Previous Article | Next Article 
Molecular and Cellular Biology, August 1999, p. 5732-5742, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Dual Requirement for the EcR/USP Nuclear
Receptor and the dGATAb Factor in an Ecdysone Response in
Drosophila melanogaster
Véronique
Brodu,
Bruno
Mugat,
Jean-Yves
Roignant,
Jean-Antoine
Lepesant, and
Christophe
Antoniewski*
Institut Jacques Monod, Laboratoire de
Biologie du Développement, CNRS UMR 7592, Université
Paris 7 Denis-Diderot, Université Paris 6 P. et M. Curie,
75251 Paris Cedex 05, France
Received 21 April 1999/Returned for modification 6 May
1999/Accepted 20 May 1999
 |
ABSTRACT |
The EcR/USP nuclear receptor controls Drosophila
metamorphosis by activating complex cascades of gene transcription in
response to pulses of the steroid hormone ecdysone at the end of larval development. Ecdysone release provides a ubiquitous signal for the
activation of the receptor, but a number of its target genes are
induced in a tissue- and stage-specific manner. Little is known about
the molecular mechanisms involved in this developmental modulation of
the EcR/USP-mediated pathway. Fbp1 is a good model of
primary ecdysone response gene expressed in the fat body for addressing
this question. We show here that the dGATAb factor binds to three
target sites flanking an EcR/USP binding site in a 70-bp enhancer that
controls the tissue and stage specificity of Fbp1
transcription. We demonstrate that one of these sites and proper
expression of dGATAb are required for specific activation of the
enhancer in the fat body. In addition, we provide further evidence that
EcR/USP plays an essential role as a hormonal timer. Our study provides
a striking example of the integration of molecular pathways at the
level of a tissue-specific hormone response unit.
 |
INTRODUCTION |
Nuclear receptors for steroid and
retinoid hormones are transcription factors that bind to gene
promoters, recruit coactivators or corepressors, and modulate the
activity of the transcription machinery. A wealth of information
concerning these mechanisms has been provided by in vitro approaches or
studies with cultured cell systems (19, 30). In whole
organisms, gene responses to circulating hormones depend on both the
target tissue and the developmental stage. Accordingly, nuclear
receptor binding sites in natural promoters are often found included in
composite assemblages of multiple binding sites for a variety of
transcription factors (29). These so-called hormone response
units are thought to integrate multiple regulatory pathways responsible
for the tissue and time specificity of the transcriptional hormonal
response. However, the mechanisms by which this integration occurs in
animals are poorly understood.
Drosophila melanogaster provides a choice model for the
study of a steroid hormone response in the context of a developing organism. At the end of the third larval instar, a major pulse of
20-hydroxyecdysone (hereafter referred to as ecdysone) triggers the
larval-to-prepupal morphological transition and initiates metamorphosis
(3). During this period, the ecdysone receptor, a
heterodimer between the EcR and USP proteins, two members of the
nuclear receptor superfamily (22, 46, 52), orchestrates complex waves of gene transcription in target tissues of ecdysone. The
regulatory pathways controlling this genetic program at the temporal
level have been examined in detail (see reference 47 for a review; see also references 11, 23, and
50 for recent advances). Despite these advances, how
transcription of genes, in response to circulating ecdysone, is
restricted to a subset or a single target tissue remains an open question.
We used Fbp1 as a model gene to address this question.
Fbp1, which encodes a receptor mediating the uptake of
hexamerins from the hemolymph (12), is transcribed in
response to ecdysone exclusively in the fat body during the second half
of the third larval instar (2, 27). Germ line transformation
analysis of its promoter has pinpointed a 70-bp enhancer (
69 to
138) sufficient to specify the spatially and temporally
ecdysteroid-controlled pattern of Fbp1 expression
(24). The EcR/USP heterodimer binds to a pseudopalindromic site in the 70-bp Fbp1 enhancer (4). Mutations of
this site completely abolished the ability of the Fbp1
enhancer to confer a fat body-specific ecdysteroid response onto a
minimal promoter-lacZ reporter transgene, indicating that
activation by the EcR/USP heterodimer is a strict requirement for the
activity of the Fbp1 enhancer (5). Germ line
transformation experiments showed, however, that an EcR/USP binding
site was unable by itself to confer an ecdysteroid response onto the
same minimal-promoter-lacZ reporter gene, even when
multimerized. This provided evidence that other transcription factors,
targeted to sequences flanking the EcR/USP binding site in the
Fbp1 enhancer, must act in vivo, in addition to the ecdysone
receptor, to mediate an ecdysteroid genetic response (5).
