
and C/EBP binding sites was subjected to DNaseI
footprinting with rSp1
and with rC/EBP

, which served as a representative
of the C/EBP
family. It should be noted that C/EBP

, C/EBP

, and
C/EBP

are
known to bind to C/EBP binding sites and to transactivate
promoters
containing these sites (
7,
23). As illustrated
in Fig.
5A,
the regions footprinted by rSp1 and rC/EBP

overlap.
Moreover, the
regions footprinted by both rSp1 (Fig.
5A) and preadipocyte
nuclear
extract (Fig.
1) are similar in that they both extend
further (and to
the same extent) 5' than the regions footprinted
by adipocyte nuclear
extract (Fig.
1) or rC/EBP

(Fig.
5A),
which
are virtually identical. The footprint of rSp1 does not, however,
extend as far 3' as that of preadipocyte nuclear extract (compare
Fig.
1 with Fig.
5A). This difference in footprinting patterns
could be due
to covalent modification of Sp1 derived from preadipocytes
which alters
its conformation. Alternatively, it could be due
to the interaction of
Sp1 with another nuclear factor present
in preadipocytes, but not
present in the cells from which rSp1
is derived, which extends the
footprint further 3'. Additional
evidence that an Sp family member is
primarily responsible for
the footprinting pattern of preadipocyte
nuclear extract is provided
in Fig.
5B. Thus, preadipocyte nuclear
extract but not adipocyte
nuclear extract (whose footprint is due
primarily to C/EBP

) is
competed away by oligonucleotide b (Fig.
2),
which contains the
Sp binding site. These findings, together with the
results of
the gel shift experiments (Fig.
3 and
4), suggest that Sp1
(or
Sp3) is primarily responsible for the footprinting pattern of
the
C/EBP

promoter and that in the preadipocyte, Sp1 or Sp3 might
interfere with transactivation by members of the C/EBP family.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 5.
DNaseI footprint analysis of the C/EBP proximal
promoter. (A) DNaseI footprint of a segment (nt 348 to 144; cut
with SmaI and StyI) of the 5' flanking region of
the C/EBP gene was subjected to digestion with DNaseI in the
presence of increasing amounts (20 to 80 ng) of rSp1 or rC/EBP . The
footprinted regions are indicated by vertical boxes indicating the
number of nucleotides from the transcriptional start site (determined
by a sequencing gel run in parallel). (B) DNaseI footprint of a segment
(nt 348 to 144) of the 5' flanking region of the C/EBP gene was
subjected to digestion with DNaseI in the presence or absence of
nuclear extract (80 µg of protein) from undifferentiated (UNDIFF) or
differentiated (DIFF) 3T3-L1 cells and increasing amounts of unlabeled
oligonucleotide corresponding to the Sp binding site (nt 203 to
180) in the C/EBP promoter.
|
|
Sp1 blocks transactivation by C/EBP
and C/EBP
of the C/EBP
gene promoter.
To determine whether the competition between Sp1
and C/EBP
in binding to the overlapping Sp and C/EBP sites in the
C/EBP
promoter observed in vitro occurs ex vivo (in preadipocytes), the effect of Sp1 on transactivation of the C/EBP
promoter by C/EBP
or C/EBP
was investigated. A C/EBP
promoter-luciferase reporter gene construct containing the overlapping Sp and C/EBP binding
sites was cotransfected into 3T3-L1 preadipocytes with either a
C/EBP
or C/EBP
expression vector along with increasing levels of
an Sp1 expression vector. In the absence of Sp1, C/EBP
or C/EBP
activated reporter gene expression by 12- to 15-fold (not shown). As
shown in Fig. 6A, increasing levels of a
Sp1 expression vector produced corresponding decreases of reporter gene
expression. At the highest level of Sp1 expression vector, inhibition
was ~95%. To assess the specificity of the inhibitory effect of Sp1, another adipocyte gene promoter, i.e., the obese gene
promoter, which contains a functional C/EBP binding site
(11) but lacks an internal or adjacent Sp binding site, was
tested. Cotransfection of a C/EBP
expression vector along with
increasing levels of the Sp1 expression vector did not inhibit reporter
gene expression. Rather, Sp1 activated reporter gene expression to a
small extent (Fig. 6B). Similarly, Sp1 activated rather than inhibited
reporter gene expression driven by the C/EBP
promoter in which the
Sp site was mutated (see below). A positive control, i.e., a minimal TK
promoter-luciferase construct (pTK-Luc; Promega), containing two
proximal Sp sites, transfected into 3T3-L1 cells, produced "dose-dependent" transactivation by the Sp1 expression vector (2 and 4 µg of the expression vector produced ~3- and ~8-fold increases in reporter gene expression, respectively).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of Sp1 on transactivation by C/EBP or -
mediated by the C/EBP or obese gene promoters. (A) A
C/EBP promoter-luciferase reporter gene construct (2 µg)
containing 343 bp of 5' flanking sequence and 125 bp of 5' untranslated
sequence of the promoter was cotransfected into 3T3-L1 preadipocytes
with a C/EBP or C/EBP expression vector (2 µg) and increasing
amounts of an Sp1 expression vector. After 48 h, luciferase assays
with cell lysates were conducted. (B) An obese gene
promoter-luciferase reporter gene construct (2 µg) containing 700 bp
of 5' flanking sequence of the promoter (containing a C/EBP regulatory
element at nt 55) was cotransfected into 3T3-L1 preadipocytes with a
C/EBP expression vector (2 µg) and increasing amounts of an Sp1
expression vector. After 48 h, luciferase assays with cell lysates
were conducted.
|
|
To verify that "transinhibition" by Sp1 occurs through the Sp site,
which overlaps the C/EBP binding site in the C/EBP

