Previous Article | Next Article 
Molecular and Cellular Biology, August 1999, p. 5474-5485, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Osmotic Stress-Induced Gene Expression in Saccharomyces
cerevisiae Requires Msn1p and the Novel Nuclear Factor
Hot1p
Martijn
Rep,1
Vladimír
Reiser,2
Ulrike
Gartner,2
Johan M.
Thevelein,1
Stefan
Hohmann,1,3,*
Gustav
Ammerer,2 and
Helmut
Ruis2
Laboratorium voor Moleculaire Celbiologie,
Katholieke Universiteit Leuven, B-3001 Heverlee, Flanders,
Belgium1; Institute of Biochemistry and
Molecular Cell Biology and Ludwig Boltzmann-Forschungsstelle für
Biochemie, University of Vienna, A-1030 Vienna,
Austria2; and Department of Cell and
Molecular Biology/Microbiology, Lundberg Laboratory, Göteborg
University, S-405 30 Göteborg, Sweden3
Received 3 March 1999/Returned for modification 8 April
1999/Accepted 28 April 1999
 |
ABSTRACT |
After a sudden shift to high osmolarity, Saccharomyces
cerevisiae cells respond by transiently inducing the expression
of stress-protective genes. Msn2p and Msn4p have been described as two
transcription factors that determine the extent of this response. In
msn2 msn4 mutants, however, many promoters still show a
distinct rise in transcriptional activity upon osmotic stress. Here we describe two structurally related nuclear factors, Msn1p and a newly
identified protein, Hot1p (for high-osmolarity-induced transcription), which are also involved in osmotic stress-induced transcription. hot1 single mutants are specifically compromised in the
transient induction of GPD1 and GPP2, which
encode enzymes involved in glycerol biosynthesis, and exhibit delayed
glycerol accumulation after stress exposure. Similar to a
gpd1 mutation, a hot1 defect can rescue cells
from inappropriately high HOG pathway activity. In contrast, Hot1p has
little influence on the osmotic stress induction of CTT1,
where Msn1p appears to play a more prominent role. Cells lacking Msn1p,
Msn2p, Msn4p, and Hot1p are almost devoid of the short-term
transcriptional response of the genes GPD1,
GPP2, CTT1, and HSP12 to osmotic
stress. Such cells also show a distinct reduction in the nuclear
residence of the mitogen-activated protein kinase Hog1p upon osmotic
stress. Thus, Hot1p and Msn1p may define an additional tier of
transcriptional regulators that control responses to high-osmolarity stress.
 |
INTRODUCTION |
The HOG (high-osmolarity glycerol
response) mitogen-activated protein (MAP) kinase pathway plays a
pivotal role in the adaptation of Saccharomyces cerevisiae
to conditions of high external osmolarity. This is best illustrated by
the fact that cells deficient in this pathway cannot proliferate on
media containing high levels of osmotically active molecules
(6). On the other hand, ectopic activation of the pathway is
also detrimental for cell growth (19, 31). This situation
has allowed an extensive genetic analysis, leading to the
identification of many positive and negative elements of the HOG
signaling pathway (19, 21, 24, 30, 31, 37-41, 60). The
system relies on the input of two independent and structurally
unrelated sensors whose signals converge at the level of the MAP kinase
kinase Pbs2p, the direct activator of the MAP kinase Hog1p (reviewed in
references 19 and 39). In addition to countering the effects of persistent high-osmolarity conditions, the HOG pathway also mediates short-term responses to
fluctuations in the osmolarity of the environment. Sudden shifts to
high osmolarity result in the accumulation of intracellular glycerol
due to a combination of HOG pathway-regulated stimulation of glycerol
synthesis (1, 6) and decreased glycerol efflux that seems to
occur independently of the HOG MAP kinase (29, 53). One of
the early HOG pathway-triggered events is the nuclear accumulation of
Hog1p kinase (16, 43) followed by a distinct transcriptional
response that over a time period of about 90 min to several hours
(depending on the extent of osmotic challenge) transiently induces
expression of genes encoding enzymes involved in glycerol synthesis,
such as GPD1 and GPP2 (HOR2) (1,
2, 20, 36, 44). In addition, the HOG-mediated signal affects expression of genes whose products have a more general role in the
protection from stress-induced damage, such as HSP104, which encodes a chaperonin (28); CTT1, which encodes
cytoplasmic catalase (49); and HSP12, whose
precise molecular function is unknown (51, 57). One of the
major unresolved problems concerning this transcriptional response is
the identity of the molecular targets recognized by the signaling
pathway (19). This problem further extends to the question
of whether and how short-term responses and long-term adaptation, both
requiring the HOG pathway (44), are mechanistically connected.
Many stress-responsive genes in yeast are regulated via a common
promoter element called the stress response element (STRE). This
element appears to be sufficient for mediating the transcriptional response to many different environmental challenges (33).
Two redundantly acting transcription factors, Msn2p and Msn4p, that recognize this sequence have been identified (35, 48). In response to a large variety of stress situations, including osmotic stress, these factors are translocated to the nucleus, where they bind
and activate target promoters such as those of the CTT1 or HSP12 gene (18). Although Msn2p and Msn4p enhance
the expression of these genes, suggesting some connection to the HOG
pathway, HOG pathway-mediated transcriptional activation can still be
found in the absence of Msn2p and Msn4p function. The extent of Msn2p- and Msn4p-independent activation varies from promoter to promoter (this
work and reference 35). Consequently, this pair of
transcription factors cannot be the only ones responsible for
high-osmolarity-induced gene expression. In the case of some yeast
promoters, induction appears to be mediated by HOG pathway-dependent
inactivation of Sko1p (34, 42, 45). Sko1p is a
transcriptional repressor, which binds to CRE-like DNA elements and
appears to tether the general repressors Tup1p and Ssn6p to promoters
(34, 42). This system does not control expression of
GPD1 (44, 45), and hence it is still unclear by
which molecular mechanisms the Hog1p MAP kinase triggers induction of
transcription of this type of target genes.
This study shows that the hitherto-undescribed nuclear protein Hot1p is
important for HOG pathway-dependent osmotic induction of genes encoding
enzymes involved in yeast glycerol biosynthesis. A protein with a
similar putative DNA-binding domain, Msn1p, contributes to both osmotic
and heat stress induction of GPD1, CTT1, and
HSP12. MSN1 has previously been isolated as a
high-copy-number suppressor of snf1 mutants (14)
and has been implicated in the regulation of iron uptake
(12) and of pseudohyphal growth (26, 27). It has
been shown to be a nuclear protein and to function as a transcriptional
activator when fused to the DNA-binding domain of LexA (14).
Our data suggest that together Hot1p and Msn1p mediate the bulk of the
Msn2p- and Msn4p-independent osmotic stress activation of the genes
GPD1, GPP2, CTT1, and
HSP12.
 |
MATERIALS AND METHODS |
Yeast strains and general methods.
The yeast strains used in
this study are summarized in Table 1.
Except for L40, they all have the W303-1A genetic background (54). The complete coding region of the HOT1 gene
(YMR172w) was deleted by the microhomology PCR method
(32) with the kanMX4 cassette (59). Deletion was
verified by PCR analysis of chromosomal DNA with specific primers.
Strain YMR56 was obtained by crossing and sporulating YSH818 and UG62,
and YMR119 and YMR120 were constructed by crossing and sporulating UG44
and UG62. General cloning methods are described by Sambrook et al.
(47). Yeast media, growth conditions, and procedures were
used as presented by Rose et al. (46). To monitor gene
expression after exposure to stress, cells were pregrown at 30°C in
rich glucose-containing medium to mid-exponential phase (optical
density at 600 nm [OD600] of between 0.7 and 1.5).
Osmotic stress was applied by adding NaCl to the cultures to the
concentrations indicated in the descriptions of the experiments. Heat
stress was applied by mixing the culture with 1/3 volume of medium at 50°C, resulting in a temperature of about 37°C. The culture was then incubated in a water bath at 37°C during the rest of the experiment.
Northern blotting techniques.
Total RNA was isolated at the
time points indicated in the figures and separated by electrophoresis
as described previously (10). Blots were hybridized in
buffer containing 7% sodium dodecyl sulfate (SDS), 0.5 M sodium
phosphate buffer (pH 7.0), and 1 mM EDTA. The signal was quantified by
using a phosphorimager (Fuji BAS-1000). The lacZ probe was a
PvuII fragment internal to the lacZ open reading
frame. All other probes were generated by PCR from chromosomal DNA of
W303-1A. The GPD1 probe includes sequences from position
527 to +95 relative to the start codon (this excludes sequences
homologous to GPD2). The probes for CTT1 (
14 to
1007) and HSP12 (
139 to +493) were kindly provided by
J. H. de Winde (Leuven, Belgium). As a loading control we used an
IPP1 probe including sequences from position +16 to +846
relative to the start codon (44). Probe fragments were
labelled with High Prime (Boehringer Mannheim).
Glycerol measurements.
To determine glycerol production
rates during an osmotic upshift, samples of a yeast culture were taken
at different time points after the shift. The samples were heated for
10 min at 95°C, cells were sedimented, and total glycerol in the
supernatant was measured. To obtain the glycerol production rate,
differences in glycerol concentrations between subsequent time points
were divided by the time interval and the mean of the
OD600s at the two time points.
Internal glycerol was determined by harvesting cells by filtration and
measuring the glycerol released by boiling the filters
for 10 min. Dry
weight was determined by drying filters with cells
at 80°C overnight.
