Previous Article | Next Article 
Molecular and Cellular Biology, August 1999, p. 5548-5556, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Human Transcription Factor hTAFII150
(CIF150) Is Involved in Transcriptional Regulation of Cell Cycle
Progression
Jay
Martin,
Robert
Halenbeck, and
Jörg
Kaufmann*
Chiron Corporation, Chiron Technologies,
Emeryville, California 94608
Received 2 February 1999/Returned for modification 15 March
1999/Accepted 25 May 1999
 |
ABSTRACT |
Here we present evidence that CIF150 (hTAFII150), the
human homolog of Drosophila TAFII150, plays an
important and selective role in establishing gene expression patterns
necessary for progression through the cell cycle. Gel filtration
experiments demonstrate that CIF150 (hTAFII150) seems to be
less tightly associated with human transcription factor IID than
hTAFII130 is associated with hTAFII250. The
transient functional knockout of CIF150 (hTAFII150) protein
led to cell cycle arrest at the G2/M transition in
mammalian cell lines. PCR display analysis with the RNA derived from
CIF150-depleted cells indicated that CIF150 (hTAFII150) is
required for the transcription of only a subset of RNA polymerase II
genes. CIF150 (hTAFII150) directly stimulated cyclin B1 and
cyclin A transcription in cotransfection assays and in vitro assays,
suggesting that the expression of these genes is dependent on CIF150
(hTAFII150) function. We defined a CIF150
(hTAFII150) consensus binding site and demonstrated that a
CIF150-responsive cis element is present in the cyclin B1
core promoter. These results suggest that one function of CIF150
(hTAFII150) is to select specific RNA polymerase II core
promoter elements involved in cell cycle progression.
 |
INTRODUCTION |
The regulation of cell growth at the
molecular level is a central problem in cancer biology research. Tumor
cells have established different mechanisms to bypass the normal
regulation of cellular proliferation including defects in cell cycle
checkpoints. The eukaryotic cell cycle is composed of four distinct
stages: G1, S, G2, and M (28). The
transitions between cell cycle stages are partly controlled by cyclins,
regulatory subunits of the cyclin-dependent kinases (34).
The gene expression of cyclins itself is cell cycle regulated (21,
33) and is crucial for maintaining normal cellular growth; the
deregulation of cyclin A and cyclin D1 has been correlated with
different human tumors (3, 13). Despite our extensive
knowledge of cyclin-dependent signaling pathways, the molecular
mechanisms for the periodic expression of the cyclins are not well understood.
The binding of general transcription factor IID (TFIID) to core
promoter elements is considered to initiate the formation of the RNA
polymerase II preinitiation complex (reviewed in references 20, 32, 37, and 49). The TATA
box, the initiator (Inr) sequence, a downstream promoter element (DPE),
and a TFIIB-specific sequence have been identified as core promoter
cis elements (4, 5, 19; for a review, see
reference 43). For promoters that contain a TATA box
the core promoter recognition is carried out by the TATA-binding
protein (TBP). However, many of the cyclin core promoters do not
contain a functional TATA box and are lacking defined transcriptional
start sites. In vitro binding studies have suggested that
TBP-associated factors (TAFIIs), which are subunits of the
TFIID complex, play a critical role in selecting core promoters
(4, 5, 16, 22, 35, 47, 48). Recently, a new
TAFII-containing complex lacking TBP has been described, supporting the view that TAFs play a role in promoter recognition (53), especially on TATA-less promoters.
TAFIIs were originally described as required coactivators
for activated transcription. Activated transcription can not be reconstituted by TBP alone in in vitro transcription assays but can be
observed in the presence of TFIID (reviewed in references 37 and 49). These results led to
the hypothesis that TAFIIs directly interact with activator
molecules bound to upstream sequences and thereby recruit general
transcription factors, including RNA polymerase II, to the promoter.
This view has been challenged by functional knockout experiments in
yeast, where activated transcription seems not to be globally affected
in the absence of certain TAFIIs. These results suggested
that some TAFIIs are dispensable for the activated
transcription of specific genes in yeast (1, 12, 26, 50,
51). More recently it has been shown that other histone-like
TAFIIs are more broadly required for transcription in yeast
(2, 25, 27). According to these reports, a critical role of
some yeast TAFIIs seems to be core promoter recognition rather than the mediation of activated transcription in general (for a
review, see references 9, 20, and
44). Recent in vitro studies using crude HeLa
nuclear extracts have also suggested that TAFIIs are not
universally required for activated transcription (29). It
should be noted that the two models for TAFII function are
not mutually exclusive and might only illustrate the functional redundancy of TAFIIs and other coactivators in promoting
activated transcription. One unifying explanation might be that only a
specific set of TAFIIs is required for mediating
transcriptional activation of a particular activator and that distinct
TFIID complexes might exist. For example Zhou and collaborators
demonstrated the in vivo importance of two TAFIIs in
Drosophila and showed that this TAFII dependence
was most severe in a subset of cells expressing the target gene
snail (55). Even more surprising is the discovery that one subset of TAFIIs in the TFIID complex is also an
integral component of histone acetylase complexes connecting the
polymerase II machinery with chromatin-modifying activities (8,
27, 30). A better understanding of TAFII
function in core promoter recognition and activation requires
additional comprehensive in vivo analysis.
We reported the identification of an essential cofactor for
TFIID-dependent Inr function, CIF150 (cofactor of Inr function) (17, 18). CIF150 protein shows striking homology to the
Drosophila TAFII150 protein
(dTAFII150) and some similarity to the essential yeast
protein TSM-1 (18, 36, 47). More recently, essentially the
same cDNA was cloned independently by Martinez and colleagues and named
human TAFII150 (hTAFII150) (23). In
contrast to what we published initially for CIF150, their fractionation
and immunopurification data suggest that hTAFII150 (CIF150)
is a tightly associated component of the human TFIID complex.
Interestingly, dTAFII250 and dTAFII150 have
been implicated in core promoter recognition (47, 48), suggesting that hTAFII150 (CIF150) might also have
sequence-specific DNA binding activity. In fact, a
temperature-sensitive mutant of the yeast homolog of
hTAFII150 (CIF150), TSM-1, has been reported to block cell
cycle progression through the G2 or M phase, revealing a
degree of promoter selectivity (36, 50).
In this study, we investigated the function of hTAFII150
(CIF150) in mammalian cells. Using HeLa nuclear extracts in gel
filtration experiments we demonstrated that in contrast to
hTAFII250 or hTAFII130, hTAFII150
(CIF150) readily dissociates from human TFIID complex. We demonstrated
that transient functional in vivo knockout experiments with
hTAFII150 (CIF150) led to cell cycle arrest in
G2 or M, similar to the phenotype of the
temperature-sensitive mutant of TSM-1 in yeast. The absence of
functional hTAFII150 (CIF150) protein affected only a
subset of class II genes, indicating that hTAFII150 (CIF150) seemed not to be required for RNA polymerase II
transcription in general. Furthermore, we demonstrated that
hTAFII150 (CIF150) has sequence-specific binding
activity which might explain the observed specificity. Finally, we
demonstrated that hTAFII150 (CIF150) is a positive
regulator of cyclin B1 transcription by characterizing a functional
CIF150 binding element (CBE) in the cyclin B1 promoter. Taken together,
our results indicate that hTAFII150 (CIF150) functions in
the recognition and selection of core promoters including cell
cycle-specific genes like cyclins A and B1.
 |
MATERIALS AND METHODS |
Purification of proteins and gel filtration of HeLa nuclear
extracts.
