This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dickson, K. S.
Right arrow Articles by Wickens, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dickson, K. S.
Right arrow Articles by Wickens, M. P.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 1999, p. 5707-5717, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

The Cleavage and Polyadenylation Specificity Factor in Xenopus laevis Oocytes Is a Cytoplasmic Factor Involved in Regulated Polyadenylation

Kirsten S. Dickson, Andrea Bilger,dagger Scott Ballantyne, and Marvin P. Wickens*

Department of Biochemistry, College of Agricultural and Life Sciences, University of Wisconsin, Madison, Wisconsin 53706

Received 19 March 1999/Returned for modification 23 April 1999/Accepted 7 May 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

During early development, specific mRNAs receive poly(A) in the cytoplasm. This cytoplasmic polyadenylation reaction correlates with, and in some cases causes, translational stimulation. Previously, it was suggested that a factor similar to the multisubunit nuclear cleavage and polyadenylation specificity factor (CPSF) played a role in cytoplasmic polyadenylation. A cDNA encoding a cytoplasmic form of the 100-kDa subunit of Xenopus laevis CPSF has now been isolated. The protein product is 91% identical at the amino acid sequence level to nuclear CPSF isolated from Bos taurus thymus. This report provides three lines of evidence that implicate the X. laevis homologue of the 100-kDa subunit of CPSF in the cytoplasmic polyadenylation reaction. First, the protein is predominantly localized to the cytoplasm of X. laevis oocytes. Second, the 100-kDa subunit of X. laevis CPSF forms a specific complex with RNAs that contain both a cytoplasmic polyadenylation element (CPE) and the polyadenylation element AAUAAA. Third, immunodepletion of the 100-kDa subunit of X. laevis CPSF reduces CPE-specific polyadenylation in vitro. Further support for a cytoplasmic form of CPSF comes from evidence that a putative homologue of the 30-kDa subunit of nuclear CPSF is also localized to the cytoplasm of X. laevis oocytes. Overexpression of influenza virus NS1 protein, which inhibits nuclear polyadenylation through an interaction with the 30-kDa subunit of nuclear CPSF, prevents cytoplasmic polyadenylation, suggesting that the cytoplasmic X. laevis form of the 30-kDa subunit of CPSF is involved in this reaction. Together, these results indicate that a distinct, cytoplasmic form of CPSF is an integral component of the cytoplasmic polyadenylation machinery.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The dynamic length changes that occur on mRNA 3' poly(A) tails in eukaryotes often lead to regulation of mRNA function. Decreases in length are commonly associated with translational repression, while increases often accompany translational activation (16, 38, 51). Changes in poly(A) tail length also appear to influence mRNA stability, with removal of poly(A) to below a certain length often triggering mRNA decay (5). A variety of sequences within the 3' untranslated region (UTR) of mRNAs have been shown to regulate the rates of both poly(A) addition and removal (51), thereby influencing both translation and mRNA stability. The detailed molecular mechanisms that underlie these alterations in poly(A) tail length are unclear.

Regulated changes in poly(A) length occur throughout development and have been examined in detail in oocytes and early embryos. In the female germline of many species, cytoplasmic polyadenylation first occurs at, or shortly before, fertilization. In Xenopus laevis, cytoplasmic polyadenylation is activated during meiotic maturation when oocytes, arrested at first meiosis, proceed through second meiosis prior to ovulation. The ability to induce meiotic maturation in culture with the hormone progesterone allows for biochemical analysis of both the elements and factors involved in cytoplasmic polyadenylation. Only those mRNAs that contain a cytoplasmic polyadenylation element (CPE) and the polyadenylation sequence AAUAAA within their 3' UTRs undergo cytoplasmic polyadenylation (13, 28, 33). CPE-binding protein (CPEB) binds preferentially to CPE-containing RNAs and appears to be a positive-acting polyadenylation factor (17, 34, 41); immunodepletion of CPEB blocks polyadenylation activity in vitro (17, 41), and injection of anti-CPEB antibodies reduces polyadenylation in vivo (41). In addition, the cytoplasmic polyadenylation reaction requires a poly(A) polymerase (PAP) (1, 12, 15), which adds successive AMP residues to the 3' end of the mRNA.

In this report we focus on the involvement of a third component, cleavage and polyadenylation specificity factor (CPSF), in cytoplasmic polyadenylation. CPSF was first characterized based on its role in nuclear cleavage and polyadenylation (21, 27, 49). In the nucleus, both the cleavage and subsequent poly(A) addition reactions require the sequence AAUAAA, typically located 10 to 30 nucleotides (nt) 5' of the polyadenylation site (10, 47, 48). CPSF binds directly to this sequence and is required for both reactions (22, 29). In mammalian somatic cells, purified CPSF consists of four subunits, with molecular masses of 160, 100, 73, and 30 kDa (6, 18, 29). The 160-kDa subunit interacts with the AAUAAA sequence and nuclear PAP (19, 22, 29, 30). This interaction brings PAP, which has little or no intrinsic specificity for RNA (43, 46), to the substrate mRNA. The 30-kDa subunit of CPSF may also bind to the AAUAAA sequence (18). In addition, the 30-kDa subunit binds preferentially to U-rich sequences (3, 22). Proteins related in sequence to each CPSF subunit have been identified in Saccharomyces cerevisiae (8, 20, 23, 35, 42, 53) and are essential for 3' end processing in that organism.

While some mechanistic similarities are evident, cytoplasmic and nuclear polyadenylation are distinct biologically. Both reactions require PAP, an enzyme present in both the nucleus and cytoplasm of X. laevis oocytes (1, 15). Both reactions require the polyadenylation sequence AAUAAA; however, cytoplasmic polyadenylation requires the additional presence of a CPE (13, 28, 33). Additionally, cytoplasmic polyadenylation affects only a subset of mRNAs and does so at specific times during development (10, 38, 51) whereas nuclear polyadenylation is a nearly universal and constitutive reaction (49). Finally, CPSF in mammalian, somatic cells is predominantly nuclear (18) and therefore is not available for a cytoplasmic event. If a CPSF-like factor is required for cytoplasmic polyadenylation, as proposed previously (7), it must be localized to the cytoplasm, as removal of the nucleus prior to meiotic maturation does not interfere with the reaction in vivo (13).

This report demonstrates that a cytoplasmic form of the 100-kDa subunit of CPSF is present in X. laevis oocytes. Although it is closely related to its counterpart in mammalian, somatic cells, the oocyte protein is largely cytoplasmic. The 100-kDa subunit of X. laevis CPSF is present in CPE-dependent complexes formed in vitro and is required for efficient cytoplasmic polyadenylation in egg extracts. A putative homologue of the 30-kDa subunit of CPSF is also present in the cytoplasm of X. laevis oocytes and may also be required for this reaction. The data support the hypothesis that a cytoplasmic complex, closely related to CPSF, is required for CPE-dependent polyadenylation.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

All chemicals were supplied by Fisher Scientific, Pittsburgh, Pa., unless noted otherwise.

Oocyte manipulations. Oocyte removal and the induction of meiotic maturation were performed essentially as described in reference 2. Oocyte injections were performed essentially as described in reference 52. Stage VI oocytes were injected with approx 50 nl of RNA (final concentrations for labeled, reporter mRNA transcripts and for production of proteins, 100 fmol/µl and 1 µg/µl, respectively).

Nuclei were removed from oocytes under mineral oil as described in reference 7. For collagenase treatment, enucleated oocytes were incubated for several hours in Marc's modified Ringer's (MMR) containing 1 mg of bovine serum albumin (Sigma, St. Louis, Mo.) per ml to allow healing. Healthy cells were then incubated in collagenase (Boehringer Mannheim, Indianapolis, Ind.) (0.2% in 100 mM sodium phosphate [pH 7.4]) for 60 to 90 min. To confirm the removal of associated follicle cells, intact enucleated oocytes were stained with Hoechst dye 33258 (Sigma; 1 µg per ml of solution containing 110 mM NaCl, 2 mM KCl, 1 mM MgSO4, 2 mM NaHCO3, 0.5 mM sodium phosphate, 15 mM Tris-Cl [pH 7.6]) and analyzed by fluorescence microscopy (excitation wavelength, 356 nm) (information applies to Fig. 1 only).

Antibody preparation. Antibodies raised against the 100-kDa subunit of Bos taurus CPSF were prepared as described previously (18). These antibodies recognize both the native and denatured forms of the 100-kDa subunit of B. taurus CPSF. The monoclonal antibody cell line J1/27 (20a) was produced in response to highly purified B. taurus CPSF and recognizes the native form of the 100-kDa subunit of X. laevis CPSF only. The monoclonal cell line raised against the carboxy-terminal 219 amino acids of p34cdc2 (A17) was produced as described previously (31).

