Previous Article | Next Article 
Molecular and Cellular Biology, July 1999, p. 4918-4926, Vol. 19, No. 7
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Homeoproteins CDP and SATB1 Interact: Potential for
Tissue-Specific Regulation
Jinqi
Liu,1
Anna
Barnett,1,
Ellis J.
Neufeld,2 and
Jaquelin
P.
Dudley1,*
Department of Microbiology and Institute for
Cellular and Molecular Biology, The University of Texas at Austin,
Austin, Texas 78712,1 and Division of
Hematology/Oncology, Children's Hospital, and Dana Farber Cancer
Institute, Department of Pediatrics, Harvard Medical School, Boston,
Massachusetts 021152
Received 11 November 1998/Returned for modification 9 February
1999/Accepted 29 March 1999
 |
ABSTRACT |
Homeoproteins are known to participate in development and cell type
specification. The homeoproteins CCAAT displacement protein (CDP) and
special AT-rich sequence binding protein 1 (SATB1) have been shown to
bind to nuclear matrix-associated regions and to act as repressors of
many cellular genes. Moreover, binding of SATB1 to the mouse mammary
tumor virus (MMTV) promoter region dramatically affects the
tissue-specific transcription of this retrovirus. Because
protein-protein interactions are a common means of regulating
homeoprotein function, we tested whether SATB1 and CDP interact in vivo
and in vitro. SATB1 interacted with CDP through its DNA-binding domain,
as demonstrated by glutathione S-transferase (GST)
pull-down assays. GST pull-down assays also showed that CDP associated
with SATB1 through three of its four DNA-binding domains (CR1, CR2, and
the homeodomain). SATB1-specific antisera, but not preimmune sera,
precipitated CDP from nuclear extracts, and CDP-specific antisera
precipitated SATB1 from the same extracts. Far-Western blotting
detected interaction of SATB1 and CDP in several different tissue
extracts. Association of purified SATB1 and CDP in vitro resulted in
the inability of each protein to bind to DNA in gel retardation assays.
CDP overexpression in cultured T cells led to a loss of detectable
SATB1 binding to the MMTV promoter region, as measured by gel shift
experiments. CDP overexpression also elevated MMTV long terminal repeat
reporter gene activity in transient-transfection assays, a result
consistent with neutralization of the SATB1 repressor function in T
cells. SATB1 is very abundant in certain tissues, particularly thymus, whereas CDP is relatively ubiquitous, except in certain terminally differentiated cell types. Because of the tissue and cell type distribution of SATB1 and CDP, we propose that the SATB1-to-CDP ratio
in different tissues is a novel mechanism for homeoproteins to control
gene expression and differentiation in mammals.
 |
INTRODUCTION |
The tissue-specific regulation of
transcription is critical to the development and function of all higher
eukaryotic organisms. Tissue-specific transcription is controlled by
the presence of factors, such as MyoD and NF-
B (29, 55),
that bind DNA to activate or suppress the expression of a subset of
genes in particular cell types. Because eukaryotic viruses contain
relatively few genes, these viruses must rely heavily on processes
operative in the cells they infect. Thus, viruses have offered numerous insights into cellular mechanisms that control transcription.
Members of our group previously have shown that negative regulation is
an important component of the tissue-specific expression of mouse
mammary tumor virus (MMTV), a retrovirus that is transmitted through
the milk of infected mothers to offspring (9, 32). Milk-borne MMTV must replicate in gut-associated B and T cells prior to
transmission to target cells in the mammary gland (6, 9, 17, 22,
48). High-level transcription and replication of MMTV in mammary
tissue result in overexpression of cellular oncogenes near viral
integration sites (42, 44). MMTV variants that cause
leukemia, rather than mammary cancer, are expressed at much higher
levels in T cells than are mammotropic MMTVs (9, 22, 48).
Loss of transcriptional suppression by leukemogenic MMTV variants is
due to deletion of negative regulatory elements (NREs), including a
matrix-associated region (MAR) within the promoter-proximal NRE in the
MMTV long terminal repeat (LTR) (22) (Fig.
1A). The protein complexes that bind to
this MMTV MAR include NRE-binding protein (NBP) and upper binding
protein (UBP) (9). The NBP and UBP complexes recently were
shown to contain the homeodomain proteins special AT-rich sequence
binding protein 1 (SATB1) and CCAAT displacement protein (CDP),
respectively (5, 12, 13, 41). Mutation of the
promoter-proximal SATB1 binding site dramatically increased MMTV LTR
reporter gene expression in lymphoid tissues of transgenic mice and
destabilized the binding of SATB1 to the MMTV LTR in vitro
(32).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
(A) The MMTV LTR, divided into U3, R, and U5 regions.
The U3 region contains the transcription regulatory signals for the
standard MMTV promoter that allows RNA initiation at the U3-R border.
The approximate positions of the promoter-proximal (pNRE) and
promoter-distal (dNRE) negative elements, as determined by reporter
gene expression in transient-transfection assays, are shown. The probes
used in this study include a 120-bp fragment that spans the pNRE and an
oligonucleotide probe that includes an inverted repeat at the 3' end of
the 120-bp probe (see Materials and Methods). (B) Domain structures of
SATB1 and CDP. The cut domains CR1, CR2, and CR3 and the homeodomain
(HD) in CDP all can bind DNA independently, whereas the coiled-coil
(CC) domain cannot (2, 18). An internal MAR domain,
including the CR domains, contains the DNA-binding domain of SATB1
(40). Numbers indicate amino acid positions. CDP (the human
protein) is known in other species as Cut (Drosophila), Clox
(dogs), and Cux (mice) (1, 8, 53). In this paper, we use CDP
to refer to proteins from all species.
|
|
In addition to their role in MMTV transcriptional regulation, SATB1 and
CDP appear to control expression of many cellular genes. Binding sites
for SATB1 and CDP are found in the MARs associated with the promoters
or enhancers of at least two other genes, those coding for CD8
and
immunoglobulin heavy chain, that show tissue-specific expression in T-
or B-lymphoid cells (4, 54a). Binding of SATB1 and CDP to
regulatory elements has been associated with transcriptional repression
of numerous genes expressed in differentiated cells (4, 15, 21,
24, 32, 52, 53). Therefore, SATB1-mediated suppression of RNA
synthesis from the MMTV LTR appears to be a good model for studies of
transcriptional repression in differentiated tissues.
SATB1 is expressed predominantly in thymus but also in brain and
several other organs (12, 13, 32). CDP expression is ubiquitous except in terminally differentiated cell types (5, 32,
41). MMTV transcription is highest in lactating mammary gland, a
tissue that lacks SATB1 and CDP NRE-binding activity, whereas MMTV
expression is diminished or undetectable in other tissues (32,
48). SATB1 and CDP are homeoproteins, and homeoprotein interaction with other proteins affects cell fate determination in
Drosophila and mammals (45, 47, 57, 58).
Therefore, we hypothesized that SATB1 could associate with CDP and that
this association might affect the ability of these proteins to act as
transcriptional suppressors. In this paper, we show that SATB1 and CDP
interact and that this interaction eliminates the DNA-binding ability
of both proteins.
 |
MATERIALS AND METHODS |
Cell culture and transient transfections.
The growth of
Jurkat human T cells, LBB.A mouse B cells, and CCL-64 mink lung cells
has been described previously (9, 32). Cells were passaged
the day prior to transfection to achieve 95% confluence on the
following day. SV40-CDP plasmid or plasmid lacking CDP sequences (pMT2)
(30 µg) (30) and 5 µg of pBAG (46) were transfected transiently into Jurkat T cells. Cells were transfected with an electroporator (BTX, San Diego, Calif.) at 1,700 µF and 126 V
in a 0.2-cm cuvette at a concentration of 2 × 106
cells/200 µl in RPMI medium containing 10% fetal bovine serum. Each
electroporation was placed into a 100-mm-diameter tissue culture dish
and incubated for 48 h prior to preparation of nuclear extracts
for Western blotting and gel shift experiments. In a second set of
experiments, very similar conditions were used, except the plasmid
amounts were different, as follows: 15 µg of SV40-CDP or pMT2 vector,
20 µg of an MMTV LTR luciferase plasmid (pLC-LUC) (9), and
5 µg of pBAG. Transfections were normalized for DNA uptake by
monitoring the
-galactosidase activity of the pBAG reporter plasmid
(46) as previously described (9). A portion of
the transfected cells was frozen and thawed three times, and the cell
debris was removed by centrifugation at 10,000 × g for
10 min at 4°C.