HeLa nuclear extracts and hTAFII150
(CIF150)-depleted nuclear extract were prepared as described previously
(7, 17, 18) and concentrated by ammonium sulfate
precipitation (30%). The depletion of hTAFII150 (CIF150)
protein was confirmed by Western blotting (data not shown; see
reference 18). One hundred microliters (10 mg/ml) of
ammonium sulfate-precipitated nuclear extracts, dialyzed against buffer
A (20 mM HEPES [pH 7.9], 1 mM EDTA, 3 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 20% glycerol) containing 0.1 or 1 M
KCl, was applied to a Superose 6 column (Pharmacia). The proteins were
eluted with buffer A (10% glycerol) containing 0.1 or 1 M KCl (flow
rate, 0.5 ml/min) and 500-µl fractions were collected. Every second
protein-containing fraction was analyzed by sodium dodecyl sulfate
(SDS)-6% polyacrylamide gel electrophoresis (PAGE), followed by
immunoblot analysis with an hTAFII150 (CIF150)-specific antibody generated against the N-terminal peptide MNRKKGDKGFESPRP or
monoclonal antibodies specific for hTAFII250 and
hTAFII130 (Santa Cruz Biotechnology, Inc.). Immunoblot
analyses were performed as described before (17). A control
gel filtration with three appropriate molecular weight standards was
performed under the same conditions. Recombinant hTAFII150
(CIF150) protein was purified from SF9 cells under native conditions by
using the baculovirus expression system (pBlueBacHis2; Invitrogen).
Whole-cell extract from baculovirus-infected SF9 cells was prepared by
sonication and applied to TALON metal affinity resin (Clontech)
according to the manufacturer's protocol applying imidazole step
elution. Recombinant hTAFII150 (CIF150) protein was tested
for CIF150 activity as described previously (17, 18) and
analyzed by SDS-8% PAGE, followed by silver staining.
Cell culture and cell cycle analysis.
IMR90 (normal human
lung fibroblasts) and HeLa cells were transfected with the
phosphothioate oligomers (100 to 400 nM) according to the protocol of
the manufacturer (Sequitur, Inc.) by using lipofection and OptiMEM
(Gibco BRL). The efficiency of transfection (around 90%) was
determined on the basis of green fluorescent protein (GFP) fluorescence
by using GFP-tagged control oligomers. The transfected cells were
harvested at different time points postlipofection for
fluorescence-activated cell sorting (FACS) and Western and Northern
analysis. Initially, four single-strand antisense oligomers were
designed to target distinct regions of hTAFII150 (CIF150)
mRNA. The functional antisense oligomer designated B
(5'TGCTCATGGAAGCATAAGCAGCCAC3') was used in combination with a control oligonucleotide Bx (5'CACCGACGAATACGAAGGTACTCGT3')
containing the reverse sequence (3'
5') of oligonucleotide B,
to ensure identical nucleotide content. To monitor cell synchrony,
106 cells from each sample were fixed in ethanol, treated
with RNase A (0.5 mg/ml for 1 h at 37°C), stained with propidium
iodide (40 µg/ml) for 2 h at 4°C, and then analyzed by flow
cytometry on a Becton Dickinson FACScan apparatus. Differential display
was performed as described by the manufacturer (Genomyx Corp.).
Transfection and reporter assays.
Cyclin A (nucleotides
887 to +136) (10) and cyclin B1 (nucleotides
893 to
+110) (6) promoter fragments were generated by PCR with HeLa
DNA and cloned into the promoterless pGL3 luciferase reporter vector
(Promega). All PCR-amplified fragments were verified by DNA sequencing.
Cotransfections were performed in HeLa cells by using different amounts
of a pEVRF1 (24)-based CIF150 expression vector
(pEVRF-CIF150) or a pEVRF1-Ob expression plasmid in combination with
the indicated reporter constructs. The expression of CIF150 (hTAFII150) protein was confirmed by Western blotting (data
not shown). The pEVRF1-Ob, cytomegalovirus (CMV), and minimal
c-Fos-luciferase constructs were a kind gift from K. Giese. Luciferase
activity was determined 36 h after transfection according to the
manufacturer's protocol (Promega).
In vitro transcription and in vitro DNA binding assays.
In
vitro transcription reactions were performed with the templates
containing the G-less cassette as described before (reference 17 and references therein). Plasmid DNAs containing
cyclin A, cyclin B1, and CMV promoter fragments were cloned upstream of a 180-bp G-less cassette by using a PCR protocol (17). The
immunoglobulin H (IgH) promoter construct fused to a G-less cassette
was a kind gift from J. D. Parvin and P. A. Sharp. For the
complementation assay, 8 µl of the CIF150-depleted nuclear extract (4 mg/ml) were preincubated for 30 min at 4°C in the presence of a DNA
template with 1, 2, and 4 µl of recombinant CIF150 protein (see Fig.
3A; 10 µl loaded), followed by the addition of ribonucleoside
triphosphates to yield the following final concentrations: 500 µM
ATP, 500 µM CTP, 500 µM GTP, and 30 µM
[
-32P]UTP. 32P-labeled RNA products were
digested for 15 min with RNase H1, resolved on an 8%
polyacrylamide-urea gel, and visualized by autoradiography. Electrophoretic mobility shift assays were performed by using 3 and 6 µl of CIF150 in 40 µl of GL buffer as previously described (18), with the exception that the reaction mixture contained 50 ng of dG-dC oligomer as competitor. After 30 min of incubation at
4°C the binding mixtures were loaded on a Tris-borate-EDTA (0.5×)-6% polyacrylamide gel, and the signals were visualized by
autoradiography. The signals were quantitated by PhosphorImager analysis (Bio-Rad, Inc.).
 |
RESULTS |
hTAFII150 (CIF150) is not as tightly associated
with hTAFII250 as hTAFII130.
At
least eight TAFIIs are associated with TBP in a complex
called TFIID (for reviews, see references 9, 10, 44,
and 46). Although the definition of a bona fide
TAFII (TATA-binding protein-associated factor) is
controversial, one biochemical criterion seems to be that a
TAFII copurifies with TBP when immunoaffinity methods are
employed under high salt conditions (1 M KCl in a phosphocellulose D
fraction). However, there is increasing evidence for distinct
TAFII-containing complexes in vivo, including a TBP-free TAF complex (53) and the recently discovered SAGA-PCAF
complex (8, 30; for a review see reference
44). In the Drosophila system
dTAFII150 is tightly associated with the TFIID complex, whereas in the mammalian system it is still controversial whether CIF150 (hTAFII150) is an integral component of human TFIID.