Western blots. Oocytes were homogenized in TE (10 mM Tris-Cl [pH 8] and 1 mM EDTA) plus protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 µg of aprotinin/ml, 10 µg of pepstatin/ml, 10 µg of leupeptin/ml, and 10 µg of chymostatin/ml). In some instances Complete-Mini (Boehringer Mannheim) protease inhibitor cocktail was substituted for these inhibitors. Clarification of oocyte homogenates was performed as described previously (4). Proteins were separated by electrophoresis through sodium dodecyl sulfate (SDS)-6.5 to 10% polyacrylamide gel electrophoresis (PAGE) gels (25) and then transferred electrophoretically to Immobilon-P (Millipore, Bedford, Mass.) in transfer buffer (25 mM Tris, 190 mM glycine, 20% methanol; except for the blots shown in Fig. 1B, where 50 mM Tris, 380 glycine, 0.1% SDS, and 20% methanol was used). Blocking, antibody incubations, and washing were performed according to standard protocols (40). Primary antibody dilutions were as follows: unpurified and Protein A-Sepharose (Sigma)-purified polyclonal anti-CPSF antibodies at 1:2,000 to 1:10,000, affinity-purified polyclonal anti-CPSF and anti-p34cdc2 antibodies at 1:1,000, monoclonal anti-hemagglutinin (HA) antibodies (Berkeley Antibody Company, Berkeley, Calif.) at 1:667, and monoclonal anti-FLAG M2 antibodies (Eastman Kodak, Rochester, N.Y.) at 1:250. Secondary anti-rabbit and anti-mouse antibody (Amersham, Arlington Heights, Ill., and Kirkegaard & Perry, Gaithersburg, Md.) dilutions were according to the manufacturers' specifications. Detection was performed with the LumiGLO chemiluminescent substrate kit (Kirkegaard & Perry) as described by the manufacturer.

Apparent molecular weights of proteins were determined in duplicate using "Hi" molecular-weight protein standards (BioRad, Hercules, Calif.). Molecular weights of X. laevis proteins detected were deduced based on the mobilities of flanking standards. In addition, "Kaleidoscope" (BioRad), "Benchmark" (Gibco-BRL Gaithersburg, Md.), or "Rainbow" (Amersham) standards were included on all blots.

Expression library screen and RACE protocol. Affinity-purified polyclonal antibodies raised against the 100-kDa subunit of B. taurus CPSF (2685) were used to screen a lambda ZAP X. laevis expression library made with oligo(dT)-selected, maternal mRNA from two-cell embryos (gift from Peter Klein). cDNAs were directionally cloned as EcoRI-XhoI fragments. Inserts have an average length of 1 to 2 kb. The library was screened by using a modification of the procedures described in references 40 and 50. Primary antibody diluted in 5% Tris-buffered saline-Tween (1:20,000) was used to screen 100,000 PFU. Positive colonies were detected by using a colorimetric assay reagent (BioRad) as described by the manufacturer. Phagemid DNAs were excised according to the manufacturer's protocol (Stratagene, La Jolla, Calif.). Phagemid DNAs were analyzed by restriction digestion with EcoRI (Promega, Madison, Wis.) and XhoI (Promega). Phagemid DNAs were sequenced by using fluorescent dideoxynucleoside triphosphates (University of Wisconsin---Madison Biotechnology Center). The largest phagemid DNA, a 3-kb fragment, was used as a substrate for a protocol for rapid amplification of cDNA ends (RACE) (14) to isolate additional 5' cDNA sequence as described by the manufacturer (Marathon cDNA Amplification kit; Clontech, Palo Alto, Calif.). The 3' antisense oligonucleotide used in this protocol was 5'CCCAGCATCTTTGGTCCTCC3' (University of Wisconsin---Madison Biotechnology Center).

DNA constructs and preparation of RNAs. A full-length CPSF100 cDNA was constructed by ligation of the RACE PCR fragment with the 3-kb cDNA. The RACE PCR fragment was cloned in frame, 5' of the 3-kb cDNA, as a NotI (Promega)-NdeI (Promega) fragment. The upstream open reading frames (uORFs) in this full-length cDNA were removed by digestion with BglII (Promega) and extended to a blunt end with the Klenow fragment of DNA polymerase I (Promega) and digestion with SmaI (Promega). This construct is referred to as Xlo CPSF100. The Xlo CPSF100 ORF was placed in frame, downstream of an HA tag from pSB33 (1). Both Xlo CPSF100 and pSB33 were digested with XhoI (Promega), extended to a blunt end with the Klenow fragment of DNA polymerase I (Promega), and digested with BglII (Promega) (HA-CPSF100). A FLAG (Eastman Kodak) epitope tag was placed at the carboxy terminus of HA-CPSF100 by using PCR. The FLAG epitope (underlined) was encoded in a 3' antisense oligonucleotide (5 ' CG TC TAGATCAC T TATCGTCATCG TCC T TG TAGTCCACAATGGCATATTGTTC3') (University of Wisconsin---Madison Biotechnology Center) and encompassed a unique XbaI site. The first amino acid of FLAG replaces the HA-CPSF100 stop codon. The 5' sense oligonucleotide (5'CAGCAATGAGGTCCCAGGACACC3') (University of Wisconsin---Madison Biotechnology Center) surrounded a unique PpuMI site in HA-CPSF100. The resulting cDNA contained an in-frame amino-terminal HA tag and an in-frame carboxy-terminal FLAG tag (HA-CPSF100-FL).

Xlo CPSF100 cDNA was linearized with XhoI (Promega) and then transcribed with T3 RNA polymerase (Gibco-BRL and Stratagene). HA-CPSF100 cDNA was linearized with HincII (Promega) and then transcribed with SP6 RNA polymerase (Promega). HA-CPSF100-FL cDNA was linearized with ClaI (Promega) and transcribed with T7 RNA polymerase (Stratagene). All reactions were performed based on the manufacturers' specifications with the exception that GTP (Stratagene) was added 5 min after initial incubation to allow increased incorporation of the m7GpppG cap (New England Biolabs, Beverly, Mass.).

Plasmids encoding L1 RNA and L1 RNA with UUUUUUAU were constructed as described (7, 12, 45). To generate the same RNAs with G substituted for U in AAUAAA, DNA encoding the L1 RNAs was subcloned into pGEM3Z (F+) (Promega), altered by site-directed mutagenesis (24), digested with AflII (New England Biolabs), and incubated with T7 RNA polymerase (Stratagene). Digestion with AflII (New England Biolabs) and incubation with T7 RNA polymerase (Stratagene) yielded a 115-nt (L1) or 123-nt (L1 with UUUUUUAU) RNA.

NS1 constructs, obtained from Robert Krug, were constructed as described in reference 36.

Gel mobility shift and supershift assays. Protein-RNA interactions were detected by using a procedure based on that described previously (12). Egg extract (0.2 µl of a 49-mg/ml solution, prepared as described in reference 12, containing 6.3 µl of buffer [100 mM KCl, 150 µM EDTA, 50 mM Tris, 10% glycerol]) and RNA (1 µl of a 4- to 5-fmol/µl solution) were incubated for 10 min at 25°C and then on ice for 1 h. One microliter of Protein A-Sepharose (Sigma)-purified antibodies (monoclonal antibody J1/27, 0.12 mg/ml; polyclonal antibody 2685, 0.82 mg/ml; preimmune antibody, 29 mg/ml) in buffer (55% glycerol, 25 mM Tris, 50 mM KCl, 1.5 mM MgCl2) or 1 µl of buffer alone was then added to some samples, and the mixtures were incubated for 2 h on ice with occasional agitation. One microliter of heparin (1.2 mg/ml) was then added to each sample, and the resulting mixtures were incubated on ice for 5 min before electrophoresis through a nondenaturing 4% acrylamide gel for 2 to 3 h at 185 V in a cold chamber at 4°C. Complexes were detected by exposure to X-ray film (Eastman Kodak) or a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).