Transfections also were performed in Jurkat cells by using SuperFect
(Qiagen, Inc., Valencia, Calif.) according to the manufacturer's
instructions. Samples included 0.1 µg of pRL-TK (Promega Corporation,
Madison, Wis.), 1 µg of pLC-LUC, and either 0.5 or 1 µg of
SV40-CDP.
All transfections were adjusted to a total of 2 µg of DNA
with
pMT2 control vector. Transfected cells were incubated for 48 h
at 37°C and assayed for sea pansy (
Renilla reniformis)
luciferase
and firefly luciferase by using a Dual Luciferase Reporter
Assay
System (Promega). Firefly luciferase activity from the MMTV LTR
(pLC-LUC) was normalized for DNA uptake by using
Renilla
luciferase
activity.
Nuclear extract preparation and gel shift assays.
Cell line
and tissue nuclear extracts were prepared according to the method of
Dignam et al. (14) with modifications as described by Liu et
al. (32). The 120-bp proximal NRE probe from the C3H MMTV
LTR (position +813 to +930 on the C3Hvx sequence of Brandt-Carlson et
al. [10]) was obtained by PCR and cloned into pCRII
(Invitrogen, San Diego, Calif.) as described by Liu et al.
(32). The plasmid was digested with EcoRI,
purified on polyacrylamide gels as described by Maxam and Gilbert
(35), and end labeled with Sequenase (Amersham, Arlington
Heights, Ill.). The 22-bp proximal NRE probe was made by the annealing
of two oligonucleotides, 5' gggGACTAATAGAACATTATTC 3' and
5' cccGAATAATGTTCTATTAGTC 3', spanning the imperfect
inverted repeat at the 3' end of the 120-bp LTR sequence, followed by
end labeling with Sequenase. Nucleotides in lowercase letters were
added to facilitate labeling. The NF-
B probe was prepared by
annealing the oligonucleotides 5' AATTCAGGGGAATTCCCCTAAGCTTGAGCT
3' and 5' CAAGCTTAGGGGAATTCCCCTG 3'. Gel shift assays
were performed essentially as described by Bramblett et al.
(9) and modified by Liu et al. (32). Anti-SATB1 and anti-CDP polyclonal sera against recombinant proteins were prepared
in rabbits as described previously (32). Antibody ablation assays were performed as described for gel shift assays, except that
antibody (2 µl of 10-fold-diluted antiserum) was added to the
reaction mixtures and incubated on ice for 10 min before addition of
labeled probe.
Plasmid constructions.
Various glutathione
S-transferase (GST) fusions of CDP have been described
previously (2). Deletions of the full-length SATB1 cDNA in
the pmAT vector (40) were constructed by digestion with
Bal31 nuclease for various periods of time following
linearization with HindIII. After repair of ends and
digestion with MluI, appropriate DNA fragments were purified
and truncated SATB1 cDNAs were substituted into the full-length pmAT
vector that had been digested with MluI and
EcoRV. The internal DNA-binding domain of SATB1 was removed by digestion with BspEI and MluI; the ends were
repaired and ligated, yielding an in-frame deletion of 291 bp.
Sequences corresponding to both C-terminal and internal SATB1 deletions
in pmAT were digested with AvaI and HindIII,
treated with Klenow enzyme, and ligated with pGEX-2T (Pharmacia,
Uppsala, Sweden) that had been digested with EcoRI and
treated with Klenow enzyme. All constructs were confirmed by sequencing.
Preparation of recombinant proteins.
Recombinant proteins
were cleaved with thrombin (26) and purified according to
standard methods (51). Briefly, bacterial cultures were
induced with 0.2 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) for 4 h
followed by pelleting and resuspension of cells in lysis buffer (1×
phosphate-buffered saline [137 mM NaCl, 2 mM KCl, 8 mM
Na2HPO4, and 1.7 mM KH2PO4], 1% Triton X-100,
100 mM EDTA, 10 mM dithiothreitol [DTT], 1 mM phenylmethylsulfonyl
fluoride [PMSF], 0.32 µg of pepstatin A per ml, 10 µg of
leupeptin per ml, and 2 µg of aprotinin per ml). Cells were lysed
with an ultrasonic processor (model 501; PGC Scientific, Gaithersburg,
Md.). The lysed cell suspension was centrifuged at 10,000 rpm for 5 min at 4°C in a Sorvall SS-34 rotor to remove insoluble material. The
supernatant was mixed with a 50% slurry of glutathione-agarose beads
(1 ml) (Sigma Chemical Co., St. Louis, Mo.), and the mixture was
incubated at room temperature for 15 min on a rotating wheel. The
suspension was centrifuged at 1,800 rpm (600 × g) in
an IEC Centra-7R rotor for 1 min at 4°C. The beads were washed twice with wash buffer (1× phosphate-buffered saline, 1% Triton X-100, 10 mM DTT, 1 mM PMSF, 0.32 µg of pepstatin A per ml, 10 µg of leupeptin per ml, and 2 µg of aprotinin per ml), followed by one wash
with cleavage buffer I (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 10 mM
DTT, 1 mM PMSF, 0.32 µg of pepstatin A per ml, 10 µg of leupeptin
per ml, and 2 µg of aprotinin per ml). Cleavage buffer II (50 mM
Tris-HCl [pH 8.0], 150 mM NaCl, and 2.5 mM CaCl2) (1 ml)
was used to resuspend the beads. Beads were collected by centrifugation at 10,000 rpm for 20 s (Fisher microcentrifuge) and then
resuspended in 0.8 ml of cleavage buffer II. Thrombin (Sigma) (20 U)
was added to the slurry, which was then incubated at room temperature
for 1 h. The beads were collected by centrifugation at 10,000 rpm for 20 s and washed with cleavage buffer I (1 ml). An aliquot of
the supernatant containing the purified protein was analyzed on a
sodium dodecyl sulfate (SDS)-10% polyacrylamide gel.
Affinity chromatography.
GST pull-down assays were performed
essentially according to the method of Melcher and Johnston
(36), with modifications. Briefly, the GST fusion protein
was bound to glutathione-agarose beads (Sigma), and the bead-bound
protein then was used to test for binding to in vitro-translated SATB1
or CDP. 35S-labeled proteins were prepared with a
TNT-coupled in vitro transcription-translation system (Promega). Resin
(20 µl) bearing equal amounts of either GST or the fusion proteins
(ca. 5 µg) was incubated with 10 µl of labeled proteins in 300 µl
of buffer D (14) containing 5 µg of bovine serum albumin
for 2 h at 4°C on a rotating wheel. The resin was washed thrice
in 1 ml of buffer D containing 0.5% Nonidet P-40 and then resuspended
in SDS-polyacrylamide gel electrophoresis buffer (32).
Samples were boiled for 5 min and then centrifuged at 10,000 × g for 30 s to remove the resin, and the supernatant was
analyzed on SDS-10% polyacrylamide gels prior to autoradiography.
Immunoprecipitations and far-Western analysis.
Immunoprecipitation conditions were described previously
(32). Immunoprecipitations also were performed in the
presence of ethidium bromide as described by Lai and Herr
(25). Far-Western blotting was performed essentially as
described by Oliner et al. (43), with modifications.
Briefly, proteins were separated on SDS-8% polyacrylamide gels,
transferred to nitrocellulose membranes, and incubated for 1 h at
room temperature in buffer D containing 5% nonfat dry milk. The blot
then was incubated with 35S-labeled in vitro-translated
protein in buffer D for 2 h at room temperature. The blot was
washed thrice with 40 ml of buffer D containing 1% Nonidet P-40 for 30 min prior to autoradiography.
 |
RESULTS |
SATB1 and CDP homeoprotein interaction in GST pull-down
experiments.