Glycerol concentrations were measured with
a glycerol determination kit
(Boehringer
Mannheim).
Plasmid construction.
The bait vector for the hybrid screen
was constructed in the following way. The HOG1 coding
sequence was amplified by PCR with oligonucleotides designed according
to the sequences corresponding to the N terminus,
TTATAAAGGATCCATATGACCACTAAC (the
BamHI site and the start are codon underlined), and the
C-terminal part, AAACCTGGATCCGTAGTCCGTAATGGTG
(the BamHI site is underlined). The PCR product was
digested with BamHI and cloned into the BamHI site of pBTM116 (kindly provided by Paul Bartel and Stan Fields), resulting in pLexA-HOG1
. This plasmid contains the full-length lexA gene linked in frame to a truncated HOG1
gene coding for the first 343 amino acids of the protein (creating a
deletion of the last 93 amino acids from its C terminus).
A
GPD1-lacZ fusion construct, p
GPD1-lacZ, was
made in the following way. Part of the
GPD1 promoter, from
position

693 to

177 relative to the ATG, was amplified by PCR by
using primers
with
BglII and
XhoI linkers
(AAAA
AGATCTCAAAGGCCTCTCCTGG [the
BglII
site is underlined] and
AAAA
CTCGAGAGCCAGTCTACGTGCG [the
XhoI
site
is underlined]). This fragment was cloned into the
CYC1 promoter
lacking the upstream activation sequence (UAS)
in front of
lacZ in pJS205BXX, an episomal plasmid with
URA3 as selectable marker
(a kind gift from H.-J.
Schüller, Greifswald, Germany) (
50).
Creation of a Hot1-GFP fusion.
Hot1p was tagged with green
fluorescence protein (GFP) by using the chromosomal gene
replacement technique (61). First, a plasmid construct with
a NotI site in front of the stop codon of the
HOT1 gene was prepared. Oligonucleotides 1 AATATCTCGAG
AATCAGGATAGCACG (partly homologous to the sequence around 700 bp upstream of the HOT1 stop codon; the XhoI site is underlined, and
the double-underlined sequence indicates the stop codon that serves to
prevent the expression of the truncated part of the HOT1
gene, which results from the gene replacement event) and 2 TATTATTTTATTGCGGCCGCCTATTCCAGCAAGGCTCTC (partly
homologous to the sequence upstream of the stop codon of the
HOT1 coding sequence; the NotI site is
underlined) were used to prepare PCR product A (700 bp). Another pair
of oligonucleotides, 3 ATAATTATATATGCGGCCGC
GCACGTACGATAG
(partly homologous to the sequence downstream of the stop codon
of the HOT1 coding sequence; the NotI site is
underlined) and 4 AATATGAGCTCTTTTTTCACCTTCCC (partly homologous to the region around 250 bp downstream of
HOT1 stop codon; the SacI site is underlined)
were used to prepare PCR product B (250 bp). PCR product A was digested
with XhoI and NotI, combined with an equimolar
amount of PCR product B digested with NotI and
SacI, and cloned in one step into pRS306 (52) vector treated with XhoI and SacI. The resulting
plasmid, p603NotI, was digested with NotI, and a GFP
cassette (18) flanked by NotI sites was cloned
into p603NotI, resulting in p603GFP. This plasmid was linearized with
HindIII (cuts 523 bp upstream of the HOT1 stop codon) and used to transform yeast. The correct integration was
checked by analysis of chromosomal DNA by PCR with specific primers.
Two-hybrid screen.
Three genomic yeast libraries (YL2H-C1,
YL2H-C2, and YLH2H-C3, constructed in modified versions of pGAD424
[25]), were used to transform yeast strain L40
(58) carrying the LexA-Hog1 (residues 1 to 343) fusion in
pBTM116 (pLexA-HOG1
). Around 2 million transformants obtained after
transformation with each of the three libraries were replica plated
from plates selective for the plasmids and containing 25 mM
3-aminotriazole onto nitrocellulose filters and incubated with X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) chromogenic substrate (5). Around 200 clones reproducibly
produced positive signals in this assay after retransformation with
plasmids recovered from candidates isolated in the first round of
selection. The second round of selection with 45 mM 3-aminotriazole
resulted in the isolation of 14 groups of candidates with different
fragments of DNA fused to the GAL4 activation domain. A
representative of the group with the highest
-galactosidase activity
was selected for further characterization. The plasmid recovered from
this strain contained an in-frame fusion of the GAL4
activation domain to codons 140 to 645 of S. cerevisiae
reading frame YMR172w.
Fluorescence microscopy.
Cells were grown to logarithmic
phase (OD600 ~ 0.8 to 1.0) in synthetic complete
medium with components used as selective markers omitted.
4,6-Diamidino-2-phenylindole (DAPI) (final concentration, 2 g/ml) was
added as a DNA dye 15 min prior to microscopy. The number of cells with
a signal was expressed relative to the sum of cells showing
fluorescence (total number of cells examined, >300) after growth under
normal conditions or after exposure to 0.4 M NaCl for 5 min. For time
course experiments, cells were scored in a similar manner, using the
camera pictures of samples taken at the time points indicated. Living
cells were viewed with a Zeiss Axioplan 2 fluorescence microscope, and
images were scanned with a Quantix charge-coupled digital camera and IP
LAB software.
Protein extract preparation and Western blot analysis.
Cells
were grown in appropriate synthetic medium to an OD600 of
~0.8 to 1.0. For osmotic stress, NaCl was added at room temperature to a final concentration of 0.4 M for the time periods indicated. To
prepare protein extracts, cultures were rapidly cooled in ice water and
harvested by centrifugation. The cell pellet was resuspended in
ice-cold lysis buffer (0.1 M morpholineethanesulfonic acid [MES], 10 mM EGTA, 1% dimethyl sulfoxide, 1 mM dithiothreitol, pH 6.5)
containing a complete protease inhibitor mix (Boehringer) and
phosphatase inhibitors (0.1 mM Na vanadate, 10 mM NaF) and vortexed
with glass beads three times for 5 min each. Samples were centrifuged
twice at 14,000 rpm in a microcentrifuge for 10 min each. All
operations were performed at 4°C. Protein concentrations in the
supernatants were determined by using a Bio-Rad protein assay kit
before the supernatants were frozen in liquid nitrogen. Extracts (100 µl) were boiled with 50 µl of 4× sample buffer (0.12 M Tris, 20%
[vol/vol] glycerol, 0.286 M 2-mercaptoethanol, 0.086 mM bromophenol
blue, 5% SDS, pH 6.8) for 3 min. Samples were resolved by SDS-7.5%
polyacrylamide gel electrophoresis (Bio-Rad Mini Protean) and
transferred onto nitrocellulose membranes (Schleicher & Schuell) in a
semidry blotting apparatus (Bio-Rad). Phosphorylated Hog1-GFP was
immunodetected by phospho-specific p38 MAP kinase (T180/Y182) antibody
(New England Biolabs), and GFP was visualized with GFP polyclonal
antibody (Clontech). Immunoblots were developed by using a horseradish
peroxidase-conjugated protein ECL detection kit (Amersham). Probes for
immunodetection were removed by incubation in stripping buffer
according to recommendations of the suppliers before application of
another primary antibody to the same membrane.
 |
RESULTS |
Identification of a putative Hog1p-interacting factor with
similarity to the transcription factors Msn1p and Gcr1p.
In an
attempt to find target proteins of the Hog1p MAP kinase, we carried out
a two-hybrid screen with HOG1 coding sequences as bait. To
minimize the background signal, we chose a lexA-HOG1 fusion
construct encoding only the first 343 residues of Hog1p. Expression of
this fusion from a truncated ADH1 promoter indeed exhibited
low intrinsic activation. Using libraries expressing yeast genomic
fragments fused to a transcription activation domain, we screened
around 6 million transformants for increased LexA-dependent expression.
Of 200 candidates that reproducibly yielded a positive signal, we
selected the clone with the highest
-galactosidase activity (see
Materials and Methods for details). Further characterization of the
clone showed that it contained codons 140 to 645 of the uncharacterized
open reading frame YMR172w fused in frame to the GAL4 activation domain. We called this gene HOT1
for high-osmolarity-induced transcription (see below). The interaction
between Hot1p and Hog1p seemed to be specific, as DNA-binding domain
fusions with other MAP kinases did not raise the transcriptional
readout (not shown). Various attempts to obtain biochemical evidence
for Hog1p-Hot1p interaction by coprecipitation assays or by
immunokinase assays failed (data not shown).
A homology search of the predicted amino acid sequence of Hot1p (718 amino acid residues) did not uncover any close overall
match in the
databases. However, Msn1p (382 amino acids) and Gcr1p
(785 amino
acids), two previously identified
S. cerevisiae proteins,
showed similarity to Hot1p in their C-terminal regions (Fig.
1).
The similarity is most pronounced
within a stretch of 64 residues
in which Hot1p and Msn1p exhibit 42%
identity and 64% similarity
and Hot1p and Gcr1p exhibit 27% identity
and 59% similarity (Fig.
1). The similarity between Hot1p and Msn1p
can even be extended
beyond this region to encompass 95 residues in
total (41% identity
and 61% similarity). The C-terminal region has
been identified
as a DNA-binding domain in the case of Gcr1p (
22,
23), a factor
required for high expression levels of glycolytic
genes (
3,
4,
7,
8). Although specific DNA binding has not
been
proven for Msn1p, the protein can function as a transcriptional
activator when fused to the LexA DNA-binding domain (
14).