Depletions. Protein A-Sepharose 4B fast-flow beads (Sigma) were swollen in NET buffer (150 mM NaCl, 50 mM Tris-Cl [pH 8.0], 0.1% [vol/vol] Nonidet P-40 [Sigma]) and equilibrated in IP1 buffer (100 mM Na2HPO4, 2 mg of bovine serum albumin/ml, 0.1% NaN3). Ten to 40 microliters of Protein A-Sepharose (Sigma)-purified monoclonal, polyclonal, or preimmune antibodies was then added to 20 µl of bead slurry (10 µl of beads and 10 µl of IP1 buffer) together with 100 µl of cold IP1 buffer. Antibodies were allowed to bind to the beads for 2 h on ice with occasional agitation. The beads were washed twice with cold IP1 buffer and then equilibrated in buffer B (100 mM KCl, 150 µM EDTA, 10% glycerol, 50 mM Tris-Cl [pH 8.5] at 4°C). The beads were then divided into two portions. Buffer was drained from one portion, and a mixture of 12 µl of egg extract (49-mg/ml solution prepared as described in reference 12) and 48 µl of buffer B was added. Beads and extract were incubated together 2 h on ice with occasional agitation. The second tube of beads was drained, and extract from the first tube was transferred to the second. The extract was incubated with these beads for 2 h on ice with occasional agitation. Five microliters was transferred to tubes containing 20 U of RNasin (Promega), 6.5 µg of yeast RNA (Torula type IV; Sigma) (further purified by multiple organic extractions and alcohol precipitations), 12.5 mM dithiothreitol (Boehringer Mannheim), 5 mM ATP, 5 mM MgCl2, and 37.4 mM creatine phosphate in a total volume of 2 µl. Either 1 µl of buffer B or 1 µl of CPSF at approx 40 ng/µl (approx 17 U/µl) concentration was then added, followed by 1 µl (2 fmol/µl) of RNA. Reaction mixtures (total volume, 9 µl) were incubated 20 min at 25°C and processed as described (7). Mock depletions were performed in parallel by using the same buffers, volumes, and incubation times.

Nucleotide sequence accession number. The nucleotide sequence for the Xlo CPSF100 cDNA has been deposited with GenBank under accession no. AF139986.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cytoplasmic homologues of the 100-kDa subunit of CPSF. Previous work suggested that a cytoplasmic factor, related to nuclear CPSF, participates in cytoplasmic polyadenylation (7, 12). To test whether a homologue of the 100-kDa subunit of CPSF is present in X. laevis oocytes, analyses by Western blotting were performed on X. laevis oocyte extracts by using affinity-purified polyclonal antibodies raised against the 100-kDa subunit of B. taurus CPSF (anti-CPSF100 antibodies) (18). X. laevis whole-cell oocyte extracts (Fig. 1A, lane 1), as well as dissected oocyte cytoplasm and nuclei (Fig. 1A, lanes 2 and 3), were analyzed. Partially purified B. taurus nuclear CPSF was probed in parallel for comparison (Fig. 1A, lane 4). Proteins with apparent molecular masses of 109 and 96 kDa were detected in oocyte extracts. The 109-kDa species comigrated with the 100-kDa subunit of B. taurus CPSF and is predominantly localized to the cytoplasm of X. laevis oocytes. (For simplicity, the 109-kDa X. laevis protein is referred to hereafter as the 100-kDa subunit.) The 96-kDa species is present in both oocyte cytoplasm and nuclei. Additionally, the 100-kDa protein is recognized selectively by a monoclonal antibody raised against the 100-kDa subunit of B. taurus CPSF; the 96-kDa protein is not (data not shown).


View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1.   Western blot of X. laevis oocyte extracts obtained by using antibodies raised against the 100-kDa subunit of B. taurus CPSF. (A) Total oocyte extracts (lane 1) as well as cytoplasmic (lane 2) and nuclear (lane 3) oocyte extracts were analyzed by using anti-CPSF100 antibodies. Oocyte cytoplasm and nuclei were manually dissected under mineral oil to reduce nuclear leakage. The equivalent of one oocyte cytoplasm or nucleus was analyzed per lane. For comparison, purified B. taurus CPSF (lane 4), corresponding to 3.6 ng of the 100-kDa subunit, was analyzed as well. (B) Oocytes were treated with collagenase to remove tightly associated follicle cells. After removal of follicle cells, oocytes were manipulated as described for panel A, and total oocyte (lane 1), cytoplasmic (lane 2), and nuclear (lane 3) proteins were examined by Western blotting by using anti-CPSF100 antibodies.

Oocytes are surrounded by a thin layer of somatic cells. To ensure that the two proteins detected were present in the oocyte and not somatically derived, oocytes were treated with collagenase to remove somatic cells prior to dissection (Fig. 1B). Collagenase-treated and untreated cells contained both proteins in comparable abundance. The presence of the 100-kDa protein in the cytoplasmic fraction of collagenase-treated cells (Fig. 1B, lane 2) suggests that it is truly cytoplasmic in the oocyte, rather than a contaminant from adherent somatic tissue.

Isolation of a homologue of the 100-kDa subunit. To isolate cDNAs encoding a homologue of the 100-kDa subunit of CPSF, an X. laevis cDNA expression library (gift from Peter Klein) was screened by using anti-CPSF100 antibodies (18). The largest cDNA isolated was 3.0 kb and encoded a partial ORF corresponding to amino acids (aa) 136 to 783 of the B. taurus peptide. The cDNA contained the entire 3' UTR, as judged by the presence of an AAUAAA sequence followed by a poly(A) tail (Fig. 2A). An additional 5' sequence (Fig. 2A) was obtained by using the RACE protocol (14). The assembled full-length cDNA contained the entire ORF, as well as both 5' and 3' UTRs. The 5' UTR contained two small uORFs, one encoding a 9-aa peptide and the other encoding an AUG immediately followed by a stop codon. Both were removed to allow efficient expression of the 100-kDa protein. The ORF of this cDNA, referred to as Xlo CPSF100 (Xlo denotes X. laevis oocyte), is 78% identical at the nucleotide sequence level and 91% identical at the amino acid sequence level to the 100-kDa subunit of B. taurus CPSF. The amino acid sequence of the 100-kDa subunit of X. laevis CPSF was aligned with the 100-kDa subunit of B. taurus CPSF (Fig. 2B). Comparisons between the 100-kDa subunit of X. laevis CPSF and the 73-kDa subunit of B. taurus CPSF, which shares extensive sequence similarity with the 100-kDa subunit of B. taurus CPSF (20), and the 100-kDa subunit of S. cerevisiae CPSF(Ydh1/Cft2) (35, 53) (Fig. 2B) are shown (Fig. 2C).


View larger version (35K):
[in this window]
[in a new window]
  		FIG. 2.   Schematic of the 100-kDa subunit of X. laevis CPSF and alignment with other CPSF homologues. (A) Schematic representation of the Xlo CPSF100 cDNA (GenBank accession no. AF139986). The portion of the cDNA starting from aa136 was obtained via expression library screening (white). An additional 5' sequence upstream of aa 136 was obtained by RACE amplification (stippled). The 5' UTR is 62 nt in length, and the 3' UTR is 820 nt in length and is followed by a poly(A) tail of 50 nt. (B) The Xlo CPSF100 amino acid sequence was aligned with the amino acid sequence from the 100-kDa subunit of B. taurus CPSF (EMBL accession no. X75931). Only the amino acids which differ from those for the X. laevis sequence are depicted for the B. taurus sequence. (C) The identity and similarity of the amino acid sequence of Xlo CPSF100 with the 100-kDa subunit of B. taurus CPSF, the 73-kDa subunit of B. taurus CPSF (EMBL accession no. X95906), and the 100-kDa subunit of S. cerevisiae CPSF (Ydh1/CftII) (GenBank accession no. U53877) were determined by using the Wisconsin GCG program.

Analysis by Northern blotting of X. laevis mRNA, using a probe spanning the entire ORF, detected two mRNAs of 3.0 and 4.0 kb. Both mRNAs are present in oocytes and eggs (Fig. 3, lanes 1 and 2) and persist throughout early embryogenesis (data not shown). Both are polyadenylated as assessed by oligo(dT) selection (Fig. 3, lane 3 and 4). Mammalian cells also contain two forms of CPSF100 mRNA (18).


View larger version (80K):
[in this window]
[in a new window]
  		FIG. 3.   Northern blot for the X. laevis CPSF100 mRNA. Total RNA from oocytes (lane 1) or eggs (lane 2) was analyzed. Poly(A)-plus RNA (pA+) was selected by multiple passes over oligo(dT) cellulose (lane 3). The flowthrough, representing poly(A)-minus RNA (pA-), was also analyzed (lane 4). Membranes were incubated with a [32P]dATP-radiolabeled probe encoding the entire 5' UTR, ORF, and 3' UTR sequences from Xlo CPSF100. RNAs were visualized by autoradiography.