promoter,
this
site was mutated. Initially, the effect of the mutation on
Sp1 binding
was determined by EMSA. As shown in Fig.
7A (lanes
1 and 2 versus lanes 5 and 6),
mutation of the Sp site in probe
a completely eliminated the complexes
produced by preadipocyte
or adipocyte nuclear extract attributable to
Sp1 and Sp3 (Fig.
3A to C). Moreover, excess unlabeled mutant probe
a-mut had no
effect on binding at the Sp site (Fig.
7A; compare lanes 1 and
2 and lanes 3 and 4), but effectively competed away the complexes
attributable to members of the C/EBP family, primarily C/EBP
(compare lanes 1 and 2 and lanes 3 and 4 in Fig.
7A; see also
Fig.
3A
and B). Probe a-mut, which has a mutation in the Sp site,
had no effect
on binding at the C/EBP

site as indicated by the
persistence of the
protein-oligonucleotide complexes ascribed
to C/EBP

(compare lanes 2 and 6, Fig.
7A) and verified by supershifting
with anti-C/EBP

antibody (compare lanes 6 and 8, Fig.
7A).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of mutation of the Sp core element in the
C/EBP gene promoter on binding and inhibition of transactivation by
Sp1. (A) An EMSA was performed with oligonucleotide a and a-mut
(mutated in the Sp binding site; see Materials and Methods) with
preadipocyte (P) or adipocyte (A) nuclear extract. A 100-fold excess of
unlabeled a-mut was added during the binding reaction in lanes 3 and 4. Antibody against C/EBP was used for the supershift experiments
(lanes 7 and 8). (B) C/EBP promoter-luciferase reporter gene
constructs (2 µg) containing 343 bp of 5' flanking sequence and 125 bp of 5' untranslated sequence either mutated in the Sp binding site
( ) or the C/EBP binding site ( ) (see Materials and Methods) were
cotransfected into 3T3-L1 preadipocytes with a C/EBP expression
vector (2 µg) and increasing amounts of an Sp1 expression vector.
After 48 h, luciferase assays with cell lysates were conducted.
(C) C/EBP promoter-reported constructs (wild types or constructs
mutated in the Sp site as in panel B) were cotransfected into 3T3-L1
preadipocytes with an Sp1 expression vector (1 µg) without or with
different amounts of a C/EBP expression vector. After 48 h,
luciferase assays with cell lysates were conducted. (D) Effect of
mutating the C/EBP and Sp binding sites in the C/EBP promoter on
reporter gene expression following induction of differentiation.
Wild-type (wt) promoter-luciferase, C/EBP site-mutated
promoter-luciferase (C/EBP Mut), and Sp site mutated
promoter-luciferase (Sp Mut) constructs were transfected into
D0 postconfluent 3T3-L1 preadipocytes. Twenty-four hours
later, the cells were induced to differentiate by using the standard
protocol, and after an additional 24 h, the cells were lysed and
luciferase assays with the cell lysates were performed.
|
|
Mutation of the same 4 nt in the C/EBP

promoter-reporter gene
construct completely prevented Sp1-mediated inhibition of
transactivation
by C/EBP

(compare Fig.
7B with Fig.
6A). Rather, Sp1
had a small
additive activating effect on transactivation by C/EBP

,
a pattern
similar to that of another adipose-specific promoter (the
obese gene promoter; Fig.
6B) that possesses a C/EBP binding
site but
lacks a Sp binding site. Furthermore, as shown in Fig.
7C, the
magnitude of transactivation of the C/EBP

promoter by C/EBP
was
increased by a factor greater than twofold by mutating the
Sp site in
3T3-L1 preadipocytes, presumably as a result of release
from inhibition
by Sp1 with the mutant construct. Mutation of
the C/EBP binding site in
the promoter markedly decreased transactivation
by members of the C/EBP
family (results not shown). While as might
be expected, Sp1 had no
inhibitory effect as the C/EBPs (with
which Sp1 competes with the
wild-type promoter construct) could
not bind and transactivate, Sp1 did
have an small activating effect
(Fig.
7B).
The effect of the Sp1 and C/EBP site mutations was also assessed during
the early stage of the differentiation program. Thus,
the wild-type
promoter-luciferase, C/EBP site-mutated promoter-luciferase,
and Sp
site-mutated promoter-luciferase constructs were transfected
into
postconfluent (D
0) 3T3-L1 preadipocytes. Twenty-four hours
after transfection, the cells were induced to differentiate and
after
an additional 24 h, cell extracts were prepared and luciferase
assays were performed. It should be noted that it is during this
period
that Sp1 levels and activity decline and C/EBP

and -
increase
(though not yet maximally). As shown in Fig.
7D, reporter
gene activity
was increased approximately twofold 24 h after induction
of
differentiation, and mutation of the C/EBP binding site prevented
this
increase. Consistent with a repressive role for Sp1 during
this time
window, mutation of the Sp site gave rise to an approximately
fivefold
increase in reporter gene activity. These results support
our proposal
that Sp1 prevents transactivation of the C/EBP

promoter
by C/EBP

and/or -

. Taken together, these results indicate that
Sp1 acts as a
competitor with the C/EBPs which interact with the
C/EBP/Sp binding
site in the C/EBP

