INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

B-cell development is characterized by the ordered assembly of immunoglobulin (Ig) heavy- and light-chain genes from their component gene segments by a site-specific DNA rearrangement reaction known as V(D)J recombination (61). This reaction is regulated such that heavy-chain genes assemble before light-chain genes, and an individual B cell expresses only one functional gene of each type (allelic exclusion [44, 46]). Heavy-chain protein is expressed on the surfaces of developing pre-B cells along with surrogate light chains and the signal transduction molecules Ig and Ig in a complex known as the pre-B-cell receptor (pre-BCR). The pre-BCR is a critical regulator of development, responsible for the activation of Ig-light-chain locus rearrangement and the inactivation of allelic heavy-chain locus rearrangement (35, 49, 52). Mutational inactivation of any of the components of the pre-BCR leads to developmental arrest at a distinct stage of B-cell development (13, 23, 24).

Developing pro-B cells which fail to assemble the pre-BCR undergo apoptosis, whereas cells expressing the pre-BCR increase expression of the anti-apoptotic Bcl-x_L gene and survive for an extended period (10). Furthermore, the ongoing expression of surface Ig is essential for B-cell viability (26). Due to the sum of these processes, the great majority of developing B cells fail to survive.

In addition to regulating gene rearrangement and cell survival, the pre-BCR signals specific alterations in the transcription of several developmentally regulated genes, including those encoding Bcl-x, TdT, and 5, and the germline  light chain locus (10, 27, 58). In order to more fully define the set of genes regulated by expression of the pre-BCR, we isolated developmentally arrested pro-B cells from RAG1-deficient mice, pre-B cells from RAG1-deficient/µ-transgenic mice (58) and mature B cells from wild-type spleen, and used RNA from these cells to perform representational difference analysis (RDA [19, 29]). This approach led to the isolation of a large set of cDNA fragments whose expression was either positively or negatively regulated by expression of the pre-BCR. Strikingly, many of the genes encode proteins involved in apoptosis. We report here on the regulated expression and posttranslational modification of one of these genes, encoding protein kinase C (PKC), and present evidence suggesting that PKC may be involved in the regulation of programmed cell death by the pre-BCR.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Purification of CD19⁺ B cells. B cells were purified from the bone marrow of RAG1-deficient and RAG1-deficient/µ-transgenic mice (58) and from the spleen of wild-type mice by using biotinylated monoclonal rat anti-mouse CD19 antibody (25) and streptavidin paramagnetic beads (MiniMacs system; Milltenyi Biotech) as previously described (54). In some experiments, less-mature bone marrow B-lineage cells were purified by the depletion of secretory IgM-positive (sIgM⁺) cells by using a monoclonal rat anti-mouse IgM antibody, yielding a mixed population of pro-B and pre-B cells, followed by selection with biotinylated anti-CD19 antibody. In addition, wild-type pro-B and pre-B cells were processed in a fluorescence-activated cell sorter (FACS) with anti-CD19, -CD43, and -IgM antibodies. The purity of selected populations was assessed by flow cytometry by using biotinylated monoclonal rat anti-mouse CD19, fluorescein isothiocyanate-conjugated monoclonal rat anti-mouse CD43 (17), and phycoerythrin-conjugated goat anti-mouse IgM antiserum (Southern Biotech).

RDA procedure. Cells were pelleted and poly(A)⁺ RNA was directly purified with the Micro-FastTrack mRNA Isolation Kit (Invitrogen). Poly(A)⁺ RNA was converted to double-stranded cDNA by using the cDNA Synthesis System (Gibco BRL) according to the manufacturer's instructions. cDNA (2 µg) was then digested with DpnII, phenol extracted, ethanol precipitated, and resuspended in 20 µl of TE (10 mM Tris [pH 8.0], 0.1 mM EDTA). The digested cDNA (12 µl) was then used for RDA as previously described (19). Final difference products after two rounds of subtraction were digested with DpnII and cloned into the BamHI site of pBluescript II KS(+) (Stratagene). Plasmid DNA was obtained by miniprep purification, digested with BamHI, and analyzed on 1.2% agarose gels. Inserts were gel purified, radioactively labelled by random priming (Boehringer Mannheim), and hybridized to Southern blots of amplified cDNA representing pro-B- and pre-B-cell populations. Inserts displaying differential expression were sequenced with an ABI Dideoxy Terminator Cycle sequencing apparatus (Applied Biosystems), and resulting sequences were compared to the GenBank database with the BLAST program (2).