In vivo expression of X. laevis CPSF100. The two CPSF-like proteins detected immunologically in the oocyte cytoplasm could be encoded by one or more mRNAs. To determine whether the isolated cDNA encoded one or both of these proteins, the N and C termini of Xlo CPSF100 were epitope-tagged with HA (39) and FLAG tags, respectively (HA-CPSF100-FL) (Fig. 4A). This cDNA was transcribed in vitro, and the mRNA was injected into oocytes (Fig. 4B, lanes 2 and 4). Proteins produced by the injected mRNA were identified by using anti-HA (Fig. 4B; compare lanes 2 and 1) or anti-FLAG (Fig. 4B; compare lanes 4 and 3) antibodies. A single protein of constant mobility was detected with each antibody. The production of a protein carrying both the N- and C-terminal epitopes from the HA-CPSF100-FL mRNA suggests that the translational product does not undergo proteolytic processing at either end.


View larger version (38K):
[in this window]
[in a new window]
  		FIG. 4.   Western blot of the in vivo expression and localization of the Xlo CPSF100 protein product. (A) Schematic representation of the protein products encoded by the three cDNA constructs used in this assay. (B) An mRNA encoding a double-epitope-tagged form of the 100-kDa subunit of X. laevis CPSF (HA-CPSF100-FL) was injected into oocytes. Protein was isolated from both uninjected (lanes 1 and 3) and injected cells (lanes 2 and 4), and production of the HA-CPSF100-FL protein was visualized by Western blotting using antibodies raised against the HA epitope tag (anti-HA antibodies) (lanes 1 and 2) or the FLAG epitope tag (anti-FL antibodies) (lanes 3 and 4). (C) An mRNA encoding an untagged form of Xlo CPSF100 was expressed in oocytes and visualized by Western blotting using anti-CPSF100 antibodies. Production of the Xlo CPSF100 protein was viewed as an increase in antibody signal in injected cells compared to uninjected cells (compare lanes 2 and 1). (D) mRNA encoding an N-terminal HA epitope-tagged form of the 100-kDa subunit (HA-CPSF100) was injected into oocytes. Both uninjected (lanes 1 to 3) and injected (lanes 4 to 6) oocytes were manually dissected into cytoplasmic and nuclear fractions. Total oocyte extracts (lanes 1 and 4), cytoplasm (each lane is equivalent to one oocyte) (lanes 2 and 5), and nuclei (each lane is equivalent to one oocyte nucleus) (lanes 3 and 6) were analyzed by Western blotting. The top half of the membrane was probed for the HA-CPSF100 protein by using anti-HA antibodies. The bottom half was analyzed by using anti-p34cdc2 (gift from Tim Hunt) to detect this nuclear protein.

To determine whether the product of Xlo CPSF100 comigrated with the endogenous, cytoplasmic CPSF, mRNA encoding an untagged form of the protein (Fig. 4A) was injected into oocytes and the protein was detected by Western blot analysis using anti-CPSF100 antibodies (Fig. 4C). Injection of the untagged CPSF100 mRNA caused a substantial increase in the amount of protein seen at the position of the endogenous 100-kDa CPSF homologue; no increase in the amount of the 96-kDa species was detected (Fig. 4C, lane 2 and 1). Taken together, these results demonstrate that the 100-kDa protein corresponds to the protein encoded by the Xlo CPSF100 cDNA and that the 96-kDa protein is neither derived from Xlo CPSF100 by alternate initiation or termination nor derived from the 100-kDa protein by proteolysis.

To determine whether the cloned Xlo CPSF100 protein was cytoplasmic, an mRNA encoding an N-terminal HA epitope-tagged mRNA (HA-CPSF100) (Fig. 4A) was injected into oocytes. After overnight incubation to allow translation and transport to occur, oocytes were manually dissected into nuclear and cytoplasmic fractions. The majority of the HA-tagged protein was present in the cytoplasm (Fig. 4D; compare lanes 5 and 6). Effectiveness of the enucleations was analyzed by Western blotting with anti-p34cdc2 antibodies (31) for this nuclear protein (Fig. 4D). These data indicate that the cloned Xlo CPSF100 protein is predominantly cytoplasmic.

Specific association of Xlo CPSF100 with a cytoplasmic polyadenylation substrate. To determine whether the 100-kDa subunit of X. laevis CPSF was present during meiotic maturation when cytoplasmic polyadenylation is activated, oocyte extracts obtained before (Fig. 5A, lane 1) and after (Fig. 5A, lane 2) maturation were analyzed by Western blotting using anti-CPSF100 antibodies. Both the 100-kDa subunit of CPSF and the cross-reacting 96-kDa protein are present after maturation. Neither the abundance nor the electrophoretic mobility of these proteins is altered during maturation (Fig. 5A) or early embryonic development (data not shown).


View larger version (38K):
[in this window]
[in a new window]
  		FIG. 5.   Electrophoretic gel mobility supershift assay of a CPE- and/or AAUAAA-containing mRNA performed in the presence of X. laevis egg extract and anti-CPSF100 antibodies. (A) Protein was isolated from oocytes (lane 1) and from oocytes induced to undergo meiotic maturation by incubation in the hormone progesterone (lane 2). Xlo CPSF100 protein was visualized by Western blotting by using anti-CPSF100 antibodies. (B) mRNAs without a CPE or an AAUAAA (lane 1), with only a CPE (lane 2), with only an AAUAAA (lane 3), or with both a CPE and an AAUAAA sequence (lanes 4 through 8) were in vitro-transcribed in the presence of [alpha -32P]UTP. Each mRNA was then incubated in the presence of X. laevis egg extract alone (lanes 1 through 4). In addition, the CPE- and/or AAUAAA-containing mRNA was incubated in the presence of X. laevis egg extract plus either monoclonal anti-CPSF100 antibodies (lane 5), monoclonal buffer (lane 6), polyclonal anti-CPSF100 antibodies (lane 7), or preimmune serum antibodies (lane 8). mRNAs were separated on a native polyacrylamide gel and visualized by exposure to film.

An RNA-binding activity, specific for CPE/AAUAAA-containing RNAs, is present in X. laevis egg extracts competent for cytoplasmic polyadenylation (12, 33). This activity fractionates in a manner similar to that of nuclear CPSF (12) and can be functionally replaced in vitro with purified nuclear CPSF (7). In order to determine whether Xlo CPSF100 was part of this complex, electrophoretic gel retardation assays were performed by using X. laevis egg extracts in the presence or absence of anti-CPSF100 antibodies (Fig. 5B). As neither polyclonal antibodies nor monoclonal antibodies raised against the 100-kDa subunit of CPSF recognize the native form of the 96-kDa protein, no conclusions can be drawn about the presence or absence of this factor in the complex. Radiolabeled RNAs containing both a CPE and the polyadenylation element AAUAAA formed a specific complex when incubated in egg extracts competent for cytoplasmic polyadenylation (Fig. 5B, lane 4) (12). This complex is not formed with RNAs that lack the CPE or contain a point mutation in AAUAAA (AAGAAA) (Fig. 5B, lanes 1, 2, and 3) (12). These results are consistent with previous data (12). When either monoclonal or polyclonal anti-CPSF100 antibodies were added to the RNA-egg extract mixture, the mobility of the specific complex was reduced (Fig. 5B, lanes 5 and 7). The addition of buffer alone or rabbit preimmune serum had no effect on the mobility of this complex (Fig. 5B, lanes 6 and 8). These data demonstrate that Xlo CPSF100 is present in polyadenylation-specific complexes.

Immunodepletion of Xlo CPSF100 inhibits CPE-dependent polyadenylation. In order to determine whether Xlo CPSF100 was required for cytoplasmic polyadenylation in vitro, both monoclonal (Fig. 6A) and polyclonal (data not shown) anti-CPSF100 antibodies were used to immunodeplete the Xlo CPSF100 protein from egg extracts. Depleted egg extracts were tested for the ability to activate CPE-dependent polyadenylation in vitro. Polyadenylation in antibody-depleted extracts was reduced in comparison to that in mock-depleted extracts (Fig. 6A; compare lanes 5 and 4). Addition of purified nuclear CPSF fully restored activity to the depleted extracts in a CPE-dependent manner (Fig. 6A, lanes 6 and 7).