To test for SATB1-CDP association, a GST-CDP fusion
protein containing the C-terminal 100 kDa of CDP [also called CDP
(CR2-Cterm)] (30) (Fig. 1B) was bound to a column
containing glutathione beads and then incubated with
[35S]methionine-labeled SATB1 obtained by in vitro
translation (36). Although translation yielded some
truncated SATB1 proteins (Fig. 2A, lane
1), the full-length protein showed the
highest level of GST-CDP binding (Fig. 2A, lane 2) and little binding
to GST alone (Fig. 2A, lanes 15 and 16). Thus, the C-terminal
two-thirds of CDP appears to be capable of specific SATB1 association,
and it contains the cut domains (cut repeat 2 [CR2] and CR3) and the homeodomain that have been shown to bind DNA independently (2, 18). Subsequently, C-terminally truncated forms of SATB1 were translated in vitro for GST-CDP binding studies (Fig. 2A, lanes 3 to
12). SATB1-CDP association diminished with SATB1 mutants that lacked
the cut domains and the homeodomain (Fig. 2A, lanes 7 to 12).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
SATB1 and CDP interaction in vitro. (A) Mapping of the
SATB1 region necessary for CDP association. GST-CDP (CR2-Cterm) was
immobilized on glutathione-agarose beads and incubated with
35S-labeled in vitro-translated full-length SATB1 (lanes 1 and 2), SATB1 mutants with C-terminal truncations (lanes 3 to 12), an
internal-deletion mutant (lanes 13 and 14), or GST alone (lanes 15 and
16). After affinity chromatography, bound proteins were resolved on
SDS-10% polyacrylamide gels (even-numbered lanes) and compared with
input labeled protein (odd-numbered lanes). (B) Lack of DNA binding of
internally deleted SATB1. Wild-type SATB1 and an internal-deletion
mutant were purified and used for gel shift assays with a labeled
120-bp proximal NRE probe prior to electrophoresis on a 4%
nondenaturing polyacrylamide gel. The 120-bp NRE probe contains two
binding sites for CDP and two binding sites for SATB1 (59).
Numbers indicate amino acid positions.
|
|
An internal-deletion mutant of SATB1 was used to determine whether a
SATB1 DNA-binding domain was essential for the interaction
with CDP
(Fig.
2A, lanes 13 and 14). No CDP interaction was detected
with the
internal-deletion mutant, suggesting that the amino acids
between
positions 298 and 394 are essential for SATB1-CDP association.
Similar
to results previously reported for SATB1 binding to the
MAR of the
immunoglobulin intronic enhancer (
40), this
internal-deletion
mutant does not bind to DNA from the MMTV proximal
NRE (Fig.
2B).
SATB1 mutants with C-terminal truncations up to position
479 bound
strongly to the MMTV NRE, but mutants with more N-terminal
truncations
did not (data not shown). These data suggest that the SATB1
DNA-binding
domain is responsible for association with
CDP.
To determine the region of CDP necessary for association with SATB1,
various truncated forms of CDP fused to GST were bound
to glutathione
beads and incubated with radiolabeled SATB1 (Fig.
3). These experiments
showed that SATB1 bound to CR1, CR2, and
the homeodomain (Fig.
3, lanes
3, 4, and 6), but not to CR3 (lane
5).
The N-terminal region containing the coiled-coil domain (lane
8) and a
spacer region between CR1 and CR2 (lane 11) bound poorly
to labeled
SATB1. As expected, SATB1 bound to a CDP fusion protein
containing both
CR3 and the homeodomain (Fig.
3, lane 7). In vitro-translated
luciferase did not bind to GST-CDP (Fig.
3, lane 13). With the
exception of CR3, it appears that each of the CDP DNA-binding
domains
is sufficient for binding to full-length SATB1. Together,
these
experiments indicate that CDP and SATB1 interact in vitro
via their
DNA-binding domains in the absence of DNA.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of different CDP domains to SATB1. GST-CDP
(CR2-Cterm), GST-CR1, GST-CR2, GST-CR3, GST-HD, GST-CR3 plus HD,
GST-coiled-coil (GST-CC), or GST only (11) (lanes 2 to 9)
were incubated with in vitro-translated labeled SATB1 (lane 1), as
described for Fig. 2A. As controls, labeled in vitro-translated CDP
containing the spacer region between CR1 and CR2 (lanes 10 and 11) or
firefly luciferase (lanes 12 and 13) also was incubated with a
GST-full-length SATB1 fusion (lane 11) or a GST-CDP (CR2-Cterm) fusion
(lane 13). Lanes 1, 10, and 12 show the input radioactively labeled
protein.
|
|
Detection of SATB1-CDP association by immunoprecipitation and
far-Western analysis.
We also determined whether SATB1 and CDP
were capable of association in vivo. Members of our group previously
showed that Jurkat T cells have high levels of SATB1 and moderate
levels of CDP (32). By using preimmune serum (Fig. 4A, lane
1) or polyclonal antibody directed
against CDP (lane 2), whole-cell extracts of Jurkat cells were
immunoprecipitated, and the immunoprecipitates were subjected to
denaturing polyacrylamide electrophoresis and Western blotting. After
incubation of blots with anti-SATB1, a 100-kDa band (consistent with
the molecular weight of SATB1) was detected by Western analysis in
immunoprecipitates with anti-CDP serum but not preimmune serum (Fig.
4A, lanes 1 and 2). Reciprocally, immunoprecipitates with anti-SATB1
serum but not preimmune serum contained a 180-kDa protein that could be
detected with anti-CDP serum (Fig. 4B, lane 2). In addition, we
performed this experiment in the presence of 200 or 400 µg of
ethidium bromide per ml to eliminate the possibility that the CDP-SATB1
interaction was the result of contaminating DNA. As expected, the
presence of ethidium bromide did not abolish the association of CDP
with SATB1 (data not shown). Immunoprecipitation results also are not
due to cross-reactivity of the antisera, since anti-SATB1 serum
specifically abolished SATB1-DNA complexes and anti-CDP serum
specifically abolished CDP-DNA complexes in gel shift assays (Fig. 4C,
lanes 3 and 4).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 4.
SATB1 and CDP interact in vivo. (A)
Coimmunoprecipitation of SATB1 with CDP-specific antibody. Jurkat
T-cell lysate was incubated with an insoluble Staphylococcus
aureus suspension to eliminate nonspecific binding prior to being
immunoprecipitated with preimmune (lane 1) or anti-CDP (lane 2) serum.
Immunoprecipitates were resolved on an SDS-8% polyacrylamide gel,
transferred to nitrocellulose, and incubated with SATB1-specific serum,
followed by development as suggested by the instructions with the
Amersham ECL kit. (B) Coimmunoprecipitation of CDP with SATB1-specific
antibody. Western blotting was performed as described for panel A,
except that immunoprecipitations were performed with preimmune (lane 1)
or anti-SATB1 (lane 2) serum prior to incubation of nitrocellulose
transfers with anti-CDP. (C) Specificity of anti-SATB1 and anti-CDP
sera. Mink lung cell nuclear extracts were incubated with no serum
(lane 1), preimmune serum (lane 2), anti-SATB1 serum (lane 3), or
anti-CDP serum (lane 4), followed by a gel shift assay with the 120-bp
MMTV promoter-proximal NRE probe (32) (Fig. 1A). Reactions
were analyzed on a 4% nondenaturing polyacrylamide gel. The detection
of both SATB1 and CDP DNA-binding activities in mink lung extracts may
indicate that certain modified forms of these proteins do not
interact.
|
|
Further evidence for the association of SATB1 and CDP was obtained by
far-Western analysis (
43). Crude nuclear extracts
from mouse
thymus and mink lung cells previously were shown to
have both CDP and
SATB1 (
32); extracted proteins were separated
by
SDS-polyacrylamide gel electrophoresis, blotted onto nitrocellulose
membranes, and incubated with radiolabeled CDP. Labeled CDP bound
to a
100-kDa protein in both mouse and mink cell nuclear extracts
(Fig.
5,
lanes 2, 3, and 5); CDP binding could be
competed by
a molar excess of unlabeled purified SATB1 (lane 4) and was
dependent
upon the presence of labeled CDP in the reaction (compare
lanes
5 and 6). Together, these experiments indicated that CDP and
SATB1
from different mammalian species form a complex in vivo and in
vitro.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 5.
Far-Western blotting to detect SATB1-CDP association.
Crude nuclear lysates from murine thymus (lanes 1 and 2) and mink lung
cells (lanes 3 to 6) were prepared as described previously
(32), resolved on SDS-8% polyacrylamide gels, and stained
with Coomassie brilliant blue (lane 1) or electrotransferred to
nitrocellulose (lanes 2 to 6). 35S-labeled in
vitro-translated CDP was incubated in the absence of competitor protein
(lanes 2, 3, and 5) or in the presence of purified recombinant SATB1
(lane 4). Mink lung cell proteins on the membrane also were incubated
with an in vitro translation reaction mixture containing
[35S]methionine, but no DNA template (lane 6). Lanes 1 to
4 are derived from a single gel; lanes 5 and 6 are from a second gel.