Library screening. The RAG1-deficient/µ-transgenic cDNA library was prepared in gt22A by using the SUPERSCRIPT lambda system for cDNA synthesis and  cloning (Gibco BRL). Plaque hybridizations were performed with replica nitrocellulose filters from plates containing 10⁴ cDNA clones. Subtracted RDA probes (described above) were labelled by random priming (Boehringer Mannheim). Hybridizations were carried out for 3 days at 42°C in 25 mM NaH₂PO₄-Na₂HPO₄ (pH 7.0), 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 1× Denhardt's solution, 250 mg of denatured salmon sperm DNA per ml, 50% formamide, 10% dextran sulfate, and 2% sodium dodecyl sulfate (SDS). Washings were performed in 2× SSC-0.1% SDS for 45 min at 68°C, followed by autoradiography. Clones hybridizing to subtracted probes were picked and replated for a secondary screen.

Plasmids. Full-length PKC (FL-PKC) cDNA (a kind gift from J. F. Mushinski, National Institutes of Health [NIH]) was constitutively expressed in 220-8 cells by using the pEFB expression vector (38) modified by addition of the neomycin resistance gene. FL-PKC, truncated PKC (T-PKC), and mutant T-PKC (muT-PKC) were conditionally expressed in 220-8 cells (53) by using a tetracycline-regulated system. 220-8 cell clones containing the pcDNA-tTak regulatory plasmid (57) were provided by Ann Sheehy. FL-PKC, T-PKC, and muT-PKC were cloned into pTet-Splice (57) modified by addition of the neomycin resistance gene. T-PKC was generated by PCR by using FL-PKC plasmid DNA as a template, and its integrity was confirmed by DNA sequencing. The primers for this amplification (GCTCTAGAAGCTTGGCAGGGATGGGTCTCC and GGAATTCCTACAGTTGCAATTCCG) included restriction enzyme sites for cloning and were used to amplify 50 ng of plasmid DNA in a 25-cycle PCR at 94°C for 1 min, 66°C for 2 min, followed by a 10-min final extension at 72°C. muT-PKC was generated by using the Altered Sites II in vitro mutagenesis system (Promega) and was sequenced to confirm mutation. The sequence of the oligonucleotide used to mutate the ATP binding site of PKC was AGAACTGTACGCCGTGAATTCGCTGAAGAA.

Immunological reagents. Antibodies used in this study were polyclonal rabbit anti-mouse PKC directed against the unique carboxyl terminus of mouse PKC (amino acids 669-683) (Santa Cruz Biotechnology) followed by polyclonal donkey anti-rabbit IgG conjugated to horseradish peroxidase (Amersham) and polyclonal anti-human poly(ADP-ribose) polymerase (PARP) from patient sera (a gift of Antony Rosen) followed by polyclonal goat anti-human IgG conjugated to horseradish peroxidase (Southern Biotechnology Associates, Inc.).

Cell cycle analysis. For cell cycle analysis, cultured cells were pulsed with 10 µM bromodeoxyuridine (BrdU) (Sigma) for 1 h in RPMI-1640 (Mediatech) supplemented with 10% heat-inactivated fetal calf serum, penicillin-streptomycin, and 50 µM -mercaptoethanol (RPMI-10% fetal calf serum) at 37°C and 5% CO₂. Cells were then fixed in ice-cold 70% ethanol (EtOH) and incubated for 20 min at room temperature, washed with phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) (wash buffer), and centrifuged. The pellet was resuspended in 0.5 ml of denaturing solution (2 M HCl, 0.5% BSA), incubated for 20 min at room temperature, centrifuged, and incubated for 2 min at room temperature in 0.5 ml of 0.1 M sodium borate. Cells were washed once in wash buffer and incubated with mouse anti-human BrdU monoclonal antibody (Pharmingen) in wash buffer plus 0.5% Tween 20 for 20 min at room temperature. Cells were then washed once with wash buffer and incubated for 20 min with fluorescein isothiocyanate-conjugated goat anti-mouse IgG at room temperature. After a final wash, cells were resuspended in 7-AAD (a fluorescent dye used to measure DNA content) at 15 mg/ml of PBS. All analyses were performed on a Becton-Dickinson FACScan instrument with CellQuest software.

Gel electrophoresis and immunoblotting. Cells were washed once with PBS and then lysed in SDS sample buffer (5 × 10⁶ cells/80 µl of sample buffer; 10% glycerol, 3% SDS, 50 mM Tris [pH 6.8]). Protein concentrations were determined by the bicinchoninic acid protein assay (Pierce) with BSA as a standard. SDS-7.5% polyacrylamide gel electrophoresis (SDS-PAGE) was performed, and the product was transferred to nitrocellulose (Schleicher and Schuell) in Tris-glycine-methanol buffer. Membranes were blocked in PBS-0.1% Tween containing 5% nonfat dry milk. Membranes were incubated with a 1/500 dilution of primary antibodies, followed by incubation with a 1/5,000 dilution of donkey anti-rabbit or goat anti-human horseradish peroxidase-conjugated antibodies and detection by enhanced chemiluminescence (Amersham).