View larger version (32K):
[in this window]
[in a new window]
  		FIG. 6.   In vitro polyadenylation assay in X. laevis egg extract depleted of the cytoplasmic form of the 100-kDa subunit of CPSF. (A) mRNAs with only an AAUAAA sequence (lanes 1, 3, and 7) or with both a CPE and an AAUAAA sequence (lanes 2, 4, 5, and 6) were in vitro transcribed in the presence of [alpha -32P]ATP. mRNAs were left untreated (lanes 1 and 2) or incubated in X. laevis egg extract passed over Protein A-Sepharose (lanes 3 and 4), egg extract washed over Protein A-Sepharose coupled to anti-CPSF100 antibodies (lane 5), or egg extract washed over Protein A-Sepharose coupled to anti-CPSF100 antibodies and then supplemented with purified nuclear B. taurus CPSF (lanes 6 and 7). mRNAs were separated on a denaturing 6% polyacrylamide gel and visualized by exposure to film. (B) X. laevis egg extract washed over Protein A-Sepharose (lane 1), washed over Protein A-Sepharose coupled to anti-CPSF100 antibodies (lane 2), or washed over Protein A-Sepharose coupled to anti-CPSF100 antibodies and then supplemented with purified B. taurus CPSF (lane 3) was separated by SDS-PAGE. Proteins were visualized by Western blotting using anti-CPSF100 antibodies.

The quantity of Xlo CPSF100 in control and depleted extracts was assessed by Western blot analysis using anti-CPSF100 antibodies. Xlo CPSF100 was depleted to near-undetectable levels in antibody-depleted (Fig. 6B, lane 2) but not mock-depleted (Fig. 6B, lane 1) extracts. Addition of purified nuclear CPSF increased the concentration of the Xlo CPSF100 protein to approximately twice the endogenous level as evaluated by Western blot analysis (Fig. 6B, lane 3). CPSF concentrations comparable to endogenous levels also restored full activity (data not shown). The 96-kDa protein was not recognized by either monoclonal antibodies or polyclonal antibodies and remained present in all egg extracts. It is possible therefore that the residual polyadenylation activity is due to the presence of this protein. These data demonstrate that removal of the Xlo CPSF100 significantly reduces cytoplasmic polyadenylation in vitro.

Influenza virus protein NS1 inhibits cytoplasmic polyadenylation. The influenza virus protein NS1 interacts with the 30-kDa subunit of B. taurus CPSF (32). The NS1-CPSF30 interaction prevents CPSF from binding to the pre-mRNA and thereby inhibits the activities of CPSF in the nucleus, blocking both pre-mRNA cleavage and polyadenylation (32). If CPSF is involved in cytoplasmic polyadenylation, then expression of NS1 in an oocyte might also prevent that reaction. To test this hypothesis, various NS1 mRNA constructs were prepared by transcription in vitro and injected into oocytes. After incubation of the oocytes overnight to permit NS1 protein production, radiolabeled polyadenylation substrates were injected and meiotic maturation was induced by the addition of progesterone.

The wild-type NS1 protein (NS1wt) (36) prevented cytoplasmic polyadenylation (Fig. 7A; compare lanes 4 and 2). An NS1 mutant lacking the RNA-binding domain, which is required for inhibition of mRNA splicing and export (26, 36, 37) but is capable of interacting with nuclear CPSF30 (NS1RBDmut) (36), prevented cytoplasmic polyadenylation as effectively as the wild-type protein (Fig. 7A; compare lanes 6 and 4). Support for the specificity of this reaction was provided by the use of mutant forms of the NS1 protein, either carrying an amino acid substitution that prevents binding to nuclear CPSF30 (NS1C30mut1) (36) or carrying a deletion of this same region (NS1C30mut2) (36). Neither of these mutant proteins had any effect on cytoplasmic polyadenylation (Fig. 7A, lanes 8 and 10). The lack of inhibition was not due to lack of these mutant proteins in the injected cells, as both NS1C30mut1 and NS1C30mut2 proteins were present in injected cells as assessed by Western blot analysis (data not shown). The mRNA degradation phenotype seen in NS1-expressing cells after the induction of meiotic maturation (Fig. 7A, lanes 4 and 6) is similar to that seen for mRNAs containing a point mutation within the AAUAAA sequence (AAGAAA) (Fig. 7B, lane 2) which prevents CPSF from binding (22, 29). This phenotype is consistent with the hypothesis that NS1 displaces CPSF from the mRNA.


View larger version (64K):
[in this window]
[in a new window]
  		FIG. 7.   In vivo polyadenylation assay of injected mRNAs in the presence of NS1. (A) X. laevis oocytes were injected with mRNA encoding various forms of the NS1 protein. Protein production was allowed to proceed overnight before subsequent analyses. An mRNA containing both a CPE and the AAUAAA sequence was in vitro-transcribed in the presence of [alpha -32P]UTP. This mRNA was injected into oocytes without NS1 protein (lanes 1 and 2) or oocytes expressing NS1 (lanes 3 and 4) (referred to as NS1-3'ss in reference 36), NS1RBDmut (lanes 5 and 6) (referred to as NS1-RM in reference 36), NS1C30mut1 (lanes 7 and 8) (referred to as NS1-EM in reference 36), or NS1C30mut2 (lanes 9 and 10) (referred to as NS1-Delta E in reference 36) proteins. After the radiolabeled RNA was injected, meiotic maturation was induced in some cells by incubation in progesterone (lanes 2, 4, 6, 8, and 10). Only cells in which germinal vesicle breakdown had occurred, as assessed by white spot formation, were assumed to have matured. RNA was isolated from cells, separated by electrophoresis through a 6% polyacrylamide gel, and visualized by autoradiography. (B) [alpha -32P]UTP-radiolabeled mRNA containing a point mutation in AAUAAA (AAGAAA) was in vitro-transcribed and injected into oocytes. Total RNAs from both oocytes (lane 1) and oocytes incubated in progesterone (lane 2) were separated by electrophoresis through a 6% polyacrylamide gel and visualized by autoradiography.

The results obtained by using NS1 protein support the view that a CPSF-like factor is required for cytoplasmic polyadenylation. In particular, they suggest that a homologue of the 30-kDa subunit is involved in this reaction.

Homologues of the 30- and 73-kDa subunits of CPSF. To determine whether a homologue of CPSF30 was present in the cytoplasm of X. laevis oocytes, Western blot analysis was performed on oocyte extracts by using affinity-purified polyclonal antibodies raised against the 30-kDa subunit of B. taurus CPSF (3). In addition, antibodies raised against the 73-kDa subunit of B. taurus CPSF (gift from David Bentley) were used to probe for a putative homologue of this CPSF subunit. Total X. laevis oocyte extracts, as well as dissected oocyte cytoplasm and nuclei, were analyzed. Both antibodies cross-reacted with proteins of the approximate size of the B. taurus CPSF subunits. The 30-kDa subunit was predominantly localized to the cytoplasm (Fig. 8A, lanes 3 and 4); the presence of this protein in collagenase-treated cells (Fig. 8A, lane 1) suggests that the 30-kDa subunit is a cytoplasmic protein and not a contaminant of adherent somatic tissue. In surprising contrast, the putative homologue of the 73-kDa subunit was predominantly localized to the nucleus (Fig. 8A; compare lanes 4 and 3). Effectiveness of the enucleations was assessed by Western blot analysis using anti-p34cdc2 antibodies (31) to detect this nuclear protein (Fig. 8B).


View larger version (26K):
[in this window]
[in a new window]
  		FIG. 8.   Western blot of X. laevis oocyte extracts obtained by using antibodies raised against the 73- and 30-kDa subunits of B. taurus CPSF. Oocyte cytoplasm and nuclei were manually dissected under mineral oil to reduce nuclear leakage. Total oocyte extracts (lanes 1 and 2) as well as cytoplasmic (lane 3) and nuclear (lane 4) oocyte extracts were analyzed. The equivalent of one oocyte cytoplasm or nucleus was analyzed per lane. Some oocytes were treated with collagenase to remove associated follicle cells (lane 1). All blots were generated from the same protein extract. (A) Analysis by Western blotting using anti-73-kDa (top) or anti-30-kDa (bottom) antibodies raised against these subunits of B. taurus CPSF. (B) Analysis by Western blotting using anti-p34cdc2 antibody to detect this nuclear protein.

These results indicate that a putative homologue of CSPF30 is present in the cytoplasm of X. laevis oocytes, consistent with the hypothesis that NS1 inhibits cytoplasmic polyadenylation via an interaction with CPSF30. In addition, they illustrate that differences exist between nuclear and cytoplasmic CPSF activities.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The work presented here indicates that the X. laevis oocyte cytoplasm harbors homologues of both the 30- and 100-kDa subunits of CPSF. The 100-kDa subunit is more than 90% identical in amino acid sequence to its mammalian nuclear counterpart. Both the 100- and 30-kDa subunits appear to be required for efficient cytoplasmic polyadenylation. A putative homologue of the 73-kDa subunit is predominantly nuclear, suggesting that nuclear and cytoplasmic forms of the complex may differ in composition.