promoter and suggest that
Sp1 (and possibly Sp3)
contributes to repression of the C/EBP
gene in the preadipocyte
prior to induction of
differentiation.
Effect of differentiation inducers on the phosphorylation, level,
and binding activity of Sp1.
Given that Sp1 can repress the
C/EBP
gene promoter, the question is raised as to whether the level
and/or binding activity of Sp1 changes during the time window of the
differentiation program during which transcription of the C/EBP
gene
is initiated. To address this issue, the cellular level of Sp1 was
monitored by immunoblotting during the course of the differentiation.
Sp1 gives rise to two bands of ~95 and 105 kDa by SDS-PAGE (Fig.
8A). Previous studies (12)
have shown that the doublet pattern of Sp1 on SDS gels is due to
differences in phosphorylation state, the more highly phosphorylated
form exhibiting slower mobility. To verify that the doublet of Sp1
observed in Fig. 8A is due to a difference in phosphorylation state,
cell extracts from day 0 and day 8 3T3-L1 preadipocytes and adipocytes
were subjected to alkaline phosphatase treatment prior to SDS-PAGE. As
shown in Fig. 8B phosphatase treatment caused both doublets to collapse
into the higher-mobility form. This finding indicates that both
phosphorylated and dephosphorylated forms of Sp1 were present.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of adipocyte differentiation inducers on the
level and phosphorylation state of Sp1. (A) Two-day postconfluent
3T3-L1 preadipocytes were induced to differentiate into adipocytes by
using the standard differentiation protocol described in Materials and
Methods. At different times (subscripts indicate to the number of days
following induction of differentiation) after the induction of
differentiation, cell lysates were subjected to SDS-PAGE and then
Western blotted with anti-Sp1 antibody. (B) Cell lysates on day 0 and
Day 8 were subjected to dephosphorylation by alkaline phosphatase
treatment (see Materials and Methods). Following dephosphorylation,
cell lysates were subjected to SDS-PAGE and Western blotting with
anti-Sp1 antibody. (C) Two-day postconfluent 3T3-L1 preadipocytes were
exposed to individual components of the differentiation inducer mixture
either alone or in combination. After 24 h, cell lysates were
analyzed as described for panel A. M, MIX; D, DEX; I, INS. (D) Two-day
postconfluent 3T3-L1 preadipocytes were exposed to MIX, Forskolin, or
MDI for the times indicated, after which cell lysates were analyzed as
described for panel in A.
|
|
Of particular interest is the fact that the level of Sp1 (most notably
the slower migrating and apparently more phosphorylated
form) falls
abruptly, i.e., on days 1 and 2, following exposure
of preadipocytes to
the differentiation inducers (MIX, INS, and
DEX) (Fig.
8A). This
decrease in Sp1 level is reflected in a decrease
in binding activity
(measured by EMSA with a limiting level of
an oligonucleotide, i.e.,
probe a, which contains both the Sp
and C/EBP binding sites found in
the C/EBP

promoter) by nuclear
extracts from preadipocytes following
exposure to the differentiation
inducers (Fig.
9). It is evident (Fig.
9A and C) that
the amount
of the low-mobility protein-oligonucleotide complex (due
primarily
to Sp1; see above) decreases and the complexes containing
C/EBP
and -

followed by C/EBP

increase. The increases in the
complexes
due to members of the C/EBP family correspond well to the
levels
of the C/EBPs assessed by Western blotting (Fig.
9B and C). It
should be noted that during differentiation, the level of Sp3
does not
change significantly (results not shown); hence, the
decrease in the
amount of the low-mobility complex (Fig.
9A and
C) appears to reflect
the fall in the level and/or state of phosphorylation
of Sp1 (Fig.
8A
and D). By day 3, however, Sp1 returns to the
preinduction level (Fig.
8A) while the level of C/EBP

remains
high (
5). It is not
known at present why the return of Sp1
later in the differentiation
program is not accompanied by a decrease
in the expression of C/EBP

