Previous Article | Next Article 
Molecular and Cellular Biology, August 1999, p. 5619-5630, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Interstrand Cross-Links Induce DNA Synthesis in
Damaged and Undamaged Plasmids in Mammalian Cell Extracts
Lei
Li,1
Carolyn
A.
Peterson,2
Xiaoyan
Lu,2
Ping
Wei,2,
and
Randy J.
Legerski2,*
Departments of Experimental Radiation
Oncology1 and Molecular
Genetics,2 University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Received 19 February 1999/Returned for modification 25 March
1999/Accepted 19 May 1999
 |
ABSTRACT |
Mammalian cell extracts have been shown to carry out
damage-specific DNA repair synthesis induced by a variety of lesions, including those created by UV and cisplatin. Here, we show that a
single psoralen interstrand cross-link induces DNA synthesis in both
the damaged plasmid and a second homologous unmodified plasmid
coincubated in the extract. The presence of the second plasmid strongly
stimulates repair synthesis in the cross-linked plasmid. Heterologous
DNAs also stimulate repair synthesis to variable extents. Psoralen
monoadducts and double-strand breaks do not induce repair synthesis in
the unmodified plasmid, indicating that such incorporation is specific
to interstrand cross-links. This induced repair synthesis is consistent
with previous evidence indicating a recombinational mode of repair for
interstrand cross-links. DNA synthesis is compromised in extracts from
mutants (deficient in ERCC1, XPF, XRCC2, and XRCC3) which are all
sensitive to DNA cross-linking agents but is normal in extracts from
mutants (XP-A, XP-C, and XP-G) which are much less sensitive. Extracts
from Fanconi anemia cells exhibit an intermediate to wild-type level of
activity dependent upon the complementation group. The DNA synthesis
deficit in ERCC1- and XPF-deficient extracts is restored by addition of purified ERCC1-XPF heterodimer. This system provides a biochemical assay for investigating mechanisms of interstrand cross-link repair and
should also facilitate the identification and functional
characterization of cellular proteins involved in repair of these lesions.
| |
INTRODUCTION |
DNA interstrand cross-linking agents
are among the oldest and yet still most effective anticancer drugs
available in the clinic, and the chemotherapeutic use of the early
forms of these chemicals, such as mustard gas and nitrogen mustard,
extends back to before the Second World War. The alkylation chemistry
of these drugs was also elucidated shortly after that war, and their
cellular pharmacology was extensively studied during the 1970s and
1980s (27). In contemporary chemotherapy, interstrand
cross-linking agents such as cyclophosamide, melphalan, and cisplatin
are among the most potent antitumor agents. Despite this lengthy
history of clinical use and pharmacologic investigation, the mechanisms of repair of the lesions produced in DNA by interstrand cross-linking agents have not been extensively studied. This situation of relative neglect of biochemical pathways of cross-link repair contrasts with the
striking advances that have been accomplished in the past decade in
other DNA damage processing pathways, such as nucleotide excision
repair (NER), base excision repair, and mismatch repair (18).
Current evidence (44) indicates that the error-free repair
of both interstrand cross-links and double-strand breaks involves a
recombinational mechanism in which an undamaged donor chromosome provides a homologous copy for the repair of the damaged template. Both
of these lesions are highly deleterious, and it has been shown in
certain yeast genetic backgrounds in which particular DNA repair
pathways have been abolished that a single occurrence of either lesion
in the genome is lethal (17, 34). The most extensive studies
of cross-link repair have been carried out in Escherichia
coli. Cole and his coworkers were the first to show that the
repair of cross-link damage in E. coli depends upon the products of the uvrA, uvrB, uvrC,
uvrD, recA, and polA genes (11, 12). These findings indicated that components of both NER and recombination pathways of E. coli were required for
cross-link repair, and Cole et al. (12) proposed a model for
the recombinational repair of interstrand cross-links in E. coli (Fig. 1). Elements of this
model as well as additional insights into this pathway have been
demonstrated by subsequent investigators as well. Using photoactivated
psoralen as a model cross-linking agent, Sancar, Hearst, and their
colleagues determined that the initial incisions made at the site of
the lesion are located 9 nucleotides to the 5' side and three
nucleotides to the 3' side (45). This same group also showed
that the (A)BC exinuclease will cleave a triple-stranded cross-linked
substrate which mimics the proposed intermediate shown in Fig. 1
(8, 9). Sladek et al. (40) showed that a
substrate with dual incisions on either side of the cross-link did not
stimulate strand exchange by RecA. However, if the nick is processed
into a gap, RecA-mediated strand exchange is stimulated, suggesting
that an exonucleolytic step, possibly carried out by PolI, is required
prior to recombination. Taken together, these findings are strong
support for a recombinational mode of interstrand cross-link repair and
are consistent with Cole's model.
The genetics of recombinational repair in the yeast Saccharomyces
cerevisiae has been well characterized (18). There are three DNA repair epistasis groups in yeast, and the RAD52 group represents recombinational repair pathways as indicated by the sensitivity of mutants within this group to ionizing radiation and/or
cross-linking agents. Many members of this group are also required for
both mitotic and meiotic recombination. In addition to the members of
the RAD52 group, members of the RAD3 group (NER pathway) are also
apparently required for interstrand cross-link repair (21,
38). However, other than RAD1 and RAD10, members of the RAD3
group are not required for double-strand break repair (20).
In addition, elements of the replicative apparatus, such as RPA, RFC,
PCNA, and DNA polymerases, may also be necessary for various stages of
repair of interstrand cross-links.
The extensive studies in yeast have yielded a reliable genetic
framework for recombinational repair pathways in eucaryotes. In
mammalian systems, however, these studies are far less advanced. There
are basically two series of mammalian mutants that have exhibited
hypersensitivity to cross-linking agents. These are laboratory-derived
mutant rodent cell lines (13) and cell lines derived from
patients with the highly cancer-prone genetic disease Fanconi anemia
(FA) (18). Members of both of these groups exhibit a general
but varied sensitivity to cross-linking agents (2, 13). The
cloning of some genes that complement these mammalian mutants has been
achieved (16, 32, 33, 41); however, the biochemical
mechanisms of recombinational repair of interstrand cross-links in
eucaryotic systems are largely unknown. As an approach to elucidate
these mechanisms, we report here our results on the development of a
mammalian cell-free assay that specifically responds to the presence of
interstrand cross-links in DNA. We show that a single cross-link
stimulates synthesis into a damaged plasmid and into an unmodified
plasmid as well.
| |
MATERIALS AND METHODS |
Cell lines and biochemicals.
Lymphoid cell lines were
obtained from the Human Genetic Mutant Cell Repository (Camden, N.J.)
and cultured in suspension in RPMI 1640 medium supplemented with 20%
fetal calf serum. V-H4 and V-C8 cell lines and the irs1 and irs1SF cell
lines were generously provided by M. Zdzienicka and N. Jones,
respectively. HeLa and rodent cell lines were cultured in Joklit medium
and minimal essential medium (MEM), respectively, plus 10% fetal calf
serum. ERCC1-XPF protein complex was a generous gift of A. Sancar, and
RPA and PCNA were generously supplied by Z.-Q. Pan.
Preparation of substrates.
For the preparation of
cross-linked duplex oligonucleotide (BsrGI oligo), two
complementary oligonucleotides with the following sequences were
synthesized and kinased: 5'
GCTCTCGTCTGTACACCGAAG and 5'
GCTCTTCGGTGTACAGACGAG. Bold letters
indicate nucleotide residues involved in the cross-link, and the
underlining indicates BsrGI restriction sites. Annealing of
these oligonucleotides creates the identical 3-nucleotide sticky end at
both ends of the duplex. These ends can be ligated to
HindIII sticky ends that have been filled in with a
single dATP residue by reaction with the Klenow fragment of DNA
polymerase I. One hundred micrograms of this substrate was added to
4,5',8-trimethylpsoralen at 5 µg/ml in 10 mM Tris (pH 7.5)-0.5 mM
EDTA-25 mM NaCl. The sample was irradiated with 365-nm UV light (10 min at 9 mW/cm2) to effect formation of the interstrand
cross-link (10) between the internal thymines of the
BsrGI site. The extent of the reaction was minimized in
order to maintain an average of one adduct or less per duplex
oligonucleotide. The cross-linked oligonucleotide was purified from
un-cross-linked DNA by denaturing polyacrylamide gel electrophoresis.