The arrows show the positions of SATB1 protein detected by interaction
with labeled CDP.
|
|
SATB1-CDP association abolishes the ability of both proteins to
bind to DNA.
Because these data indicated that SATB1 and CDP
interact via their DNA-binding domains (Fig. 2 and 3), we performed
experiments to determine if this interaction affected the DNA-binding
ability of these proteins. SATB1 and CDP purified from bacterial
lysates were used in titration experiments to determine if formation of protein-protein complexes would prevent DNA binding. When either protein alone was added to a labeled probe with both SATB1 and CDP
binding sites, distinct protein-DNA complexes were detected (Fig. 6A,
lanes 2 and 3). However, addition of CDP
to a constant amount of SATB1 prior to probe addition resulted in the
loss of SATB1 DNA-binding ability (Fig. 6, lanes 4 to 9), and the
ability of CDP to bind to DNA was not recovered until CDP was in molar excess (lane 9). Moreover, these data indicate that SATB1 and CDP do
not form heteromeric complexes that bind to DNA. Control experiments
indicated that CDP did not interfere with the ability of NF-
B to
bind to DNA (Fig. 6B). These experiments support the idea that SATB1
associates with CDP to prevent DNA binding to the MMTV LTR.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Interaction of SATB1 and CDP interferes with the
DNA-binding ability of both proteins. (A) Inhibition of DNA binding
after SATB1-CDP association. N-terminally truncated SATB1 and CDP were
purified from recombinant fusion proteins and used for gel shift assays
with the 22-bp proximal NRE probe (32) prior to
electrophoresis on 4% nondenaturing polyacrylamide gels. SATB1 (500 ng, or 5.6 pmol) (lane 2) was mixed with 50 to 800 ng (0.7 to 11 pmol)
(lanes 4 to 9) of CDP before addition of the labeled probe. Lane 1 shows results achieved with no added protein, whereas lane 3 shows
results for 50 ng of CDP alone. The estimated molecular masses of SATB1
and CDP were 90 and 70 kDa, respectively. The 22-bp NRE probe appears
to have a single binding site for CDP and for SATB1 (59). A
12-h exposure of the autoradiogram is shown. (B) NF- B DNA binding is
unaffected by CDP. LBB.A B-cell (23) nuclear extracts (4 µg) were incubated with no CDP (lane 2) or 50 to 200 ng (0.7 to 2.8 pmol) of recombinant purified CDP (lanes 3 to 5) prior to addition of
the labeled NF- B probe from the interleukin-2 receptor promoter
(32) and analysis as described above. (C) The CR1, but not
CR3, domain of CDP interferes with SATB1 binding to DNA. Increasing
amounts of purified CR1 (9 to 225 pmol) (lanes 2 to 7) or CR3 (5.6 to
140 pmol) (lanes 8 to 12) were added to 2.5 µg (28 pmol) of purified
SATB1 and incubated with the 120-bp MMTV proximal NRE probe
(32) prior to analysis on a native polyacrylamide gel. Lane
1 contains no recombinant protein. Because the individual CDP cut
domains do not bind well to the 120-bp probe relative to SATB1 or CDP
containing the homeodomain [CDP(CR2-Cterm)], binding of CR1 and CR3
alone is not detectable under these conditions (not shown). The
calculated molecular masses of the purified CR1 and CR3 proteins were
approximately 11 and 18 kDa, respectively. A 2-h exposure of the
autoradiogram is shown.
|
|
Previous experiments indicated that SATB1 and CDP associate through
specific DNA-binding domains to prevent binding to the
MMTV NRE (Fig.
2,
3, and
6A). These results also indicated that
the CR1 domain, but
not the CR3 domain, of CDP bound to SATB1
in GST pull-down experiments.
Thus, our data suggested that CDP
CR1, but not CR3, would prevent SATB1
from binding to DNA. Gel
retardation experiments with the 120-bp
proximal NRE probe showed
that CDP CR1 inhibited binding of SATB1 to
the MMTV NRE but the
CR3 domain of CDP did not (Fig.
6C). Based on the
calculated molecular
weights of SATB1 and CDP CR1, one or two CR1
molecules are sufficient
to prevent binding of an SATB1 molecule to the
NRE. These results
support our prediction that association of SATB1
with specific
CDP domains (Fig.
3) prevents SATB1 from binding to
DNA.
Overexpression of CDP in transfection assays.
If SATB1 and CDP
associate in vivo and this association abolishes their ability to bind
to DNA, then overexpression of CDP relative to SATB1 should alter the
DNA-binding activity observed in nuclear extracts. Jurkat T cells that
contain a large amount of SATB1 DNA-binding activity relative to that
of CDP (32) were transfected transiently with a CDP
expression vector prior to preparation of nuclear extracts. Western
blots of the extracts verified that CDP transfection increased CDP
expression fourfold in Jurkat cells, whereas the total amount of SATB1
was unchanged (Fig. 7A). Gel shift assays
with the same extracts showed that CDP overexpression greatly
diminished the level of SATB1 binding to the MMTV proximal NRE sites
relative to that observed from vector control-transfected cells, yet no
CDP binding was detectable, despite the presence of CDP binding sites
in the NRE (Fig. 7B). Together, these results indicated that the level
of SATB1 binding to the MMTV LTR decreased when the intracellular level
of CDP increased in T cells. These data support the idea that formation of CDP-SATB1 complexes via their DNA-binding domains prevents binding
of both proteins to an MMTV regulatory region that contains a MAR and
is involved in the tissue-specific regulation of transcription (32).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 7.
CDP overexpression leads to reduced SATB1 DNA binding.
(A) Overexpression of CDP determined by Western blotting. Nuclear
extracts were prepared 48 h following transfection and used for
Western analysis with anti-SATB1 or -CDP serum. Equal amounts of
extract were loaded in each lane, and the labeled bands were
quantitated by densitometry. (B) CDP overexpression prevents SATB1 DNA
binding to the MMTV LTR. The same nuclear extracts as used for panel A
were used for gel shift assays with the labeled 120-bp proximal NRE
probe (32). The upper band observed in lanes 2 and 3 does
not contain CDP, as determined with anti-CDP serum in gel shift assays
(not shown). This band may represent binding of two molecules of SATB1
to the 120-bp NRE probe.
|
|
If the CDP-SATB1 interaction results in a loss of SATB1 DNA-binding
activity for the MMTV NRE, then CDP overexpression in
a cell line that
shows SATB1 DNA-binding activity will titrate
out the SATB1 DNA-binding
and repressor functions. Thus, CDP overexpression
in Jurkat T cells
that express high levels of SATB1 should elevate
expression of an MMTV
LTR reporter gene construct (pLC-LUC). Jurkat
cells were cotransfected
with a CDP expression plasmid or a CDP-negative
control vector and
pLC-LUC by electroporation. A

-galactosidase
expression plasmid also
was included to normalize for DNA uptake
(Fig.
8A). Compared to that in cells
transfected with the CDP-negative
vector, CDP overexpression in Jurkat
cells increased MMTV LTR-directed
luciferase activity approximately
twofold. To ensure that this
increase was not due to the method of DNA
introduction or the
expression plasmid used to control for DNA uptake,
we also overexpressed
CDP in Jurkat cells by using the SuperFect method
(Fig.
8B). Again,
this experiment showed that CDP overexpression
resulted in a two-
to threefold increase in luciferase expression and
that this increase
was proportional to the amount of CDP transfected.
Therefore,
these experimental results are consistent with the idea that
association
of SATB1 and CDP results in the mutual loss of their
DNA-binding
activities and that this loss of activity leads to
inactivation
of the SATB1 repressor function in T cells.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 8.
Overexpression of CDP in Jurkat cells elevates
expression from the MMTV LTR. (A) Overexpression of CDP in Jurkat cells
by electroporation. Transfections of the CDP expression vector (15 µg) were performed in triplicate, and results are expressed as an
average increase over the value determined from the average of three
determinations of the CDP-negative control vector (assigned a value of
1). Error bar indicates the standard deviation from the mean. (B)
Overexpression of CDP in Jurkat cells by using the SuperFect
transfection method. Values were calculated as described for panel A. Addition of more DNA (from any source) in the transfection assays
resulted in lower reporter gene activity.
|
|
 |
DISCUSSION |
Interaction of SATB1 and CDP.