.
Conceivably, C/EBP

becomes covalently
modified late in the program,
which increases its binding affinity.
Further studies will be required
to address this issue.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 9.
Changes in Sp1/Sp3 binding activity and expression of
C/EBP , - , and - following induction of differentiation. (A) An
EMSA was performed with a limiting amount (0.004 ng) of an
oligonucleotide (probe a) containing the Sp and C/EBP binding sites in
the proximal C/EBP gene promoter. An EMSA was performed with nuclear
extracts from 3T3-L1 cells at 12, 24, 36, and 48 h after induction
of differentiation. (B) Western blot analyses for C/EBP , - , and
- , and 422/aP2 using the cell lysates as described for panel A. (C)
Changes in the binding activity of Sp1 + Sp3 ( ) and C/EBP
and - ( ) and the expression of C/EBP ( ) at 12, 24, 36, and
48 h after induction of differentiation. Data are from panels A
and B above.
|
|
To determine which of the differentiation inducers causes the changes
in Sp1 level and phosphorylation state, each component
was tested alone
and in combination. As shown in Fig.
8C, MIX
was found to be the
inducer responsible for lowering the level
of Sp1 after exposure for
24 h. MIX is an inhibitor of cAMP phosphodiesterase
and is capable
of increasing the cellular cAMP concentration of
3T3-L1 preadipocytes
(
12a). To determine whether cAMP per se
has an effect on Sp1
level, the effect of Forskolin, a specific
activator of adenyl cyclase
(
25), was compared with the effects
of MIX and the complete
mixture of the differentiation inducers
MIX, DEX, and INS (MDI). As
shown in Fig.
8D, Forskolin, like
MIX and MDI, caused a rapid (within 2 to 4 h) decrease in both
forms of Sp1. It can be concluded that an
increase in cAMP following
exposure of growth-arrested preadipocytes to
the differentiation
inducers, notably MIX, causes the decrease in the
cellular level
of
Sp1.
 |
DISCUSSION |
The proximal promoter of the C/EBP
gene possesses overlapping
Sp and C/EBP binding sites (Fig. 2). Previous studies (4, 20-22) have shown that members of the C/EBP family of
transcription factors bind to and transactivate the C/EBP
promoter
through the C/EBP element. As shown in the present article, the
ubiquitous transcription factor Sp1 binds to the Sp site located at the
5' end of the C/EBP binding site in the promoter (Fig. 2). In vitro binding experiments revealed that binding of Sp1 to the Sp site prevents binding to the C/EBP binding site by members of the C/EBP family, e.g., C/EBP
and C/EBP
(Fig. 4; see also Fig. 9) as well as C/EBP
(results not shown). Competition among members of the Sp
and C/EBP families also occurs ex vivo in the 3T3-L1 adipocytes (Fig.
4A). Thus, transactivation of a C/EBP
promoter-reporter gene by
C/EBP
or C/EBP
was blocked by overexpression of Sp1 (Fig. 6A).
Several lines of evidence show that the effect of Sp1 is mediated
through the Sp site per se, rather than through an indirect effect on
members of the C/EBP family. Thus, mutation of the Sp site prevents
both binding and trans-inhibition by Sp1 (Fig. 7A and B) and
actually increased the response to C/EBP
, presumably by eliminating
competition by Sp1 (Fig. 7C). Since Sp1 is constitutively expressed at
relatively high levels by preadipocytes and binds to the Sp site in the
C/EBP
promoter with high affinity, it seems likely that this site
would be occupied by Sp1 in the preadipocyte before induction of
differentiation. These findings suggest that Sp1 acts as a repressor of
the C/EBP
gene, and thereby of adipocyte differentiation. It should
be noted that in other contexts Sp1 and specific C/EBPs can cooperate
positively to activate transcription of a promoter. For example,
C/EBP
, but not C/EBP
, can act synergistically (in HepG2 cells)
with Sp1 to activate transcription mediated by the CYP2D5 gene
promoter, a promoter that contains both C/EBP and Sp binding sites
(16).
Evidence from several laboratories suggests that several members of the
C/EBP family of transcription factors participate in the adipocyte
differentiation program through a cascade mechanism (2,
30-32). C/EBP
and C/EBP
are expressed early in the
differentiation program preceding the expression of C/EBP
(2,
6a, 32). Moreover, all three of these C/EBPs have the capacity to
bind and to transactivate the C/EBP
gene through a C/EBP binding
site in the proximal promoter (20-22, 32). Therefore, it
would be necessary for Sp1 to vacate the Sp site in the promoter at the appropriate point in the differentiation program. C/EBP
and C/EBP
are expressed within 8 h after the exposure of 3T3-L1
preadipocytes to differentiation inducers and are maximal by 14 to
16 h (Fig. 9). Expression of C/EBP
begins about 36 h after
induction, when the levels of C/EBP
and C/EBP
are at their
maximum (Fig. 9). However, as mentioned above, in the preadipocyte, the
C/EBP binding site is obscured by Sp1 and must be vacated before
C/EBP
and C/EBP
can bind. The present investigation suggests a
mechanism by which the C/EBP binding site (with an Sp site at its 5'
end) may be vacated to allow transcriptional activation of the gene by
C/EBP
and C/EBP