To begin the construction of the cross-linked template (CLT) plasmid, a
duplex oligonucleotide containing a
NcoI site was
inserted
between the two
SspI sites in pBSII, and the resulting
plasmid was designated pBS-Nco. To insert the cross-linked
oligonucleotide,
an aliquot of pBS-Nco was digested with
HindIII, and a single
deoxyadenine residue was added to
the 3' ends of the cleavage
site by incubation with Klenow fragment of
DNA polymerase I. This
latter step which prevents self-ligation of the
plasmid or the
cross-linked oligonucleotide increases the efficiency of
the ligation
reaction. After ligation, covalently closed CLT plasmid
was purified
by CsCl-ethidium bromide gradient centrifugation. Ethidium
bromide
was quantitatively removed by repeated rounds of ion exchange
chromatography. For construction of the control template (CT)
and the
donor template (DT) plasmids, an un-cross-linked version
of the duplex
oligonucleotide was cloned into the
HindIII sites
of the
CLT plasmid and pBSII, respectively. Since the CLT contains
both
orientations of the duplex oligonucleotide, both orientations
were also
obtained in the CT and DT plasmids. These latter plasmids
represent
permanent constructs that were prepared in bulk quantities
from host
cells.
Modification of the CT plasmid with either angelicin or
N-acetoxy-
N-2-acetyl aminofluorene (AAAF) was
performed as previously
described (
30,
46).
CRS assay.
Mammalian whole-cell (WC) extracts were prepared
by the method of Manley et al. (36). Before being used in
the cross-link repair synthesis (CRS) assay, each extract was tested
for competency in the NER assay (48). Extracts that were
defective in the NER assay were discarded with the exception of UV20 or
xeroderma pigmentosum (XP) extracts, which are constitutively deficient
in this assay. The repair reaction buffer is essentially that
previously described (48). Standard 50-µl reaction
mixtures contained (final concentration) 100 µg of extract, 20 to 40 ng of the CLT or CT, 100 to 150 ng of the DT, 45 mM HEPES-KOH (pH 7.8),
75 mM KCl, 7.4 mM MgCl2, 0.9 mM dithiothreitol, 0.4 mM
EDTA, 2 mM ATP, 20 µM each of dATP, dGTP, and TTP, 8 µM dCTP, 2 µCi [
-32P]dCTP (3,000 Ci/mmol), 40 mM
phosphocreatine, 2.5 µg of creatine phosphokinase, approximately 3%
glycerol, and 18 µg of bovine serum albumin. The reaction mixtures
were usually incubated for 3 h at 22°C.
After incubation, the reactions were stopped by the addition of EDTA to
20 mM. One microgram of DNase-free RNase (Boehringer
Mannheim) was
added, and the sample was incubated for 10 min at
37°C. Sodium
dodecyl sulfate (SDS) was added to 0.5% and proteinase
K to 190 µg/ml, and the samples were incubated at 37°C for 30
min. The DNA
was subsequently extracted with phenol-chloroform
and precipitated with
95% ethanol-2% KAc on ice. Plasmids were
then sequentially digested
with
BsaI (or
AvaII) and
NcoI under
conditions recommended by the manufacturers. After gel electrophoresis
and staining with ethidium bromide, the gels were photographed
and
subsequently dried down for autoradiography. Using intensifying
screens, gels were typically exposed for 4 to 16 h at
80°C.
Quantification
of autoradiograms was performed by scanning
autoradiograms with
Adobe Photoshop software and determining band
intensities with
Intelligent Quantifier software (Bio Image). Each
assay reported
in this publication was performed a minimum of two
times, and
representative results are
shown.
Immunodepletion of HeLa extracts.
Anti-hRad51 sera or
preimmune (control) sera were adjusted to 1× TBS buffer (10 mM
Tris-HCl [pH 7.5]-100 mM NaCl) and then incubated with preswollen
protein A-sepharose beads for 45 min at 4°C. The beads were washed
three times with TBS buffer and then incubated with 100 µg of HeLa WC
extract for 2 h on ice with gentle rotation. The supernatant
(hRad51-depleted extract) was recovered and subsequently examined in
the CRS assay.
| |
RESULTS |
Substrates for the CRS assay.
Our approach to the development
of an in vitro assay for interstrand cross-link repair was to monitor
damage-induced repair synthesis. Since we anticipated a recombinational
mode of DNA repair, the assay required a damaged plasmid and a
homologous donor plasmid that could, however, be distinguished from
each other upon gel electrophoresis. With these constraints in mind, we
constructed the plasmid substrates illustrated in Fig.
2A for the CRS assay. The starting
material for each of the three constructs, which are referred to as the
CLT, the DT, and the CT, was the pBluescriptII (pBSII) plasmid. The
salient features of the CLT are the placement of a single psoralen
cross-link at a unique site by the insertion of a cross-linked
oligonucleotide and the addition of a restriction site
(NcoI) that allows the CLT plasmid to be distinguished from
the DT plasmid. The cross-linked oligonucleotide was prepared by
reaction with 4,5',8-trimethylpsoralen plus near-UV light
(10) and subsequent gel purification. As shown (Fig. 2B), the typical CLT preparation contains essentially 100% cross-linked DNA
with no detectable uncross-linked material. We estimate that approximately 10 to 20% of the CLT also contains psoralen monoadducts. However, as shown below, these lesions do not stimulate repair synthesis in undamaged donor plasmids. The DT plasmid is identical to
the CLT plasmid except that it lacks the NcoI site and the psoralan cross-link (Fig. 2A). The CT plasmid is identical to the CLT
plasmid except that it lacks the psoralen cross-link (Fig. 2A). Further
details of the preparation of these substrates can be found in
Materials and Methods.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Construction of plasmid substrates for the CRS assay.
(A) CLT, CT, and DT represent cross-linked template, control template,
and donor template, respectively. *, site of interstrand cross-link;
oligo, oligonucleotide. (B) Purity of the CLT. An aliquot of the CLT
and CT was digested with BssHII, radiolabeled, and
electrophoresed through a denaturing polyacrylamide gel. Digestion with
BssHII excises a fragment of 189 bp containing the
cross-link.
|
|
CRS assay with mammalian cell extracts.
Employing the
substrates described above, we evaluated various mammalian cell
extracts for DNA synthesis induced by the presence of photoactivated
psoralen interstrand cross-links by using incorporation of radiolabeled
nucleotides as a measure of activity. We used the buffer, which
includes an ATP regenerating system, that was previously described for
the NER cell-free assay (48). To briefly summarize these
results, both WC (37) and nuclear (14) extracts yielded results indicating that DNA synthesis induced by interstrand cross-links occurred in these extracts. However, more consistent results were obtained with WC extracts, and all the experiments reported here were carried out with these extracts. Cytoplasmic extracts, prepared as described previously (31), exhibited
little evidence of damage-specific DNA synthesis.
Shown in Fig.
3A is an example of CRS
assay results obtained with HeLa WC extracts. After incubation in the
extract, the DNAs
were extracted and subsequently digested with
NcoI and
BsaI. Since
the
NcoI site is
unique to the CLT and CT plasmids, this digestion
allowed the CLT-CT
and DT plasmids to be resolved by gel electrophoresis.
As shown (Fig.
3A, lane 1), coincubation of the CLT and DT resulted
in an
approximately 20- to 30-fold increase in the level of incorporation
compared to the coincubation of the CT and DT plasmids (Fig.