CPSF and cytoplasmic polyadenylation. Purified B. taurus CPSF directs CPE-specific polyadenylation in vitro when combined with B. taurus PAP (7). This circumstantial evidence and related observations first raised the hypothesis that CPSF-like factors are present in the cytoplasm of oocytes and were involved in developmentally regulated polyadenylation (7, 12). The work reported here tests that hypothesis by examining both whether such cytoplasmic factors exist in the oocyte and whether they are indeed required for CPE-dependent polyadenylation both in vivo and in vitro.

To address the question of whether CPSF subunits are present in the cytoplasm of X. laevis oocytes, antibodies against the B. taurus factor were used to analyze oocyte nuclear and cytoplasmic fractions. The oocyte cytoplasm contains a protein closely related to the 100-kDa subunit of mammalian, nuclear CPSF (Fig. 1). Similarly, a 30-kDa protein detected by anti-CPSF30 antibodies (3) is also cytoplasmic (Fig. 8). In contrast, the X. laevis 73-kDa subunit (Fig. 8) and all identified CPSF subunits cloned from B. taurus (18-20, 22, 29, 30) and S. cerevisiae (8, 20, 23, 35, 42, 53) are predominantly nuclear at steady state. These data confirm a critical prediction of the earlier hypothesis (7, 12): that cytoplasmic CPSF-like factors do exist in the oocyte cytoplasm. In addition, they raise new questions about the overall composition of this cytoplasmic complex.

Three functional tests support the conclusion that CPSF is an integral and required component of the cytoplasmic polyadenylation machinery. First, CPSF specifically associates with CPE/AAUAAA-containing RNAs (Fig. 5). Previous work suggested that a CPE/AAUAAA-specific RNA-binding activity in X. laevis egg extracts was required for cytoplasmic polyadenylation (12). The data presented here indicate that the 100-kDa CPSF protein is part of this RNA-binding complex. Second, depletion of the 100-kDa subunit of CPSF from egg extracts results in a decrease in CPE-specific polyadenylation in vitro (Fig. 6). The fact that activity is only partially lost may reflect either the involvement of complexes that do not contain CPSF or an involvement of the 96-kDa protein that cannot be effectively immunodepleted. Third, overexpression of the influenza virus protein NS1 inhibits cytoplasmic polyadenylation in vivo (Fig. 7).

The recent observation that poly(A)-binding protein II (PABII) and NS1 interact (9) could be interpreted to suggest that NS1 prevents cytoplasmic polyadenylation via an effect on PABII rather than CPSF30. In the nuclear reaction, the interaction of NS1 with PABII results in the nuclear accumulation of stable, cleaved mRNAs with short (ca. 10 nt) poly(A) tails (9). Two lines of evidence presented here suggest that this is not the case in the oocyte cytoplasm. First, overexpressed NS1 and NS1RBD-mut proteins prevent cytoplasmic polyadenylation in a manner that yields products very similar to those observed with substrates with a point mutation in AAUAAA (AAGAAA). In both cases, the RNAs did not receive any detectable poly(A) and were largely unstable (Fig. 7). Second, the NS1-inhibited cytoplasmic polyadenylation products differ from nuclear polyadenylation products (9) in that they lack the short poly(A) tail. These results suggest that NS1 exerts an effect through an interaction with CPSF30 and not PABII.

CPSF, CPEB, and cytoplasmic polyadenylation. The biochemical events that initiate early cytoplasmic polyadenylation during meiotic maturation, prior to nuclear breakdown, are unknown (see "Nuclear and cytoplasmic CPSF," below). However, modifications of identified cytoplasmic polyadenylation factors are unlikely to trigger this event. Quantitative changes in the amount or mobility of the three CPSF subunits identified thus far are not detected during meiotic maturation (Fig. 1 and unpublished data). Similarly, activation appears to require neither an increase in nor hyperphosphorylation of CPEB (2, 41). Additionally, although PAP is hyperphosphorylated during meiotic maturation (1, 15), the form of PAP found prior to maturation is active in vitro (12). These results suggest that an as yet unidentified factor may be required to activate cytoplasmic polyadenylation during meiotic maturation.

Nuclear and cytoplasmic CPSF. The high degree of sequence similarity between the cytoplasmic X. laevis and the nuclear B. taurus 100-kDa CPSF subunits suggests that the nuclear and cytoplasmic factors are closely related and could perform similar functions (Fig. 2). The presence of putative homologues of the 30- and 73-kDa subunits of CPSF in X. laevis extracts (Fig. 8) suggests conservation of these subunits as well. The ability of nuclear CPSF to recapitulate CPE-specific polyadenylation in vitro indicates that nuclear CPSF can function in the regulated cytoplasmic polyadenylation event (7). Conversely, the ability of enucleated oocytes to undergo cytoplasmic polyadenylation (12), as well as the fact that poly(A) tail length changes occur on a number of mRNAs prior to nuclear breakdown (2, 11), argues that nuclear and cytoplasmic polyadenylation require distinct machineries. The absence of a detectable 73-kDa subunit in the cytoplasm suggests that at least one important distinction exists between these two activities and may underlie the requirement for an additional factor (e.g., CPEB) in the cytoplasmic event.

The distinct subcellular localization of the 100- and 30-kDa subunits in relation to the 73-kDa subunit could be exploited to regulate polyadenylation activity. For example, it might underlie the existence of two classes of cytoplasmic polyadenylation reactions (2, 11). As described previously, polyadenylation of certain mRNAs is independent of c-mos polyadenylation and maturation-promoting factor activation (class I), whereas polyadenylation of other mRNAs requires both c-mos and MPF activities (class II) (2, 11). Polyadenylation of c-mos mRNA and subsequent production of Mos protein ultimately results in nuclear breakdown during meiosis. In one model, class I polyadenylation, which occurs prior to nuclear breakdown, should require only those CPSF subunits that are cytoplasmic in the oocyte (i.e., the 30- and 100-kDa subunits), while class II polyadenylation should require the 73-kDa subunit in addition and therefore occurs only when that subunit is released after nuclear breakdown. This hypothesis is consistent with the observation that the nuclear 73-kDa subunit can be coimmunoprecipitated with the cytoplasmic 100-kDa subunit from oocyte extracts prepared after nuclear breakdown (7a). Viewed in this manner, the increase in cytoplasmic polyadenylation activity may be analogous to the increase in nuclear 3' end formation activity in B cells, in which elevation of the level of the 64-kDa subunit of cleavage stimulatory factor increases cleavage and polyadenylation at a specific site (44). Regardless, the existence of distinctly compartmentalized CPSF subunits raises key questions as to the mechanism of cytoplasmic polyadenylation. It is now critical to identify components with which cytoplasmic CPSF subunits interact and to determine how cytoplasmic CPSF contributes to regulated polyadenylation in the oocyte and embryo. In particular, the question of whether the activity or recruitment of CPSF to specific mRNAs is regulated through additional components is central.


    ACKNOWLEDGMENTS

We thank Walter Keller, Elmar Wahle, Andreas Jenny, and Silvia Barabino for providing advice, purified CPSF, and antibodies to CSPF100 and CPSF30. David Bentley is thanked for providing antibodies to CPSF70. We thank Peter Klein for the X. laevis expression library and Claire Walczak for advice on library screening. We thank Xiao-Yan Qian, Martin Nemeroff, and Robert Krug for supplying the NS1 constructs and antibodies and for communicating results prior to publication. We thank Tim Hunt and Julian Gannon for providing antibodies to p34cdc2. We thank the Wickens lab, in particular Nicola Gray and Donald Gillian-Daniels for helpful discussion and comments on the manuscript. We especially thank Laura Vanderploeg and Adam Steinberg for their extreme patience in assembling the figures.

This work was supported by NIH research grants GM31892 and GM50942 to M.P.W. and by University of Wisconsin Molecular Biosciences training grant predoctoral fellowships to S.B. and K.S.D.