. We found that one of the differentiation inducers, notably MIX (a cAMP phosphodiesterase inhibitor) or Forskolin
(or dibutyryl-cAMP; results not shown), triggers the decrease in the
level of Sp1. This decrease in Sp1 level is accompanied by a decrease
in Sp1 binding capacity as indicated by EMSA (Fig. 9A). Compelling
evidence obtained with other cell systems indicates that cAMP increases
the rate of turnover of Sp1 (8). Importantly, a decrease in
the cellular level of Sp1 would allow C/EBP
and C/EBP
access to
the C/EBP binding site in the C/EBP
gene promoter and thus,
transactivation of the gene.
It is important that C/EBP
not be expressed prematurely, i.e.,
before preadipocytes undergo mitotic clonal expansion, since C/EBP
is antimitotic (28) and would prevent this critical mitosis. A delay in expression of the gene would guarantee that mitosis occurs
before expression of C/EBP
. Considerable indirect evidence indicates
that the "critical mitosis" is required for terminal differentiation (7, 23), presumably because changes in
chromatin structure that accompany DNA replication allow access of
cis-elements to trans-acting factors which
activate (or derepress) transcription of the genes (e.g., the C/EBP
gene) that are necessary for differentiation.
We have shown that, in addition to negative regulation of the C/EBP
gene in the preadipocyte by Sp1, this gene is also controlled through
another repression mechanism (13, 27). Previously, we
identified dual repressive elements in the C/EBP
gene promoter and a
transacting factor (CUP) expressed by preadipocytes but not adipocytes
that binds to these elements (27). CUP was purified from
nuclear extracts of 3T3-L1 preadipocytes. Amino acid sequencing and
mass spectral analysis of the protein showed it to be an isoform of the
transcription factor AP-2
(13). CUP/AP-2
is expressed by preadipocytes and during differentiation its expression decreases concomitantly with the transcriptional activation of the C/EBP
gene.
Consistent with a repressive role of AP-2
/CUP, an AP-2
1 expression vector cotransfected with a C/EBP
promoter-reporter construct into 3T3-L1 adipocytes inhibits reporter gene transcription. Thus, two mechanisms guarantee that expression of the C/EBP
gene is
repressed in the preadipocyte, repressed by Sp1 at the C/EBP binding
site as reported in this article, and repressed by CUP/AP-2
at dual
CUP repressor binding sites in the promoter and 5' untranslated region
of the gene (13, 27).
 |
ACKNOWLEDGMENTS |
This work was supported by a research grant from the National
Institutes of Health (NIDDK).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Chemistry, The Johns Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-3554. Fax:
(410) 955-0903. E-mail: dlane{at}jhmi.edu.
 |
REFERENCES |
| 1.
|
Bernlohr, D. A.,
M. A. Bolanowski,
T. J. Kelly, and M. D. Lane.
1985.
Evidence for an increase in transcription of specific mRNAs during differentiation of 3T3-L1 preadipocytes.
J. Biol. Chem.
260:5563-5567[Abstract/Free Full Text].
|
| 2.
|
Cao, Z.,
R. M. Umek, and S. L. McKnight.
1991.
Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5:1538-1552[Abstract/Free Full Text].
|
| 3.
|
Cheneval, D.,
R. J. Christy,
D. Geiman,
P. Cornelius, and M. D. Lane.
1991.
Cell-free transcription directed by the 422 adipose P2 gene promoter: activation by the CCAAT/enhancer binding protein.
Proc. Natl. Acad. Sci. USA
88:8465-8469[Abstract/Free Full Text].
|
| 4.
|
Christy, R. J.,
K. H. Kaestner,
D. E. Geiman, and M. D. Lane.
1991.
CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes.
Proc. Natl. Acad. Sci. USA
88:2593-2597[Abstract/Free Full Text].
|
| 5.
|
Christy, R. J.,
V. W. Yang,
J. M. Ntambi,
D. E. Geiman,
W. H. Landschulz,
A. D. Friedman,
Y. Nakabeppu,
T. J. Kelly, and M. D. Lane.
1989.
Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAAT/enhancer binding protein interacts with and activates the promoters of two adipocyte-specific genes.
Genes Dev.
3:1323-1335[Abstract/Free Full Text].
|
| 6.
|
Cooke, D. W., and M. D. Lane.
1998.
A sequence element in the GLUT4 gene that mediates repression by insulin.
J. Biol. Chem.
273:6210-6217[Abstract/Free Full Text].
|
| 6a.
| Cornelius, P., and M. D. Lane. Unpublished
results.
|
| 7.
|
Cornelius, P.,
O. A. MacDougald, and M. D. Lane.
1994.
Regulation of adipocyte development.
Annu. Rev. Nutr.
14:99-129[Medline].
|
| 8.
|
Han, I., and J. E. Kudlow.
1997.
Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.
Mol. Cell. Biol.
17:2550-2558[Abstract].
|
| 9.
|
Herrera, R.,
H. S. Ro,
G. S. Robinson,
K. G. Xanthopoulos, and B. M. Spiegelman.
1989.
A direct role for C/EBP and the AP-I binding site in gene expression linked to adipocyte differentiation.
Mol. Cell. Biol.
9:5331-5339[Abstract/Free Full Text].
|
| 10.
|
Hwang, C.-S.,
T. Loftus,
S. Mandrup, and M. Lane.
1997.
Adipocyte differentiation and leptin expression.
Annu. Rev. Cell Biol. Dev.
13:231-259[Medline].
|
| 11.
|
Hwang, C.-S.,
S. Mandrup,
O. M. MacDougald,
D. E. Geiman, and M. D. Lane.
1996.
Transcriptional activation of the mouse obese gene by CCAAT/enhancer binding protein .
Proc. Natl. Acad. Sci. USA
93:873-877[Abstract/Free Full Text].