3A,
lane
2) or compared to when the substrates were incubated separately
(Fig.
3A, lanes 3 to 5). Both the CLT and the DT exhibited higher
levels of
incorporation when incubated together compared to the
control
experiments, although the degree of incorporation in the
CLT was
typically about three to four times greater than that
in the DT when
normalized to the relative mass of the plasmids
in the experiment.
These results indicate that a single psoralen
cross-link induces DNA
synthesis in the modified plasmid as well
as in an undamaged homologous
plasmid. That the observed synthesis
is not due to an NER mechanism was
shown by the induction of incorporation
into the undamaged plasmid. The
latter finding is the hallmark
of the assay.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
CRS assay with HeLa WC extract. Details of the assay are
given in Materials and Methods. After incubation in the extract and
processing of samples, the DNAs were codigested with (A)
NcoI and BsaI or (B) NcoI and
AflIII and examined by agarose gel electrophoresis.
Fragments from the CLT indicated by CLT/CT contain the psoralen
cross-link. The faster-migrating band in (A) is the smaller
NcoI-BsaI fragment from the CLT. The upper panel
represents the autoradiogram of the ethidium bromide-stained gel shown
in the lower panel.
|
|
To make an initial determination of the pattern of incorporation in the
CLT, the CRS assay was repeated; however, the subsequent
enzyme
digestions were performed with
NcoI and
AflIII.
Use of
these enzymes caused the CLT to be cleaved into two fragments,
the smaller of which contained the cross-link. As shown (Fig.
3B, lane
1), even though the fragment containing the cross-link
is about 1.5 times smaller than the larger of the CLT fragments,
quantification of
the band intensity indicated that it had approximately
five times the
amount of incorporation, suggesting that the observed
DNA synthesis was
centered around the site of the lesion. In addition,
the level of
incorporation observed in the larger CLT fragment
was above the
background level, suggesting that DNA synthesis
in the CRS assay can
occur over large regions of the damaged
plasmid.
We next characterized the parameters of the assay in order to optimize
its efficiency. To summarize these findings, we found
that incubation
at 22°C yielded slightly more activity (10 to
20%) than that at
30°C. The assay was strongly inhibited at 37°C.
In previous work by
others, it was shown that both spermidine
and ammonium sulfate
stimulated an in vitro recombinational assay
for double-strand break
repair (
23). The CRS assay was not stimulated
by either of
these reagents. The optimum amount of salt (KCl)
was determined, and
the assay exhibited a broad maximum between
20 and 100 mM. With 200 mM
KCl, all activity was abolished. This
salt profile is similar to that
observed for the NER cell-free
assay (
48). Both ATP and an
ATP-regenerating system are required
for damage-specific incorporation
in the CRS assay. In the absence
of ATP, only high levels of
nonspecific background incorporation
are observed. Kumaresan et al.
(
28), however, have reported
site-specific incision at the
site of a psoralen cross-link in
the absence of ATP with mammalian cell
extracts. An initial kinetic
analysis of the assay indicated that
incorporation was essentially
linear for at least 6 h of
incubation. Our typical incubation
conditions for experiments reported
here, unless otherwise indicated,
were 3 h at 22°C in the buffer
described in Materials and
Methods.
Incorporation in the unmodified plasmid is dependent upon an
interstrand cross-link in the CLT.
To demonstrate that the
observed synthesis in the DT plasmid was dependent upon the presence of
a cross-link in the CLT, we modified the CT plasmid with either AAAF or
angelicin and used these substrates in place of the CLT in the CRS
assay. Angelicin is a psoralen derivative that forms only monoadducts
(26) and is therefore subject to repair by the NER pathway.
Likewise, the AAAF-induced lesions strongly stimulate the NER pathway.
As shown (Fig. 4A), neither of these
adducts resulted in stimulation of incorporation into the DT above
background levels. These results indicate that the presence of the
interstrand cross-link is required to induce synthesis into the
undamaged plasmid and therefore that the repair of this lesion occurs
by a fundamentally different mechanism than that for the repair of
monoadducts.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Incorporation into the donor plasmid is dependent upon
the cross-link. (A) Neither AAAF or angelicin induce repair synthesis
in the DT plasmid. After incubation in HeLa WC extract, the samples
were processed and digested with NcoI and AvaII.
(B) A double-strand break does not substitute for the interstrand
cross-link. The CT plasmid was digested with SmaI to create
a single blunt-ended double-strand break (L-CT). After incubation in
the extract samples in lanes 1, 3, and 5 were digested with
NcoI and AvaII. Samples in lanes 2 and 4 were
digested with NcoI.
|
|
We also determined whether a double-strand break introduced into the CT
plasmid near to the same site as the cross-link in
the CLT would induce
DNA synthesis. No incorporation was observed
in either the CT or DT
plasmids in the presence of this lesion
(Fig.
4B, lane 2). Thus, a
double-strand break does not mimic
the pattern of incorporation
observed in the presence of an interstrand
cross-link. Interestingly,
linearization of the DT or CLT plasmids
prior to the assay does not
alter the pattern of incorporation
observed with the covalently closed
substrates (results not
shown).
Heterologous DNAs can substitute for the homologous DT
plasmid.
To determine if the unmodified donor plasmid had to be
completely or highly homologous to the CLT, we substituted other DNAs for the DT plasmid. A surprising pattern emerged from these
experiments. The pET28 plasmid (5,369 bp), which contains regions (f1
and ColE1 origins) of exact homology to the CLT, exhibited only a
modest increase in stimulation of synthesis, while the pACYC184 plasmid (4,244 bp), which contains only a small region (120 bp) of partial homology (about 70%), stimulates incorporation as efficiently as does
the DT plasmid (Fig. 5). We also tested
whether øx174 and simian virus 40 (SV-40) DNAs could function as
donors and found that they stimulated incorporation to an intermediate
level between those of pET and pACYC184 (results not shown). Neither of
these DNAs has any extensive homology with the CLT. These results indicate that extensive regions of homology are not required between the damaged plasmid and the donor DNA; however, not all DNAs are equivalent as donors. The requirements for an efficient donor DNA are
not apparent from these experiments.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Heterologous DNAs stimulate repair synthesis to variable
extents. (A) After incubation in HeLa WC extract, the samples were
digested as follows: lanes 1 and 4, NcoI and
BsaI; lanes 2, 3, 5, and 6, BamHI. Digestion with
BamHI caused linearization of all DNAs. (B) Histogram
showing quantification of results shown in panel A. Each bar represents
the sum of the band intensities of the CLT plus the DT/pET28/pACYC184
minus the sum of the band intensities of the CT plus DT/pET28/pACYC184
representing the background. The absolute incorporation was then
normalized by setting the value for the DT/CLT at 100%.
|
|
If these various DNAs can act as donors, the question arises as to why
the CLT does not appear to act as its own donor. To
investigate this
question further, we incubated increasing amounts
of the CLT in the
absence of any other plasmid in the CRS assay.
Interestingly, a
second-order increase was observed in incorporation
in the CLT (Fig.
6). Thus, the CLT may be able to act as
its own
donor. The second-order nature of the reaction may indicate an
intermolecular reaction, or also possibly that inhibitory DNA
binding
proteins are being titrated out.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Incorporation into the CLT as a function of plasmid
concentration. (A) After incubation in HeLa WC extract, DNAs were
digested with NcoI and BsaI. (B) Quantification
and graphical display of the results shown in panel A.  , CT;  ,
CLT. All values were normalized by setting the band intensity of the
CLT at 100 ng to 100%.
|
|
The CRS assay is not deficient in extracts from XP groups A, C, and
G.