Analysis of the role of these sequences is complicated by the fact that
their regulatory function cannot be revealed in the absence of
activation by the liganded EcR/USP heterodimer. We show here that
replacement of the EcR/USP binding site with an upstream activation
sequence (UAS) site can circumvent this limitation. In the presence of
the yeast activator GAL4, transcriptional activation of this modified
Fbp1 enhancer remains restricted to the third-instar fat
body, providing direct confirmation that sequences flanking the EcR/USP
binding site play an important role in this specific activation. We
further show that dGATAb, the product of the serpent (srp) gene, binds in the close vicinity of the EcR/USP
binding site and is strictly required for activation of the
Fbp1 enhancer. Together, our results demonstrate that the
Fbp1 enhancer functions as a complex ecdysone response unit
integrating spatial and temporal cues in a specific response to the
hormonal signal and provide evidence for the central role played by the
EcR/USP nuclear receptor as a developmental timer in this process.
 |
MATERIALS AND METHODS |
Plasmids.
A BamHI-DraI fragment from
the srp cDNA (a gift from K. P. Rehorn and R. Reuter)
was subcloned into the bluescript KS+ plasmid between the
BamHI and SmaI sites. The resulting construct,
pBS-srp, allows coupled in vitro transcription-translation of the Srp
protein. For bacterial expression of Srp, we isolated the
srp cDNA from pBS-srp as a BamHI-EcoRI
fragment and inserted it after Klenow blunting into the SmaI
cloning site of the glutathione S-transferase (GST)-tagged
expression vector pGEX-3X (Pharmacia). The germ line transformation
vector pAE was described in reference 5, where it
was referred to as pAEP1. pAE[UAS] was derived from pAE by PCR
mutagenesis of the ATTCATTCAAC EcR/USP binding site in the Fbp1 enhancer (see Fig. 3). This sequence was replaced with
the UAS CGGAGTACTGTCCTCCG in the pAE[UAS] construct.
Plasmids pAE
, pAE
, pAE
', and pAE
' were derived from pAE
by mutagenesis (for the positions used, see Fig. 3). The structures of
all of the mutagenized transformation vectors were confirmed by direct sequencing.
GATAb production in bacteria or rabbit reticulocyte lysate.
Crude GST-Srp bacterial extract was prepared as described in reference
16 from Escherichia coli BL21 transformed
with the pGST-srp expression vector. This extract was purified by
glutathione-Sepharose affinity chromatography in accordance with the
manufacturer's (Pharmacia) recommendations. The full-length Srp
protein was translated in a rabbit reticulocyte lysate by using the
pBS-srp plasmid and T7 RNA polymerase in a Promega coupled
transcription-translation system.
DNase I footprinting.
Oligonucleotides 5'
GTAGCGGCCGCATGACAACAATTTATTTAAT 3' (upper primer) and 5'
CTGCAGCTTTTATACCC 3' (lower primer) were used to amplify by
PCR a
194 to
18 fragment from the Fbp1 promoter. Depending on the DNA strand that was to be analyzed, the upper or lower
primer was 32P labelled by using T4 polynucleotide kinase.
A 0.2-pmol sample of the labelled
194 to
18 Fbp1
fragment was mixed with 1 µg of crude bacterial extract or 100 ng of
GST-purified GATAb and 2 µg of poly(dI-dC) in binding buffer (25 mM
HEPES [pH 7.6], 60 mM KCl, 5% glycerol, 5 mM MgCl2, 0.1 mM EDTA [pH 8], 0.75 mM dithiothreitol [DTT]) in a final volume of
16 µl. After 20 min at 4°C, 3 µl of DNase I (Worthington) at 2.6 µg/ml was added and the mixture was left for 2.5 min. The reaction
was then stopped by addition of 40 µl of stop solution (20 mM EDTA,
0.1% sodium dodecyl sulfate [SDS]). DNA was phenol-chloroform
extracted twice, ethanol precipitated, resuspended in a formamide-dye
mixture, and electrophoresed in an 8% polyacrylamide-urea sequencing gel.
Fat body nuclear extracts.
All of the buffers used for
nuclear extract preparation were supplemented with protease inhibitors
(0.5 mM Pefablock and aprotinin at 10 µg/ml). Late-third-instar
larvae were dissected in buffer C (20 mM Tris [pH 7.5], 50 mM KCl, 2 mM DTT, 0.1 mM EDTA, 0.15 mM spermine, 0.5 mM spermidine), and fat
bodies were immediately frozen in an Eppendorf tube kept on dry ice.
When collected, 50 fat bodies were rapidly thawed in 200 µl of cold
buffer C and vigorously vortexed. They were then refrozen and thawed
twice with vortexing. Nuclei and debris were pelleted upon rapid
centrifugation in an Eppendorf centrifuge (20 s at 5,500 × g) and washed with 200 µl of buffer C. After centrifugation (15 s at 5,500 × g), the crude nuclear pellet was
suspended in 40 µl of extraction buffer C2 (same as buffer C but with
600 mM KCl) and the homogenate was left on ice for 20 min. After
centrifugation (15 min at 4°C and top speed), the supernatant was
diluted with 2 volumes of buffer C3 (same as buffer C but without KCl),
aliquoted, and kept at
80°C until use.
Gel shift assays.
Three to 4 µl of fat body nuclear
extract or 3 µl of rabbit reticulocyte lysate, 2 µg of poly(dI-dC),
specific competitor DNA or antibodies, if appropriate, and 2 fmol of
32P-labelled probe (about 5 × 104
cpm/fmol) were mixed in binding buffer (25 mM HEPES [pH 7], 9% glycerol, 90 mM KCl, 1 mM EDTA [pH 8], 0.9 mM DTT), and gel shift assays were performed as described in reference 4.