|
| 12.
|
Jackson, S. P.,
J. J. MacDonald,
S. Lees-Miller, and R. Tjian.
1990.
GC box binding induces phosphorylation of Sp1 by a DNA-dependent protein kinase.
Cell
63:155-165[Medline].
|
| 12a.
| Janicot, M., and M. D. Lane. Unpublished
results.
|
| 13.
|
Jiang, M.-S.,
Q.-Q. Tang,
J. McLenithan,
D. Geiman,
W. Shillinglaw,
W. J. Henzel, and M. D. Lane.
1998.
Derepression of the C/EBP gene during adipogenesis: identification of AP-2 as a repressor.
Proc. Natl. Acad. Sci. USA
95:3467-3471[Abstract/Free Full Text].
|
| 14.
|
Kaestner, K. H.,
R. J. Christy, and M. D. Lane.
1990.
Mouse insulin-responsive glucose transporter gene: characterization of the gene and trans-activation by the CCAAT/enhancer binding protein.
Proc. Natl. Acad. Sci. USA
87:251-255[Abstract/Free Full Text].
|
| 15.
|
Lavery, D. J., and U. Schibler.
1993.
Circadian transcription of the cholesterol 7 hydroxylase gene may involve the liver-enriched bZIP protein DBP.
Genes Dev.
7:1871-1884[Abstract/Free Full Text].
|
| 16.
|
Lee, Y.-H.,
S. C. Williams,
M. Baer,
E. Sternbeck,
F. J. Gonzalez, and P. F. Johnson.
1997.
The ability of C/EBP but not C/EBP to synergize with an Sp1 protein is specified by the leucine zipper and activation domain.
Mol. Cell. Biol.
17:2038-2047[Abstract].
|
| 17.
|
Legraverend, C.,
P. Antonson,
P. Flodby, and K. G. Xanthopoulos.
1993.
High level activity of the mouse CCAAT/enhancer binding protein (C/EBP ) gene promoter involves autoregulation and several ubiquitous transcription factors.
Nucleic Acids Res.
21:1735-1742[Abstract/Free Full Text].
|
| 18.
|
Lin, F.-T., and M. D. Lane.
1992.
Antisense CCAAT/enhancer-binding protein RNA suppresses coordinate gene expression and triglyceride accumulation during differentiation of 3T3-L1 preadipocytes.
Genes Dev.
6:533-544[Abstract/Free Full Text].
|
| 19.
|
Lin, F.-T., and M. D. Lane.
1994.
CCAAT/enhancer binding protein is sufficient to initiate the 3T3-L1 adipocyte differentiation program.
Proc. Natl. Acad. Sci. USA
91:8757-8761[Abstract/Free Full Text].
|
| 20.
|
Lin, F.-T.,
O. A. MacDougald,
A. M. Diehl, and M. D. Lane.
1993.
A 30 kilodalton alternative translation product of the CCAAT/enhancer binding protein message: transcriptional activator lacking antimitotic activity.
Proc. Natl. Acad. Sci. USA
90:9606-9610[Abstract/Free Full Text].
|
| 21.
|
MacDougald, O. A.,
P. Cornelius,
F.-T. Lin,
S. S. Chen, and M. D. Lane.
1994.
Glucocorticoids reciprocally regulate expression of the CCAAT/enhancer-binding protein and genes in 3T3-L1 adipocytes and white adipose tissue.
J. Biol. Chem.
269:19041-19047[Abstract/Free Full Text].
|
| 22.
|
MacDougald, O. A.,
P. Cornelius,
R. Liu, and M. D. Lane.
1995.
Insulin regulates transcription of the CCAAT/enhancer binding protein (C/EBP) , , and genes in fully-differentiated 3T3-L1 adipocytes.
J. Biol. Chem.
270:647-654[Abstract/Free Full Text].
|
| 23.
|
MacDougald, O. A., and M. D. Lane.
1995.
Transcriptional regulation of gene expression during adipocyte differentiation.
Annu. Rev. Biochem.
64:345-373[Medline].
|
| 23a.
|
Promega Corporation.
1997.
Promega Technical Bulletin no. 137.
Promega Corporation, Madison, Wis.
|
| 24.
|
Samuelsson, L.,
K. Stromberg,
K. Vikman,
G. Bjursell, and S. Enerback.
1991.
The CCAAT/enhancer binding protein and its role in adipocyte differentiation: evidence for direct involvement in terminal adipocyte development.
EMBO J.
10:3787-3793[Medline].
|
| 25.
|
Seamon, K. B., and J. W. Daly.
1981.
Forskolin: a unique diterpene activator of cyclic AMP-generating systems.
J. Cyclic Nucleotide Res.
7:201-224[Medline].
|
| 26.
|
Student, A. K.,
R. Y. Hsu, and M. D. Lane.
1980.
Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes.
J. Biol. Chem.
255:4745-4750[Abstract/Free Full Text].
|
| 27.
|
Tang, Q.-Q.,
M.-S. Jiang, and M. D. Lane.
1997.
Repression of transcription mediated by dual elements in the CCAAT/enhancer binding protein gene.
Proc. Natl. Acad. Sci. USA
94:13571-13575[Abstract/Free Full Text].
|
| 28.
|
Umek, R. M.,
A. D. Friedman, and S. L. McKnight.
1991.
CCAAT-enhancer binding protein: a component of a differentiation switch.
Science
251:288-292[Abstract/Free Full Text].
|
| 29.
|
Vasseur-Cognet, M., and M. D. Lane.
1993.
CCAAT/enhancer binding protein (C/EBP ) undifferentiated protein: a developmentally regulated nuclear protein that binds to the C/EBP gene promoter.
Proc. Natl. Acad. Sci. USA
90:7312-7316[Abstract/Free Full Text].
|
| 30.
|
Wu, Z.,
N. L. R. Bucher, and S. R. Farmer.
1996.
Induction of peroxisome proliferator-activated receptor during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBP , C/EBP , and glucocorticoids.
Mol. Cell. Biol.
16:4128-4136[Abstract].
|
| 31.
|
Wu, Z.,
Y. Xie,
N. L. Bucher, and S. R. Farmer.
1995.
Conditional ectopic expression of C/EBP beta in NIH-3T3 cells induces PPAR gamma and stimulates adipogenesis.
Genes Dev.
9:2350-63[Abstract/Free Full Text].
|
| 32.
|
Yeh, W.-C.,
Z. Cao,
M. Classon, and S. L. McKnight.
1995.
Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins.
Genes Dev.
9:168-181[Abstract/Free Full Text].
|
Molecular and Cellular Biology, July 1999, p. 4855-4865, Vol. 19, No. 7