Previously, it was shown that
SATB1 and CDP bind to NREs located upstream of the MMTV promoter
(9, 32). These NREs were localized to a region that is
deleted in MMTV variants that cause T-cell lymphomas rather than
mammary tumors (3, 22, 27, 37). The promoter-proximal NRE
appears to act as a MAR, and deletion of either the promoter-proximal
or promoter-distal NREs elevated reporter gene expression from the MMTV
LTR in tissues of transgenic mice other than the mammary gland
(48). Further studies with transgenic mice showed that a
substitution mutation in the proximal NRE destabilized SATB1 binding
and elevated reporter gene expression in nonmammary tissues
(32). Together, these experiments indicated that SATB1
binding to the proximal NRE is critical for transcriptional suppression
of MMTV in nonmammary tissues. Loss of MMTV transcriptional suppression
in T cells may lead to high levels of viral transcription and
replication, resulting in the onset of T-cell lymphomas (9,
22).
Experiments presented here suggest that the availability of SATB1 for
DNA binding to the MMTV LTR in different cell types
is affected by
binding to other factors, such as the homeoprotein
CDP. GST pull-down
assays showed that the DNA-binding domain of
SATB1 is needed for
interaction with CDP (Fig.
2). Similarly,
three of the four DNA-binding
domains of CDP (CR1, CR2, and the
homeodomain) formed complexes with
SATB1 (Fig.
3). Because the
DNA-binding domains of these two proteins
interact, perhaps it
is not surprising that SATB1 and CDP association
results in the
failure of either protein to bind to the MMTV promoter
(Fig.
6A).
In agreement with the idea that SATB1-CDP interaction leads
to
a loss of DNA-binding ability, CR1, but not CR3, association with
SATB1 abolished detectable binding of SATB1 to the MMTV proximal
NRE
(Fig.
6C). CR3 is the only known DNA-binding domain of CDP
that does
not associate with SATB1. Although the nature of the
molecular
interaction between CDP and SATB1 is unknown, the failure
of the CDP
CR3 domain to bind to SATB1 may be due to the presence
of a predicted
helical region found in CR1, CR2, and the homeodomain
and the absence
of this region in CR3 (as determined by using
the GeneStream Align
program).
Consequences of SATB1 association with CDP.
What are the
functional consequences of SATB1-CDP interaction? Since association of
SATB1 with CDP resulted in a loss of the DNA-binding activity of both
proteins in vitro in gel retardation assays, we transfected a CDP
expression vector into human Jurkat T cells that have a large amount of
SATB1 relative to CDP (32). Such experiments showed that CDP
overexpression resulted in decreased SATB1 binding to the MMTV proximal
NRE without altering the amount of SATB1 present in nuclear extracts
(Fig. 7). Thus, in vivo association of CDP and SATB1 appears to affect
binding of these homeoproteins to DNA, and transcription of a variety
of genes, including MMTV, may be altered by CDP-SATB1 interaction.
CDP or SATB1 overexpression in tissue culture cells leads to some
cytotoxic effects (
24,
30), and these effects may obscure
the results of reporter gene assays. However, we were able to
overexpress CDP approximately fourfold in Jurkat T cells (Fig.
7). Such
experiments clearly showed that CDP overexpression in
Jurkat cells
resulted in a loss of SATB1 binding to the MMTV proximal
NRE. This loss
of NRE binding allowed approximately two- to threefold
increases in
reporter gene expression from the MMTV LTR in two
types of
transient-transfection assays (Fig.
8). Such small effects
are typical
of nuclear matrix-binding factors in transfection
experiments (
7,
16). Previous experiments showed that mutation
of a SATB1-binding
site in the MMTV NRE region leads to low-level
effects on MMTV reporter
gene expression in transient-transfection
assays (
9,
32).
However, the same mutation leads to a dramatic
elevation of MMTV
expression in transgenic mice, particularly
in lymphoid tissues
relative to other tissue types (
32).
SATB1 and CDP binding sites are located within the MARs of several
genes, including those coding for CD8

and immunoglobulin
heavy
chain, that are expressed in lymphoid cells (
4,
49,
54a).
Both SATB1 and CDP have been implicated in the repression
of genes
expressed in highly differentiated cell types (
4,
15,
21,
24,
32,
52,
53). Binding sites for SATB1 and
CDP also are located within
a MAR in the MMTV NRE, a region that
is deleted in MMTV strains that
exhibit high expression in T cells,
leading to leukemia rather than
mammary tumors (
9,
22,
32).
How is the association between SATB1 and CDP different from
interactions between other homeodomain-containing proteins? Clearly,
homeoproteins have shown associations with numerous proteins,
including
members of the same homeoprotein family, members of
different
homeoprotein families, and nonhomeodomain proteins (
58).
An
example of homeoprotein interactions between members of different
homeoprotein families is the interaction of Hox and Pbx proteins
(
34), whereas association of Oct-1 and VP16 represent
interactions
between nonhomeoproteins (
11). SATB1-CDP
interactions appear
to be associations between members of the same
homeoprotein family,
i.e., those containing CR domains. Unlike many
homeoprotein interactions,
however, the SATB1-CDP association can
involve regions outside
the homeodomains, most notably the CRs. SATB1
and CDP are unusual
proteins in which the homeodomains are not required
for DNA binding
in vitro, although the contribution of the homeodomain
to DNA
binding appears to be greater for CDP than for SATB1 (
2,
12).
Similar to SATB1-CDP interaction, the association of murine
Mlx
and Dlx homeoproteins results in inactivation of their DNA-binding
activity (
58). However, the association involves the
homeodomains
of each protein and results in the loss of the Mlx
repressor activity
and the Dlx activator function (
58).
Thus, the CDP-SATB1 interaction
is unique because it involves
protein-protein associations outside
the homeodomain and because these
associations potentially would
inactivate the repressor activity of
both
proteins.
Model for tissue-specific regulation by SATB1 and CDP.
The
homeodomain proteins SATB1 and CDP appear to regulate the expression of
MMTV and other genes in highly differentiated cell types
(32; also this study). We propose a model where the ratio of SATB1 to CDP determines whether gene transcription is suppressed, perhaps through modulation of protein factor binding to
transcriptional control regions and MARs (Fig.
9). In this model, certain tissues, such
as thymus, would have SATB1 in excess of CDP. If the DNA-binding
ability of SATB1 is abolished by interaction of a single molecule of
SATB1 with each of the CDP DNA-binding domains (CR1, CR2, and the
homeodomain) (Fig. 6), then SATB1 repression would be extinguished in
most tissues, except those that have very high SATB1 levels (e.g., T
cells). Binding of available CDP to SATB1 would abolish the DNA-binding
activity of both proteins, although any excess SATB1 would act as a
repressor for the MMTV promoter. This model is supported by our
transfection experiments in Jurkat T cells, in which we were able to
titrate out the repressor activity of SATB1 by CDP overexpression. In
other cell types, CDP may exceed the available SATB1. Preliminary data
suggest that CDP also may act as a repressor of MMTV transcription
(17a). If CDP is a repressor of MMTV expression, a high
CDP/SATB1 ratio would suppress MMTV transcription. Alternatively, other
cell types may have nearly equimolar amounts of SATB1 and CDP, and
these cells may have little repressor activity for the MMTV promoter from either CDP or SATB1. B cells may represent such a cell type, since
they are relatively permissive for MMTV expression (23, 50).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 9.
Model for SATB1-CDP interaction in different mouse
tissues. The large cylinders represent CDP protein, whereas the
smaller, dark cylinders represent SATB1. CDP may be inactivated for DNA
binding by association with a single molecule of SATB1. Alternatively,
binding of SATB1 to one of three possible sites within CR1, CR2, or the
homeodomain may alter the specificity of CDP binding to different
promoters. The large box represents the MMTV LTR that is divided into
U3, R, and U5 domains. Transcription is initiated at the U3-R border of
the 5' LTR within the MMTV provirus. Upstream of the transcription
initiation site are two regions termed the promoter-proximal and
promoter-distal NREs (pNRE and dNRE, respectively). For simplicity, the
binding of a single SATB1 or CDP molecule to the pNRE or dNRE is shown,
although at least two binding sites each for SATB1 and CDP are located
within the pNRE (59).
|
|
Members of our group have shown previously that various mouse tissues
express CDP and SATB1 DNA-binding activity to different
extents
(
32) and that the level of MMTV expression in these
tissues
differs from intermediate to undetectable (
20,
48).