Martinez et al. recently described a TAFII150-containing
TFIID complex in which TAFII150 (CIF150) is apparently
associated with human TFIID (23). These results contradict
our earlier published results that CIF150 is only substoichiometrically
present in the TFIID complex. Here, we performed side-by-side
immunoblot experiments comparing CIF150 electrophoretic mobility to
that of hTAFII130 by SDS-PAGE (Fig.
1A). We used a polyclonal antibody highly
specific for recombinant CIF150 protein purified from bacculo-virus
extracts (Fig. 1A, lane 1; see also Fig. 3A). Recombinant CIF150,
native CIF150, and hTAFII130 have similar electrophoretic
mobilities (Fig. 1A). This result explains, as suggested by Martinez et
al., the difficulties to detect the 150-kDa protein in the
immunopurified TFIID complex (23). However, it was still
puzzling that we had originally succeeded in purifying
hTAFII150 (CIF150) in a complementation assay with
TFIID-containing fractions (17). To test the hypothesis that
our nuclear extract preparation method disrupts the association of
TFIID and CIF150, we performed gel filtration experiments. hTAFII250 and hTAFII130 coeluted from the gel
filtration column with an apparent molecular weight expected for TFIID
(Fig. 1B, fraction 3). This result clearly indicates that these two
TAFIIs are stably associated in the TFIID complex in our
nuclear extracts. However, CIF150 (hTAFII150) eluted at a
later fraction, suggesting that the majority of CIF150 protein is not
associated with the TFIID complex (Fig. 1B, middle panel). We performed
these experiments under high-salt (1 M KCl) as well as low-salt (0.1 M
KCl) conditions with the same result, suggesting that the disruption of
hTAFII150 (CIF150) and TFIID occurs during or before our
nuclear extract preparation.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
CIF150 (hTAFII150) seems to be less tightly
associated with holo TFIID than hTAFII250 and
hTAFII130. (A) Recombinant and native CIF150 have an
electrophoretic mobility in SDS-6% PAGE very similar to that of
hTAFII130. Shown is a side-by-side immunoblot analysis of
recombinant CIF150 (Rec.) (lane 1; 3 µl), native CIF150 (lane 2; 10 µl of HeLA nuclear extract [NE]) in comparison to
hTAFII130 (lane 4; 10 µl of HeLA nuclear extract [NE]).
Lane 3 contains molecular mass (M) standards (in kilodaltons). (B) Gel
filtration experiments with HeLa nuclear extracts (buffer A [10%
glycerol, 0.1 M KCl]) indicate a dissociation of CIF150 and human
TFIID. Immunoblot assays were performed with 4 µl of HeLa nuclear
extract (lane 1) (L) and gel filtration fractions 1 to 17 (lane 2 to
18, 20 µl loaded). The elutions of molecular mass standards are
indicated. V0, voided volume.
|
|
It is worth noting that we were able to detect a very weak
hTAF
II150 (CIF150)-specific signal in fraction 3 (Fig.
1B,
lane
4) when we overexposed the immunoblot (data not shown), indicating
that a small portion of hTAF
II150 (CIF150) protein might be
present
in the TFIID complex. As mentioned before we previously
demonstrated
by Far-Western analysis that hTAF
II150
(CIF150) interacts directly
with TAF
II130, suggesting that
hTAF
II150 (CIF150) is able to associate
with TFIID under
certain conditions. One possible difference in
the nuclear extract
preparations might be that our extracts contained
less DNA, since we
used ammonium sulfate precipitation to concentrate
our nuclear
extracts. Contaminating DNA might lead to coimmunoprecipitation
of DNA
binding proteins, explaining the tight association of
hTAF
II150
(CIF150) and TFIID in the above-mentioned
experiments by Martinez
et al. (
23). Taken together,
however, our data demonstrate that
under conditions where
TAF
II250 and TAF
II130 form a highly stable
complex, the majority of hTAF
II150 (CIF150) was not
associated
with the TFIID
complex.
Functional knockout of hTAFII150 (CIF150) is leading to
a cell cycle arrest in G2 or M.
The above results
suggested that CIF150 (hTAFII150) might function
independently of the holo TFIID complex. To investigate the potential
role of CIF150 protein in vivo, we attempted to knock out the function
of CIF150 transiently in human cells. Initially, we tested four
different CIF150-specific antisense phosphorothioate oligonucleotides
for their ability to modulate CIF150 function. The transfection of one
antisense oligonucleotide (B) into HeLa cells led to a
concentration-dependent increase of cells in the G2/M phase
and a decrease of cells in the G1 phase of the cell cycle
(Fig. 2A, right panel; data not shown),
whereas the other three oligomers had no effect on cell cycle
progression (data not shown). Since HeLa cells are highly transformed
and bear defects in cell cycle checkpoints (p53
and
RB
), we confirmed the antisense effect by using the
primary lung fibroblast cell line IMR90 (Fig. 2B). A control
oligonucleotide (Bx [reverse sequence of B]) did not affect the cell
cycle progression in either cell line (Fig. 2A and B). In Fig. 2C, we
analyzed the RNA derived from HeLa cells treated with antisense
oligonucleotide B and control oligonucleotide Bx. Quantitative reverse
transcription (RT)-PCR (Fig. 1C, lanes 1 to 6) as well as Northern
hybridization (lanes 7 to 10) revealed dramatically reduced CIF150 mRNA
levels 24 h after antisense oligonucleotide treatment. In order to
demonstrate the antisense oligonucleotide effect on the CIF150 protein
level we performed an immunoblot analysis with CIF150-specific
antiserum on cell lysates prepared from different time points after
antisense oligonucleotide treatment (Fig. 2D and E). The level of
CIF150 protein decreased 36 h after antisense oligonucleotide
treatment but remained unchanged after 24 h or in control
oligonucleotide-treated cells. Since the antisense oligomer was
transiently transfected, the CIF150 protein level increased again after
48 h (Fig. 2D, lane 3). At this point we do not know the exact
level of hTAFII150 (CIF150) depletion after our antisense
oligonucleotide treatment. It is possible that the remaining
hTAFII150 (CIF150) protein, which is undetectable by
immunoblotting, is sufficient for some hTAFII150 (CIF150)
function. One technical problem is the immanent toxicity and
instability of the oligonucleotides, preventing us from achieving a
more complete depletion for a longer period of time (Fig. 2D).
Nevertheless, the demonstrated dose-dependent effect with different
concentrations of antisense oligonucleotide B (Fig. 2E and A) suggests
that we at least partially deplete hTAFII150 (CIF150)
activity. Taken together our data indicate that hTAFII150
(CIF150) is likely to be involved in cell cycle progression through
G2/M, which is in agreement with one of the described
functions of the yeast homolog TSM-1 (50).






View larger version (198K):
[in this window]
[in a new window]
|
FIG. 2.