Cell culture and induction of apoptosis. 220-8 cells (53) were cultured at 37°C with 5% CO₂ in 10% RPMI medium. Apoptosis was induced by using two different protocols: (i) irradiation for 5 min with UV-B (0.5 mW/cm²) in PBS followed by incubation at 37°C with 5% CO₂ in 10% RPMI medium for 24 h or (ii) incubation at 37°C with 5% CO₂ in 10% RPMI medium supplemented with 2 µg of etoposide per ml (Sigma) for 48 h. Cell death by apoptosis was confirmed by ethidium bromide visualization of internucleosomal DNA cleavage on 0.7% agarose gels. DNA was purified as previously described (50). 220-8 cells harboring the tetracycline-regulated plasmids were maintained in 10% RPMI medium supplemented with 0.5 mg of G418 per ml, 1.2 µg of mycophenolic acid per ml, 250 µg of xanthine per ml, 15 µg of hypoxanthine per ml, and 1 µg of tetracycline-HCl (Sigma) per ml. For protein induction, cells were washed and cultured in 10% RPMI medium in the absence of tetracycline.

Protease inhibitors. Leupeptin (stock concentration, 4.2 mM in water), pepstatin A (1.4 mM in dimethyl sulfoxide [DMSO]), chymostatin (10 mM in DMSO), and the caspase inhibitors Ac-YVAD-CHO (50 mM in water), Z-VAD-FMK (50 mM in methanol), and Z-DEVD-FMK (50 mM in DMSO) were purchased from Calbiochem. Tosyl-L-lysine chloromethyl ketone (TLCK) (100 mM in water) and tosyl-L-phenylalanine chloromethyl ketone (TPCK) (57 mM in EtOH) were obtained from Boehringer Mannheim. Iodoacetamide (10 mM in water) was obtained from Sigma. Protease inhibitors were added to culture medium immediately after UV-B irradiation.

In vitro translation and caspase cleavage. PKC was in vitro translated from pBluescript vector by using the TnT T7 Quick System (Promega) according to the manufacturer's instructions. Recombinant caspase-3 with an activity of 250 relative fluorescence units/min/µl when DEVD-AMC was used as a substrate was provided by Christine Kikly (SmithKline). Cleavage reaction mixtures contained 4 µl of in vitro-translated PKC and 3 µl of purified recombinant caspase-3. Caspase reaction buffer (100 mM HEPES [pH 7.5]-10% sucrose-0.1% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate [CHAPS]-10 mM dithiothreitol) was added to bring the total volume of reaction to 30 µl. Reactions were carried out at 37°C overnight (~15 h). Samples were separated by SDS-PAGE and analyzed by Western blot analysis.

In-gel protein kinase assays. In-gel kinase assays were performed as described with minor modification (9, 12). Protein extracts were subjected to electrophoresis on an SDS-4% polyacrylamide stacking gel and an SDS-7.5% polyacrylamide separating gel. Myelin basic protein (MBP) (0.5 mg/ml; Sigma) was added to the separating gel just prior to polymerization. Following electrophoresis, SDS was removed from the gel by washing five times in 50 mM Tris-HCl (pH 7.6) for 15 min each. The gel was subsequently incubated in a solution containing 40 mM Tris-HCl (pH 7.6), 0.1 mM EGTA, 0.1 mM EDTA, 10 mM MgCl₂, 0.4 mM dithiothreitol, and 250 µCi of [-³²P]ATP for 2 h at 25°C. Gels were washed three times with a solution containing 40 mM Tris-HCl (pH 7.6), 1 mM EDTA, 2.5 mM sodium pyrophosphate, and 5% (wt/vol) Dowex 2 × 8 resin (20/50 mesh; Fluka) for 1 h to remove unincorporated ³²P. The gel was briefly rinsed with deionized water and fixed with three washes in 10% (wt/vol) trichloroacetic acid at 70°C for 1 h. The gel was then sealed in a plastic bag and exposed directly to film.