Consistent
with such a function, Msn1p has been reported to be a
resident
nuclear protein (
14). To localize Hot1p in the
cell, we made
use of a carboxy-terminal GFP tag. The construct was
shown to
be functional by complementation of the sensitivity of the
hot1 mutant to severe stress (see below). A strong
fluorescence signal
colocalized with nuclear DNA under normal and
hyperosmotic (Fig.
2) and hypo-osmotic
(data not shown) conditions.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Hot1p is structurally related to Msn1p and Gcr1p.
Pairwise alignments of the C-terminal regions of Hot1p with Msn1p and
Gcr1p are shown. Arrows delineate a region of 64 residues that has the
highest similarity. The similarity between Hot1p and Msn1p extends
further towards the C-terminal end.
|
|

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
Hot1p is a nuclear protein. Logarithmically growing
cells of strain VRY140 (HOT1-GFP) were examined by
fluorescence or light microscopy under normal growth conditions and 5 min after addition of NaCl to a final concentration of 0.4 M. DIC,
differential interference contrast.
|
|
Efficient induction of GPD1 expression depends on
Hot1p.
Since Hot1p may interact with Hog1p and exhibits similarity
to the transcriptional activators Gcr1p and Msn1p, we tested whether hot1 mutations affect the expression of genes induced by
high-osmolarity stress via the HOG pathway. Particularly, we tested
whether the expression of the key glycerol biosynthesis genes
GPD1 and GPP2, which are known to be partly
regulated by the HOG pathway (1, 20, 36, 44), was affected
by the mutation. Northern analysis demonstrated that this was indeed
the case (Fig. 3). The main effect of a
hot1 mutation was a significant decrease of maximal transcript accumulation after a shift to high-salt conditions (0.7 M
NaCl). Unlike a hog1 mutant, hot1 cells are not
delayed in their transcriptional response. In hog1 hot1
double mutants, the remaining response is kinetically similar to that
of a hog1 mutant but is reduced even further. This result
indicates that Hot1 could act downstream of Hog1p, perhaps as a
mediator of nuclear kinase activity, although it also suggests that the
two proteins have independent functions in the control of
GPD1 and GPP2 expression. The specific reduction
of mRNA levels in the hot1 mutant should be caused at the
transcriptional level, since a CYC1-lacZ fusion gene driven
by GPD1 UAS elements exhibited a reduction of its mRNA level
in a hot1 mutant that was similar to that for the entire GPD1 gene (Fig. 4).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Role of Hog1p and Hot1p in the induction of expression
of GPD1 and GPP2. Cells of the wild type ( )
and of the hot1 ( ), hog1 (×), and hot1
hog1 ( ) mutants were exposed to 0.7 M NaCl at time zero. (A)
Northern blotting; (B) quantification. The highest relative mRNA level
in the wild type was set to 100.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
GPD1-lacZ induction is affected by the
hot1 mutation. The mutant effect was tested by using a
reporter consisting of a CYC1-lacZ construct lacking its own
UAS fused to part (position 693 to 177) of the GPD1
promoter. Wild-type ( ) and hot1 ( ) cells were
transformed with the pGPD1-lacZ plasmid and exposed to 0.7 M
NaCl, and total RNA was probed for lacZ mRNA. The graph
shows lacZ mRNA levels relative to those of IPP1;
the highest relative mRNA level in the wild type was set to 100.
|
|
Hot1p and Msn1p are necessary for a complete transcriptional
response to osmotic stress.
Having obtained evidence that
HOT1 controls the promoters of GPD1 and
GPP2, we tested the influence of the absence of various combinations of transcription factors that might affect expression of
GPD1 and GPP2, as well as of CTT1 and
HSP12, two general stress-responsive genes predominantly
controlled via STREs (33, 57). While the upstream region of
the GPD1 gene contains STRE-like sequences (at positions
330,
286, and
34), no evidence for their functionality has yet
been reported. Deletion of MSN2 and MSN4, the two
genes encoding two redundant transcription factors binding to STREs, has little effect on osmotic induction of GPD1 and
GPP2 beyond a slight delay (Fig.
5). Deletion of the MSN1 gene
also has little effect on mRNA induction. On the other hand, an
important part of the response still existing in hot1
mutants is lost when MSN1, MSN2, and
MSN4 are also deleted, suggesting a complex functional overlap and perhaps cooperation of these factors. Interestingly, there
was about a 5-fold induction of the GPD1 mRNA level even in
the quadruple mutant (wild type, 13-fold), indicating that additional
factors must be involved in the regulation of GPD1 expression.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of combinations of hot1,
msn1, msn2, and msn4 mutations on
osmotic induction of GPD1, GPP2, CTT1,
and HSP12. Cells of the wild type ( ) and the
msn1 ( ), msn2 msn4 (×), msn1 msn2
msn4 ( ), hot1 ( ), hot1 msn1 ( ),
hot1 msn2 msn4 ( ), and hot1 msn1 msn2 msn4
( ) mutants were exposed to osmotic stress (0.7 M NaCl) at time zero.
(A) Northern blotting; (B) quantification. The highest relative mRNA
level in the wild type was set to 100.
|
|
A similar but not identical pattern of dependencies became apparent in
the case of the predominantly STRE-regulated genes.
As previously
published, osmotic induction of expression of the
CTT1 gene
is dependent mainly on
MSN2 and
MSN4
(
35). However,
an
msn1 deletion has a strong
negative effect on expression in
this case, while a single
hot1 mutation has little effect. When
various mutations are
tested in combination, most of the response
is lost in
msn1 msn2
msn4 triple mutants, and the slight response
still remaining is
lost virtually completely in the
hot1 msn1 msn2 msn4
quadruple mutant (see particularly Fig.
5A). A somewhat
different
pattern was observed in the case of
HSP12, another
STRE-regulated
gene (
57). Like
CTT1, this gene is
regulated predominantly by
MSN2 and
MSN4, as
either the single
hot1 or single
msn1 mutation
has only negligible effects, while a combination of both leads
to a
50% reduction in maximal expression (Fig.
5B). However, in
the
msn2 msn4 double mutant the remaining induction (20% of
maximal
wild-type levels) is strongly dependent on
HOT1.
Although there
is still a visible increase of
HSP12 mRNA in
the quadruple mutant
during the osmotic upshift (Fig.
5A), the maximal
level is only
1% of wild type in this mutant. Overall, it is apparent
that individual
contributions of the two sets of regulatory genes are
highly dependent
on promoter context and cannot be predicted by the
presence or
number of STRE elements alone. Nevertheless, since for all
genes
tested by us the osmotic stress-specific expression was
drastically
reduced in the absence of Hot1p, Msn1p, Msn2p, and Msn4p,
we suggest
that this might also hold true for most other osmotic
stress-induced
genes.
Having established that Hot1p, Msn1p, and Msn2p plus Msn4p affect
osmotic induction of glycerol biosynthesis and general
stress-responsive
gene transcripts differentially, we tested the effect
of the respective
mutations on the expression of two of the genes
affected,
GPD1 and
CTT1, during continuous growth
under normal and high-osmolarity
conditions (Fig.
6). These data confirm the differential
effects
of Msn1p and Hot1p on a glycerol biosynthesis gene and on a
general
stress-responsive gene. They also demonstrate that the
hot1 mutation
results in increased
CTT1 mRNA
levels in cells that are fully
adapted to high salt concentrations.
This stimulating effect of
hot1 is clearly dependent on the
presence of Msn1p, Msn2p, and
Msn4p, since it is lost in the respective
double and triple mutants.
A similar effect of
hot1 was
observed in the case of other general
stress-responsive genes,
particularly
HSP12 (not shown). In the
case of
GPD1 mRNA, there is a stimulating effect of
hot1
only
in the absence of NaCl, which is again dependent on
MSN1 and
MSN2 plus
MSN4. Under
steady-state growth conditions, Hot1p appears
to be required for proper
regulation of
GPD1 expression in response
to the NaCl
concentration, while Msn1p and Msn2p plus Msn4p contribute
to
expression irrespective of the NaCl concentration (Fig.
6).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of combinations of hot1,
msn1, msn2, and msn4 mutations on
GPD1 and CTT1 expression. mRNA levels during
continuous growth in rich glucose medium containing no NaCl (black
bars), 0.5 M NaCl (grey bars), or 0.85 M NaCl (open bars) are shown.
The highest relative mRNA level in the wild type (WT) was set to 100.
|
|
Hot1p is specifically required for the osmotic induction of
GPD1.
To establish if the effects mediated by Hot1p and
Msn1p are osmospecific, the respective mutants and the msn2
msn4 mutant were exposed to heat stress via a shift from 30 to
37°C, and mRNA induction of GPD1 and CTT1 was
monitored. In contrast to induction by osmotic stress, induction by
heat stress of CTT1 mRNA was completely dependent on Msn2p
and Msn4p (Fig. 7). However, deletion of
MSN1 also reduced maximal mRNA levels, to about 40%. Heat
induction of GPD1 is also affected by loss of
MSN1, MSN2, and MSN4 function but is
completely independent of HOT1 (Fig. 7). Involvement of Msn2p and Msn4p in GPD1 expression indicates that some or
all of the STRE-like elements in its promoter may be functional, at least under heat stress. More importantly, these data indicate that
Hot1p is dedicated to the induction by high osmolarity, whereas Msn1p,
like Msn2p and Msn4p, contributes to the transcriptional response
induced by several kinds of stress.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
Induction by heat shock of GPD1 and
CTT1 expression in hot1, msn1, and
msn2 msn4 mutants. Cells of the wild type ( ) and the
hot1 ( ), msn1 (×), and msn2 msn4
( ) mutants were exposed to heat stress (37°C) at time zero. (A)
Northern blotting; (B) quantification. The highest relative mRNA level
in the wild type was set to 100.
|
|
Hot1p is functionally linked to the HOG pathway.