XP cell lines are highly deficient in NER as determined by both
in vivo and in vitro assays (18). To determine whether or not extracts prepared from XP cell lines are also deficient in the CRS
assay, we examined extracts from three XP groups. In yeast, mutations
in genes (RAD14, RAD4, and RAD2) that
are homologous to these XP genes have not been found to be required for
recombinational repair of double-strand breaks (20), but
they have been implicated in the repair of interstrand cross-links
(21, 38). In the mammalian ERCC series, however, only mutant
cell lines with defects in the ERCC1 or XPF-ERCC4
genes exhibit extreme hypersensitivity to cross-linking agents, while
ERCC groups 2, 3, 5, and 6 exhibit only a modest sensitivity that is
reasonably explained by the induction of monoadducts (1,
19). ERCC groups 2, 3, 5, and 6 are equivalent to XP groups D, B,
G, and Cockayne's syndrome group B, respectively. Shown in Fig.
7 are the results of the CRS assay
performed with WC extracts prepared from cells from XP groups A, C, and
G. Since these extracts were prepared from lymphoid cell lines, results
with a normal human lymphoid extract (WI-L2) are also shown as a
control. Typically, HeLa extracts exhibit an approximately twofold
higher level of activity in the CRS assay than do extracts from
lymphoid cells. All three of the XP extracts exhibited levels of
activity in the CRS assay quantitatively similar to the normal lymphoid
control, indicating that these extracts were competent for
cross-link-induced DNA synthesis. These results are consistent with the
cellular findings and indicate that these XP proteins do not play a
major role in the repair of interstrand cross-links as determined by
the CRS assay. These findings also strengthen our conclusion that the
CRS assay is distinct from the cell-free assay for NER.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 7.
CRS assay with XP cell lines. The CRS assay was
performed as described in the legend to Fig. 3A. (A) Results of the CRS
assay for extracts from XP cells representing groups A (GM02345C), C
(GM02246B), and G (XPG83). (B) Histogram showing quantification of the
results shown in panel A. Each bar represents the sum of the band
intensities of the CLT plus the DT minus the sum of the band
intensities of the CT plus DT. The absolute incorporation was then
normalized by setting the value for HeLa cells at 100%.
|
|
The CRS assay in rodent mutants hypersensitive to cross-linking
agents.
A number of rodent mutants (Table
1) that are highly sensitive to the
cross-linking agent mitomycin C have been identified (13).
We have evaluated extracts prepared from several of these mutant cell
lines for activity in the CRS assay. As was found for human lymphoid
cell lines, extracts from a wild-type hamster cell line (V79) generally
exhibited 1.5- to 2-fold lower activity than did HeLa cell extracts
(Fig. 8). Extracts from UV20, V-C8, irs1,
and irs1SF mutant cell lines were all highly deficient in the CRS
assay. Extracts from UV41 cells representing complementation group 4 were also highly negative in the assay (see below). Extracts from the
cell line V-H4 exhibited a wild-type level of activity. The finding
that irs1 and irs1SF mutant cells are deficient in the assay is of
particular interest since the genes that complement these cells, XRCC2
and XRCC3, have recently been cloned and both are members of the RecA
gene family (32).
View larger version (59K):
[in this window]
[in a new window]
|
FIG. 8.
CRS assay with rodent mutants hypersensitive to
cross-linking agents. (A) The CRS assay was performed as described in
the legend to Fig. 3A. (A) Results of the CRS assay for extracts
from rodent cell lines UV20, V-C8, irs1, irs1SF, V-H4, and V79. (B)
Histogram showing quantification of the results shown in panel A. Bar
values were arrived at as described in the legend to Fig. 7.
|
|
The V-H4, V-C8, irs1, and irs1SF cell lines have no known defect in
NER. To ensure that extracts from each cell line were
prepared
properly, each extract was analyzed in the NER cell-free
assay and was
found competent by this measure (results not shown).
UV20 mutants are,
however, defective in NER due to a mutation
in ERCC1. Thus, to
demonstrate the quality of the extracts prepared
from this cell line,
we performed a complementation assay by addition
of purified ERCC1-XPF
protein complex. Complementation was observed
in the NER assay,
indicating that the UV20 extracts were properly
prepared (results not
shown).
The CRS assay in FA cell lines.
FA is an autosomal recessive
disease characterized by congenital abnormalities, progressive bone
marrow failure, and a marked predisposition to leukemia (6).
Cells from FA patients exhibit a hypersensitivity to DNA bifunctional
cross-linking agents, such as diepoxybutane and mitomycin C, but not to
monofunctional agents (2). FA is genetically heterogeneous
in that at least eight complementation groups (A to H) have been
identified (24, 25, 41). We assayed extracts from lymphoid
cell lines representing three of these groups, A, B, and C, in the CRS
assay (Fig. 9). Extracts from groups A
and C exhibited approximately half the activity found in a normal
lymphoid cell line, while an extract from group B cells showed normal
levels of activity. These results indicate that, in general, extracts
from FA cells are not highly defective in the CRS assay, as was found
for the rodent mutants, but may have a partial reduction in the
stimulation of DNA synthesis in response to an interstrand cross-link.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 9.
CRS assay with FA cell lines. The CRS assay was
performed as described in the legend to Fig. 3A. (A) Results of the CRS
assay for extracts from FA cells representing groups A (GM13022), B
(GM13071), and C (GM13020). (B) Histogram showing quantification of the
results shown in panel A. Bar values were arrived at as described in
the legend to Fig. 7.
|
|
hRad51 is not required for the CRS assay.
Rad51 is a
eucaryotic homologue of the E. coli homologous recombination
protein RecA, and both the human and yeast proteins have been shown to
mediate strand transfer reactions in vitro (3, 43).
Experiments described above (Fig. 5) indicated that nonhomologous
plasmids could act as donors in the CRS assay and therefore suggested
that Rad51 may not be required for cross-link repair in vitro. To
determine if hRad51 is required in cross-link repair, HeLa extracts
were immunodepleted of the protein, and subsequently examined in the
CRS assay. As shown (Fig. 10A), greater than 95% removal of hRad51 was obtained by immunodepletion with antiserum as compared to preimmune serum. Examination of the
hRad51-depleted extracts in the CRS assay showed no loss of activity
compared to extracts depleted with preimmune serum (Fig. 10B). In fact, a moderate and reproducible increase in activity was observed in the
hRad51-depleted extracts.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 10.
CRS assay with hRad51-depleted extracts. (A) Western
analysis of HeLa cell extracts immunodepleted with a polyclonal rabbit
serum raised against hRad51. Lane 1, untreated HeLa cell extract; lane
2, extract treated with preimmune serum; lanes 3 and 4, extracts
treated with hRad51 antiserum. (B) CRS assay of treated extracts. Lane
1, extract treated with preimmune serum; lanes 2 and 3, extract treated
with hRad51 antiserum.
|
|
Complementation of defective extracts in the CRS assay.
Complementation of defective extracts is an established biochemical
method for verifying the validity of an assay. As described above,
extracts prepared from UV20 and UV41 cells are highly deficient in the
CRS assay. These two mutant cell lines are defective in ERCC1 and XPF
function, respectively. We obtained purified samples of the ERCC1-XPF
complex and determined whether this complex could complement either of
these extracts. For both cell lines, robust complementation was
observed with the addition of the ERCC1-XPF complex (Fig. 11A and
B). These results demonstrate that
extracts deficient in the CRS assay can be rescued specifically
by purified proteins, although complementation of the XRCC2-
XRCC3- and V-C8-deficient extracts must also be obtained in order to
confirm the role of these proteins in the CRS assay.
| |
DISCUSSION |
Great progress has been made in recent years on the elucidation in
eucaryotic cells of the multiple mechanisms of repair of double-strand
breaks (22). However, little is known about the mechanisms
of repair of interstrand cross-links in these systems. In both yeast
and mammals it is clear that genes that are involved in recombinational
processes are also components of cross-link repair (44).