Functional knockout of CIF150 (hTAFII150)
protein leads to cell cycle arrest in G2 or M and to
reduced gene expression of cyclin B1. (A) Analyses of the cell cycle of
HeLa cells 36 h after transfection with the CIF150 specific
antisense oligomer B or oligomer Bx (reverse sequence). The different
concentrations of the oligomers are indicated. (B) Cell cycle analyses
of IMR90 cells after 36 h of oligomer treatment. (C) Total RNA,
derived from HeLa cells treated with oligomer B or Bx, analyzed by
quantitative RT-PCR (lanes 1 to 6, 100, 200, and 300 nM concentrations
of oligomer B and Bx) and Northern blot analysis (lanes 7 to 10) with
CIF150- and -actin-specific primers or 32P-labeled cDNA
probes. (D) HeLa cell extracts from different time points, after
antisense oligomer (400 nM) treatment, analyzed by immunoblotting for
the decrease of CIF150 protein. Control (C) nuclear extract (lane 1)
and molecular size markers (M) (lane 2) were loaded. (E) Cyclin B1
protein expression decreases after CIF150 antisense treatment (100, 200, and 300 nM) of HeLa cells. (F) Differential PCR display identifies
genes that are transcriptionally dependent on CIF150. A representative
nondenaturing gel of differential display products is shown. Total RNA
was prepared 24 h (lane 1 and 2) or 36 h (lane 3 and 4) after
oligomer transfection. Arrows indicate cDNAs which are specifically
upregulated or downregulated after antisense treatment.
|
|
Expression of a specific set of class II genes, including cyclin
B1, seems to be dependent on hTAFII150 (CIF150)
activity.
To confirm the results of our FACS analysis, we analyzed
cyclin B1 expression by using extracts from antisense and control oligomer-treated HeLa cells. Again, CIF150 protein levels were concentration-dependently reduced by using antisense oligonucleotide B
(Fig. 2E). The level of cyclin B1 expression seemed to be affected in
the same way by the antisense treatment, indicating a cell cycle arrest
and confirming the results of our FACS analysis (Fig. 2E). In order to
address the question of whether the decrease of cyclin B1 was the
result of a more general effect on transcription in the absence of
CIF150, we set out to determine the expression levels of other mRNAs.
As a first approach we analyzed RNA derived from cells treated with the
antisense or control oligomer (at 36 h [Fig. 2D]) by
differential PCR display. In this assay each band represents the RT-PCR
product of a specific mRNA. Only a minority of transcripts seemed to be
affected by the loss of hTAFII150 (CIF150) function (Fig.
2F), suggesting that hTAFII150 (CIF150) mediates the
selective transcription of a specific set of class II genes. In order
to identify potential hTAFII150 (CIF150)-dependent cDNAs,
we analyzed a limited set of the affected PCR fragments. In our initial
screen (with 40 PCR products analyzed) we identified the following
potential target genes of hTAFII150 (CIF150): ribosomal proteins L44, S10, and L7a, cyclin B1, ISGF-3, metallothionein II,
lipid kinase (68 kDa; type I), DNA methyltransferase, and 10 novel
human cDNAs including a human homolog of a Xenopus mitotic phosphoprotein (data not shown). Similar gene-specific effects have
been reported for a temperature-sensitive mutant of mammalian TAFII250 (11, 38, 40, 41, 45, 52) and after
functional knockout experiments using yeast TAFII90
(1) and TAFII145 (42, 50, 51). A more
comprehensive analysis has demonstrated more recently that about 15%
of all yeast genes show a significant decrease in expression upon heat
shock of a temperature-sensitive allele of yeast TAFII145,
establishing that not all RNA polymerase II transcription is dependent
on the yeast homolog of human TAFII250 (12). For
the later part of this article we decided to concentrate on the
hypothesis that hTAFII150 (CIF150) might be directly
involved in cyclin B1 and cyclin A (G2/M cyclins)
transcription (Fig. 2E).
hTAFII150 (CIF150) directly stimulates the TATA-less
cyclin B1 and cyclin A promoters.
Our differential PCR display
analysis, as well as the CIF150 or cyclin B1 immunoblot data after
antisense oligonucleotide treatment (Fig. 2E), indicated a correlation
between CIF150 activity and cyclin B1 transcription. These results
suggested that hTAFII150 (CIF150) might be a positive
regulator of this TATA-less promoter. In order to test this hypothesis
more directly we analyzed the effect of CIF150 on in vitro
transcription and cotransfection assays. For in vitro transcription we
used highly purified recombinant CIF150 protein (Fig.
3A) in combination with nuclear extracts chromatographically depleted of CIF150 activity as described previously (17, 18). In the absence of CIF150 activity we did not
observe cyclin B1 and A promoter-dependent transcription. The titration of CIF150 protein stimulated the TATA-less cyclin A and B1 promoters, indicating that CIF150 is required for their transcription (Fig. 3B;
compare lane 1 with lanes 2, 3, and 4). The TATA-containing control
promoters (IgH and CMV) were not affected by the absence of CIF150. To
demonstrate the TATA-less promoter-specific stimulation effect of
CIF150 in vivo, we performed cotransfection experiments with CIF150
expression vectors in combination with a luciferase reporter gene fused
to cyclin B1 and A promoter fragments. The overexpression of CIF150 had
only a minor effect on TATA-containing CMV and on minimal Fos promoter
activity but was able to stimulate cyclin B1 and cyclin A transcription
in HeLa cells (Fig. 3C). The upper panel of Fig. 3C shows the absolute
luciferase activities by using the c-Fos, cyclin B1, and cyclin A
promoters in cotransfection experiments with an unrelated expression
plasmid (pEVRF1-Ob) and CIF150 expression plasmid (pEVRF-CIF150). Both
the cyclin A and B1 promoters are preferentially stimulated by CIF150,
compared to the TATA-containing promoters c-Fos and CMV (Fig. 3C).
These findings support our in vitro data and suggest that
hTAFII150 (CIF150) is required for cyclin B1 and A
transcription but is more dispensable for the transcription of
TATA-containing promoters, including the CMV, IgH, and minimal Fos
promoters. It has been shown previously that a 90-bp upstream region of
the cyclin B1 promoter is sufficient to mediate cell cycle-dependent
transcription, supporting the idea of an involvement of the core
promoter in regulation (14). In addition, the preferential
stimulation of the TATA-less cyclin promoters by the overexpression of
hTAFII150 (CIF150) seems to confirm our biochemical data
that hTAFII150 (CIF150) is only substoichiometrically
present in the human TFIID complex (Fig. 1B). This indicates that
hTAFII150 (CIF150) activity might be limiting on specific
sets of promoters.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
CIF150 (hTAFII150) is a positive regulator
of cyclin B1 and cyclin A transcription. (A) Purified CIF150 was
visualized after SDS-PAGE by silver staining (20 µl loaded in lane
2). M, molecular size standards (in kilodaltons). (B) CIF150 is
required for cyclin B1 and cyclin A transcription but not for IgH and
CMV transcription. In vitro transcription was performed by using
CIF150-depleted nuclear extracts (lane 1) alone or in combination with
increasing amounts of recombinant CIF150 protein (lanes 2 to 4). (C)
Cotransfection of increasing amounts of CIF150 expression plasmid with
cyclin B1, cyclin A, CMV, and Fos promoter-driven luciferase reporter
constructs. Relative luciferase units are shown in the upper panel, and
fold stimulation is shown in the lower panel. The amount of CMV-derived
vector in each transfection assay was kept constant by using an
unrelated expression plasmid (pEVRF1-Ob). The values shown are the
averages from at least four independent transfection experiments ± standard deviations (error bars).
|
|
hTAFII150 (CIF150) binds DNA sequence
specifically.