RNA PCR analysis. RNA was prepared from cells by a modification of the acid guanidine thiocyanate-phenol-chloroform extraction method (52). RNA PCR assays were performed with randomly primed cDNA (51). Then 2 µl of cDNA was amplified in a 25-µl reaction mixture by using previously described conditions (52). Primers for control H-2 PCR and for the germline kappa transcript were identical to those used previously (52). The PKC primers were ATGTCGTCCGGCACGATGAA and GACACCGAATATGTACTTC.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Isolation of pro-B-cell- and pre-B-cell-specific cDNA clones. We used the subtractive cDNA cloning strategy of RDA to identify genes whose activity is affected by expression of Ig-heavy-chain protein during B-cell development (19, 29). In wild-type mice, pro-B cells (fractions A to C) are CD43⁺/CD19⁺, while pre-B and later-stage B cells are CD43/CD19⁺ (fractions D to F [17]). In RAG1-deficient mice, B-cell development is arrested at the CD43⁺ pro-B-cell stage, while expression of a transgenic heavy-chain protein (µ) in RAG1-deficient/µ-transgenic mice allows progression to the CD43 pre-B-cell stage (Fig. 1A) (58). Using biotinylated anti-CD19 antibodies and streptavidin paramagnetic beads, we purified CD19⁺/CD43⁺ cells from RAG1-deficient mouse bone marrow (Fig. 1A) (pro-B, fractions A to C) and CD19⁺/CD43 cells from RAG1-deficient/µ-transgenic mice (pre-B, fraction D). In addition, we purified CD19⁺ surface IgM⁺ cells (fractions E and F) from wild-type spleen. cDNA synthesized by using RNA obtained from these various purified cell fractions was used in a series of RDA experiments. We then used subtracted RDA sequences to probe a RAG1-deficient/µ-transgenic pre-B-cell cDNA library.

View larger version (49K): [in this window] [in a new window]   FIG. 1.   PKC expression during B-cell development. (A) Two-color flow cytometric analysis of isolated murine bone marrow cells (upper panels). Unfractionated wild-type bone marrow cells were resolved into fractions A to F by staining with anti-CD19 and either anti-IgM or anti-CD43 monoclonal antibodies (14) (lower panels). CD19+ cells were purified from the bone marrow of RAG1-deficient (Rag1/) and RAG1-deficient/µ-transgenic (RAG1//µ) mice by using biotinylated anti-CD19 antibody and streptavidin paramagnetic beads. Purified cells were analyzed by staining with anti-CD19 and anti-CD43 antibodies. (B) RT-PCR analysis of PKC expression. Equivalent amounts of total RNA purified from the indicated organs (lanes 1 through 4), IgM+ splenocytes (mature B cells, lane 5), CD19+ IgM bone marrow (pro-B and pre-B cells, lane 6), RAG1-deficient CD19 bone marrow (pro-B cells, lane 7; lower panel part A) and RAG1-deficient/µ-transgenic CD19+ bone marrow (pre-B cells, lane 8; lower panels part A) were reverse transcribed and analyzed by PCR with primers specific for PKC and H-2 (an MHC class I transcript used to confirm the integrity and equivalence of each sample). Controls included PCR analysis of genomic DNA (lane 9) and a mock cDNA reaction (no RNA). Products were separated by gel electrophoresis, blotted to nylon filters, and hybridized with radioactive probes specific for each transcript. Phosphorimages of the blots are shown. (C) RT-PCR analysis of PKC expression in RNA purified from sorted wild-type pro-B and pre-B cells. Pro-B and pre-B cells were purified by FACS from wild-type bone marrow by using anti-CD19, anti-CD43, and anti-IgM antibodies, and RNA was purified. Aliquots of randomly primed cDNA generated from these RNAs were analyzed for transcription of PKC, the germline kappa transcript (ko), and H-2. Both undiluted and 1:10-diluted cDNA was analyzed as indicated. Lane 1 contained H2O in place of template. The phosphorimage of PCR product blots is shown.

Stage-specific expression of PKC during B-cell development. We chose to further characterize one gene from the group implicated in apoptosis, the gene encoding PKC. To examine the pattern of expression of PKC mRNA, we performed RT-PCR analysis on RNA purified from various murine tissues. Amplification of a major histocompatibility complex (MHC) class I gene transcript expressed at similar levels in all cells showed that there were similar amounts of amplifiable cDNA in each sample (Fig. 1B, H-2 lanes). We found high levels of PKC transcripts in thymocytes, IgM bone marrow-derived B-cell precursors from wild-type mice, and bone marrow-derived pro-B cells from RAG1-deficient mice (Fig. 1B, PKC). Interestingly, we detected extremely low levels of PKC transcripts in pre-B cells purified from RAG1-deficient/µ-transgenic bone marrow. We confirmed this difference between pro-B and pre-B expression levels by analyzing RNA purified from wild-type CD19⁺/CD43⁺ pro-B and CD19⁺/CD43 IgM pre-B cells. We found that pro-B cells expressed approximately 10-fold more PKC mRNA than pre-B cells (Fig. 1C, compare lanes 2 and 3 with lanes 4 and 5). IgM⁺ splenic B-cell RNA contained a higher level of PKC transcripts than did unfractionated splenocyte RNA, suggesting that mature T lymphocytes express lower levels of PKC mRNA than do mature B lymphocytes (Fig. 1B, lanes 4 and 5). We also detected expression in cells harvested from brain and kidney (lanes 1 and 2), thus confirming and extending previous reports characterizing the broad pattern of expression of PKC (4, 36).