Here, we describe the development of a mammalian cell-free assay which
is based upon the measurement of DNA synthesis induced by the presence
of a single psoralen interstrand cross-link. Under the conditions
employed, the damage-induced DNA synthesis is dependent upon the
presence of the cross-link and is stimulated by the presence of an
undamaged donor plasmid. Some degree of this stimulation may be due to
titration of inhibitory factors; however, the most intriguing finding
is that the damage-induced DNA synthesis is observed in both the
plasmid containing the cross-link and the undamaged plasmid. The latter
finding is the hallmark of the assay since it has not been observed
previously in the repair of UV-induced photoproducts, psoralen
monoadducts, or other lesions susceptible to repair by the NER pathway
(39, 48). We also showed that psoralen monoadducts,
AAAF-induced lesions, and double-strand breaks do not induce DNA
synthesis in an undamaged plasmid. The stimulation of incorporation by
an undamaged plasmid and the finding of DNA synthesis in this plasmid
suggest that a recombinational mode of DNA repair is occurring.
Importantly, we also found that the undamaged plasmid does not have to
be homologous to the damaged plasmid in order to stimulate DNA
synthesis, although why some DNAs stimulate synthesis to a greater
degree than others is not clear since it does appear to be based on
overall homology. Nevertheless, this observation seems to suggest that
Cole's model involving homologous recombination is not the operative
pathway for repair of cross-links in the CRS assay. This conclusion is further supported by our finding that hRad51 is not required for the
CRS assay.
That the observed incorporation is unlikely to be due to damage-induced
aberrant DNA synthesis is indicated by the following reasons. (i) The
incorporation into the undamaged DNA is cross-link specific and is not
observed in the presence of monoadducts or double-strand breaks. (ii)
Mutant cell lines that are sensitive to cross-linking reagents in vivo
are for the most part deficient in the CRS assay. (iii) Incorporation
of nucleotides into the undamaged plasmid suggests that we are
observing a type of damage processing that involves some form of
recombination. This finding is not observed in the in vitro assay for
repair of photoproducts by NER (39, 48).
In E. coli, it is clear that the uvr pathway
plays an essential role in the repair of interstrand cross-links
(11, 12). In yeast as well, components of the incision stage
of the NER pathway have been implicated in the repair of interstrand
cross-links (21, 38). However, the role of mammalian NER
genes in the repair of interstrand cross-links has proven to be
controversial. One reason for this situation is that many, if not most,
interstrand cross-linking agents also produce monoadducts which are
typically repaired by the NER pathway. Thus, it is often difficult to
determine whether the sensitivity of mutants is due to the monoadduct
or to the interstrand cross-link. The study by Hoy et al.
(19) found, however, that of the first five ERCC
complementation groups, only groups 1 and 4 were extremely
hypersensitive to cross-linking agents. A more recent study by
Andersson et al. (1) have noted similar results using
cyclophosamide analogs as the cross-linking agent. They showed that
groups 1 and 4 were approximately 30-fold more sensitive to these drugs
than groups 2, 3, 5, and 6. The CRS assay allows for a biochemical
determination of the role of NER proteins in interstrand cross-link
repair. As we showed above, XP groups A, C, and G were all proficient
in DNA synthesis, indicating that these NER proteins are not involved
in cross-link repair as measured by the CRS assay. Moreover, consistent
with the previously reported in vivo studies, we have found that
extracts from the rodent mutants mutated in ERCC1 or XPF-ERCC4 are
highly defective in the CRS assay. However, it must be noted that NER
proteins could play a role in the second incision step (Fig. 1) which
might occur after the bulk of the DNA synthesis has taken place as
measured in the CRS assay. Somewhat in contrast with our results,
Bessho et al. (4) have recently reported that reconstituted
NER incision proteins can perform dual incisions near the site of
cross-links. Curiously, however, the incisions do not flank the
cross-link as proposed in E. coli (11, 12), but
are found slightly 5' to the cross-linked base. It is therefore
possible that NER proteins are involved in a second, but most likely
minor, pathway of cross-link repair.
As described above (Table 1), a number of rodent cell lines, in
addition to the ERCC group 1 and 4 mutants, that are hypersensitive to
cross-linking agents have been identified (13). We have
analyzed extracts from a number of these cell lines and found,
consistent with their in vivo phenotype, that they are highly defective
in the CRS assay. The only exception was the cell line V-H4. V-H4 and
FA-A may represent the same molecular defect since there is evidence
from cell fusion studies to indicate that FA-A and V-H4 cell lines
belong to the same complementation group (52). It is also
possible that the V-H4 gene product participates in a step of the
repair reaction subsequent to DNA synthesis. The human genes that
complement UV20 (47) and the irs1 and irs1SF mutants (32) have been isolated, but the cloning of the gene for
V-C8 has not been reported. The finding that these mutants are
deficient in the CRS assay is consistent with the in vivo results
showing extreme hypersensitivity of these mutants to cross-linking
reagents (13). This overall correlation between our in vitro
results and the previous cellular findings strongly validates the CRS assay as a measure of cross-link repair. In addition, the finding that
extracts deficient in XRCC2 and XRCC3, both of which are related to the
RecA-hRad51 family (32), suggests that the CRS assay may be
reflective of recombinational repair processes. Furthermore, it should
be noted that the CRS assay does not distinguish as to whether the
defects in these hamster cells is reflective of a deficiency in an
incision step or a synthesis step of cross-link repair.
In contrast to their in vivo hypersensitivity to interstrand
cross-linking agents, FA complementation groups A, B and C showed significant activity in the CRS assay, although groups A and C exhibited approximately half the activity observed in extracts from
control lymphoid cells. Both the FAA (14, 33) and
FAC (42) genes have been cloned, and both
polypeptides predicted from their sequences represent novel proteins of
unknown function. It has been reported that the FAC protein is
localized entirely in the cytoplasm (49, 51) and further
that the cytoplasmic location of FAC is essential for its function
since when it is targeted to the nucleus it fails to correct the defect
in FAC cells (50). These results and others suggest that FA
proteins may be involved in a cytoplasmic defense mechanism, such as
prevention of oxidative damage, rather than having a direct role in DNA
repair processing. However, more recent findings indicate an
interaction between FAA and FAC that results in translocation of the
complex into the nucleus (29). Consistent with these results
is a recent model that proposes that FA proteins are involved in a
pathway of feedback control of DNA replication during S phase of the
cell cycle (16). Other studies have suggested that FA
proteins may be involved in regulating apoptosis and/or the cell cycle
after exposure to cross-linking agents (5). Our in vitro
results are somewhat ambiguous in regard to a direct role for FA
proteins in DNA repair in that FA groups A and C are subnormal but not highly deficient as was found for the crosslink-sensitive rodent mutants, while group B cells exhibited a wild-type level of activity.
There is substantial evidence to indicate that Cole's model (Fig. 1)
is the likely mechanism for repair of interstrand cross-links in
E. coli (12). However, the applicability of this
pathway in mammalian cells is questionable since we have shown that
elements of the NER machinery other than ERCC1-XPF are not required for steps preceding DNA synthesis and that there is no absolute requirement for extensive homology between damaged and undamaged plasmids in the
CRS assay. There are four identified pathways of double-strand break
repair that have been identified in eukaryotic cells. These are (i)
homologous recombination (HR), (ii) nonhomologous end joining (NHEJ),
(iii) single-strand annealing (SSA), and (iv) break-induced replication
(BIR). It is a distinct possibility that a modification of one of these
pathways represents the mechanism of interstrand cross-link repair that
is observed in the CRS assay. Both NHEJ and SSA can be eliminated as
candidates on the basis that there is no obvious requirement for a
donor plasmid in these mechanisms. Both HR and BIR require short
segments of homology to initiate the strand transfer reaction; however,
HR also requires extensive homology for branch migration of the
Holliday junction, whereas, BIR requires no further homology because
the resulting D loop is extended by DNA synthesis (35).