Since dTAFII150 has been reported to
recognize specific core promoter elements (47, 48), we have
begun to identify a cis-acting CIF150-responsive element. As
a first step, we performed binding-site selection (31) by
using highly purified recombinant CIF150 (Fig. 3A). A pool of DNA
fragments with 7 bp of randomized nucleotide pairs were 32P
labeled and used in three successive rounds of gel shift experiments (Fig. 4A). The data in Fig. 4B show that
the selected protein-DNA complex was specific for the CIF150 protein as
demonstrated by a supershift induced by CIF150-specific antiserum. The
DNA sequences of 44 selected PCR fragments revealed a statistically
significant enrichment of fragments with the core sequence 5'GAG3'
after the alignment of the sequences (Fig. 4C; data not shown). We
estimate that we improved the binding affinity of CIF150 only fivefold after four rounds of selection (Fig. 4A; data not shown). This might be
due to the presence of cryptic binding sites within the flanking
sequences of the PCR primers (Fig. 4C) and/or the ability of CIF150 to
form relatively stable complexes nonspecifically with DNA. It is
therefore possible that the consensus sequence we identified depended
partly on some initial nonrandomized flanking sequence. To validate the
putative sequence element we performed electrophoretic mobility shift
experiments by using DNA fragments with defined base pair substitutions
(Fig. 4D). Substitutions of the GAG core sequence reduced CIF150
binding dramatically, compared to flanking substitutions (Fig. 4D;
compare oligonucleotides a and d with oligonucleotides b, c, e, f, and
g). These experiments demonstrate that CIF150 binds the GAG core
sequence with higher affinity than randomized DNA, indicating a
potential role of CIF150 (hTAFII150) in promoter
recognition and selection. The final selected consensus sequence is
very short (Py X GAG [A/C] [A/Py]), and we do not know yet whether
this sequence is part of a larger high-affinity site. Therefore, using
longer randomized sequences for the initial selection experiment might
lead to a stronger hTAFII150 (CIF150) consensus binding
site. Taken together the demonstrated preference for
hTAFII150 (CIF150) binding to a GAG-containing core
sequence might only be a starting point for a more detailed analysis.
However, a loosely defined consensus sequence has also been reported
for the Inr (Py Py A +1 N [T/A] Py Py) and DPE (G [A/T]
C G) elements, which are both considered to be recognized by
TAFIIs (4, 5, 43).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
CIF150 (hTAFII150) has sequence-specific
binding activity. (A) CIF150 binding-site selection. The arrow
indicates the specific protein-DNA complex. (B) The addition of
anti-CIF150 (lane 4) but not that of preimmune serum (lane 3)
supershifted the retarded band. (C) Consensus CBE derived after four
rounds of binding-site selection. (D) Point mutational analysis of the
CBE by gel shift experiments. The sequences of the oligonucleotides
used are shown at the bottom, with the nucleotides (in bold) that
differ from oligonucleotide d (100%). The results are representative
of three independent experiments.
|
|
Mutation in one putative CIF50 binding element (CBE) in the cyclin
B1 core promoter abolishes stimulation by CIF150
(hTAFII150).
The cyclin B1 core promoter contains two
putative CBEs (GAG core sequences) flanking a noncanonical TATA box
(Fig. 5; see reference
6). In order to test the role of CIF150 in promoter recognition directly, we mutated both putative CBEs in the cyclin B1
core promoter and tested these constructs in cotransfection experiments. The mutation of the upstream site (Fig. 5, Mut 2) did not
affect the stimulation of the cyclin B1 promoter by CIF150. However,
the substitution of a putative binding site (5'GAGGCTA3') just 4 bp downstream of a noncanonical TATA box abolished the stimulation of reporter activity by CIF150 (Fig. 5). These data suggest
that CIF150 interacts with the cyclin B1 promoter in a sequence-specific manner to stimulate transcription. Moreover, these
results provide more evidence to support the view that one of the
regulatory functions of TAFIIs, including CIF150, is to select core promoters through the sequence-specific recognition of DNA.
Although we originally identified CIF150 (hTAFII150) as a
cofactor for Inr function, the DNA-binding analyses as well as our
mutational analyses of the cyclin B1 core promoter suggest that
hTAFII150 (CIF150) may not be involved in Inr recognition itself. Our current working model is that hTAFII150
(CIF150) contacts DNA downstream of the
25 region but upstream of the
start site and thereby stabilizes TFIID binding preferentially on
TATA-less promoters, whereas another protein in the TFIID complex (most likely, TAFII250) binds directly to the Inr element.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Identification of a CBE in the cyclin B1 core promoter.
Shown is the cotransfection of increasing amounts of CIF150 expression
plasmid (1 and 2 µg) with cyclin B1 wild-type (wt) and cyclin B1
promoter mutant constructs fused to a luciferase reporter plasmid. The
amount of CMV-derived vector in each transfection assay was kept
constant by using an unrelated expression plasmid (pEVRF1-Ob). The
values shown are the averages of four independent experiments ± standard deviations (error bars). An arrow indicates the transcription
start site, and the 25 region of the promoter is underlined. Bold
nucleotides indicate the changes in the mutated promoter constructs.
|
|
 |
DISCUSSION |
It is evident from in vitro studies that TAFIIs serve
multiple functions as coactivators for activated transcription and also play an important role as promoter selectivity factors (reviewed in
references 9, 20, 37, 49). Although
TAFIIs are integral components of the general transcription
machinery, individual TAFIIs might be required by only a
distinct subset of activators or a subset of RNA polymerase II core
promoters. We employed transient functional knockout experiments with
these essential genes as one approach to elucidate the function of
individual TAFIIs in vivo. Our experiments demonstrated for
the first time that the transient depletion of CIF150
(hTAFII150) in mammalian cells leads to a cell cycle arrest
phenotype. These results are in agreement with experiments obtained
with temperature-sensitive mutants of the yeast homolog TSM-1
(50). Analysis of the RNA derived from HeLa cells depleted
of hTAFII150 (CIF150) protein suggests that hTAFII150 (CIF150) is not an absolute requirement for all
RNA polymerase II-dependent transcription in mammalian cells.
Furthermore, we present evidence that hTAFII150 (CIF150)
exhibited specificity for TATA-less promoters, including the cell
cycle-specific cyclin A and B1 promoters. However, at this point we do
not know whether the hTAFII150 (CIF150)-dependent
transcription of the TATA-less cyclin B1 and cyclin A promoters is TBP dependent.