In a
wild-type strain, the MAP kinase kinase kinase Ssk2p is kept inactive
under basal conditions due to the function of an N-terminal negative
regulatory domain (37). Deletion of this domain leads to
constitutive activation of the downstream kinase cascade independent of
the function of the upstream osmosensors. While expression of this
truncated kinase is detrimental for cell growth, this effect can be
suppressed by deletions of genes encoding downstream components of the
pathway, such as HOG1 (Fig. 8)
(30, 37). Here we show that deletion of GPD1 also
partially suppresses the growth defect caused by a hyperactive HOG
pathway (Fig. 8). Since a plasmid encoding a constitutively open Fps1p
glycerol export channel (53) also partially suppressed
unregulated Ssk2p (data not shown), overaccumulation of intracellular
glycerol probably contributes to growth inhibition by an overactive HOG
pathway. If Hot1p was to act at or downstream of the HOG kinase cascade controlling GPD1 induction, then a hot1 mutation
might also suppress the negative effect of a constitutively active HOG
pathway. Indeed, this appears to be the case (Fig. 8). The partial
suppression of negative effects of constitutive HOG pathway activity by
hot1 and gpd1 mutations is consistent with a role
of Hot1p in GPD1 expression. It is noteworthy that deletion
of MSN1 or of MSN2 plus MSN4 does not
lead to such a suppression phenotype (Fig. 8).

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 8.
Suppression of the growth defect caused by a
constitutively activated HOG pathway. The wild type and
hot1, hog1, msn2 msn4,
msn1, and gpd1 mutants were transformed with
plasmid pGAL1::SSK2 N, encoding Ssk2p
with its N-terminal inhibitory domain (amino acids 1 to 1172) deleted
(30). Expression of this construct is induced by a shift to
galactose medium. Transformants were grown to logarithmic phase in
selective medium containing glucose, sedimented, washed with water, and
diluted to an OD600 of 1.0. Ten microliters of this
suspension and of a 1:10 dilution were dropped on plates containing
glucose or galactose.
|
|
Nuclear factors mediating the transcriptional response to stress
contribute to nuclear retention of Hog1p MAP kinase.
Formally, the
effects of the hot1 mutation could be attributed to
inefficient activation of the kinase cascade of the HOG pathway. We
therefore investigated whether and how hot1 might influence
Hog1p kinase activity. Activation of Hog1p in wild-type cells can be
correlated with its rapid translocation to the nucleus. Also, during
adaptation, the inactivation (dephosphorylation) of the kinase can be
correlated with nuclear export (16, 43). Both nuclear
accumulation and reexport of the MAP kinase can be visualized by using
a functional Hog1-GFP fusion. When msn1 hot1 and msn1
msn2 msn4 hot1 mutants were tested for kinetics of nuclear Hog1-GFP import, it was apparent that Hog1p levels were not
significantly affected by the mutations and that nuclear accumulation
and Hog1-GFP dual phosphorylation were not delayed compared to those in
the wild-type control. In contrast, the period of nuclear residence and
dual phosphorylation of Hog1-GFP was clearly shortened in the
msn2 msn4 mutant, as previously reported (43),
and in the hot1 msn1 and quadruple mutants (Fig.
9). This observation suggests that Hot1p
and Msn1p may be part of nuclear structures that help retain the
activated Hog1p kinase in the nucleus.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 9.
Hot1p, Msn1p, Msn2p, and Msn4p affect kinetics of Hog1p
phosphorylation and nuclear residence. (A) Logarithmically growing
cells of the wild type ( ) and the hot1 msn1 ( ),
msn2 msn4 (×), and msn1 msn2 msn4 hot1 ( )
mutants were transformed with pVR65-WT (HOG1-GFP) and examined in time
courses by fluorescence microscopy under normal growth conditions and
after addition of NaCl to a final concentration of 0.4 M. (B)
Determination of the phosphorylation profile of Hog1-GFP. Samples were
taken at the time points indicated, and protein extracts were prepared.
Western blots were analyzed with anti-active p38 antibody (Ab) or with
anti-GFP antibody to determine the protein level of Hog1-GFP.
|
|
hot1 mutants are delayed in glycerol accumulation and
are hypersensitive to killing by severe osmotic stress.
To further
clarify whether the effects on gene expression described above are
relevant for a functional osmotic stress response, we tested several
physiological parameters, including glycerol production and cell
survival during or after stress exposure. Consistent with effects on
GPD1 transcript levels, the glycerol production rate (Fig.
10A) and internal glycerol accumulation
(Fig. 10B) were clearly decreased in hot1 mutants compared
to the wild type for a time period of about 2.5 h when the
osmolarity of the medium was suddenly increased (0.7 M NaCl). Wild-type
and mutant cells were tested for growth on 1.5 M sorbitol and on 0.7 M
NaCl, a condition that prevents the growth of a hog1 mutant.
Surprisingly, none of the single or multiple mutations tested caused a
pronounced defect in growth under these conditions (Fig.
11A and data not shown). Since the
defect might be apparent only during the period of adaptation to a
changing environment, we shifted cells from normal medium to 1.7 M NaCl
and counted the number of survivors after 20 h. Two sets of
experiments were performed. In one set cells were preinduced with a 15- or 60-min mild osmotic shock (0.4 M NaCl) before exposure to 1.7 M
NaCl, and in the other set cells were directly transferred into 1.7 M
NaCl. With the exception of hog1 mutants, all cells showed
high survival rates when preinducing conditions were applied. On the
other hand, cells not preconditioned by mild stress are dramatically
more sensitive to the severe type of stress. Under these conditions,
hot1 mutant cells are more sensitive than wild-type cells or
even mutants lacking the general stress transcription factors Msn2p and
Msn4p (Fig. 11B). Perhaps not surprisingly, hog1 cells are
most sensitive in this type of experiment, presumably because important
targets of the Hog1p MAP kinase are transcriptional effectors different
from Hot1p or do not act at the transcriptional level. Perhaps already
under noninducing conditions, Hot1p determines a pattern of gene
expression that guards a cell against sudden osmotic insults.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 10.
Hot1p affects glycerol production rate (A) and glycerol
accumulation (B). Cells of the wild type ( ) and the hot1
( ), msn2 msn4 (×), and hot1 msn2 msn4 ( )
mutants were exposed to 0.7 M NaCl at time zero. The total glycerol
production rate and intracellular glycerol accumulation were measured
as described in Materials and Methods.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 11.
(A) Growth of a hot1 strain is unaffected by
1.5 M sorbitol. Cells were grown to logarithmic phase and diluted to an
OD600 of 1.0. A 10-fold serial dilution series was plated
on rich glucose medium containing either no osmolyte or 1.5M sorbitol.
(B) Cells with HOT1 deleted are more sensitive to severe
osmotic stress conditions. Logarithmically growing strains were
incubated in the presence of 0.4 M NaCl for 0 (black bars), 15 (grey
bars), or 60 (open bars) min before the final concentration of NaCl was
increased to 1.7 M. After 20 h, the samples were appropriately
diluted and plated at about 300 cells per plate. After 3 days, the
total number of colonies was counted and expressed relative to that in
the corresponding unstressed sample.
|
|
 |
DISCUSSION |
New factors mediating osmotic stress signaling.
The S. cerevisiae Hog1p kinase is related to the p38 MAP kinase from
mammalian cells and to Sty1 from Schizosaccharomyces pombe.
While p38 and Sty1 are responsive to different types of stress, Hog1p
is activated specifically by osmotic stress, probably reflecting an
adaptation to the specific environment of S. cerevisiae, whose osmotic pressure can change dramatically (19, 55).
Although the architecture of the HOG pathway of S. cerevisiae is known in more detail than that of the pathway
stimulating p38, the actual targets of the Hog1p kinase have remained
elusive (19). In other eukaryotic systems the transcription
factor substrate(s) of p38/Hog1p appears to be restricted to
ATF-related proteins. This does not appear to be the case in S. cerevisiae. Sko1p, which has been described recently as an
ATF-like transcriptional repressor, may be a Hog1p target, but it
appears to control only a subset of the Hog1p-regulated genes (42,
44, 45). In our aim to identify nuclear regulators involved in
the osmotic response, we have focused our attention on two structurally
related nuclear proteins, Msn1p and Hot1p. Until now neither factor had
been implicated in the osmotic stress response. From the studies
presented here, we conclude that in addition to the general stress
factors Msn2p and Msn4p, these two proteins are required for most of
the short-term transcriptional response to hyperosmotic stress. This
raised the question of whether the novel factor Hot1p and Msn1p are
direct targets of the HOG pathway.
Hot1p may be a target of the HOG pathway.