Although
there is not a perfect correlation between the level
of SATB1 and CDP
DNA-binding activity for the MMTV promoter and
levels of MMTV
transcription in different tissues, it is likely
that tissue-specific
levels of MMTV RNA represent the interplay
between the absence of
functional transcription suppressors and
the presence of
transcriptional activators. For example, lactating
mammary gland is
known to express the highest levels of MMTV RNA,
and neither SATB1 nor
CDP DNA-binding activity for the MMTV NRE
is detectable in this tissue
(
32). However, MMTV transcription
in lactating mammary
tissue also appears to be regulated by positive
factors that bind the
mammary gland enhancer in the LTR (
19,
28,
38,
39,
56).
Different SATB1-to-CDP ratios also may alter the activity or DNA
sequence recognition by CDP. Because the CDP CRs and homeodomain
each
can bind DNA independently and with unique specificity, binding
of
SATB1 to a single CDP-binding domain may change CDP recognition
of DNA
target sequences (
2,
18) or alter its interaction
with other
proteins, such as CDP alternatively spliced product
or
retinoblastoma-related factors (
31,
54). Independent
interactions
of SATB1 with different CDP domains are indicated by
experiments
showing that CR1, but not CR3, neutralize SATB1 DNA binding
(Fig.
6C). Thus, the ability of CDP and SATB1 to act as repressors
depends
upon the relative interaction of these homeoproteins and the
requirement
of these proteins for gene regulation in different tissues.
Because
CDP and its homologues each can serve in
Drosophila
sensory organ
development (
33), these data have broad
implications for organismal
development as well as for the
cell-type-specific expression of
many genes (including c-
myc
and c-
mos, as well as those coding
for globin, CD8,
immunoglobulin, histones, and Ncam) regulated
by SATB1 or CDP (
4,
15,
21,
24,
49,
52,
53).
 |
ACKNOWLEDGMENTS |
We thank Henry Bose, Paul Gottlieb, Phil Tucker, Jim Bull, and
Susan Ross for useful discussions and T. Kohwi-Shigematsu and H. Bose
for reagents. We also thank Mary Lozano for help with transfection experiments.
This work was supported by NIH grants CA34780 to J.P.D. and DK01977 and
HL49196 to E.J.N.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Microbiology, ESB 226, The University of Texas at Austin, Austin, TX
78712-1095. Phone: (512) 471-8415. Fax: (512) 471-7088. E-mail:
jdudley{at}uts.cc.utexas.edu.
Present address: Howard Hughes Medical Institute, Brigham and
Women's Hospital, Harvard Medical School, Boston, MA 02115.
 |
REFERENCES |
| 1.
|
Andres, V.,
B. Nadal-Ginard, and V. Mahdavi.
1992.
Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development.
Development
116:321-334[Medline].
|
| 2.
|
Aufiero, B.,
E. J. Neufeld, and S. H. Orkin.
1994.
Sequence-specific DNA binding of individual cut repeats of the human CCAAT displacement/cut homeodomain protein.
Proc. Natl. Acad. Sci. USA
91:7757-7761[Abstract/Free Full Text].
|
| 3.
|
Ball, J. K.,
H. Diggelmann,
G. A. Dekaban,
G. F. Grossi,
R. Semmler,
P. A. Waight, and R. F. Fletcher.
1988.
Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus.
J. Virol.
62:2985-2993[Abstract/Free Full Text].
|
| 4.
|
Banan, M.,
I. C. Rojas,
W. H. Lee,
H. L. King,
J. V. Harriss,
R. Kobayashi,
C. F. Webb, and P. D. Gottlieb.
1997.
Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8 gene.
J. Biol. Chem.
272:18440-18452[Abstract/Free Full Text].
|
| 5.
|
Barberis, A.,
G. Superti-Furga, and M. Busslinger.
1987.
Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter.
Cell
50:347-359[Medline].
|
| 6.
|
Beutner, U.,
E. Kraus,
D. Kitamura,
K. Rajewsky, and B. T. Huber.
1994.
B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens.
J. Exp. Med.
179:1457-1466[Abstract/Free Full Text].
|
| 7.
|
Bode, J.,
Y. Kohwi,
L. Dickinson,
T. Joh,
D. Klehr,
C. Mielke, and T. Kohwi-Shigematsu.
1992.
Biological significance of unwinding capability of nuclear matrix-associating DNAs.
Science
255:195-197[Abstract/Free Full Text].
|
| 8.
|
Bodmer, R.,
S. Barbel,
S. Sheperd,
J. W. Jack,
L. Y. Jan, and Y. N. Jan.
1987.
Transformation of sensory organs by mutations of the cut locus of D. melanogaster.
Cell
51:293-307[Medline].
|
| 9.
|
Bramblett, D.,
C.-L. L. Hsu,
M. Lozano,
K. Earnest,
C. Fabritius, and J. Dudley.
1995.
A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat.
J. Virol.
69:7868-7876[Abstract].
|
| 10.
|
Brandt-Carlson, C.,
J. S. Butel, and D. Wheeler.
1993.
Phylogenetic and structural analyses of MMTV LTR ORF sequences of exogenous and endogenous origins.
Virology
193:171-185[Medline].
|
| 11.
|
Cleary, M. A.,
S. Stern,
M. Tanaka, and W. Herr.
1993.
Differential positive control by Oct-1 and Oct-2: activation of a transcriptionally silent motif through Oct-1 and VP16 corecruitment.
Genes Dev.
7:72-83[Abstract/Free Full Text].
|
| 12.
|
Dickinson, L. A.,
C. D. Dickinson, and T. Kohwi-Shigematsu.
1997.
An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region.
J. Biol. Chem.
272:11463-11470[Abstract/Free Full Text].
|
| 13.
|
Dickinson, L. A.,
T. Joh,
Y. Kohwi, and T. Kohwi-Shigematsu.
1992.
A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition.
Cell
70:631-645[Medline].
|
| 14.
|
Dignam, J. D.,
P. L. Martin,
B. S. Shastry, and R. G. Roeder.
1983.
Eukaryotic gene transcription with purified components.
Methods Enzymol.
101:582-598[Medline].
|
| 15.
|
Dufort, D., and A. Nepveu.
1994.
The human Cut homeodomain protein represses transcription from the c-myc promoter.
Mol. Cell. Biol.
14:4251-4257[Abstract/Free Full Text].
|
| 16.
|
Forrester, W. C.,
C. van Genderen,
T. Jenuwein, and R. Grosschedl.
1994.
Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix attachment regions.
Science
265:1221-1225[Abstract/Free Full Text].
|
| 17.
|
Golovkina, T. V.,
A. Chervonsky,
J. P. Dudley, and S. R. Ross.
1992.
Transgenic mouse mammary tumor virus superantigen expression prevents viral infection.
Cell
69:637-645[Medline].
|
| 17a.
| Gregg, K., and J. Dudley. Unpublished data.
|
| 18.
|
Harada, R.,
D. Dufort,
C. Denis-Larose, and A. Nepveu.
1994.
Conserved cut repeats in the human cut homeodomain protein function as DNA binding domains.
J. Biol. Chem.
269:2062-2067[Abstract/Free Full Text].
|
| 19.
|
Haraguchi, S.,
R. A. Good,
R. W. Engelman,
S. Greene, and N. K. Day.
1997.
Prolactin, epidermal growth factor or transforming growth factor- activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat.
Mol. Cell. Endocrinol.
129:145-155[Medline].
|
| 20.
|
Henrard, D., and S. R. Ross.
1988.
Endogenous mouse mammary tumor virus is expressed in several organs in addition to the lactating mammary gland.
J. Virol.
62:3046-3049[Abstract/Free Full Text].
|
| 21.
|
Higgy, N. A.,
H. A. Tarnasky,
I. Valarche,
A. Nepveu, and F. A. van der Hoorn.
1997.
Cux/CDP homeodomain protein binds to an enhancer in the rat c-mos locus and represses its activity.