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sue, N., Jack, B. H. A., Eaton, S. A., Pearson, R. C. M., Funnell, A. P. W., Turner, J., Czolij, R., Denyer, G., Bao, S., Molero-Navajas, J. C., Perkins, A., Fujiwara, Y., Orkin, S. H., Bell-Anderson, K., Crossley, M.
(2008). Targeted Disruption of the Basic Kruppel-Like Factor Gene (Klf3) Reveals a Role in Adipogenesis. Mol. Cell. Biol.
28: 3967-3978
[Abstract]
[Full Text]
-
Horie, T., Ono, K., Kinoshita, M., Nishi, H., Nagao, K., Kawamura, T., Abe, Y., Wada, H., Shimatsu, A., Kita, T., Hasegawa, K.
(2008). TG-interacting factor is required for the differentiation of preadipocytes. J. Lipid Res.
49: 1224-1234
[Abstract]
[Full Text]
-
Petersen, R. K., Madsen, L., Pedersen, L. M., Hallenborg, P., Hagland, H., Viste, K., Doskeland, S. O., Kristiansen, K.
(2008). Cyclic AMP (cAMP)-Mediated Stimulation of Adipocyte Differentiation Requires the Synergistic Action of Epac- and cAMP-Dependent Protein Kinase-Dependent Processes. Mol. Cell. Biol.
28: 3804-3816
[Abstract]
[Full Text]
-
Wu, C.-C., Lin, J.-C., Yang, S.-C., Lin, C.-W., Chen, J. J.W., Shih, J.-Y., Hong, T.-M., Yang, P.-C.
(2008). Modulation of the expression of the invasion-suppressor CRMP-1 by cyclooxygenase-2 inhibition via reciprocal regulation of Sp1 and C/EBP{alpha}. Molecular Cancer Therapeutics
7: 1365-1375
[Abstract]
[Full Text]
-
Payne, V. A., Au, W.-S., Gray, S. L., Nora, E. D., Rahman, S. M., Sanders, R., Hadaschik, D., Friedman, J. E., O'Rahilly, S., Rochford, J. J.
(2007). Sequential Regulation of Diacylglycerol Acyltransferase 2 Expression by CAAT/Enhancer-binding Protein beta (C/EBPbeta) and C/EBP{alpha} during Adipogenesis. J. Biol. Chem.
282: 21005-21014
[Abstract]
[Full Text]
-
Li, X., Kim, J. W., Gronborg, M., Urlaub, H., Lane, M. D., Tang, Q.-Q.
(2007). Role of cdk2 in the sequential phosphorylation/activation of C/EBPbeta during adipocyte differentiation. Proc. Natl. Acad. Sci. USA
104: 11597-11602
[Abstract]
[Full Text]
-
Cesena, T. I., Cardinaux, J.-R., Kwok, R., Schwartz, J.
(2007). CCAAT/Enhancer-binding Protein (C/EBP) beta Is Acetylated at Multiple Lysines: ACETYLATION OF C/EBPbeta AT LYSINE 39 MODULATES ITS ABILITY TO ACTIVATE TRANSCRIPTION. J. Biol. Chem.
282: 956-967
[Abstract]
[Full Text]
-
Liu, H., Tang, J. R., Choi, Y. H., Napolitano, M., Hockman, S., Taira, M., Degerman, E., Manganiello, V. C.
(2006). Importance of cAMP-response Element-binding Protein in Regulation of Expression of the Murine Cyclic Nucleotide Phosphodiesterase 3B (Pde3b) Gene in Differentiating 3T3-L1 Preadipocytes. J. Biol. Chem.
281: 21096-21113
[Abstract]
[Full Text]
-
Gustafson, B., Smith, U.
(2006). Cytokines Promote Wnt Signaling and Inflammation and Impair the Normal Differentiation and Lipid Accumulation in 3T3-L1 Preadipocytes. J. Biol. Chem.
281: 9507-9516
[Abstract]
[Full Text]
-
Zuo, Y., Qiang, L., Farmer, S. R.
(2006). Activation of CCAAT/Enhancer-binding Protein (C/EBP) {alpha} Expression by C/EBPbeta during Adipogenesis Requires a Peroxisome Proliferator-activated Receptor-{gamma}-associated Repression of HDAC1 at the C/ebp{alpha} Gene Promoter. J. Biol. Chem.
281: 7960-7967
[Abstract]
[Full Text]
-
Salma, N, Xiao, H, Imbalzano, A N
(2006). Temporal recruitment of CCAAT/enhancer-binding proteins to early and late adipogenic promoters in vivo. J Mol Endocrinol
36: 139-151
[Abstract]
[Full Text]
-
Tang, Q.-Q., Gronborg, M., Huang, H., Kim, J.-W., Otto, T. C., Pandey, A., Lane, M. D.
(2005). Sequential phosphorylation of CCAAT enhancer-binding protein {beta} by MAPK and glycogen synthase kinase 3{beta} is required for adipogenesis. Proc. Natl. Acad. Sci. USA
102: 9766-9771
[Abstract]
[Full Text]
-
Gantt, K., Cherry, J., Tenney, R., Karschner, V., Pekala, P. H.
(2005). An Early Event in Adipogenesis, the Nuclear Selection of the CCAAT Enhancer-binding Protein {beta} (C/EBP{beta}) mRNA by HuR and its Translocation to the Cytosol. J. Biol. Chem.
280: 24768-24774
[Abstract]
[Full Text]
-
Numata, A., Shimoda, K., Kamezaki, K., Haro, T., Kakumitsu, H., Shide, K., Kato, K., Miyamoto, T., Yamashita, Y., Oshima, Y., Nakajima, H., Iwama, A., Aoki, K., Takase, K., Gondo, H., Mano, H., Harada, M.
(2005). Signal Transducers and Activators of Transcription 3 Augments the Transcriptional Activity of CCAAT/Enhancer-binding Protein {alpha} in Granulocyte Colony-stimulating Factor Signaling Pathway. J. Biol. Chem.
280: 12621-12629
[Abstract]
[Full Text]
-
Rochford, J. J., Semple, R. K., Laudes, M., Boyle, K. B., Christodoulides, C., Mulligan, C., Lelliott, C. J., Schinner, S., Hadaschik, D., Mahadevan, M., Sethi, J. K., Vidal-Puig, A., O'Rahilly, S.
(2004). ETO/MTG8 Is an Inhibitor of C/EBP{beta} Activity and a Regulator of Early Adipogenesis. Mol. Cell. Biol.
24: 9863-9872
[Abstract]
[Full Text]
-
Abrams, K. L., Xu, J., Nativelle-Serpentini, C., Dabirshahsahebi, S., Rogers, M. B.
(2004). An Evolutionary and Molecular Analysis of Bmp2 Expression. J. Biol. Chem.
279: 15916-15928
[Abstract]
[Full Text]
-
Giusti, V., Suter, M., Verdumo, C., Gaillard, R. C., Burckhardt, P., Pralong, F. P.