The first indication
that HOT1 might be implicated in osmotic stress came from
the fact that a partial clone was obtained as an interacting partner of
Hog1p in the yeast two-hybrid system. Although this suggested a
potential physical interaction of Hog1p and Hot1p, we failed to find
any corroborating biochemical evidence for direct Hog1p-Hot1p
interaction. On the other hand, our data undoubtedly support a
physiological interaction of Hot1p with the HOG pathway. First, the
fact that a hot1 mutation partially suppresses the negative
effects of constitutive hyperactivation of the HOG pathway is
consistent with a functional role of Hot1p in responses triggered via
the Hog1p MAP kinase. Consistently, we found that deletion of
GPD1, a transcriptional target of the HOG pathway, also
suppressed the effects conferred by hyperactive Hog1p. On the other
hand, deletion of MSN1 and of MSN2 plus
MSN4, which encode transcription factors controlling
STRE-controlled genes but not the hyperosmotic induction of glycerol
biosynthesis genes, did not suppress these effects. This finding
further supports a specific role of Hot1p in mediating (part of the)
HOG pathway-controlled osmotic regulation of glycerol biosynthesis genes.
Two observations make the connection between Hot1p and Hog1p even
closer. The
hot1 defect reduces the transient induction
of
GPD1 and
GPP2 mRNAs and, consistent with that,
also the rate
of cellular glycerol accumulation upon an increase in
osmolarity.
Finally, a
hot1 mutation has a negative effect
on survival of
yeast cells upon severe high-salt stress. Therefore,
Hot1p must
somehow affect the effectivity of the response system
downstream
of the MAP kinase. The following arguments support this
notion.
The dichotomy of the transcriptional response

namely, Hot1p
initiating
mainly
GPD1 expression and Msn1p contributing
mainly to
CTT1 induction

indicates
that these two factors
are unlikely to influence the activation
mechanism of the MAP kinase
per se. Unless their activity is dedicated
to signaling systems that
act in parallel with the HOG pathway,
the Hog1p kinase must act
upstream of these two nuclear factors.
This view is consistent with the
observations that upon osmotic
upshift in a
hot1 msn1 mutant
or even a quadruple
msn1 msn2 msn4 hot1 mutant, dual
phosphorylation of Hog1p is unaffected and the
kinase is able to
accumulate in the nucleus with unimpaired kinetics.
What is different
from wild-type cells in such mutants, however,
is the abbreviated
nuclear residence of Hog1p. In the fission
yeast
S. pombe, a
similar phenomenon concerning the Sty1 kinase
and the transcription
factor Atf1 has been interpreted to indicate
that the transcription
factor provides nuclear anchorage for the
kinase (
17). From
such a viewpoint, Hot1p and Msn1p should either
be nuclear retention
factors or at least control the activity
of such factors in some way.
Another, more remote possibility
is that loss of Hot1p and Msn1p
function somehow leads to an increase
in the activity of stress
adaptation factors such as protein phosphatases
controlling the Hog1p
phosphorylation state (
60).
While the data are consistent with a role of Hot1p in mediating osmotic
stress signaling downstream of Hog1p, we note that
these two proteins
may have roles in the control of expression
of the glycerol
biosynthesis genes
GPD1 and
GPP2 independent of
each other. This notion is based on the observation that the profiles
of induction of the two glycerol biosynthesis genes are different
in
hog1 and
hot1 mutants. Moreover, additional
deletion of
HOT1 in a
hog1 mutant results in a
hog1-like induction profile, but
maximal induction is
further diminished. These observations are
inconsistent with a simple
linear pathway from Hog1p to Hot1p
and further to
GPD1 or
GPP2 expression but rather suggest that
at least part of the
function of Hot1p (and Msn1p) function is
exerted in a pathway parallel
to
Hog1p.
A number of observations made in this investigation are in line with
the assumption that Hot1p acts as a transcriptional activator
of the
expression of some genes, which are controlled via the
HOG pathway.
Hot1p is a resident nuclear protein, and its C-terminal
region exhibits
sequence similarity to the DNA-binding domain
of Gcr1p and a similar
region in the transcriptional activator
Msn1p. The loss-of-function
phenotype resulting in the diminished
induction of
GPD1 and
GPP2 mRNAs indicates that Hot1p acts as
a positive factor in
this situation. Since the function of a
GPD1 upstream region
driving the expression of a
CYC1-lacZ reporter
gene is also
impaired in
hot1 cells, the effect of Hot1p is most
likely
on transcriptional induction rather than mRNA stability.
Despite a
number of attempts, we have been unable to demonstrate
binding of Hot1p
to upstream elements of the genes investigated
(
GPD1 and
CTT1) by gel retardation experiments (data not shown).
Gcr1p
and Msn1p, which are similar to Hot1p in their (putative)
DNA-binding
domains, bind DNA only weakly and with low sequence
specificity
(
14,
22). Recently, we have obtained preliminary
evidence by
use of chromatin precipitation methods that Msn1p
indeed binds
specifically to stress-responsive promoters, suggesting
that the same
may hold true for Hot1p in the case of glycerol
biosynthesis genes. At
least in some Gcr1p-controlled promoters,
interaction with another
DNA-binding factor, Rap1p, is required
for specific DNA binding
(
11,
56). The
GPD1 promoter contains
Rap1p
binding sites (
13), and Hot1p might well bind to promoters
only in cooperation with this or other DNA-binding proteins. In
conclusion, we presently favor a direct role of Msn1p and Hot1p
in the
regulation of
GPD1 and
GPP2 expression. We have
observed,
however, that the expression of
HOT1 is itself
about twofold stimulated
after an osmotic shift in a time course
similar to that observed
for
GPD1 (data not shown), which
could indicate further levels
of interdependent regulation of these
factors.
Msn1p, Msn2p, Msn4p, and Hot1p mediate a large part of the osmotic
induction of several stress-inducible genes.
To what extent do the
four factors Msn1p, Msn2p, Msn4p, and Hot1p account for the normally
observed transcriptional effects upon an osmotic upshift? According to
the present data, all positive factors seem to have been recognized in
the case of CTT1, while at least one additional,
still-unknown factor appears to contribute to the induction of
HSP12 and the glycerol biosynthesis genes GPD1
and GPP2. The Sko1p-Ssn6p-Tup1p repressor system, which has been shown to play an important role in negative control of some genes
induced by high osmolarity (34, 42, 45), does not appear to
be important at least for regulation of GPD1 (44, 45). Nevertheless, in all cases investigated, the contribution of
the four factors is substantial, as the residual expression levels
found in the quadruple mutant plunge to a minor fraction of those found
in wild-type cells.
With regard to the individual contributions, one can clearly define
separate spheres of influence. Hot1p appears to be most
important in
the case of glycerol biosynthesis gene expression,
where Msn2p plus
Msn4p and Msn1p have minor importance. In the
case of the general
stress-responsive genes
CTT1 and
HSP12, where
Msn2p plus Msn4p are much more important for regulation, Msn1p
and/or
Hot1p makes an additional contribution to the high-osmolarity
response.
The described effects of the
hot1 mutation on the initial
transcriptional response when cells experience an increase of medium
osmolarity are also rather different from its long-term effects,
i.e.,
its effects on mRNA levels in cells fully adapted to a given
external
osmolarity. Although deletion of
HOT1 has both a short-
and
a long-term negative effect on
GPD1 transcription in
salt-exposed
cells, it has a strong stimulating effect on
CTT1 and
HSP12 mRNA
levels in fully adapted
cells. This increase in steady-state levels,
already seen under basal
conditions, is dependent on Msn1p and
on Msn2p plus Msn4p. Although
this may point to a specific repressor
function of Hot1p under some
conditions, these effects could also
be due to compensating mechanisms
acting on general stress response
genes, possibly via Msn1p and/or
Msn2p plus
Msn4p.
Effects on growth, survival, and glycerol accumulation.
It
seems surprising that the reduced amount of GPD1 mRNA in the
hot1 mutant and, especially, in the hot1 msn1 msn2
msn4 quadruple mutant has no strong effect on growth in media with
high solute concentrations. In contrast to the case for hog1
mutants, there is no or only a minor effect of hot1 on the
growth rate when assayed on plates or in liquid medium (not shown). The
GPD1 mRNA level in adapted cells apparently supports enough
enzyme synthesis for glycerol production to sustain the turgor pressure
required for growth. This observation also makes it likely that the MAP
kinase controls substrates important for growth and proliferation in addition to transcription factors. Nevertheless, the initial response to hyperosmotic stress, i.e., the accumulation of intracellular glycerol, is clearly delayed in a hot1 mutant, leaving it
less well prepared for sudden rises in osmolarity. Although this could explain the reduced fitness of hot1 mutants upon sudden
exposure to high NaCl concentrations, this effect might still involve
as-yet-unrecognized targets of Hot1p.
 |
ACKNOWLEDGMENTS |
The first three authors have contributed equally to this publication.
We are grateful to C. Schüller (Vienna, Austria) for helpful
discussions and critically reading the manuscript, to A. Marchler-Bauer (Vienna, Austria) for first pointing out to us the similarity between
HOT1 and MSN1 sequences, and to H. Saito (Boston,
Mass.) and H.-J. Schüller (Greifswald, Germany) for providing plasmids.
We acknowledge support from the Commission of the European Union via
contracts BIO4-CT95-0161 to J.M.T. and S.H. and FMRX-CT96-0007 to
J.M.T., H.R., and S.H. The Vienna groups have also been supported by
grants P10815 and P12478 (to H.R.) and W001 (predoctoral fellowship to
V.R.) from the Fonds zur Förderung der wissenschaftlichen Forschung, Vienna, Austria.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cell and Molecular Biology/Microbiology, Göteborg University, Box
462, S-405 30 Göteborg, Sweden. Phone: 46-31-7732595. Fax:
46-31-7732599. E-mail: hohmann{at}gmm.gu.se.
 |
REFERENCES |
| 1.
|
Albertyn, J.,
S. Hohmann,
J. M. Thevelein, and B. A. Prior.
1994.
GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway.
Mol. Cell. Biol.
14:4135-4144[Abstract/Free Full Text].
|
| 2.
|
Ansell, R.,
K. Granath,
S. Hohmann,
J. Thevelein, and L. Adler.
1997.
The two isoenzymes for yeast NAD-dependent glycerol 3-phosphate dehydrogenase, encoded by GPD1 and GPD2, have distinct roles in osmoadaption and redox regulation.
EMBO J.
16:2179-2187[Medline].
|
| 3.
|
Baker, H.
1991.
GCR1 of Saccharomyces cerevisiae encodes a DNA binding protein whose binding is abolished by mutations in CTTCC sequence motif.
Proc. Natl. Acad. Sci. USA
88:9443-9447[Abstract/Free Full Text].
|
| 4.
|
Baker, H.
1986.
Glycolytic gene expression in Saccharomyces cerevisiae: nucleotide sequence of GCR1, null mutants, and evidence for expression.
Mol. Cell. Biol.
6:3774-3784[Abstract/Free Full Text].
|
| 5.
|
Breeden, L., and K. Nasmyth.
1985.
Regulation of the yeast HO gene.
Cold Spring Harbor Symp. Quant. Biol.
50:643-650[Abstract/Free Full Text].
|
| 6.
|
Brewster, J. L.,
T. de Valoir,
N. D. Dwyer,
E. Winter, and M. C. Gustin.
1993.
An osmosensing signal transduction pathway in yeast.
Science
259:1760-1763[Abstract/Free Full Text].
|
| 7.
|
Chambers, A.,
E. A. Packham, and I. R. Graham.
1995.
Control of glycolytic gene expression in the budding yeast (Saccharomyces cerevisiae).
Curr. Genet.
29:1-9[Medline].
|
| 8.
|
Clifton, D., and D. G. Frankel.
1981.
The gcr (glycolysis regulation) mutation of Saccharomyces cerevisiae.
J. Biol. Chem.
256:13074-13078[Abstract/Free Full Text].
|
| 9.
|
Cyrcková, F.,
C. de Virgilio,
E. Manser,
J. R. Pringle, and K. Nasmyth.
1995.
Ste20-like protein kinases are required for normal localization of cell growth and for cytokinesis in budding yeast.
Genes Dev.
9:1817-1830[Abstract/Free Full Text].
|
| 10.
|
de Winde, J. H.,
M. Crauwels,
S. Hohmann,
J. M. Thevelein, and J. Winderickx.
1996.
Differential requirement of the yeast sugar kinases for sugar sensing in the establishment of the catabolite repressed state.
Eur. J. Biochem.
241:633-643[Medline].
|
| 11.
|
Drazinic, C. M.,
J. B. Smerage,
M. C. Lopez, and H. V. Baker.
1996.
Activation mechanism of the multifunctional transcription factor repressor-activator protein 1 (Rap1p).
Mol. Cell. Biol.
16:3187-3196[Abstract/Free Full Text].
|
| 12.
|
Eide, D., and L. Guarente.
1992.
Increased dosage of a transcriptional activator gene enhances iron-limited growth of Saccharomyces cerevisiae.
J. Gen. Microbiol.
138:347-354[Abstract/Free Full Text].
|
| 13.
|
Eriksson, P.,
L. Adler, and A. Blomberg.
1997.
Ph.D. thesis.
Gothenburg University, Gothenburg, Sweden.
|
| 14.
|
Estruch, F., and M. Carlson.
1990.
Increased dosage of the MSN1 gene restores invertase expression in yeast mutants defective in the SNF1 protein kinase.
Nucleic Acids Res.
11:6959-6964.
|
| 15.
|
Estruch, F., and M. Carlson.
1993.
Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:3872-3881[Abstract/Free Full Text].
|
| 16.
|
Ferrigno, P.,
F. Posas,
D. Koepp,
H. Saito, and P. A. Silver.
1998.
Regulated nucleo/cytoplasmic exchange of HOG1 MAPK requires the importin beta homologs NMD5 and XPO1.
EMBO J.
17:5606-5614[Medline].
|
| 17.
|
Gaits, F.,
G. Degols,
K. Shiozaki, and P. Russell.
1998.
Phosphorylation and association with the transcription factor Atf1 regulate localization of Spc1/Sty1 stress-activated kinase in fission yeast.
Genes Dev.
12:1464-1473[Abstract/Free Full Text].
|
| 18.
|
Görner, W.,
E. Durchschlag,
M. T. Martinez-Pastor,
F. Estruch,
G. Ammerer,
B. Hamilton,
H. Ruis, and C. Schüller.
1998.
Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity.
Genes Dev.
12:586-597[Abstract/Free Full Text].
|
| 19.
|
Gustin, M. C.,
J. Albertyn,
M. Alexander, and K. Davenport.
1998.
MAP kinase pathways in the yeast Saccharomyces cerevisiae.
Microbiol. Mol. Biol. Rev.
62:1264-1300[Abstract/Free Full Text].
|
| 20.
|
Hirayama, T.,
T. Maeda,
H. Saito, and K. Shinozaki.
1995.
Cloning and characterization of seven cDNAs for hyperosmolarity-responsive (HOR) genes of Saccharomyces cerevisiae.
Mol. Gen. Genet.
249:127-138[Medline].
|
| 21.
|
Hohmann, S.
1997.
Shaping up: the response of yeast to osmotic stress, p. 101-145.
In
S. Hohmann, and W. H. Mager (ed.), Yeast stress responses. R.G. Landes, Austin, Tex.
|
| 22.
|
Huie, M. A., and H. V. Baker.
1996.
DNA-binding properties of the yeast transcriptional activator, Gcr1p.
Yeast
12:307-317[Medline].
|
| 23.
|
Huie, M. A.,
E. W. Scott,
C. M. Drazinic,
M. C. Lopez,
I. K. Hornstra,
T. P. Yang, and H. V. Baker.
1992.
Characterization of the DNA-binding activity of GCR1: in vivo evidence for two GCR1-binding sites in the upstream activating sequence of TPI of Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:2690-2700[Abstract/Free Full Text].
|
| 24.
|
Jacoby, T.,
H. Flanagan,
A. Faykin,
A. G. Seto,
C. Mattison, and I. Ota.
1997.
Two protein tyrosine phosphatases inactivate the osmotic stress response pathway in yeast by targeting the mitogen activated protein kinase, Hog1.
J. Biol. Chem.
272:17749-17755[Abstract/Free Full Text].
|
| 25.
|
James, P.,
J. Halladay, and E. A. Craig.
1996.
Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast.
Genetics
144:1425-1436[Abstract].
|
| 26.
|
Lambrechts, M. G.,
F. F. Bauer,
J. Marmur, and I. S. Pretorius.
1996.
Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast.
Proc. Natl. Acad. Sci. USA
93:8419-8424[Abstract/Free Full Text].
|
| 27.
|
Lambrechts, M. G.,
P. Sollitti,
J. Marmur, and I. S. Pretorius.
1996.
A multicopy suppressor gene, MSS10, restores STA2 expression in Saccharomyces cerevisiae strains containing the STA10 repressor gene.
Curr. Genet.
29:523-529[Medline].
|
| 28.
|
Lindquist, S., and G. Kim.
1996.
Heat-shock protein 104 expression is sufficient for thermotolerance in yeast.
Proc. Natl. Acad. Sci. USA
93:5301-5306[Abstract/Free Full Text].
|
| 29.
|
Luyten, K.,
J. Albertyn,
W. F. Skibbe,
B. A. Prior,
J. Ramos,
J. Thevelein, and S. Hohmann.
1995.
Fps1, a yeast member of the MIP family of channel proteins, is a facilitator for glycerol uptake and efflux and is inactive under osmotic stress.
EMBO J.
14:1360-1371[Medline].
|
| 30.
|
Maeda, T.,
M. Takekawa, and H. Saito.
1995.
Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3-containing osmosensor.
Science
269:554-558[Abstract/Free Full Text].
|
| 31.
|
Maeda, T.,
S. M. Wurgler-Murphy, and H. Saito.
1994.
A two-component system that regulates an osmosensing MAP kinase cascade in yeast.
Nature
369:242-245[Medline].
|
| 32.
|
Manivasakam, P.,
S. C. Weber,
J. McElver, and R. H. Schiestl.
1995.
Micro-homology mediated PCR targeting in Saccharomyces cerevisiae.
Nucleic Acids Res.
23:2799-2800[Free Full Text].
|
| 33.
|
Marchler, G.,
C. Schüller,
G. Adam, and H. Ruis.
1993.
A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions.
EMBO J.
12:1997-2003[Medline].
|
| 34.
|
Márquez, J. A.,
A. Pascual-Ahuir,
M. Proft, and R. Serrano.
1998.
The Ssn6-Tup1 repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and -independent genes.
EMBO J.
17:2543-2553[Medline].
|
| 35.
|
Martinez-Pastor, M. T.,
G. Marchler,
C. Schüller,
A. Marchler-Bauer,
H. Ruis, and F. Estruch.
1996.
The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress-response element (STRE).
EMBO J.
15:2227-2235[Medline].
|
| 36.
|
Norbeck, J.,
A. K. Påhlman,
N. Akhtar,
A. Blomberg, and L. Adler.
1996.
Purification and characterization of two isoenzymes of DL-glycerol 3-phosphatase from Saccharomyces cerevisiae. Identification of the corresponding GPP1 and GPP2 genes and evidence for osmotic regulation of Gpp2p expression by the osmosensing MAP kinase signal transduction pathway.