It is worth noting that the TBP-free TFTC complex described by
Wieczorek et al. (53) did contain additional polypeptides, including one of the same size as hTAFII150 (CIF150). An
attractive hypothesis is that hTAFII150 (CIF150) binding to
the CBE might compensate for the absence of TBP binding to the TATA
box. Similar models have been suggested for the Inr-, TAF-, and
DPE-dTAFII60 interactions (4, 5, 48, 49), which
are most likely functionally analogous to the CIF150-CBE interaction in
compensating for a weak or missing TATA box interaction. However,
hTAFII150 (CIF150)-dependent transcription seems to be
different in that the overexpression of hTAFII150 (CIF150)
directly stimulates transcription from TATA-less cyclin promoters,
suggesting that CIF150 activity, but not TFIID, is limiting on these
promoters. Furthermore, we were able to demonstrate that
hTAFII150 (CIF150) seemed to be more dispensable for the transcription of TATA-containing promoters by using in vitro
complementation assays and cotransfection assays. These results
together with the functional knockout experiments presented suggest
that hTAFII150 (CIF150) might be initiating gene-specific
transcription without necessarily being stably integrated into the
human TFIID complex. Our gel filtration results demonstrated that at
least a portion of the hTAFII150 (CIF150) protein can
dissociate from TFIID under low-salt conditions. As mentioned before,
the absence of a tight interaction between TFIID and
hTAFII150 (CIF150) is reminiscent of the TFIID-TFIIA
interaction. TFIIA and dTAFII150 are tightly associated
with the TFIID complex in Drosophila cells but not in human
cells (54). A hypothesis that would include our results is
that hTAFII150 (CIF150) may have a function related to
TFIIA in stabilizing the TFIID-DNA interaction (18).
Whether hTAFII150 (CIF150) also plays a role in mediating
activated transcription, as a direct target of activation domains is
currently unknown and warrants further study. Addressing this question
is important in light of studies demonstrating that
TAFII250 function in cyclin A promoter-dependent
transcription is apparently associated with both enhancer and core
promoter elements (52).
The implication of hTAFII150 (CIF150) in cell cycle
progression is not unprecedented. It has been demonstrated that other TAFIIs play an important role in the regulation of cell
growth and cell cycle progression (26, 38, 39, 40, 42, 45, 52). Further experiments are needed to elucidate the cell cycle regulation of hTAFII150 (CIF150) itself.
hTAFII150 (CIF150) might be phosphorylated by
cyclin-cyclin-dependent kinase complexes to modulate CIF150 activity
or degradation of CIF150 protein during cell cycle progression. We wish
to emphasize that the positive regulation of cyclin B1 and cyclin A
transcription by hTAFII150 (CIF150) does not exclude other
activating and repressing mechanisms of cell cycle-regulated
transcription. Several mechanisms of transcriptional repression have
been proposed, including chromatin structure changes of the promoter
region, inhibition of general transcription factors, and DNA binding
competition (for a review, see reference 15).
In summary, our data suggest that the mammalian TAF-like protein CIF150
(hTAFII150) is a necessary positive transcriptional regulator of cell cycle progression through G2/M. The
depletion of CIF150 (hTAFII150) activity in vivo seems to
selectively affect a subset of class II promoters, and CIF150 activity
appears to be one rate-limiting step for cyclin B1 transcription.
Future studies of the regulatory role of hTAFII150 (CIF150)
in signal transduction pathways should provide more insights into the
regulation of the eukaryotic cell cycle.
 |
ACKNOWLEDGMENTS |
We thank T. Shi and T. Brown for FACS analysis, L. Cornroy and S. Widger for baculovirus expression of CIF150, T. Wolf for selection and
synthesis of the antisense oligomers, and M. Innis, N. Marini, A. Klippel, C. Reinhardt, K. Giese, and K. Ahrens for their helpful
discussions and comments on the manuscript. We also thank J. Escobedo
and L. T. Williams for their support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Chiron
Corporation, Chiron Technologies, 4560 Horton St., Emeryville, CA
94608. Phone: (510) 923-6946. Fax: (510) 923-5550. E-mail:
Joerg_Kaufmann{at}chiron.com.
 |
REFERENCES |
| 1.
|
Apone, L. M.,
C. A. Virbasius,
J. C. Reese, and M. R. Green.
1996.
Yeast TAFII90 is required for cell-cycle progression through G2/M but not for general transcription activation.
Genes Dev.
10:2368-2380[Abstract/Free Full Text].
|
| 2.
|
Apone, L. M.,
C. A. Virbasius,
F. C. Holstege,
J. Wang,
R. A. Young, and M. R. Green.
1998.
Broad, but not universal, transcriptional requirement for yTAFII17, a histone H3-like TAFII present in TFIID and SAGA.
Mol. Cell
2:653-661[Medline].
|
| 3.
|
Brechot, C.
1993.
Oncogenic activation of cyclin A.
Curr. Opin. Genet. Dev.
3:11-18[Medline].
|
| 4.
|
Burke, T. W., and J. T. Kadonaga.
1996.
Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters.
Genes Dev.
10:711-724[Abstract/Free Full Text].
|
| 5.
|
Burke, T. W., and J. T. Kadonaga.
1997.
The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila.
Genes Dev.
11:3020-3031[Abstract/Free Full Text].
|
| 6.
|
Cogswell, J. P.,
M. M. Godlevski,
M. Bonham,
J. Bisi, and L. Babiss.
1995.
Upstream stimulatory factor regulates expression of the cell cycle-dependent cyclin B1 gene promoter.
Mol. Cell. Biol.
15:2782-2790[Abstract].
|
| 7.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 8.
|
Grant, P. A.,
D. Schieltz,
M. G. Pray-Grant,
D. J. Steger,
J. C. Reese,
J. R. Yates III, and J. L. Workman.
1998.
A subset of TAFIIs are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation.
Cell
94:45-53[Medline].
|
| 9.
|
Hahn, S.
1998.
The role of TAFs in RNA polymerase II transcription.
Cell
95:579-582[Medline].
|
| 10.
|
Henglein, B.,
X. Chenivesse,
J. Wang,
D. Eick, and C. Brechot.
1994.
Structure and cell cycle-regulated transcription of the human cyclin A gene.
Proc. Natl. Acad. Sci. USA
91:5490-5494[Abstract/Free Full Text].
|
| 11.
|
Hisatake, K.,
S. Hasegawa,
R. Takada,
Y. Nakatani,
M. Horikoshi, and R. G. Roeder.
1993.
The p250 subunit of native TATA-binding factor TFIID is the cell-cycle regulatory protein CCG1.
Nature
362:179-181[Medline].
|
| 12.
|
Holstege, F. C. P.,
E. G. Jennings,
J. J. Wyrick,
T. I. Lee,
C. J. Hengartner,
M. R. Green,
T. R. Golub,
E. S. Lander, and R. A. Young.
1998.
Dissecting the regulatory circuitry of a eukaryotic genome.
Cell
95:717-728[Medline].
|
| 13.
|
Hunter, T., and J. Pines.
1994.
Cyclins and cancer II: cyclin D and CDK inhibitors come of age.