(2004). Molecular Determinants of Human Adipose Tissue: Differences between Visceral and Subcutaneous Compartments in Obese Women. J. Clin. Endocrinol. Metab.
89: 1379-1384
[Abstract]
[Full Text]
-
Zhang, J.-W., Klemm, D. J., Vinson, C., Lane, M. D.
(2004). Role of CREB in Transcriptional Regulation of CCAAT/Enhancer-binding Protein {beta} Gene during Adipogenesis. J. Biol. Chem.
279: 4471-4478
[Abstract]
[Full Text]
-
Zhang, J.-W., Tang, Q.-Q., Vinson, C., Lane, M. D.
(2004). Dominant-negative C/EBP disrupts mitotic clonal expansion and differentiation of 3T3-L1 preadipocytes. Proc. Natl. Acad. Sci. USA
101: 43-47
[Abstract]
[Full Text]
-
Wu, F. Y., Wang, S. E., Tang, Q.-Q., Fujimuro, M., Chiou, C.-J., Zheng, Q., Chen, H., Hayward, S. D., Lane, M. D., Hayward, G. S.
(2003). Cell Cycle Arrest by Kaposi's Sarcoma-Associated Herpesvirus Replication-Associated Protein Is Mediated at both the Transcriptional and Posttranslational Levels by Binding to CCAAT/Enhancer-Binding Protein {alpha} and p21CIP-1. J. Virol.
77: 8893-8914
[Abstract]
[Full Text]
-
Zhang, J., Wang, S., Wesley, R. A., Danner, R. L.
(2003). Adjacent Sequence Controls the Response Polarity of Nitric Oxide-sensitive Sp Factor Binding Sites. J. Biol. Chem.
278: 29192-29200
[Abstract]
[Full Text]
-
Tang, Q.-Q., Otto, T. C., Lane, M. D.
(2003). CCAAT/enhancer-binding protein beta is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. USA
100: 850-855
[Abstract]
[Full Text]
-
Shi, Y., Taylor, S. I., Tan, S.-L., Sonenberg, N.
(2003). When Translation Meets Metabolism: Multiple Links to Diabetes. Endocr. Rev.
24: 91-101
[Abstract]
[Full Text]
-
Cabrero, A., Merlos, M., Laguna, J. C., Carrera, M. V.
(2003). Down-regulation of acyl-CoA oxidase gene expression and increased NF-{kappa}B activity in etomoxir-induced cardiac hypertrophy. J. Lipid Res.
44: 388-398
[Abstract]
[Full Text]
-
Tang, Q.-Q., Otto, T. C., Lane, M. D.
(2003). Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. USA
100: 44-49
[Abstract]
[Full Text]
-
Prusty, D., Park, B.-H., Davis, K. E., Farmer, S. R.
(2002). Activation of MEK/ERK Signaling Promotes Adipogenesis by Enhancing Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) and C/EBPalpha Gene Expression during the Differentiation of 3T3-L1 Preadipocytes. J. Biol. Chem.
277: 46226-46232
[Abstract]
[Full Text]
-
Keembiyehetty, C. N., Candelaria, R. P., Majumdar, G., Raghow, R., Martinez-Hernandez, A., Solomon, S. S.
(2002). Paradoxical Regulation of Sp1 Transcription Factor by Glucagon. Endocrinology
143: 1512-1520
[Abstract]
[Full Text]
-
Zhang, P., Klenk, E. S., Lazzaro, M. A., Williams, L. B., Considine, R. V.
(2002). Hexosamines Regulate Leptin Production in 3T3-L1 Adipocytes through Transcriptional Mechanisms. Endocrinology
143: 99-106
[Abstract]
[Full Text]
-
Kockar, F. T., Foka, P., Hughes, T. R., Kousteni, S., Ramji, D. P.
(2001). Analysis of the Xenopus laevis CCAAT-enhancer binding protein {{alpha}} gene promoter demonstrates species-specific differences in the mechanisms for both auto-activation and regulation by Sp1. Nucleic Acids Res
29: 362-372
[Abstract]
[Full Text]
-
Morrison, R. F., Farmer, S. R.
(2000). Hormonal Signaling and Transcriptional Control of Adipocyte Differentiation. J. Nutr.
130
: 3116S-3121S
[Abstract]
[Full Text]
-
Rosen, E. D., Walkey, C. J., Puigserver, P., Spiegelman, B. M.
(2000). Transcriptional regulation of adipogenesis. Genes Dev.
14: 1293-1307
[Full Text]
-
Choy, L., Skillington, J., Derynck, R.
(2000). Roles of Autocrine TGF-{beta} Receptor and Smad Signaling in Adipocyte Differentiation. JCB
149: 667-682
[Abstract]
[Full Text]
-
Tang, Q.-Q., Lane, M. D.
(1999). Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev.
13: 2231-2241
[Abstract]
[Full Text]
-
Welm, A. L., Mackey, S. L., Timchenko, L. T., Darlington, G. J., Timchenko, N. A.
(2000). Translational Induction of Liver-enriched Transcriptional Inhibitory Protein during Acute Phase Response Leads to Repression of CCAAT/Enhancer Binding Protein alpha mRNA. J. Biol. Chem.
275: 27406-27413
[Abstract]
[Full Text]
-
Harrington, R. H., Sharma, A.
(2001). Transcription Factors Recognizing Overlapping C1-A2 Binding Sites Positively Regulate Insulin Gene Expression. J. Biol. Chem.
276: 104-113
[Abstract]
[Full Text]
-
Laniel, M.-A., Poirier, G. G., Guerin, S. L.
(2001). Nuclear Factor 1 Interferes with Sp1 Binding through a Composite Element on the Rat Poly(ADP-ribose) Polymerase Promoter to Modulate Its Activity in Vitro. J. Biol. Chem.
276: 20766-20773
[Abstract]
[Full Text]
-
Hamm, J. K., Park, B. H., Farmer, S. R.
(2001). A Role for C/EBPbeta in Regulating Peroxisome Proliferator-activated Receptor gamma Activity during Adipogenesis in 3T3-L1 Preadipocytes. J. Biol. Chem.
276: 18464-18471
[Abstract]
[Full Text]
-
Tang, Q.-Q., Lane, M. D.
(2000). Role of C/EBP homologous protein (CHOP-10) in the programmed activation of CCAAT/enhancer-binding protein-beta during adipogenesis. Proc. Natl. Acad. Sci. USA
97: 12446-12450
[Abstract]
[Full Text]
-
Jiang, M.-S., Lane, M. D.
(2000). Sequential repression and activation of the CCAAT enhancer-binding protein-alpha (C/EBPalpha ) gene during adipogenesis. Proc. Natl. Acad. Sci. USA
97: 12519-12523
[Abstract]
[Full Text]