J. Biol. Chem.
271:13875-13881[Abstract/Free Full Text].
|
| 37.
|
Posas, F., and H. Saito.
1998.
Activation of the yeast SSK2 MAP kinase kinase kinase by the SSK1 two-component response regulator.
EMBO J.
17:1385-1394[Medline].
|
| 38.
|
Posas, F., and H. Saito.
1997.
Osmotic activation of the HOG MAPK pathway via Ste11p MAPKKK: scaffold role of Pbs2p MAPKK.
Science
276:1702-1705[Abstract/Free Full Text].
|
| 39.
|
Posas, F.,
M. Takekawa, and H. Saito.
1998.
Signal transduction by MAP kinase cascades in budding yeast.
Curr. Opin. Microbiol.
1:175-182.
[Medline] |
| 40.
|
Posas, F.,
E. A. Witten, and H. Saito.
1998.
Requirement of STE50 for osmostress-induced activation of the STE11 mitogen-activated protein kinase kinase kinase in the high-osmolarity glycerol response pathway.
Mol. Cell. Biol.
18:5788-5796[Abstract/Free Full Text].
|
| 41.
|
Posas, F.,
S. M. Wurgler-Murphy,
T. Maeda,
E. A. Witten,
T. C. Thai, and H. Saito.
1996.
Yeast HOG1 MAP kinase cascade is regulated by a multi-step phosphorelay mechanism in the SLN1-YPD1-SSK1 "two-component" osmosensor.
Cell
86:865-875[Medline].
|
| 42.
|
Proft, M., and R. Serrano.
1999.
Repressors and upstream repressing sequences of the stress-regulated ENA1 gene in Saccharomyces cerevisiae: bZIP protein Sko1p confers HOG-dependent osmotic regulation.
Mol. Cell. Biol.
19:537-546[Abstract/Free Full Text].
|
| 43.
|
Reiser, V.,
H. Ruis, and G. Ammerer.
1999.
Kinase activity-dependent nuclear export opposes stress-induced nuclear accumulation and retention of Hog1 mitogen-activated protein kinase in the budding yeast Saccharomyces cerevisiae.
Mol. Biol. Cell
10:1147-1161[Abstract/Free Full Text].
|
| 44.
|
Rep, M.,
J. Albertyn,
J. M. Thevelein,
B. A. Prior, and S. Hohmann.
1999.
Different signalling pathways contribute to the control of GPD1 expression by osmotic stress in Saccharomyces cerevisiae.
Microbiology
145:715-727[Medline].
|
| 45.
|
Rep, M.,
J. M. Thevelein, and S. Hohmann.
1999.
The role of ATF-like transcription factors in yeast osmoadaptation.
Unpublished results.
|
| 46.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics. A laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 47.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 48.
|
Schmitt, A. P., and K. McEntee.
1996.
Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5777-5782[Abstract/Free Full Text].
|
| 49.
|
Schüller, G.,
J. L. Brewster,
M. R. Alexander,
M. C. Gustin, and H. Ruis.
1994.
The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.
EMBO J.
13:4382-4389[Medline].
|
| 50.
|
Schüller, H. J.,
A. Hahn,
F. Troster,
A. Schutz, and E. Schweizer.
1992.
Coordinate genetic control of yeast fatty acid synthase genes FAS1 and FAS2 by an upstream activation site common to genes involved in membrane lipid biosynthesis.
EMBO J.
11:107-114[Medline].
|
| 51.
|
Siderius, M.,
E. Rots, and W. H. Mager.
1997.
High-osmolarity signalling in Saccharomyces cerevisiae is modulated in a carbon-source-dependent fashion.
Microbiology
143:3241-3250[Abstract/Free Full Text].
|
| 52.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 53.
|
Tamás, M. J.,
K. Luyten,
F. C. W. Sutherland,
A. Hernandez,
J. Albertyn,
H. Valadi,
H. Li,
B. A. Prior,
S. G. Kilian,
J. Ramos,
L. Gustafsson,
J. M. Thevelein, and S. Hohmann.
1999.
Fps1p controls the accumulation and release of the compatible solute glycerol in yeast osmoregulation.
Mol. Microbiol.
31:1087-1104[Medline].
|
| 54.
|
Thomas, B. J., and R. J. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
56:619-630[Medline].
|
| 55.
|
Toone, W. M., and N. Jones.
1998.
Stress-activated signalling pathways in yeast.
Genes Cells
3:485-498[Abstract].
|
| 56.
|
Tornow, J.,
X. Zeng,
W. Gao, and G. M. Santangelo.
1993.
GCR1, a transcriptional activator in Saccharomyces cerevisiae, complexes with RAP1 and can function without its DNA binding domain.
EMBO J.
12:2431-2437[Medline].
|
| 57.
|
Varela, J. C. S.,
U. M. Praekelt,
P. A. Meacock,
R. J. Planta, and W. H. Mager.
1995.
The Saccharomyces cerevisiae HSP12 gene is activated by the high-osmolarity glycerol pathway and negatively regulated by protein kinase A.
Mol. Cell. Biol.
15:6232-6245[Abstract/Free Full Text].
|
| 58.
|
Vojtek, A. B.,
S. M. Hollenberg, and J. A. Cooper.
1993.
Mammalian Ras interacts directly with the serine/threonine kinase Raf.
Cell
74:205-214[Medline].
|
| 59.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[Medline].
|
| 60.
|
Wurgler-Murphy, S. M.,
T. Maeda,
E. A. Witten, and H. Saito.
1997.
Regulation of the Saccharomyces cerevisiae Hog1 mitogen-activated protein kinase by the Ptp2 and Ptp3 protein tyrosine phosphatases.
Mol. Cell. Biol.
17:1289-1297[Abstract/Free Full Text].
|
| 61.
| Zachariae, W., and K. Nasmyth. Unpublished results.
|
Molecular and Cellular Biology, August 1999, p. 5474-5485, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Heyland, J., Fu, J., Blank, L. M.
(2009). Correlation between TCA cycle flux and glucose uptake rate during respiro-fermentative growth of Saccharomyces cerevisiae. Microbiology
155: 3827-3837
[Abstract]
[Full Text]
-
Motizuki, M., Xu, Z.
(2009). Importance of Polarisome Proteins in Reorganization of Actin Cytoskeleton at Low pH in Saccharomyces cerevisiae. J Biochem
146: 705-712
[Abstract]
[Full Text]
-
Ni, L., Bruce, C., Hart, C., Leigh-Bell, J., Gelperin, D., Umansky, L., Gerstein, M. B., Snyder, M.
(2009). Dynamic and complex transcription factor binding during an inducible response in yeast. Genes Dev.
23: 1351-1363
[Abstract]
[Full Text]
-
Rosonina, E., Willis, I. M., Manley, J. L.
(2009). Sub1 Functions in Osmoregulation and in Transcription by both RNA Polymerases II and III. Mol. Cell. Biol.
29: 2308-2321
[Abstract]
[Full Text]
-
Molin, C., Jauhiainen, A., Warringer, J., Nerman, O., Sunnerhagen, P.
(2009). mRNA stability changes precede changes in steady-state mRNA amounts during hyperosmotic stress. RNA
15: 600-614
[Abstract]
[Full Text]
-
Bahn, Y.-S.
(2008). Master and Commander in Fungal Pathogens: the Two-Component System and the HOG Signaling Pathway. Eukaryot Cell
7: 2017-2036
[Full Text]
-
Westfall, P. J., Patterson, J. C., Chen, R. E., Thorner, J.
(2008). Stress resistance and signal fidelity independent of nuclear MAPK function. Proc. Natl. Acad. Sci. USA
105: 12212-12217
[Abstract]
[Full Text]
-
Melamed, D., Pnueli, L., Arava, Y.
(2008). Yeast translational response to high salinity: Global analysis reveals regulation at multiple levels. RNA
14: 1337-1351
[Abstract]
[Full Text]
-
Bermejo, C., Rodriguez, E., Garcia, R., Rodriguez-Pena, J. M., Rodriguez de la Concepcion, M. L., Rivas, C., Arias, P., Nombela, C., Posas, F., Arroyo, J.
(2008). The Sequential Activation of the Yeast HOG and SLT2 Pathways Is Required for Cell Survival to Cell Wall Stress. Mol. Biol. Cell
19: 1113-1124
[Abstract]
[Full Text]
-
Ye, T., Garcia-Salcedo, R., Ramos, J., Hohmann, S.
(2006). Gis4, a New Component of the Ion Homeostasis System in the Yeast Saccharomyces cerevisiae.. Eukaryot Cell
5: 1611-1621
[Abstract]
[Full Text]
-
Page, M. J., Di Cera, E.
(2006). Role of na+ and k+ in enzyme function.. Physiol. Rev.
86: 1049-1092
[Abstract]
[Full Text]
-
Thorsen, M., Di, Y., Tangemo, C., Morillas, M., Ahmadpour, D., Van der Does, C., Wagner, A., Johansson, E., Boman, J., Posas, F., Wysocki, R., Tamas, M. J.
(2006). The MAPK Hog1p Modulates Fps1p-dependent Arsenite Uptake and Tolerance in Yeast. Mol. Biol. Cell
17: 4400-4410
[Abstract]
[Full Text]
-
Marques, J. M., Rodrigues, R. J., de Magalhaes-Sant'Ana, A. C., Goncalves, T.