Biochim. Biophys. Acta
1351:313-324[Medline].
|
| 22.
|
Hsu, C.-L. L.,
C. Fabritius, and J. Dudley.
1988.
Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat.
J. Virol.
62:4644-4652[Abstract/Free Full Text].
|
| 23.
|
King, L. B., and R. B. Corley.
1990.
Lipopolysaccharide and dexamethasone induce mouse mammary tumor proviral gene expression and differentiation in B lymphocytes through distinct regulatory pathways.
Mol. Cell. Biol.
10:4211-4220[Abstract/Free Full Text].
|
| 24.
|
Kohwi-Shigematsu, T.,
K. Maass, and J. Bode.
1997.
A thymocyte factor SATB1 suppresses transcription of stably integrated matrix-attachment region-linked reporter genes.
Biochemistry
36:12005-12010[Medline].
|
| 25.
|
Lai, J. S., and W. Herr.
1992.
Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations.
Proc. Natl. Acad. Sci. USA
89:6958-6962[Abstract/Free Full Text].
|
| 26.
|
Lavallie, E. R.,
J. M. McCoy,
D. B. Smith, and P. Riggs.
1994.
Enzymatic and chemical cleavage of fusion proteins, p. 16.4.5-16.4.17.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 27.
|
Lee, W. T.,
O. Prakash,
D. Klein, and N. H. Sarkar.
1987.
Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice.
Virology
159:39-48[Medline].
|
| 28.
|
Lefebvre, P.,
D. S. Berard,
M. G. Cordingley, and G. L. Hager.
1991.
Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines.
Mol. Cell. Biol.
11:2529-2537[Abstract/Free Full Text].
|
| 29.
|
Lenardo, M. J., and D. Baltimore.
1989.
NF- B: a pleiotropic mediator of inducible and tissue-specific gene control.
Cell
58:227-229[Medline].
|
| 30.
|
Lievens, P. M.,
J. J. Donady,
C. Tufarelli, and E. J. Neufeld.
1995.
Repressor activity of CCAAT displacement protein in HL-60 myeloid leukemia cells.
J. Biol. Chem.
270:12745-12750[Abstract/Free Full Text].
|
| 31.
|
Lievens, P. M.,
C. Tufarelli,
J. J. Donady,
A. Stagg, and E. J. Neufeld.
1997.
CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro.
Gene
197:73-81[Medline].
|
| 32.
|
Liu, J.,
D. Bramblett,
Q. Zhu,
M. Lozano,
R. Kobayashi,
S. R. Ross, and J. P. Dudley.
1997.
The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression.
Mol. Cell. Biol.
17:5275-5287[Abstract].
|
| 33.
|
Ludlow, C.,
R. Choy, and K. Blochlinger.
1996.
Functional analysis of Drosophila and mammalian cut proteins in flies.
Dev. Biol.
178:149-159[Medline].
|
| 34.
|
Mann, R. S., and S. K. Chan.
1996.
Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins.
Trends Genet.
12:258-262[Medline].
|
| 35.
|
Maxam, A. M., and W. Gilbert.
1977.
A new method for sequencing DNA.
Proc. Natl. Acad. Sci. USA
74:560-564[Abstract/Free Full Text].
|
| 36.
|
Melcher, K., and S. A. Johnston.
1995.
GAL4 interacts with TATA-binding protein and coactivators.
Mol. Cell. Biol.
15:2839-2848[Abstract].
|
| 37.
|
Michalides, R., and E. Wagenaar.
1986.
Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias.
Virology
154:76-84[Medline].
|
| 38.
|
Mink, S.,
E. Härtig,
P. Jennewein,
W. Doppler, and A. C. B. Cato.
1992.
A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.
Mol. Cell. Biol.
12:4906-4918[Abstract/Free Full Text].
|
| 39.
|
Mok, E.,
T. V. Golovkina, and S. R. Ross.
1992.
A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice.
J. Virol.
66:7529-7532[Abstract/Free Full Text].
|
| 40.
|
Nakagomi, K.,
Y. Kohwi,
L. A. Dickinson, and T. Kohwi-Shigematsu.
1994.
A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1.
Mol. Cell. Biol.
14:1852-1860[Abstract/Free Full Text].
|
| 41.
|
Neufeld, E. J.,
D. G. Skalnik,
P. M. Lievens, and S. H. Orkin.
1992.
Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut.
Nat. Genet.
1:50-55[Medline].
|
| 42.
|
Nusse, R., and H. E. Varmus.
1982.
Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome.
Cell
31:99-109[Medline].
|
| 43.
|
Oliner, J. D.,
J. M. Andresen,
S. K. Hansen,
S. Zhou, and R. Tjian.
1996.
SREBP transcriptional activity is mediated through an interaction with the CREB-binding protein.
Genes Dev.
10:2903-2911[Abstract/Free Full Text].
|
| 44.
|
Peters, G.,
S. Brookes,
R. Smith, and C. Dickson.
1983.
Tumorigenesis by mouse mammary tumor virus: evidence for a common region for provirus integration in mammary tumors.
Cell
33:369-377[Medline].
|
| 45.
|
Pinsonneault, J.,
B. Florence,
H. Vaessin, and W. McGinnis.
1997.
A model for extradenticle function as a switch that changes HOX proteins from repressors to activators.
EMBO J.
16:2032-2042[Medline].
|
| 46.
|
Price, J.,
D. Turner, and C. Cepko.
1987.
Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer.
Proc. Natl. Acad. Sci. USA
84:156-160[Abstract/Free Full Text].
|
| 47.
|
Rieckhof, G. E.,
F. Casares,
H. D. Ryoo,
M. Abu-Shaar, and R. S. Mann.
1997.
Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein.
Cell
91:171-183[Medline].
|
| 48.
|
Ross, S. R.,
C.-L. L. Hsu,
Y. Choi,
E. Mok, and J. P. Dudley.
1990.
Negative regulation in correct tissue-specific expression of mouse mammary tumor virus in transgenic mice.
Mol. Cell. Biol.
10:5822-5829[Abstract/Free Full Text].
|
| 49.
|
Scheuermann, R. H., and U. Chen.
1989.
A developmental-specific factor binds to suppressor sites flanking the immunoglobulin heavy-chain enhancer.
Genes Dev.
3:1255-1266[Abstract/Free Full Text].
|
| 50.
|
Sharma, S.,
L. B. King, and R. B. Corley.
1988.
Molecular events during B lymphocyte differentiation. Induction of endogenous mouse mammary tumor proviral envelope transcripts after B cell stimulation.
J. Immunol.
141:2510-2518[Abstract].
|
| 51.
|
Smith, D. B.
1993.
Purification of glutathione-S-transferase fusion proteins.
Methods Mol. Cell. Biol.
4:220-229.
|
| 52.
|
Superti-Furga, G.,
A. Barberis,
G. Schaffner, and M. Busslinger.
1988.
The 117 mutation in Greek HPFH affects the binding of three nuclear factors to the CCAAT region of the -globin gene.
EMBO J.
7:3099-3107[Medline].
|
| 53.
|
Valarche, I.,
J. P. Tissier-Seta,
M. R. Hirsch,
S. Martinez,
C. Goridis, and J. F. Brunet.
1993.
The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype.
Development
119:881-896[Abstract/Free Full Text].
|
| 54.
|
van Wijnen, A. J.,
M. F. van Gurp,
M. C. de Ridder,
C. Tufarelli,
T. J. Last,
M. Birnbaum,
P. S. Vaughan,
A. Giordano,
W. Krek,
E. J. Neufeld,
J. L. Stein, and G. S. Stein.
1996.
CDP/cut is the DNA-binding subunit of histone gene transcription factor HiNF-D: a mechanism for gene regulation at the G1/S phase cell cycle transition point independent of transcription factor E2F.
Proc. Natl. Acad. Sci. USA
93:11516-11521[Abstract/Free Full Text].
|
| 54a.
|
Wang, Z.,
A. Goldstein,
R.-T. Zong,
D. Lin,
E. J. Neufeld,
R. H. Scheuermann, and P. W. Tucker.
1999.
Cux/CDP homeoprotein is a component of NF-µNR and represses the immunoglobulin heavy chain introhic enhancer by antagonizing the Bright transcription activator.
Mol. Cell. Biol.
19:284-295[Abstract/Free Full Text].
|
| 55.
|
Weintraub, H.