Cell
79:573-582[Medline].
|
| 14.
|
Hwang, A.,
A. Maity,
W. G. McKenna, and R. J. Muschel.
1995.
Cell cycle-dependent regulation of the cyclin B1 promoter.
J. Biol. Chem.
270:28419-28424[Abstract/Free Full Text].
|
| 15.
|
Johnson, A. D.
1995.
The price of repression.
Cell
81:655-658[Medline].
|
| 16.
|
Kaufmann, J., and S. T. Smale.
1994.
Direct recognition of initiator elements by a component of the transcription factor IID complex.
Genes Dev.
8:821-829[Abstract/Free Full Text].
|
| 17.
|
Kaufmann, J.,
C. P. Verrijzer,
J. Shao, and S. T. Smale.
1996.
CIF, an essential cofactor for TFIID-dependent initiator function.
Genes Dev.
10:873-886[Abstract/Free Full Text].
|
| 18.
|
Kaufmann, J.,
K. Ahrens,
R. Koop,
S. T. Smale, and R. Mueller.
1998.
CIF150, a human cofactor for transcription factor IID-dependent initiator function.
Mol. Cell. Biol.
18:233-239[Abstract/Free Full Text].
|
| 19.
|
Lagrange, T.,
A. N. Kapanidis,
H. Tang,
D. Reinberg, and R. H. Ebright.
1998.
New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB.
Genes Dev.
12:34-44[Abstract/Free Full Text].
|
| 20.
|
Lee, T. I., and R. A. Young.
1998.
Regulation of gene expression by TBP-associated proteins.
Genes Dev.
12:1398-1408[Free Full Text].
|
| 21.
|
Lew, D. J.,
V. Dulic, and S. I. Reed.
1991.
Isolation of three novel human cyclins by rescue of G1 cyclin (Cln) function in yeast.
Cell
66:1197-1206[Medline].
|
| 22.
|
Martinez, E.,
C. M. Chiang,
H. Ge, and R. G. Roeder.
1994.
TAFs in TFIID function through the initiator to direct basal transcription from a TATA-less class II promoter.
EMBO J.
13:3115-3126[Medline].
|
| 23.
|
Martinez, E.,
H. Ge,
Y. Tao,
C. X. Yuan,
V. Palhan, and R. G. Roeder.
1998.
Novel cofactors and TFIIA mediate functional core promoter selectivity by the human TAFII150-containing TFIID complex.
Mol. Cell. Biol.
18:6571-6583[Abstract/Free Full Text].
|
| 24.
|
Matthias, P.,
M. M. Mueller,
E. Schreiber,
S. Rusconi, and W. Schaffner.
1989.
Eukaryotic expression vectors for analysis of mutant proteins.
Nucleic Acids Res.
17:6418[Free Full Text].
|
| 25.
|
Michel, B.,
P. Komarnitsky, and S. Buratowski.
1998.
Histone-like TAFs are essential for transcription in vivo.
Mol. Cell
2:663-673[Medline].
|
| 26.
|
Moqtaderi, Z.,
Y. Bai,
D. Poon,
A. P. Weil, and K. Struhl.
1996.
TBP-associated factors are not generally required for transcriptional activation in yeast.
Nature
383:188-191[Medline].
|
| 27.
|
Moqtaderi, Z.,
M. Keaveney, and K. Struhl.
1998.
The histone H3-like TAF is broadly required for transcription in yeast.
Mol. Cell
2:675-682[Medline].
|
| 28.
|
Murray, A., and T. Hunt.
1993.
The cell cycle. W. H.
Freeman and Company, New York, N.Y.
|
| 29.
|
Oelgeschlager, T.,
Y. Tao,
Y. K. Kang, and R. G. Roeder.
1998.
Transcription activation via enhanced preinitiation complex assembly in a human cell-free system lacking TAFIIs.
Mol. Cell
1:925-931[Medline].
|
| 30.
|
Ogryzko, V. V.,
T. Kotani,
X. Zhang,
R. L. Schiltz,
T. Howard,
X.-J. Yang,
B. H. Howard,
J. Qin, and Y. Nakatani.
1998.
Histone-like TAFs within the PCAF histone acetylase complex.
Cell
94:35-44[Medline].
|
| 31.
|
Oliphant, A. R.,
C. J. Brandl, and K. Struhl.
1989.
Defining the sequence specificity of DNA-binding proteins by selecting binding sites from random-sequence oligonucleotides: analysis of yeast GCN4 protein.
Mol. Cell. Biol.
9:2944-2949[Abstract/Free Full Text].
|
| 32.
|
Orphanides, G.,
T. Lagrange, and D. Reinberg.
1996.
The general transcription factors of RNA polymerase II.
Genes Dev.
10:2657-2683[Free Full Text].
|
| 33.
|
Pines, J., and T. Hunter.
1990.
Human cyclin A is adenovirus E1A-associated protein p60 and behaves differently from cyclin B.
Nature
346:760-763[Medline].
|
| 34.
|
Pines, J.
1993.
Cyclins and cyclin-dependent kinases: take your partners.
Trends Biochem. Sci.
18:195-197[Medline].
|
| 35.
|
Purnell, B. A.,
P. A. Emanuel, and D. S. Gilmour.
1994.
TFIID sequence recognition of the initiator and sequence farther downstream in Drosophila class II genes.
Genes Dev.
8:830-842[Abstract/Free Full Text].
|
| 36.
|
Ray, B. L.,
C. I. White, and J. E. Haber.
1991.
The TSM1 gene of Saccharomyces cerevisiae overlaps the MAT locus.
Curr. Genet.
20:25-31[Medline].
|
| 37.
|
Roeder, R. G.
1996.
The role of general initiation factors in transcription by RNA polymerase II.
Trends Biochem. Sci.
21:327-335[Medline].
|
| 38.
|
Ruppert, S.,
E. H. Wang, and R. Tjian.
1993.
Cloning and expression of human TAFII250: a TBP-associated factor implicated in cell-cycle regulation.
Nature
362:175-179[Medline].
|
| 39.
|
Segil, N.,
M. Guermah,
A. Hoffmann,
R. G. Roeder, and N. Heintz.
1996.
Mitotic regulation of TFIID: inhibition of activator-dependent transcription and changes in subcellular localization.
Genes Dev.
10:2389-2400[Abstract/Free Full Text].
|
| 40.
|
Sekiguchi, T.,
Y. Nohiro,
Y. Nakamura,
N. Hisamoto, and T. Nishimoto.
1991.
The human CCG1 gene, essential for progression of the G1 phase, encodes a 210-kilodalton nuclear DNA-binding protein.
Mol. Cell. Biol.
11:3317-3325[Abstract/Free Full Text].
|
| 41.
|
Sekiguchi, T.,
E. Noguchi,
T. Hatashida,
T. Nakshima,
H. Toyoshima,
T. Nichimoto, and T. Hunter.
1996.
D-type cyclin expression is decreased and p21 and p27 CDK inhibitor expression is increased when tsBN462 CCG1/TAFII250 mutant cells arrest in G1 at the restrictive temperature.