(2006). Saccharomyces cerevisiae Hog1 Protein Phosphorylation upon Exposure to Bacterial Endotoxin. J. Biol. Chem.
281: 24687-24694
[Abstract]
[Full Text]
-
Reiser, V., D'Aquino, K. E., Ee, L.-S., Amon, A.
(2006). The Stress-activated Mitogen-activated Protein Kinase Signaling Cascade Promotes Exit from Mitosis. Mol. Biol. Cell
17: 3136-3146
[Abstract]
[Full Text]
-
Jiang, R., Tu, Z., Chen, T., Sun, F.
(2006). Network motif identification in stochastic networks. Proc. Natl. Acad. Sci. USA
103: 9404-9409
[Abstract]
[Full Text]
-
Krasley, E., Cooper, K. F., Mallory, M. J., Dunbrack, R., Strich, R.
(2006). Regulation of the Oxidative Stress Response Through Slt2p-Dependent Destruction of Cyclin C in Saccharomyces cerevisiae. Genetics
172: 1477-1486
[Abstract]
[Full Text]
-
Santos, A., del Mar Alvarez, M., Mauro, M. S., Abrusci, C., Marquina, D.
(2005). The Transcriptional Response of Saccharomyces cerevisiae to Pichia membranifaciens Killer Toxin. J. Biol. Chem.
280: 41881-41892
[Abstract]
[Full Text]
-
Vyas, V. K., Berkey, C. D., Miyao, T., Carlson, M.
(2005). Repressors Nrg1 and Nrg2 Regulate a Set of Stress-Responsive Genes in Saccharomyces cerevisiae. Eukaryot Cell
4: 1882-1891
[Abstract]
[Full Text]
-
Proft, M., Gibbons, F. D., Copeland, M., Roth, F. P., Struhl, K.
(2005). Genomewide Identification of Sko1 Target Promoters Reveals a Regulatory Network That Operates in Response to Osmotic Stress in Saccharomyces cerevisiae. Eukaryot Cell
4: 1343-1352
[Abstract]
[Full Text]
-
Edmunds, J. W., Mahadevan, L. C.
(2004). MAP kinases as structural adaptors and enzymatic activators in transcription complexes. J. Cell Sci.
117: 3715-3723
[Abstract]
[Full Text]
-
Saito, H., Tatebayashi, K.
(2004). Regulation of the Osmoregulatory HOG MAPK Cascade in Yeast. J Biochem
136: 267-272
[Abstract]
[Full Text]
-
Wolfger, H., Mamnun, Y. M., Kuchler, K.
(2004). The Yeast Pdr15p ATP-binding Cassette (ABC) Protein Is a General Stress Response Factor Implicated in Cellular Detoxification. J. Biol. Chem.
279: 11593-11599
[Abstract]
[Full Text]
-
O'Rourke, S. M., Herskowitz, I.
(2004). Unique and Redundant Roles for HOG MAPK Pathway Components as Revealed by Whole-Genome Expression Analysis. Mol. Biol. Cell
15: 532-542
[Abstract]
[Full Text]
-
Goodwin, T. J. D., Butler, M. I., Poulter, R. T. M.
(2003). Cryptons: a group of tyrosine-recombinase-encoding DNA transposons from pathogenic fungi. Microbiology
149: 3099-3109
[Abstract]
[Full Text]
-
Sato, N., Kawahara, H., Toh-e, A., Maeda, T.
(2003). Phosphorelay-Regulated Degradation of the Yeast Ssk1p Response Regulator by the Ubiquitin-Proteasome System. Mol. Cell. Biol.
23: 6662-6671
[Abstract]
[Full Text]
-
Rodriguez-Hernandez, C. J., Sanchez-Perez, I., Gil-Mascarell, R., Rodriguez-Afonso, A., Torres, A., Perona, R., Murguia, J. R.
(2003). The Immunosuppressant FK506 Uncovers a Positive Regulatory Cross-talk between the Hog1p and Gcn2p Pathways. J. Biol. Chem.
278: 33887-33895
[Abstract]
[Full Text]
-
Yaakov, G., Bell, M., Hohmann, S., Engelberg, D.
(2003). Combination of Two Activating Mutations in One HOG1 Gene Forms Hyperactive Enzymes That Induce Growth Arrest. Mol. Cell. Biol.
23: 4826-4840
[Abstract]
[Full Text]
-
Wojda, I., Alonso-Monge, R., Bebelman, J.-P., Mager, W. H., Siderius, M.
(2003). Response to high osmotic conditions and elevated temperature in Saccharomyces cerevisiae is controlled by intracellular glycerol and involves coordinate activity of MAP kinase pathways. Microbiology
149: 1193-1204
[Abstract]
[Full Text]
-
Enjalbert, B., Nantel, A., Whiteway, M.
(2003). Stress-induced Gene Expression in Candida albicans: Absence of a General Stress Response. Mol. Biol. Cell
14: 1460-1467
[Abstract]
[Full Text]
-
Page, N., Gerard-Vincent, M., Menard, P., Beaulieu, M., Azuma, M., Dijkgraaf, G. J. P., Li, H., Marcoux, J., Nguyen, T., Dowse, T., Sdicu, A.-M., Bussey, H.
(2003). A Saccharomyces cerevisiae Genome-Wide Mutant Screen for Altered Sensitivity to K1 Killer Toxin. Genetics
163: 875-894
[Abstract]
[Full Text]
-
Nadal, E. d., Casadome, L., Posas, F.
(2003). Targeting the MEF2-Like Transcription Factor Smp1 by the Stress-Activated Hog1 Mitogen-Activated Protein Kinase. Mol. Cell. Biol.
23: 229-237
[Abstract]
[Full Text]
-
Kaeberlein, M., Andalis, A. A., Fink, G. R., Guarente, L.
(2002). High Osmolarity Extends Life Span in Saccharomyces cerevisiae by a Mechanism Related to Calorie Restriction. Mol. Cell. Biol.
22: 8056-8066
[Abstract]
[Full Text]
-
Hohmann, S.
(2002). Osmotic Stress Signaling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev.
66: 300-372
[Abstract]
[Full Text]
-
Teige, M., Scheikl, E., Reiser, V., Ruis, H., Ammerer, G.
(2001). Rck2, a member of the calmodulin-protein kinase family, links protein synthesis to high osmolarity MAP kinase signaling in budding yeast. Proc. Natl. Acad. Sci. USA
98: 5625-5630
[Abstract]
[Full Text]
-
Causton, H. C., Ren, B., Koh, S. S., Harbison, C. T., Kanin, E., Jennings, E. G., Lee, T. I., True, H. L., Lander, E. S., Young, R. A.
(2001). Remodeling of Yeast Genome Expression in Response to Environmental Changes. Mol. Biol. Cell
12: 323-337
[Abstract]
[Full Text]
-
Pascual-Ahuir, A., Serrano, R., Proft, M.
(2001). The Sko1p Repressor and Gcn4p Activator Antagonistically Modulate Stress-Regulated Transcription in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 16-25
[Abstract]
[Full Text]
-
Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein, D., Brown, P. O.
(2000). Genomic Expression Programs in the Response of Yeast Cells to Environmental Changes. Mol. Biol. Cell
11: 4241-4257
[Abstract]
[Full Text]
-
Garreau, H., Hasan, R. N., Renault, G., Estruch, F., Boy-Marcotte, E., Jacquet, M.
(2000). Hyperphosphorylation of Msn2p and Msn4p in response to heat shock and the diauxic shift is inhibited by cAMP in Saccharomyces cerevisiae. Microbiology
146: 2113-2120
[Abstract]
[Full Text]
-
Garcia-Gimeno, M. A., Struhl, K.
(2000). Aca1 and Aca2, ATF/CREB Activators in Saccharomyces cerevisiae, Are Important for Carbon Source Utilization but Not the Response to Stress. Mol. Cell. Biol.
20: 4340-4349
[Abstract]
[Full Text]
-
Rep, M., Krantz, M., Thevelein, J. M., Hohmann, S.
(2000). The Transcriptional Response of Saccharomyces cerevisiae to Osmotic Shock. Hot1p AND Msn2p/Msn4p ARE REQUIRED FOR THE INDUCTION OF SUBSETS OF HIGH OSMOLARITY GLYCEROL PATHWAY-DEPENDENT GENES. J. Biol. Chem.
275: 8290-8300
[Abstract]
[Full Text]
-
Eriksson, P., Alipour, H., Adler, L., Blomberg, A.
(2000). Rap1p-binding Sites in the Saccharomyces cerevisiae GPD1 Promoter Are Involved in Its Response to NaCl. J. Biol. Chem.
275: 29368-29376
[Abstract]
[Full Text]
-
Pahlman, A.-K., Granath, K., Ansell, R., Hohmann, S., Adler, L.
(2001). The Yeast Glycerol 3-Phosphatases Gpp1p and Gpp2p Are Required for Glycerol Biosynthesis and Differentially Involved in the Cellular Responses to Osmotic, Anaerobic, and Oxidative Stress. J. Biol. Chem.
276: 3555-3563
[Abstract]
[Full Text]
-
Yale, J., Bohnert, H. J.
(2001). Transcript Expression in Saccharomyces cerevisiae at High Salinity. J. Biol. Chem.
276: 15996-16007
[Abstract]
[Full Text]
-
Posas, F., Chambers, J. R., Heyman, J. A., Hoeffler, J. P., de Nadal, E., Arino, J.
(2000). The Transcriptional Response of Yeast to Saline Stress. J. Biol. Chem.
275: 17249-17255
[Abstract]
[Full Text]