Thus, the BIR mechanism is consistent with our finding that extensive
homology between the damaged and donor plasmids is not required. HR and
BIR have also been distinguished in yeast by their genetic
requirements. HR is RAD51 dependent but RAD1
independent, while BIR has been shown to be RAD51
independent and RAD1 dependent (7, 35). We have
shown here that the CRS assay is dependent upon the mammalian homologue
of Rad1, XPF, and also the protein with which it is complexed, ERCC1.
In addition, we demonstrated that immunodepletion of hRad51 from HeLa
extracts did not reduce activity in the CRS assay, indicating that it
is Rad51 independent. It should be noted, however, that the lack of
involvement of Rad51 in the CRS assay does not necessarily indicate
that it is not involved in cross-link repair. It may be involved in a
step subsequent to the DNA synthesis. Nevertheless, the BIR model,
presumably in some modified form, is most consistent with the results
that we have obtained from the CRS assay. Finally, it is also clear
that cross-links are not simply processed into double-strand breaks and
subsequently repaired as such, since our in vitro results show that
cross-links elicit extensive DNA synthesis while double-strand breaks
do not.
| |
ACKNOWLEDGMENTS |
We thank A. Sancar and Z.-Q. Pan for providing purified proteins
and M. Zdzienicka and N. Jones for providing cell lines.
This work was supported by American Federation of Aging Research grant
A95035 and National Institutes of Health grants CA52461, CA75160 and CA76172.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics, University of Texas M. D. Anderson Cancer
Center, Houston, TX 77030. Phone: (713) 792-8941. Fax: (713) 794-4295. E-mail: randy_legerski{at}molgen.mdacc.tmc.edu.
Present Address: Department of Cell Biology, Baylor College of
Medicine, Houston, TX 77030.
| |
REFERENCES |
| 1.
|
Andersson, B. S.,
T. Sadeghi,
M. J. Sicilano,
R. J. Legerski, and D. Murray.
1996.
Nucleotide excision repair genes as determinants of cellular sensitivity to cyclophosphamide analogs.
Cancer Chemother. Pharmacol.
38:406-416[Medline].
|
| 2.
|
Auerbach, A. D.
1993.
Fanconi anaemia diagnosis and the diepoxybutane (DEB) test.
Exp. Hematol.
21:731-733[Medline].
|
| 3.
|
Baumann, P.,
F. E. Benson, and S. C. West.
1996.
Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro.
Cell
87:757-766[Medline].
|
| 4.
|
Bessho, T.,
D. Mu, and A. Sancar.
1997.
Initiation of DNA interstrand cross-link repair in humans: the nucleotide excision repair system makes dual incisions 5' to the cross-linked base and removes a 22- to 28-nucleotide-long damage-free strand.
Mol. Cell. Biol.
17:6822-6830[Abstract].
|
| 5.
|
Buchwald, M., and E. Moustacchi.
1998.
Is Fanconi anaemia caused by a defect in the processing of DNA damage?
Mutat. Res.
408:75-90[Medline].
|
| 6.
|
Butturini, A.,
R. P. Gale,
P. C. Verlander,
B. Adler-Brecher,
A. P. Gillio, and A. D. Auerbach.
1994.
Hematologic abnormalities in Fanconi anaemia: an international Fanconi anaemia registry study.
Blood
84:1650-1655[Abstract/Free Full Text].
|
| 7.
|
Chen, C.,
K. Umezu, and R. D. Kolodner.
1998.
Chromosomal rearrangements occur in S. cerevisiae rfa1 mutator mutants due to mutagenic lesions processed by double-strand-break repair.
Mol. Cell
2:9-22[Medline].
|
| 8.
|
Cheng, S.,
A. Sancar, and J. E. Hearst.
1991.
RecA-dependent incision of psoralen-crosslinked DNA by (A)BC exinuclease.
Nucleic Acids Res.
19:657-663[Abstract/Free Full Text].
|
| 9.
|
Cheng, S.,
B. Van Houten,
H. B. Gamper,
A. Sancar, and J. E. Hearst.
1988.
Use of psoralen-modified oligonucleotides to trap three-stranded RecA-DNA complexes and repair of these cross-linked complexes by ABC exinuclease.
J. Biol. Chem.
263:15110-15117[Abstract/Free Full Text].
|
| 10.
|
Cimino, G. D.,
H. B. Gamper,
S. T. Isaacs, and J. E. Hearst.
1985.
Psoralens as photoactive probes of nucleic acid structure and function: organic chemistry, photochemistry, and biochemistry.
Annu. Rev. Biochem.
54:1151-1193[Medline].
|
| 11.
|
Cole, R. S.
1973.
Repair of DNA containing interstrand crosslinks in Escherichia coli: sequential excision and recombination.
Proc. Natl. Acad. Sci. USA
70:1064-1068[Abstract/Free Full Text].
|
| 12.
|
Cole, R.,
S. D. Levitan, and R. R. Sinden.
1976.
Removal of psoralen interstrand crosslinks from DNA of Escherichia coli: mechanism and genetic control.
J. Mol. Biol.
103:39-59[Medline].
|
| 13.
|
Collins, A. R.
1993.
Mutant rodent cell lines sensitive to ultraviolet light, ionizing radiation and cross-linking agents: a comprehensive survey of genetic and biochemical characteristics.
Mutat. Res.
293:99-118[Medline].
|
| 14.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:579-585.
|
| 15.
|
Digweed, M., and K. Sperling.
1996.
Molecular analysis of Fanconi anaemia.
BioEssays
18:579-585[Medline].
|
| 16.
|
Fanconi Anaemia/Breast Cancer Consortium.
1996.
Positional cloning of the Fanconi anaemia group A gene.
Nat. Genet.
14:324-328[Medline].
|
| 17.
|
Frankenburg, D. M.,
M. Frankenburg-Schwager,
D. Blocher, and R. Harbich.
1981.
Evidence for DNA double-strand breaks as the critical lesions in yeast cells irradiated with sparsely or densely ionizing radiation under oxic and anoxic conditions.
Radiat. Res.
88:524-532[Medline].
|
| 18.
|
Friedberg, E. C.,
G. C. Walker, and W. Siede.
1995.
DNA repair and mutagenesis.
ASM Press, Washington, D.C.
|
| 19.
|
Hoy, C. A.,
L. H. Thompson,
C. L. Mooney, and E. P. Salazar.
1985.
Defective DNA cross-link removal in Chinese hamster cell mutants hypersensitive to bifunctional alkylating agents.
Cancer Res.
45:1737-1743[Abstract/Free Full Text].
|
| 20.
|
Ivanov, E. L., and J. E. Haber.
1995.
RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:2245-2251[Abstract].
|
| 21.
|
Jachymczyk, W. J.,
R. C. Von Borstel,
M. R. A. Mowat, and P. J. Hastings.
1981.
Repair of interstrand cross-links in DNA of Saccharomyces cerevisiae requires two systems of DNA repair: the RAD3 system and the RAD51 system.
Mol. Gen. Genet.
182:196-205[Medline].
|
| 22.
|
Jeggo, P. A.
1997.
DNA-PK: at the cross-roads of biochemistry and genetics.
Mutat. Res.
384:1-14[Medline].
|
| 23.
|
Jessberger, R.,
V. Podust,
U. Hubscher, and P. Berg.
1993.
A mammalian complex that repairs double-strand breaks and deletions by recombination.
J. Biol. Chem.
268:15070-15079[Abstract/Free Full Text].
|
| 24.
|
Joenje, H.,
F. J. R. Lo Ten Foe,
A. B. Oostra,
C. G. van Berkel,
M. A. Rooimans,
T. Schroeder-Kurth,
R. D. Wegner,
J. J. Gille,
M. Buchwald, and F. Arwert.
1995.
Classification of Fanconi anaemia patients by complementation analysis: evidence for a fifth genetic subtype.