PKC is cleaved during B-cell development. We used antisera specific for PKC to examine PKC expression in lymphocytes at the protein level. We detected a single 80-kDa protein, corresponding in molecular mass to FL-PKC, in thymocytes and splenocytes (Fig. 2A, lanes 1 and 3). However, the pattern of PKC expression detected by Western blot in RAG1-deficient pro-B cells, RAG1-deficient/µ-transgenic pre-B cells, and a mixture of wild-type pro-B and pre-B cells was more complex. In addition to the 80-kDa band corresponding to FL-PKC, we also detected a 50-kDa immunoreactive species (Fig. 2B, PKC lanes 1 to 3). Since our anti-PKC antiserum was raised against a peptide corresponding to amino acids 669 to 683 in the carboxy terminus of mouse PKC, we hypothesized that the 50-kDa band contains the C-terminal kinase domain of PKC. Both the 80- and 50-kDa Western blot bands were specific in that they could be competed by the immunogenic peptide (data not shown).

View larger version (41K): [in this window] [in a new window]   FIG. 2.   Western blot analysis of PKC expression in developing lymphocytes. (A) PKC expression in gamma-irradiated lymphocytes. Single cell suspensions from thymus and spleen were either cultured directly (lanes labelled ) or subjected to 1,000 rads of gamma irradiation and cultured for 15 h (lanes labelled +). Cells were lysed, and equal amounts of protein (20 µg) were subjected to immunoblot analysis with anti-PKC antiserum. Lane 5 contains a lysate of a pro-B cell line transfected with an expression vector containing the PKC cDNA (clone A4) and induced to undergo apoptosis by UV-B irradiation. Arrows indicate FL-PKC (80 kDa) and a smaller polypeptide which specifically reacts with anti-PKC antisera (50 kDa). (B) (Upper) PKC expression in purified B-cell populations. Cells from the bone marrow of RAG1-deficient (pro-B), RAG1-deficient/µ-transgenic (pre-B), and wild-type (pro-B plus pre-B) mice were harvested, and B-cell precursors were purified by positive selection based on the expression of CD19 and negative selection for surface IgM (see Materials and Methods). The lane labelled A4/UV-B shows lysates prepared from transfected pro-B cell clone A4, as described above. Identical cell equivalents (106) were analyzed by immunoblotting by using anti-PKC antisera. Arrows indicate the 80-kDa FL-PKC and the 50-kDa immunoreactive fragment. (Lower) The immunoblot shown in panel A was stripped and reprobed with anti-PARP antisera. Arrows denote full-length PARP (113 kDa) and cleaved PARP (89 kDa).

PKC cleavage is induced by various proapoptotic stimuli in a transfected pro-B cell line. We used the Abelson virus-transformed pro-B cell line 220-8 to further examine the relationship between PKC and apoptosis. Endogenous PKC was undetectable in 220-8 cells by Western blot analysis but was readily detectable after stable transfection with an expression vector containing the FL-PKC cDNA (Fig. 3A, compare lanes 1, 5, 7, and 9). Treatment of cells with the anticancer drug etoposide, a DNA-damaging agent, results in the induction of apoptosis (5, 63). In 220-8 PKC transfectants, etoposide-induced apoptosis was associated with cleavage of PKC to a 50-kDa fragment (Fig. 3A, lanes 6, 8, and 10) and the characteristic internucleosomal cleavage of chromosomal DNA (Fig. 3B, lanes 2 and 4). Similar results were obtained with apoptosis induced by the DNA-damaging agent camptothecin and by UV-B irradiation (Fig. 2A, lane 5; Fig. 2B, lane 4; and data not shown). This 50-kDa apoptosis-induced cleavage product comigrates with the 50-kDa PKC species expressed in developing B cells (Fig. 2B).

View larger version (36K): [in this window] [in a new window]   FIG. 3.   PKC is cleaved to a 50-kDa fragment during apoptosis. (A) Western blot analysis of 220-8 pro-B cells transfected with a PKC expression vector and induced to undergo apoptosis. Untransfected (lanes 1 and 2), empty-vector transfected (vector clone B1, lanes 3 and 4), and PKC-transfected 220-8 cells (clones A4, A5, and A6, lanes 5 to 10) were cultured in the absence () or presence (+) of 2 µg of etoposide per ml for 48 h. Lysates were subjected to immunoblot analysis with anti-PKC antisera. Arrows indicate FL-PKC (80 kDa) and cleaved PKC (50 kDa). Equivalent amounts of protein (20 µg) were analyzed. (B) Etoposide treatment leads to apoptosis, as evidenced by DNA fragmentation. Control untransfected (lanes 1 and 2) and PKC-expression-vector-transfected 220-8 cells (lanes 3 and 4) were treated with etoposide as described above. DNA was harvested and equal amounts (1 µg) were electrophoresed through 0.7% agarose gels and visualized with ethidium bromide staining.