K.S.D. and A.B. contributed equally to this work.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Biochemistry, College of Agricultural and Life Sciences, University of Wisconsin, 433 Babcock Dr., Madison, WI 53706. Phone: 608-262-8007. Fax: 608-262-9108. E-mail: wickens{at}biochem.wisc.edu.

dagger Present address: McArdle Laboratory, University of Wisconsin---Madison, Madison, WI 53706.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Ballantyne, S., A. Bilger, J. Astrom, A. Virtanen, and M. Wickens. 1995. Poly(A) polymerases in the nucleus and cytoplasm of frog oocytes: dynamic changes during oocyte maturation and early development. RNA 1:64-78[Abstract].
2. Ballantyne, S., D. L. J. Daniel, and M. Wickens. 1997. A dependent pathway of cytoplasmic polyadenylation reactions linked to cell cycle control by c-mos and CDK1 activation. Mol. Biol. Cell 8:1633-1648[Abstract].
3. Barabino, S. M. L., W. Hubner, A. Jenny, L. Minvielle-Sebastia, and W. Keller. 1997. The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc finger proteins. Genes Dev. 11:1703-1716[Abstract/Free Full Text].
4. Barkoff, A., S. Ballantyne, and M. Wickens. 1998. Meiotic maturation in Xenopus requires polyadenylation of multiple mRNAs. EMBO J. 17:3168-3175[Medline].
5. Beelman, C. A., and R. Parker. 1995. Degradation of mRNA in eukaryotes. Cell 81:179-183[Medline].
6. Bienroth, S., E. Wahle, C. Suter-Crazzolara, and W. Keller. 1991. Purification of the cleavage and polyadenylation factor involved in the 3'-processing of messenger RNA precursors. J. Biol. Chem. 266:19768-19776[Abstract/Free Full Text].
7. Bilger, A., C. A. Fox, E. Wahle, and M. Wickens. 1994. Nuclear polyadenylation factors recognize cytoplasmic polyadenylation elements. Genes Dev. 8:1106-1116[Abstract/Free Full Text].
7a. Bilger, A., and M. Wickens. Unpublished data.
8. Chanfreau, G., S. M. Noble, and C. Guthrie. 1996. Essential yeast protein with unexpected similarity to subunits of mammalian cleavage and polyadenylation specificity factor (CPSF). Science 274:1511-1514[Abstract/Free Full Text].
9. Chen, Z., Y. Li, and R. M. Krug. 1999. Influenza A virus NS1 protein targets poly(A)-binding protein II of the cellular 3' end processing machinery. EMBO J. 18:2273-2283[Medline].
10. Colgan, D. F., and J. L. Manley. 1997. Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11:2755-2766[Free Full Text].
11. De Moor, C. H., and J. D. Richter. 1997. The Mos pathway regulates cytoplasmic polyadenylation in Xenopus oocytes. Mol. Cell. Biol. 17:6419-6426[Abstract].
12. Fox, C. A., M. D. Sheets, E. Wahle, and M. Wickens. 1992. Polyadenylation of maternal mRNA during oocyte maturation: poly(A) addition in vitro requires a regulated RNA binding activity and a poly(A) polymerase. EMBO J. 11:5021-5032[Medline].
13. Fox, C. A., M. D. Sheets, and M. P. Wickens. 1989. Poly(A) addition during maturation of frog oocytes: distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU. Genes Dev. 3:2151-2162[Abstract/Free Full Text].
14. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid amplification of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002[Abstract/Free Full Text].
15. Gebauer, F., and J. D. Richter. 1995. Cloning and characterization of a Xenopus poly(A) polymerase. Mol. Cell. Biol. 15:1422-1430[Abstract].
16. Gray, N. K., and M. Wickens. 1998. Control of translation initiation in animals. Annu. Rev. Cell Dev. Biol. 14:399-458[Medline].
17. Hake, L. E., and J. D. Richter. 1994. CPEB is a specificity factor that mediates cytoplasmic polyadenylation during Xenopus oocyte maturation. Cell 79:617-627[Medline].
18. Jenny, A., H. P. Hauri, and W. Keller. 1994. Characterization of cleavage and polyadenylation specificity factor and cloning of its 100-kilodalton subunit. Mol. Cell. Biol. 14:8183-8190[Abstract/Free Full Text].
19. Jenny, A., and W. Keller. 1995. Cloning of cDNAs encoding the 160 kDa subunit of the bovine cleavage and polyadenylation specificity factor. Nucleic Acids Res. 23:2629-2635[Abstract/Free Full Text].
20. Jenny, A., L. Minvielle-Sebastia, P. J. Preker, and W. Keller. 1996. Sequence similarity between the 73-kilodalton protein of mammalian CPSF and a subunit of yeast polyadenylation factor I. Science 274:1514-1517[Abstract/Free Full Text].
20a. Jenny, A., and W. Keller. Unpublished data.
21. Keller, W. 1995. No end yet to messenger RNA 3' processing! Cell 81:829-832[Medline].
22. Keller, W., S. Bienroth, K. M. Lang, and G. Christofori. 1991. Cleavage and polyadenylation factor CPF specifically interacts with the pre-mRNA 3' processing signal AAUAAA. EMBO J. 10:4241-4249[Medline].
23. Kessler, M. M., J. Zhao, and C. L. Moore. 1996. Purification of the Saccharomyces cerevisiae cleavage/polyadenylation factor I. J. Biol. Chem. 271:27167-27175[Abstract/Free Full Text].
24. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotype selection. Proc. Natl. Acad. Sci. USA 82:488-492[Abstract/Free Full Text].
25. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
26. Lu, Y., X. Qian, and R. M. Krug. 1994. The influenza virus NS1 protein: a novel inhibitor of pre-mRNA splicing. Genes Dev. 8:1827-1828.
27. Manley, J. L. 1995. A complex protein assembly catalyzes polyadenylation of mRNA precursors. Curr. Opin. Genet. Dev. 5:222-228[Medline].
28. McGrew, L. L., E. Dworkin-Rastl, M. B. Dworkin, and J. D. Richter. 1989. Poly(A) elongation during Xenopus oocyte maturation is required for translational recruitment and is mediated by a short sequence element. Genes Dev. 3:803-815[Abstract/Free Full Text].
29. Murthy, K. G. K., and J. L. Manley. 1992. Characterization of the multisubunit cleavage-polyadenylation factor from calf thymus. J. Biol. Chem. 267:14804-14811[Abstract/Free Full Text].
30. Murthy, K. G. K., and J. L. Manley. 1995. The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'-end formation. Genes Dev. 9:2672-2683[Abstract/Free Full Text].
31. Nebreda, A. R., J. V. Gannon, and T. Hunt. 1995. Newly synthesized protein(s) must associate with p34cdc2 to activate MAP kinase and MPF during progesterone-induced maturation of Xenopus oocytes. EMBO J. 14:5597-5607[Medline].
32. Nemeroff, M. E., S. M. L. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3' end formation of cellular pre-mRNAs. Mol. Cell 1:991-1000[Medline].
33. Paris, J., and J. D. Richter. 1990. Maturation-specific polyadenylation and translational control: diversity of cytoplasmic polyadenylation elements, influence of poly(A) tail size, and formation of stable polyadenylation complexes. Mol. Cell. Biol. 10:5634-5645[Abstract/Free Full Text].
34. Paris, J., K. Swenson, H. Piwnica-Worms, and J. D. Richter. 1991. Maturation-specific polyadenylation: in vitro activation by p34cdc2 and phosphorylation of a 58-kD CPE-binding protein. Genes Dev. 5:1697-1708[Abstract/Free Full Text].
35. Preker, P. J., M. Ohnacker, L. Minvielle-Sebastia, and W. Keller. 1997. A multisubunit 3' end processing factor from yeast containing poly(A) polymerase and homologues of the subunits of mammalian cleavage and polyadenylation specificity factor. EMBO J. 16:4727-4737[Medline].
36. Qian, X.-Y., F. Alonso-Caplen, and R. M. Krug. 1994. Two functional domains of the influenza virus NS1 protein are required for regulation of nuclear export of mRNA. J. Virol. 68:2433-2441[Abstract/Free Full Text].
37. Qui, Y., and R. M. Krug. 1994. The influenza virus NS1 protein is a poly(A)-binding protein that inhibits nuclear export of mRNAs containing poly(A). J. Virol. 68:2425-2432[Abstract/Free Full Text].
38. Richter, J. D. 1996. Dynamics of poly(A) addition and removal during development, p. 481-503. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
39. Roof, D. M., P. B. Meluh, and M. D. Rose. 1992. Kinesin-related proteins required for assembly of the mitotic spindle. J. Cell Biol. 118:95-108[Abstract/Free Full Text].
40. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
41. Stebbins-Boaz, B., L. E. Hake, and J. D. Richter. 1996. CPEB controls the cytoplasmic polyadenylation of cyclin, Cdk2 and c-mos mRNAs and is necessary for oocyte maturation in Xenopus. EMBO J. 15:2582-2592[Medline].
42. Stumpf, G., and H. Domdey. 1996. Dependence of yeast pre-mRNA 3' end processing on CFT-1: a sequence homolog of the mammalian AAUAAA binding factor. Science 274:1517-1520[Abstract/Free Full Text].
43. Takagaki, Y., L. C. Ryner, and J. L. Manley. 1988. Separation and characterization of a poly(A) polymerase and a cleavage/specificity factor required for pre-mRNA polyadenylation. Cell 52:731-742[Medline].
44. Takagaki, Y., R. L. Seipelt, M. L. Peterson, and J. L. Manley. 1996. The polyadenylation factor CstF-64 regulates alternative processing of IgM heavy chain pre-mRNA during B cell differentiation. Cell 87:941-952[Medline].
45. Verrotti, A. C., S. R. Thompson, C. Wreden, S. Strickland, and M. Wickens. 1996. Evolutionary conservation of sequence elements controlling cytoplasmic polyadenylation. Proc. Natl. Acad. Sci. USA 93:9027-9032[Abstract/Free Full Text].
46. Wahle, E. 1991. Purification and characterization of a mammalian polyadenylate polymerase involved in the 3' end processing of messenger RNA precursors. J. Biol. Chem. 266:3131-3139[Abstract/Free Full Text].
47. Wahle, E., and W. Keller. 1992. The biochemistry of 3'-end cleavage and polyadenylation of messenger RNA precursors. Annu. Rev. Biochem. 61:419-440[Medline].
48. Wahle, E., and W. Keller. 1996. The biochemistry of polyadenylation. Trends Biochem. Sci. 21:247-250[Medline].
49. Wahle, E., and U. Kuhn. 1997. The mechanism of 3' cleavage and polyadenylation of eukaryotic pre-mRNA. Prog. Nucleic Acid Res. Mol. Biol. 57:41-71[Medline].
50. Walczak, C. E., T. J. Mitchison, and A. Desai. 1996. XKCM1: a Xenopus kinesin-related protein that regulates microtubule dynamics during mitotic spindle assembly. Cell 84:37-47[Medline].
51. Wickens, M., P. Anderson, and R. Jackson. 1997. Life and death in the cytoplasm: messages from the 3' end. Curr. Opin. Genet. Dev. 7:220-232[Medline].
52. Wickens, M. P., and J. B. Gurdon. 1983. Post-transcriptional processing of simian virus 40 late transcripts in injected frog oocytes. J. Mol. Biol. 163:1-26[Medline].
53. Zhao, J., M. M. Kessler, and C. L. Moore. 1997. Cleavage factor II of Saccharomyces cerevisiae contains homologues to subunits of the mammalian cleavage/polyadenylation specificity factor and exhibits sequence-specific, ATP-dependent interaction with precursor RNA. J. Biol. Chem. 272:10831-10838[Abstract/Free Full Text].