1993.
The MyoD family and myogenesis: redundancy, networks, and thresholds.
Cell
75:1241-1244[Medline].
|
| 56.
|
Yanagawa, S.-I.,
H. Tanaka, and A. Ishimoto.
1991.
Identification of a novel mammary cell line-specific enhancer element in the long terminal repeat of mouse mammary tumor virus, which interacts with its hormone-responsive element.
J. Virol.
65:526-531[Abstract/Free Full Text].
|
| 57.
|
Zappavigna, V.,
D. Sartori, and F. Mavilio.
1994.
Specificity of HOX protein function depends on DNA-protein and protein-protein interactions, both mediated by the homeo domain.
Genes Dev.
8:732-744[Abstract/Free Full Text].
|
| 58.
|
Zhang, H.,
G. Hu,
H. Wang,
P. Sciavolino,
N. Iler,
M. M. Shen, and C. Abate-Shen.
1997.
Heterodimerization of Msx and Dlx homeoproteins results in functional antagonism.
Mol. Cell. Biol.
17:2920-2932[Abstract].
|
| 59.
| Zhu, Q., and J. Dudley. Unpublished data.
|
Molecular and Cellular Biology, July 1999, p. 4918-4926, Vol. 19, No. 7
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Thomas, V., Samanta, S., Fikrig, E.
(2008). Anaplasma phagocytophilum Increases Cathepsin L Activity, Thereby Globally Influencing Neutrophil Function. Infect. Immun.
76: 4905-4912
[Abstract]
[Full Text]
-
Maitra, U., Seo, J., Lozano, M. M., Dudley, J. P.
(2006). Differentiation-Induced Cleavage of Cutl1/CDP Generates a Novel Dominant-Negative Isoform That Regulates Mammary Gene Expression. Mol. Cell. Biol.
26: 7466-7478
[Abstract]
[Full Text]
-
Cadieux, C., Fournier, S., Peterson, A. C., Bedard, C., Bedell, B. J., Nepveu, A.
(2006). Transgenic Mice Expressing the p75 CCAAT-Displacement Protein/Cut Homeobox Isoform Develop a Myeloproliferative Disease-Like Myeloid Leukemia. Cancer Res.
66: 9492-9501
[Abstract]
[Full Text]
-
Yeh, T.-Y., Chuang, J.-Z., Sung, C.-H.
(2005). Dynein light chain rp3 acts as a nuclear matrix-associated transcriptional modulator in a dynein-independent pathway. J. Cell Sci.
118: 3431-3443
[Abstract]
[Full Text]
-
Seo, J., Lozano, M. M., Dudley, J. P.
(2005). Nuclear Matrix Binding Regulates SATB1-mediated Transcriptional Repression. J. Biol. Chem.
280: 24600-24609
[Abstract]
[Full Text]
-
Thomas, V., Samanta, S., Wu, C., Berliner, N., Fikrig, E.
(2005). Anaplasma phagocytophilum Modulates gp91phox Gene Expression through Altered Interferon Regulatory Factor 1 and PU.1 Levels and Binding of CCAAT Displacement Protein. Infect. Immun.
73: 208-218
[Abstract]
[Full Text]
-
Truscott, M., Raynal, L., Wang, Y., Berube, G., Leduy, L., Nepveu, A.
(2004). The N-terminal Region of the CCAAT Displacement Protein (CDP)/Cux Transcription Factor Functions as an Autoinhibitory Domain that Modulates DNA Binding. J. Biol. Chem.
279: 49787-49794
[Abstract]
[Full Text]
-
Kaul-Ghanekar, R., Jalota, A., Pavithra, L., Tucker, P., Chattopadhyay, S.
(2004). SMAR1 and Cux/CDP modulate chromatin and act as negative regulators of the TCR{beta} enhancer (E{beta}). Nucleic Acids Res
32: 4862-4875
[Abstract]
[Full Text]
-
Zhu, Q., Maitra, U., Johnston, D., Lozano, M., Dudley, J. P.
(2004). The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis. Mol. Cell. Biol.
24: 4810-4823
[Abstract]
[Full Text]
-
Foucher, I., Montesinos, M. L., Volovitch, M., Prochiantz, A., Trembleau, A.
(2003). Joint regulation of the MAP1B promoter by HNF3{beta}/Foxa2 and Engrailed is the result of a highly conserved mechanism for direct interaction of homeoproteins and Fox transcription factors. Development
130: 1867-1876
[Abstract]
[Full Text]
-
Truscott, M., Raynal, L., Premdas, P., Goulet, B., Leduy, L., Berube, G., Nepveu, A.
(2003). CDP/Cux Stimulates Transcription from the DNA Polymerase {alpha} Gene Promoter. Mol. Cell. Biol.
23: 3013-3028
[Abstract]
[Full Text]
-
Mustafa, F., Bhadra, S., Johnston, D., Lozano, M., Dudley, J. P.
(2003). The Type B Leukemogenic Virus Truncated Superantigen Is Dispensable for T-Cell Lymphomagenesis. J. Virol.
77: 3866-3870
[Abstract]
[Full Text]
-
Goebel, P., Montalbano, A., Ayers, N., Kompfner, E., Dickinson, L., Webb, C. F., Feeney, A. J.
(2002). High Frequency of Matrix Attachment Regions and Cut-Like Protein x/CCAAT-Displacement Protein and B Cell Regulator of IgH Transcription Binding Sites Flanking Ig V Region Genes. J. Immunol.
169: 2477-2487
[Abstract]
[Full Text]
-
Zhu, Q., Dudley, J. P.
(2002). CDP Binding to Multiple Sites in the Mouse Mammary Tumor Virus Long Terminal Repeat Suppresses Basal and Glucocorticoid-Induced Transcription. J. Virol.
76: 2168-2179
[Abstract]
[Full Text]
-
Mustafa, F., Lozano, M., Dudley, J. P.
(2000). C3H Mouse Mammary Tumor Virus Superantigen Function Requires a Splice Donor Site in the Envelope Gene. J. Virol.
74: 9431-9440
[Abstract]
[Full Text]
-
Zhu, Q., Gregg, K., Lozano, M., Liu, J., Dudley, J. P.
(2000). CDP Is a Repressor of Mouse Mammary Tumor Virus Expression in the Mammary Gland. J. Virol.
74: 6348-6357
[Abstract]
[Full Text]
-
Stünkel, W., Huang, Z., Tan, S.-H., O'Connor, M. J., Bernard, H.-U.
(2000). Nuclear Matrix Attachment Regions of Human Papillomavirus Type 16 Repress or Activate the E6 Promoter, Depending on the Physical State of the Viral DNA. J. Virol.
74: 2489-2501
[Abstract]
[Full Text]
-
Alvarez, J. D., Yasui, D. H., Niida, H., Joh, T., Loh, D. Y., Kohwi-Shigematsu, T.
(2000). The MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes during T-cell development. Genes Dev.
14: 521-535
[Abstract]
[Full Text]
-
Antes, T. J., Chen, J., Cooper, A. D., Levy-Wilson, B.
(2000). The Nuclear Matrix Protein CDP Represses Hepatic Transcription of the Human Cholesterol-7alpha Hydroxylase Gene. J. Biol. Chem.
275: 26649-26660
[Abstract]
[Full Text]
-
Hawkins, S. M., Kohwi-Shigematsu, T., Skalnik, D. G.
(2001). The Matrix Attachment Region-binding Protein SATB1 Interacts with Multiple Elements within the gp91phox Promoter and Is Down-regulated during Myeloid Differentiation. J. Biol. Chem.
276: 44472-44480
[Abstract]
[Full Text]
-
Eklund, E. A., Jalava, A., Kakar, R.
(2000). Tyrosine Phosphorylation of HoxA10 Decreases DNA Binding and Transcriptional Repression during Interferon gamma -induced Differentiation of Myeloid Leukemia Cell Lines. J. Biol. Chem.
275: 20117-20126
[Abstract]
[Full Text]
-
Li, S., Aufiero, B., Schiltz, R. L., Walsh, M. J.
(2000). Regulation of the homeodomain CCAAT displacement/cut protein function by histone acetyltransferases p300/CREB-binding protein (CBP)-associated factor and CBP. Proc. Natl. Acad. Sci. USA
97: 7166-7171
[Abstract]
[Full Text]