Protease inhibitors block UV-B-induced cleavage of PKC. Genetic and biochemical studies have demonstrated that proteases of the caspase family are involved in the induction of apoptosis (34, 65). The finding that proteolytic cleavage of PKC and PKC occurs between aspartic acid and asparagine at sites similar to one cleaved in caspase-1 (9, 18) raised the possibility that a caspase family member was involved in cleavage of PKC. To address this issue, PKC-transfected 220-8 cells were stimulated to undergo apoptosis by UV-B irradiation in the presence of various protease inhibitors. Chymostatin, pepstatin A, and leupeptin did not prevent cleavage of PKC (Fig. 4A, lanes 11 to 13). In contrast, TPCK, TLCK, and iodoacetamide abolished the cleavage of PKC (Fig. 4A, lanes 5 to 10). Thus, the sensitivity of PKC cleavage to protease inhibitors is identical to that observed for PARP and U1-70-kDa cleavage in apoptotic cells (5, 20).

View larger version (50K): [in this window] [in a new window]   FIG. 4.   Effect of protease inhibitors on PKC cleavage. (A) PKC-transfected 220-8 cells (clone A4) were irradiated with UV-B and incubated for 24 h in growth medium containing the indicated protease inhibitors. Cells were then lysed, and equivalent amounts of protein (20 µg) were immunoblotted with anti-PKC antisera. Lysates from a control culture (no protease inhibitors, lane 1) or cultures with the various drug diluents (lanes 2 to 4) are shown. The arrows indicate FL- and cleaved PKC. (B) Caspase inhibitors block the generation of the 50-kDa PKC fragment. The caspase inhibitors Ac-YVAD-CHO (lanes 3 to 6), Z-VAD-FMK (lanes 9 to 12), and Z-DEVD-FMK (lanes 15 to 18) were added to cells described in panel A during a 24-h culture period after UV-B treatment, and cells were lysed, and subjected to immunoblot analysis with anti-PKC antisera. The open triangle indicates increasing levels of inhibitor (25, 50, 100, and 200 µM). Control samples with no protease inhibitor (lanes 2, 8, and 14) or drug diluent (lanes 1, 7, and 13) are shown to the left of each set. The arrows indicate FL- and cleaved PKC. (C) Recombinant caspase-3 cleaves PKC in vitro. In vitro-translated FL-PKC (lanes 2 and 3) or T-PKC (lanes 4 and 5) was incubated for 15 h at 37°C in the absence (lanes 2 and 4) or presence (lanes 3 and 5) of purified recombinant caspase-3 and subjected to immunoblot analysis with anti-PKC antisera. Lane 1 contains a lysate of PKC-transfected cells (clone A4) induced to undergo apoptosis in response to UV-B irradiation. The arrows indicate the intact (80 kDa) and proteolysed (50 kDa) forms of FL-PKC.

Cleavage of PKC is associated with activation of its kinase function. To explore the biological significance of PKC cleavage in developing B cells, we assessed whether cleavage of PKC during apoptosis resulted in activation of its kinase function. An in-gel kinase assay was used to detect phosphorylation of a known substrate for all PKC isoforms, myelin basic protein (9). Kinase activity was restricted to PKC-transfected cells induced to undergo UV-B-induced apoptosis (Fig. 5B, lane 6) and comigrated with the 50-kDa fragment detected by immunoblot analysis in apoptotic cell lysates (Fig. 5A, lane 2). As predicted, the FL-PKC protein did not have kinase activity in the absence of added coactivators. Taken together, these findings indicate that cleavage of PKC during apoptosis in 220-8 cells is associated with activation of its kinase function.

View larger version (24K): [in this window] [in a new window]   FIG. 5.   Apoptosis activates a 50-kDa kinase in PKC-transfected 220-8 cells. (A) Western blot analysis of PKC-transfected 220-8 cells induced to undergo apoptosis by UV-B treatment. PKC-transfected (clone A4; lanes 1 and 2) and untransfected (lanes 3 and 4) 220-8 cells were treated with UV-B, cultured for 24 h, and lysed. Equal amounts (20 µg) of lysate were subjected to immunoblot analysis with anti-PKC antisera. Asterisks denote the 80-kDa and 50-kDa FL- and cleaved PKC proteins, respectively. (B) In-gel kinase assay. Lysates (20 µg) from cells described in panel A were electrophoresed through gels containing 0.5 µg of myelin basic protein per ml incorporated in the gel matrix. Following gel electrophoresis, SDS was washed from the gels, and a kinase reaction with [-32P]ATP was carried out in vitro. After unincorporated radioactive material was removed, the gel was fixed and exposed to film. A phosphorimage of the gel is shown.