Blood
86:2156-2160[Abstract/Free Full Text].
|
| 25.
|
Joenje, H.,
A. B. Oostra,
M. Wijker,
F. M. di Summa,
C. G. M. van Berkel,
M. A. Rooimans,
W. Ebell,
M. van Weel,
J. C. Pronk,
M. Buchwald, and F. Arwert.
1997.
Evidence for at least eight Fanconi anaemia genes.
Am. J. Hum. Genet.
61:940-944[Medline].
|
| 26.
|
Kittler, L.,
Z. Hradecna, and J. Suhnel.
1980.
Cross-link formation of phage lambda DNA in situ photochemically induced by the furocoumarin derivative angelicin.
Biochim. Biophys. Acta
607:215-220[Medline].
|
| 27.
|
Kohn, K. W.
1996.
Beyond DNA cross-linking: history and prospects of DNA-targeted cancer treatment Fifteenth Bruce F. Cain Memorial Award Lecture.
Cancer Res.
56:5533-5546[Abstract/Free Full Text].
|
| 28.
|
Kumaresan, K. R.,
B. Hang, and M. W. Lambert.
1995.
Human endonucleolytic incision of DNA 3' and 5' to a site-directed psoralen monoadduct and interstrand cross-link.
J. Biol. Chem.
270:30709-30716[Abstract/Free Full Text].
|
| 29.
|
Kupfer, G. M.,
D. Naf,
A. Suliman,
M. Pulsipher, and A. D. D'Andrea.
1997.
The Fanconi anaemia proteins, FAA and FAC, interact to form a nuclear complex.
Nat. Genet.
17:487-490[Medline].
|
| 30.
|
Legerski, R. J.,
H. B. Gray, Jr., and D. L. Robberson.
1977.
A sensitive endonuclease probe for lesions in deoxyribonucleic acid helix structure produced by carcinogenic or mutagenic agents.
J. Biol. Chem.
252:8740-8746[Abstract/Free Full Text].
|
| 31.
|
Li, J. J., and T. J. Kely.
1984.
Simian virus 40 DNA replication in vitro.
Proc. Natl. Acad. Sci. USA
81:6973-6977[Abstract/Free Full Text].
|
| 32.
|
Liu, N.,
J. E. Lamerdin,
R. S. Tebbs,
D. Schild,
J. D. Tucker,
M. R. Shen,
K. W. Brookman,
M. J. Siciliano,
C. A. Walter,
W. Fan,
L. S. Narayana,
Z. Q. Zhou,
A. W. Adamson,
K. J. Sorensen,
D. J. Chen,
N. J. Jones, and L. H. Thompson.
1998.
XRCC2 and XRCC3, new human Rad51-family members, promote chromosome stability and protect against DNA crosslinks and other damages.
Mol. Cell
1:783-793[Medline].
|
| 33.
|
Lo Ten Foe, J. R.,
M. A. Rooimans,
L. Bosnoyan-Collins,
N. Alon,
M. Wijker,
L. Parker,
J. Lightfoot,
M. Carreau,
D. F. Callen,
A. Savoia,
N. C. Cheng,
C. G. M. van Berkel,
H. P. Strunk,
H. J. P. Gille,
G. Pals,
F. A. E. Kruyt,
J. C. Pronk,
F. Arwert,
M. Buchwald, and H. Joenje.
1996.
Expression cloning of a cDNA for the major Fanconi anaemia gene, FAA.
Nat. Genet.
14:320-323[Medline].
|
| 34.
|
Magana-Schwencke, N.,
J. A. Henriques,
R. Chanet, and E. Moustacchi.
1982.
The fate of 8-methozypsoralen photoinduced crosslinks in nuclear and mitochondrial yeast DNA: comparison of wild-type and repair-deficient strains.
Proc. Natl. Acad. Sci. USA
79:1722-1726[Abstract/Free Full Text].
|
| 35.
|
Malkova, A.,
E. L. Ivanov, and J. E. Haber.
1996.
Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced replication.
Proc. Natl. Acad. Sci. USA
93:7131-7136[Abstract/Free Full Text].
|
| 36.
|
Manley, J. L.,
A. Fire,
A. Cano,
P. A. Sharp, and M. L. Gefter.
1980.
DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract.
Proc. Natl. Acad. Sci. USA
77:3855-3859[Abstract/Free Full Text].
|
| 37.
|
McBlane, J. F.,
D. C. van Gent,
D. A. Ramsden,
C. Romeo,
C. A. Cuomo,
M. Gellert, and M. A. Oettinger.
1995.
Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps.
Cell
83:387-395[Medline].
|
| 38.
|
Miller, R. D.,
L. Prakash, and S. Prakash.
1982.
Genetical control of excision of Saccharoymyces cerevisiae interstrand DNA cross-links induced by psoralen plus near-UV light.
Mol. Cell. Biol.
2:939-948[Abstract/Free Full Text].
|
| 39.
|
Sibghat-Ullah, S.,
I. Husain,
W. Carlton, and A. Sancar.
1989.
Human nucleotide excision repair in vitro: repair of pyridine dimers, psoralen and cisplatin adducts by HeLa cell-free extract.
Nucleic Acids Res.
17:4471-4484[Abstract/Free Full Text].
|
| 40.
|
Sladek, F. M.,
M. M. Munn,
W. D. Rupp, and P. Howard-Flanders.
1989.
In vitro repair of psoralen-DNA cross-links by RecA, UvrABC, and the 5'-exonuclease of DNA polymerase I.
J. Biol. Chem.
264:6755-6765[Abstract/Free Full Text].
|
| 41.
|
Strathdee, C. A.,
A. M. V. Duncan, and M. Buchwald.
1992.
Evidence for at least four Fanconi anaemia genes including FACC on chromosome 9.
Nat. Genet.
1:196-198[Medline].
|
| 42.
|
Strathdee, C. A.,
H. Gavish,
W. R. Shannon, and M. Buchwald.
1992.
Cloning of cDNAs for Fanconi's anaemia by functional complementation.
Nature
356:763-767[Medline].
|
| 43.
|
Sung, P., and D. L. Robberson.
1995.
DNA strand exchange mediated by a RAD51-ssDNA nucleoprotein filament with polarity opposite to that of RecA.
Cell
82:453-461[Medline].
|
| 44.
|
Thompson, L. H.
1996.
Evidence that mammalian cells possess homologous recombinational repair pathways.
Mutat. Res.
363:77-88[Medline].
|
| 45.
|
Van Houten, B.,
H. Gamper,
S. R. Holbrook,
J. E. Hearst, and A. Sancar.
1986.
Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen crosslink at a defined position.
Proc. Natl. Acad. Sci. USA
83:8077-8081[Abstract/Free Full Text].
|
| 46.
|
Warmer, W. G.,
W. C. Timmer,
R. R. Wei,
S. A. Miller, and A. Kornhauser.
1995.
Furocoumarin-photosensitized hydroxylation of guanosine in RNA and DNA.
Photochem. Photobiol.
61:336-340[Medline].
|
| 47.
|
Westerveld, A.,
J. H. Hoeijmakers,
M. van Duin,
J. de Wit,
H. Odijk,
A. Pastink,
R. D. Wood, and D. Bootsma.
1984.
Molecular cloning of a human DNA repair gene.
Nature
310:425-429[Medline].
|
| 48.
|
Wood, R. D.,
P. Robins, and T. Lindahl.
1988.
Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts.
Cell
53:97-106[Medline].
|
| 49.
|
Yamashita, T.,
D. L. Barber,
Y. Zhu,
N. Wu, and A. D. D'Andrea.
1994.
The Fanconi anaemia polypeptide FACC is localized to the cytoplasm.
Proc. Natl. Acad. Sci. USA
91:6712-6716[Abstract/Free Full Text].
|
| 50.
|
Youssoufian, H.
1994.
Localization of Fanconi anaemia C protein to the cytoplasm of mammalian cells.