Molecular and Cellular Biology, August 1999, p. 5707-5717, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Benoit, P., Papin, C., Kwak, J. E., Wickens, M., Simonelig, M. (2008). PAP- and GLD-2-type poly(A) polymerases are required sequentially in cytoplasmic polyadenylation and oogenesis in Drosophila. Development 135: 1969-1979 [Abstract] [Full Text]  
  • Cui, J., Sackton, K. L., Horner, V. L., Kumar, K. E., Wolfner, M. F. (2008). Wispy, the Drosophila Homolog of GLD-2, Is Required During Oogenesis and Egg Activation. Genetics 178: 2017-2029 [Abstract] [Full Text]  
  • Kim, J. H., Richter, J. D. (2007). RINGO/cdk1 and CPEB mediate poly(A) tail stabilization and translational regulation by ePAB. Genes Dev. 21: 2571-2579 [Abstract] [Full Text]  
  • Addepalli, B., Hunt, A. G. (2007). A novel endonuclease activity associated with the Arabidopsis ortholog of the 30-kDa subunit of cleavage and polyadenylation specificity factor. Nucleic Acids Res 35: 4453-4463 [Abstract] [Full Text]  
  • Rouget, C., Papin, C., Mandart, E. (2006). Cytoplasmic CstF-77 Protein Belongs to a Masking Complex with Cytoplasmic Polyadenylation Element-binding Protein in Xenopus Oocytes. J. Biol. Chem. 281: 28687-28698 [Abstract] [Full Text]  
  • ROUHANA, L., WANG, L., BUTER, N., KWAK, J. E., SCHILTZ, C. A., GONZALEZ, T., KELLEY, A. E., LANDRY, C. F., WICKENS, M. (2005). Vertebrate GLD2 poly(A) polymerases in the germline and the brain. RNA 11: 1117-1130 [Abstract] [Full Text]  
  • Seli, E., Lalioti, M. D., Flaherty, S. M., Sakkas, D., Terzi, N., Steitz, J. A. (2005). An embryonic poly(A)-binding protein (ePAB) is expressed in mouse oocytes and early preimplantation embryos. Proc. Natl. Acad. Sci. USA 102: 367-372 [Abstract] [Full Text]  
  • RYAN, K., CALVO, O., MANLEY, J. L. (2004). Evidence that polyadenylation factor CPSF-73 is the mRNA 3' processing endonuclease. RNA 10: 565-573 [Abstract] [Full Text]  
  • Kwak, J. E., Wang, L., Ballantyne, S., Kimble, J., Wickens, M. (2004). Mammalian GLD-2 homologs are poly(A) polymerases. Proc. Natl. Acad. Sci. USA 101: 4407-4412 [Abstract] [Full Text]  
  • Tay, J., Hodgman, R., Sarkissian, M., Richter, J. D. (2003). Regulated CPEB phosphorylation during meiotic progression suggests a mechanism for temporal control of maternal mRNA translation. Genes Dev. 17: 1457-1462 [Abstract] [Full Text]  
  • Hofmann, I., Schnolzer, M., Kaufmann, I., Franke, W. W. (2002). Symplekin, a Constitutive Protein of Karyo- and Cytoplasmic Particles Involved in mRNA Biogenesis in Xenopus laevis Oocytes. Mol. Biol. Cell 13: 1665-1676 [Abstract] [Full Text]  
  • Lazar, S., Galiani, D., Dekel, N. (2002). cAMP-Dependent PKA Negatively Regulates Polyadenylation of c-mos mRNA in Rat Oocytes. Mol. Endocrinol. 16: 331-341 [Abstract] [Full Text]  
  • Jin, S.-W., Arno, N., Cohen, A., Shah, A., Xu, Q., Chen, N., Ellis, R. E. (2001). In Caenorhabditis elegans, the RNA-Binding Domains of the Cytoplasmic Polyadenylation Element Binding Protein FOG-1 Are Needed to Regulate Germ Cell Fates. Genetics 159: 1617-1630 [Abstract] [Full Text]  
  • Dickson, K. S., Thompson, S. R., Gray, N. K., Wickens, M. (2001). Poly(A) Polymerase and the Regulation of Cytoplasmic Polyadenylation. J. Biol. Chem. 276: 41810-41816 [Abstract] [Full Text]  
  • Hodgman, R., Tay, J., Mendez, R., Richter, J. D. (2001). CPEB phosphorylation and cytoplasmic polyadenylation are catalyzed by the kinase IAK1/Eg2 in maturing mouse oocytes. Development 128: 2815-2822 [Abstract] [Full Text]  
  • Richter, J. D. (2001). Think globally, translate locally: What mitotic spindles and neuronal synapses have in common. Proc. Natl. Acad. Sci. USA 98: 7069-7071 [Abstract] [Full Text]  
  • Koonin, E. V., Wolf, Y. I., Aravind, L. (2001). Prediction of the Archaeal Exosome and Its Connections with the Proteasome and the Translation and Transcription Machineries by a Comparative-Genomic Approach. Genome Res 11: 240-252 [Abstract] [Full Text]  
  • WICKENS, M., BERNSTEIN, D., CRITTENDEN, S., LUITJENS, C., KIMBLE, J. (2001). PUF Proteins and 3'UTR Regulation in the Caenorhabditis elegans Germ Line. Cold Spring Harb Symp Quant Biol 66: 337-344 [Abstract]  
  • Thompson, S. R., Goodwin, E. B., Wickens, M. (2000). Rapid Deadenylation and Poly(A)-Dependent Translational Repression Mediated by the Caenorhabditis elegans tra-2 3' Untranslated Region in Xenopus Embryos. Mol. Cell. Biol. 20: 2129-2137 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dickson, K. S.
Right arrow Articles by Wickens, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dickson, K. S.
Right arrow Articles by Wickens, M. P.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»