Inducible expression of either FL-PKC or T-PKC in transformed pro-B cells alters cell cycle progression. To determine whether PKC contributes to apoptosis, we expressed FL-PKC, T-PKC, and a kinase-deficient muT-PKC (Lys-383 in the ATP-binding site mutated to Asn) in 220-8 cells by using a tetracycline-regulated expression system (57). A diagram of the FL-PKC, T-PKC, and muT-PKC constructs is shown in Fig. 6A. These constructs were expressed under the control of the tTA transactivator, comprised of the Escherichia coli tetracycline repressor fused to the transactivation domain of the herpes virus VP16 protein. The addition of tetracycline to the culture medium blocks transcription of PKC by preventing binding of tTA to tetO operator sequences present within the promoter of the PKC expression construct. We used Western blot analysis to confirm the expression of the various PKC constructs upon tetracycline withdrawal (Fig. 6B). As described above, T-PKC and muT-PKC migrated with slightly faster mobility on an SDS-polyacrylamide gel than the UV-B-induced 50-kDa cleavage product of FL-PKC.

View larger version (27K): [in this window] [in a new window]   FIG. 6.   Tetracycline-regulated expression of PKC in transfected cell lines. (A) Schematic of PKC. The FL-PKC construct contains both the regulatory regions (V1 and C1) and the kinase regions (C3, V4, C4, and V5) separated by V3. The truncated constructs (T-PKC and muT-PKC) contain only the kinase region and use internal ATGs present in the V3 region to initiate translation. MuT-PKC contains Asn substituted for Lys403 in the ATP binding site. The putative site for apoptosis-induced cleavage is shown upstream of the ATG in V3. (B) Western blot analysis of tetracycline-regulated expression of PKC. Extracts (20 µg) from vector-transfected (vector clones 1 and 2; lanes 1 to 4), FL-PKC-transfected (clones 6 and 13; lanes 5 to 8), T-PKC-transfected (clones 2 and 3; lanes 9 to 12), and muT-PKC-transfected (clones 4 and 8; lanes 13 and 14) 220-8 cells grown for 96 h in the presence (+) or absence () of 1 µg of tetracycline per ml were subjected to immunoblot analysis by using anti-PKC antisera. The last lane, labelled A4/UV-B, shows PKC-transfected clone A4 induced to undergo apoptosis by UV-B treatment. Arrows denote 80-kDa FL-PKC, 50-kDa cleaved PKC, and a slightly smaller T-PKC fragment.

View larger version (38K): [in this window] [in a new window]   FIG. 7.   T-PKC expression arrests cell cycle progression in G1 and induces apoptosis. (A) Flow cytometric analysis of cell cycle status. Cells (as described in the legend to Fig. 6B) were grown in the absence of tetracycline for 96 h and pulsed with 10 µM BrdU for 1 h. Cells were then permeabilized, stained with monoclonal anti-BrdU antibody and 7-AAD, and analyzed for DNA content by flow cytometry. Representative analyses of empty-vector transfected control cells (clone V2) (left) and T-PKC-transfected cells (clone T2) (right) are shown with the boxed regions indicating cells in G0/G1, S, and G2/M. Each cell culture was subjected to identical analysis. (B) The percentage of cells in each phase of the cell cycle is depicted in a bar graph. The identity of each clone is indicated below each set of bars. Flow cytometry data was gated on live cells by using forward and side-scatter criteria. (C) Cells (as described in the legend to Fig. 6B) were grown for 96 h in the presence (+) or absence () of 1 µg of tetracycline per ml, and DNA fragmentation was monitored by gel electrophoresis in 0.7% agarose gels. A digital photograph of the ethidium-stained gel is shown.

Induction of apoptosis by overexpression of PKC catalytic fragments. Having found that PKC was cleaved into a kinase-active form during apoptosis, we sought to clarify the role of the catalytic fragment of PKC in contributing to apoptosis itself. We assayed the transfectants described above for endonucleolytic cleavage of nuclear DNA by agarose gel electrophoresis (Fig. 7C). Induction of T-PKC expression was associated with DNA fragmentation indicative of apoptosis (lanes 10 and 12). This was not observed upon induction of FL-PKC (lanes 5 to 8) or control-vector transfectants (lanes 1 to 4). Furthermore, the kinase-inactive muT-PKC failed to induce DNA fragmentation (lanes 13 to 16), supporting a role for the C-terminal kinase domain of PKC in the apoptotic pathway.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Members of the PKC family are serine and threonine kinases with a wide range of physiological functions. These enzymes are activated upon external stimulation of cells by various ligands, including hormones, neurotransmitters, and growth factors (reviewed in reference 40). The 11 known isoforms of PKC have been divided into the classical (cPKC; , , and ), novel (nPKC; , , , , and µ), and atypical (aPKC;  and ) groups (1). The Ca²⁺-dependent cPKCs contain the conserved regulatory regions C1 and C2, while the Ca²⁺-independent nPKC and aPKC isoforms lack the Ca²⁺-binding C2 domain (40).