Proc. Natl. Acad. Sci. USA
91:7975-7979[Abstract/Free Full Text].
|
| 51.
|
Youssoufian, H.
1996.
Cytoplasmic location of FAC is essential for the correction of a prerepair defect in Fanconi anaemia group C cells.
J. Clin. Investig.
97:2003-2010[Medline].
|
| 52.
|
Zdzienicka, M. Z.,
F. Arwert,
I. Neuteboom,
M. Rooimans, and J. W. Simons.
1990.
The Chinese hamster V79 cell mutant V-H4 is phenotypically like Fanconi anaemia cells.
Cell. Mol. Genet.
16:575-581.
|
Molecular and Cellular Biology, August 1999, p. 5619-5630, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lee, Y.-J., Park, S.-J., Ciccone, S. L.M., Kim, C.-R., Lee, S.-H.
(2006). An in vivo analysis of MMC-induced DNA damage and its repair. Carcinogenesis
27: 446-453
[Abstract]
[Full Text]
-
Zhang, N., Kaur, R., Lu, X., Shen, X., Li, L., Legerski, R. J.
(2005). The Pso4 mRNA Splicing and DNA Repair Complex Interacts with WRN for Processing of DNA Interstrand Cross-links. J. Biol. Chem.
280: 40559-40567
[Abstract]
[Full Text]
-
Richards, S., Liu, S.-T., Majumdar, A., Liu, J.-L., Nairn, R. S., Bernier, M., Maher, V., Seidman, M. M.
(2005). Triplex targeted genomic crosslinks enter separable deletion and base substitution pathways. Nucleic Acids Res
33: 5382-5393
[Abstract]
[Full Text]
-
Tsodikov, O. V., Enzlin, J. H., Scharer, O. D., Ellenberger, T.
(2005). Crystal structure and DNA binding functions of ERCC1, a subunit of the DNA structure-specific endonuclease XPF-ERCC1. Proc. Natl. Acad. Sci. USA
102: 11236-11241
[Abstract]
[Full Text]
-
van Waardenburg, R. C.A.M., de Jong, L. A., van Delft, F., van Eijndhoven, M. A.J., Bohlander, M., Bjornsti, M.-A., Brouwer, J., Schellens, J. H.M.
(2004). Homologous recombination is a highly conserved determinant of the synergistic cytotoxicity between cisplatin and DNA topoisomerase I poisons. Molecular Cancer Therapeutics
3: 393-402
[Abstract]
[Full Text]
-
Guillonneau, F., Guieysse, A. L., Nocentini, S., Giovannangeli, C., Praseuth, D.
(2004). Psoralen interstrand cross-link repair is specifically altered by an adjacent triple-stranded structure. Nucleic Acids Res
32: 1143-1153
[Abstract]
[Full Text]
-
Sridharan, D., Brown, M., Lambert, W. C., McMahon, L. W., Lambert, M. W.
(2003). Nonerythroid {alpha}II spectrin is required for recruitment of FANCA and XPF to nuclear foci induced by DNA interstrand cross-links. J. Cell Sci.
116: 823-835
[Abstract]
[Full Text]
-
Bessho, T.
(2003). Induction of DNA Replication-mediated Double Strand Breaks by Psoralen DNA Interstrand Cross-links. J. Biol. Chem.
278: 5250-5254
[Abstract]
[Full Text]
-
Zheng, H., Wang, X., Warren, A. J., Legerski, R. J., Nairn, R. S., Hamilton, J. W., Li, L.
(2003). Nucleotide Excision Repair- and Polymerase {eta}-Mediated Error-Prone Removal of Mitomycin C Interstrand Cross-Links. Mol. Cell. Biol.
23: 754-761
[Abstract]
[Full Text]
-
Digweed, M., Rothe, S., Demuth, I., Scholz, R., Schindler, D., Stumm, M., Grompe, M., Jordan, A., Sperling, K.
(2002). Attenuation of the formation of DNA-repair foci containing RAD51 in Fanconi anaemia. Carcinogenesis
23: 1121-1126
[Abstract]
[Full Text]
-
Zhang, N., Lu, X., Zhang, X., Peterson, C. A., Legerski, R. J.
(2002). hMutS{beta} Is Required for the Recognition and Uncoupling of Psoralen Interstrand Cross-Links In Vitro. Mol. Cell. Biol.
22: 2388-2397
[Abstract]
[Full Text]
-
Knauert, M. P., Glazer, P. M.
(2001). Triplex forming oligonucleotides: sequence-specific tools for gene targeting. Hum Mol Genet
10: 2243-2251
[Abstract]
[Full Text]
-
Wang, X., Peterson, C. A., Zheng, H., Nairn, R. S., Legerski, R. J., Li, L.
(2001). Involvement of Nucleotide Excision Repair in a Recombination-Independent and Error-Prone Pathway of DNA Interstrand Cross-Link Repair. Mol. Cell. Biol.
21: 713-720
[Abstract]
[Full Text]
-
Zhang, N., Zhang, X., Peterson, C., Li, L., Legerski, R.
(2000). Differential processing of UV mimetic and interstrand crosslink damage by XPF cell extracts. Nucleic Acids Res
28: 4800-4804
[Abstract]
[Full Text]
-
De Silva, I. U., McHugh, P. J., Clingen, P. H., Hartley, J. A.
(2000). Defining the Roles of Nucleotide Excision Repair and Recombination in the Repair of DNA Interstrand Cross-Links in Mammalian Cells. Mol. Cell. Biol.
20: 7980-7990
[Abstract]
[Full Text]
-
Yu, V. P.C.C., Koehler, M., Steinlein, C., Schmid, M., Hanakahi, L. A., van Gool, A. J., West, S. C., Venkitaraman, A. R.
(2000). Gross chromosomal rearrangements and genetic exchange between nonhomologous chromosomes following BRCA2 inactivation. Genes Dev.
14: 1400-1406
[Abstract]
[Full Text]
-
Mu, D., Bessho, T., Nechev, L. V., Chen, D. J., Harris, T. M., Hearst, J. E., Sancar, A.
(2000). DNA Interstrand Cross-Links Induce Futile Repair Synthesis in Mammalian Cell Extracts. Mol. Cell. Biol.
20: 2446-2454
[Abstract]
[Full Text]
-
Li, L., Peterson, C. A., Zhang, X., Legerski, R. J.
(2000). Requirement for PCNA and RPA in interstrand crosslink-induced DNA synthesis. Nucleic Acids Res
28: 1424-1427
[Abstract]
[Full Text]
-
Yang, L.-Y., Li, L., Jiang, H., Shen, Y., Plunkett, W.
(2000). Expression of ERCC1 Antisense RNA Abrogates Gemcitabine-mediated Cytotoxic Synergism with Cisplatin in Human Colon Tumor Cells Defective in Mismatch Repair but Proficient in Nucleotide Excision Repair. Clin. Cancer Res.
6: 773-781
[Abstract]
[Full Text]
-
Faruqi, A. F., Datta, H. J., Carroll, D., Seidman, M. M., Glazer, P. M.
(2000). Triple-Helix Formation Induces Recombination in Mammalian Cells via a Nucleotide Excision Repair-Dependent Pathway. Mol. Cell. Biol.
20: 990-1000
[Abstract]
[Full Text]
-
Schild, D., Lio, Y.-c., Collins, D. W., Tsomondo, T., Chen, D. J.
(2000). Evidence for Simultaneous Protein Interactions between Human Rad51 Paralogs. J. Biol. Chem.
275: 16443-16449
[Abstract]
[Full Text]
-
Greenberg, R. B., Alberti, M., Hearst, J. E., Chua, M. A., Saffran, W. A.
(2001). Recombinational and Mutagenic Repair of Psoralen Interstrand Cross-links in Saccharomyces cerevisiae. J. Biol. Chem.
276: 31551-31560
[Abstract]
[Full Text]
Top
Abstract
Introduction