Genes Cell
1:687-705[Abstract].
|
| 42.
|
Shen, W.-C., and M. R. Green.
1997.
Yeast TAFII145 functions as a core promoter selectivity factor, not a general coactivator.
Cell
90:615-624[Medline].
|
| 43.
|
Smale, S. T.
1994.
Architecture of core promoters for eukaryotic protein-coding genes, p. 63-81.
In
R. C. Conaway, and J. W. Conaway (ed.), Transcription: mechanisms and regulation. Raven Press, New York, N.Y.
|
| 44.
|
Struhl, K., and Z. Moqtaderi.
1998.
The TAFs in the HAT.
Cell
94:1-4[Medline].
|
| 45.
|
Suzuki-Yagawa, Y.,
M. Guermah, and R. G. Roeder.
1997.
The ts13 mutation in the TAFII250 subunit (CCG1) of TFIID directly affects transcription of D-type cyclin genes in cells arrested in G1 at the nonpermissive temperature.
Mol. Cell. Biol.
17:3284-3294[Abstract].
|
| 46.
|
Tansey, W. P., and W. Herr.
1997.
TAFs: guilt by association?
Cell
88:729-732[Medline].
|
| 47.
|
Verrijzer, C. P.,
K. Yokomori,
J.-L. Chen, and R. Tjian.
1994.
Drosophila TAFII150: similarity to yeast gene TSM-1 and specific binding to core promoter DNA.
Science
264:933-941[Abstract/Free Full Text].
|
| 48.
|
Verrijzer, C. P.,
J.-L. Chen,
K. Yokomori, and R. Tjian.
1995.
Binding of TAF's to core elements directs promoter selectivity by RNA polymerase II.
Cell
81:1115-1125[Medline].
|
| 49.
|
Verrijzer, C. P., and R. Tjian.
1996.
TAF's mediate transcriptional activation and promoter selectivity.
Trends Biochem. Sci.
21:338-342[Medline].
|
| 50.
|
Walker, S. S.,
J. C. Reese,
L. M. Apone, and M. R. Green.
1996.
Transcription activation in cells lacking TAFIIs.
Nature
383:185-188[Medline].
|
| 51.
|
Walker, S. S.,
W.-C. Shen,
J. C. Reese,
L. M. Apone, and M. R. Green.
1997.
Yeast TAFII145 required for transcription of G1/S cyclin genes and regulated by the cellular growth state.
Cell
90:607-614[Medline].
|
| 52.
|
Wang, E. H.,
S. Zou, and R. Tjian.
1997.
TAFII250-dependent transcription of cyclin A is directed by ATF activator proteins.
Genes Dev.
11:2658-2669[Abstract/Free Full Text].
|
| 53.
|
Wieczorek, E.,
M. Brand,
X. Jacq, and L. Tora.
1998.
Function of TAFII-containing complex without TBP in transcription by RNA polymerase II.
Nature
393:187-191[Medline].
|
| 54.
|
Yokomori, K.,
A. Admon,
J. A. Goodrich,
J.-L. Chen, and R. Tjian.
1993.
Drosophila TFIIA-L is processed into two subunits that are associated with the TBP/TAF complex.
Genes Dev.
7:2235-2245[Abstract/Free Full Text].
|
| 55.
|
Zhou, J.,
J. Zwicker,
P. Szymanski,
M. Levine, and R. Tjian.
1998.
TAFII mutations disrupt Dorsal activation in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
95:13483-13488[Abstract/Free Full Text].
|
Molecular and Cellular Biology, August 1999, p. 5548-5556, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deato, M. D. E., Tjian, R.
(2007). Switching of the core transcription machinery during myogenesis. Genes Dev.
21: 2137-2149
[Abstract]
[Full Text]
-
Udayakumar, T. S., Belakavadi, M., Choi, K.-H., Pandey, P. K., Fondell, J. D.
(2006). Regulation of Aurora-A Kinase Gene Expression via GABP Recruitment of TRAP220/MED1. J. Biol. Chem.
281: 14691-14699
[Abstract]
[Full Text]
-
Maile, T., Kwoczynski, S., Katzenberger, R. J., Wassarman, D. A., Sauer, F.
(2004). TAF1 Activates Transcription by Phosphorylation of Serine 33 in Histone H2B. Science
304: 1010-1014
[Abstract]
[Full Text]
-
Jurchott, K., Bergmann, S., Stein, U., Walther, W., Janz, M., Manni, I., Piaggio, G., Fietze, E., Dietel, M., Royer, H.-D.
(2003). YB-1 as a Cell Cycle-regulated Transcription Factor Facilitating Cyclin A and Cyclin B1 Gene Expression. J. Biol. Chem.
278: 27988-27996
[Abstract]
[Full Text]
-
Munz, C., Psichari, E., Mandilis, D., Lavigne, A.-C., Spiliotaki, M., Oehler, T., Davidson, I., Tora, L., Angel, P., Pintzas, A.
(2003). TAF7 (TAFII55) Plays a Role in the Transcription Activation by c-Jun. J. Biol. Chem.
278: 21510-21516
[Abstract]
[Full Text]
-
Yamazaki, K., Aso, T., Ohnishi, Y., Ohno, M., Tamura, K., Shuin, T., Kitajima, S., Nakabeppu, Y.
(2003). Mammalian Elongin A Is Not Essential for Cell Viability but Is Required for Proper Cell Cycle Progression with Limited Alteration of Gene Expression. J. Biol. Chem.
278: 13585-13589
[Abstract]
[Full Text]
-
Frontini, M., Imbriano, C., diSilvio, A., Bell, B., Bogni, A., Romier, C., Moras, D., Tora, L., Davidson, I., Mantovani, R.
(2002). NF-Y Recruitment of TFIID, Multiple Interactions with Histone Fold TAFIIs. J. Biol. Chem.
277: 5841-5848
[Abstract]
[Full Text]
-
Um, M., Yamauchi, J., Kato, S., Manley, J. L.
(2001). Heterozygous Disruption of the TATA-Binding Protein Gene in DT40 Cells Causes Reduced cdc25B Phosphatase Expression and Delayed Mitosis. Mol. Cell. Biol.
21: 2435-2448
[Abstract]
[Full Text]
-
Hernández-Hernández, A., Ferrús, A.
(2001). Prodos Is a Conserved Transcriptional Regulator That Interacts with dTAFII16 in Drosophila melanogaster. Mol. Cell. Biol.
21: 614-623
[Abstract]
[Full Text]
-
Macpherson, N., Measday, V., Moore, L., Andrews, B.
(2000). A Yeast taf17 Mutant Requires the Swi6 Transcriptional Activator for Viability and Shows Defects in Cell Cycle-Regulated Transcription. Genetics
154: 1561-1576
[Abstract]
[Full Text]
-
Furukawa, T., Tanese, N.
(2000). Assembly of Partial TFIID Complexes in Mammalian Cells Reveals Distinct Activities Associated with Individual TATA Box-binding Protein-associated Factors. J. Biol. Chem.
275: 29847-29856
[Abstract]
[Full Text]