Proteolytic cleavage is known to regulate the activity of several PKC isoforms. cPKCs undergo cleavage in V3 by the calcium-activated proteases calpain I and II, deleting the C1 and C2 regulatory regions and resulting in kinase-active fragments (22). Other studies have shown that the PKC and  isoforms are cleaved and activated by the cysteine protease caspase-3 in cells induced to undergo apoptosis (7, 9). Caspase-3-mediated cleavage of PKC at a DMQD/N site, and PKC at a DEVD/K site, deletes the C1 regulatory domain. Overexpression of the anti-apoptotic proteins Bcl-2 and Bcl-x_L blocked cleavage of both kinases, while overexpression of the cleaved, kinase-active PKC fragment resulted in apoptosis (7, 9).

We found that PKC mRNA is expressed at high levels in purified pro-B cells and early-stage thymocytes, and at lower levels in purified pre-B cells, mature B cells, and unfractionated spleen (Fig. 1). Analysis of PKC at the protein level revealed a more complex pattern of expression (Fig. 2). FL-PKC was predominant in purified bone marrow pro-B cells and nearly absent from pre-B cells. The truncated form of PKC was present in similar amounts at both developmental stages, but the ratio of cleaved to full-length protein was clearly increased in pre-B cells.

Thymocytes and unfractionated bone marrow cells cleave endogenous PKC into a 50-kDa fragment in response to gamma irradiation (Fig. 2A and data not shown). While not expressed in a variety of transformed pro-B cell lines, PKC is cleaved in a pro-B cell line transfected with PKC cDNA and induced to undergo apoptosis with a variety of DNA-damaging agents. Surprisingly, PKC was relatively resistant to irradiation-induced cleavage in mature splenic lymphocytes, suggesting that susceptibility of PKC to irradiation-induced apoptosis and proteolysis may be a developmentally regulated characteristic of B and T lymphocytes.

Inducible expression of either FL- or T-PKC in 220-8 cells led to a cell cycle arrest (Fig. 7B). In the case of the truncated protein, this arrest was accompanied by apoptotic cell death (Fig. 7C). Both of these effects required intact kinase activity, as the kinase-inactive mutant failed to induce cell cycle arrest or apoptosis. Previous reports have shown that ectopic expression of FL-PKC in NIH 3T3 fibroblasts blocked phosphorylation of Rb protein and inhibited cell growth in quiescent cultures restimulated to enter the cell cycle (31). PKC inhibition of cell growth in these systems correlated with increased expression of cyclin E and of the cyclin-dependent kinase inhibitors p21 and p27. Furthermore, in contrast to control NIH 3T3 cells, cells transfected with PKC could be induced to undergo adipocyte differentiation. In the epidermis, high levels of PKC expression are detected in the suprabasal layers where keratinocytes undergo differentiation (41). These data are consistent with a model where altered expression of cell cycle-related genes may contribute to the ability of PKC to promote cellular differentiation. Thus, PKC can regulate the cell cycle, promote differentiation, and contribute to apoptosis. The existence of two forms of PKC, having overlapping and distinct effects, complicates analysis of the potential roles of PKC in B-cell development, however.

How is the truncated form of PKC generated in developing B cells? It is possible that T-PKC is generated by the initiation of translation at an internal ATG within its mRNA. Examination of the nucleotide sequence of PKC revealed an ATG codon which might generate a protein of the approximately correct size. We do not think this is the case, however, for the following reasons. First, in vitro translation of FL-PKC mRNA did not lead to the generation of a 50-kDa protein (Fig. 4C). Second, our engineered truncated protein uses the ATG in question and generates a fragment significantly smaller than the T-PKC generated by the induction of apoptosis in cells expressing the full length protein (Fig. 4C and 6B). Finally, at the pre-B-cell stage in B-cell development where we detect the greatest fraction of cleaved PKC, we fail to detect any PKC mRNA (Fig. 1B and 2B).

Does PKC proteolysis regulate apoptosis of developing B cells? Death is a frequent outcome for cells at each stage of B-cell development. Pro-B cells that fail to generate an in-frame heavy-chain-gene rearrangement die by apoptosis. Forced expression of the anti-apoptotic gene encoding Bcl-x_L rescues these cells but does not promote their further development (10). Pre-B cells which fail to generate an in-frame light-chain-gene rearrangement also fail to survive. This is most obvious in RAG1-deficient/µ-transgenic mice where mutant pre-B cells are continuously generated and cannot mature but achieve steady-state numbers nonetheless (~10 to 20% of nonerythroid marrow) (56, 58). Immature B cells expressing autoreactive surface IgM either successfully edit their receptors or undergo apoptotic cell death (reviewed in reference 14). Finally, it was shown recently that continuous expression of surface Ig is required for survival of mature peripheral B cells (26). Hence, B cells at every stage in their development are poised to undergo apoptosis.