Competitions were performed with a 200-fold molar excess of
double-stranded oligonucleotides. Double-stranded oligonucleotides A,
A
, B, and B
have been described previously (4). The
double-stranded oligonucleotide ADH includes the region from
77 to
53 of the D. muleri Adh-1 promoter.
Larval developmental-stage determination.
Drosophila
stocks were maintained at 25°C on a standard Drosophila
medium. Developmental-stage determination was carried out essentially
as described in reference 2 with a few
modifications. Egg laying on a hard agar plate coated with a strip of
baker's yeast was restricted to 1 h. Two 1-h precollection egg
layings were discarded. Embryos were washed from the yeast, distributed on a hard agar plate, and allowed to develop at 25°C until eclosion. First-instar larvae were collected by hand at 1-h intervals,
transferred to tubes containing mashed Drosophila medium in
batches of 80 larvae, and collected at 6-h intervals from the
mid-second larval instar to the late-third larval instar.
RT-PCR.
Total RNA (about 100 µg) was isolated from 25 to
50 larvae at different stages as previously described (7),
and poly(A)+ RNA was isolated by using the Oligotex mRNA
Midi Kit (Qiagen). Approximately 50 ng of poly(A)+ RNA was
denatured (65°C) prior to use as a template in a 20-µl cDNA
synthesis reaction mixture containing 1× reverse transcription (RT)-PCR buffer (50 mM KCl, 20 mM Tris-HCl [pH 8.4], 2.5 mM
MgCl2, bovine serum albumin at 100 mg/ml, 2.5 mM DTT, 1 mM
[each] deoxynucleoside triphosphate), 17.5 U of RNasin (Promega), 100 pmol of random d(N)6 primers, and 8 U of avian myeloblastosis virus
reverse transcriptase (Boehringer). The reaction mixture was incubated
for 10 min at 22°C and then for 90 min at 42°C. One-microliter
aliquots of the cDNA reaction mixture were analyzed separately for
srp (38), Fbp1 (31), and
the ribosomal protein gene rpL17A (34) in 50-µl PCR mixtures containing 1× Taq DNA polymerase buffer
(Bioprobe System), 0.2 mM each deoxynucleoside triphosphate, 20 pmol of gene-specific primers, 0.2 µl of [32P]dCTP (3,000 Ci/mmol; Amersham), and 2.5 U of Taq DNA polymerase (Promega). The PCR conditions used were 94°C for 3 min followed by 22 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min.
Control reactions were performed to ensure that the number of
amplification cycles was within the logarithmic phase for all three
sets of primers (data not shown). All PCR primers were chosen so that
they hybridized to separate exons in order to distinguish correctly
spliced mRNA from unspliced RNA or contaminating genomic DNA. The
srp sense primer was 5' AGCAGCAACAACATCATCAC 3',
and the srp antisense primer was 5'
TTGGCAGTCTGAGTAAGCAA 3', corresponding to positions 929 to
948 and 1160 to 1141, respectively, of the srp cDNA sequence
(EMBL nucleotide sequence database accession no. Y07662). The
Fbp1 sense primer was 5' ACTACGAATCAGGACAGGGT 3',
and the Fbp1 antisense primer was 5'
CAGATCGATGACGTTCTGCA 3', corresponding to positions 1552 to
1571 and 1814 to 1795, respectively, of the Fbp1 genomic
sequence (EMBL nucleotide sequence database accession no. X69965). The
rpL17A sense primer was 5' GTGATGAACTGTGCCGACAA
3', and the rpL17A antisense primer was 5'
CCTTCATTTCGCCCTTGTTG 3', corresponding to positions 536 to 555 and 1388 to 1369, respectively, of the rpL17A genomic
sequence (GenBank nucleotide sequence database accession no. M 85295). Amplification reaction products obtained with rpL17A primers
were fractionated by electrophoresis on a 6% polyacrylamide gel and quantified with a Molecular Dynamics PhosphorImager. Amplification reaction products obtained with the srp and Fbp1
primers were then electrophoresed after loading of an amount that was
normalized in relation to rpL17A amplification.
Antibodies.
The #Srp rabbit antibody was raised against a
synthetic peptide corresponding to the 22 last amino acids of GATAb
(21). The #2B8 monoclonal antibody, a generous gift from P. Ramain, was raised against a peptide corresponding to amino acids 378 to 397 of the GATAa/Pannier protein (37). We have shown that this antibody specifically recognizes the TSSSGQA motif that is also
present in the N-terminal part of GATAb but is not found in any other
known protein (11a). The #2B8 antibody should thus be
considered to be a genuine specific antibody for both GATAa and GATAb.
Antibody staining of tissues.
Larvae were dissected in
phosphate-buffered saline (PBS), and tissues were fixed for 20 min at
room temperature in 3.4% paraformaldehyde-30 mM
piperazine-N,N'-bis(2-ethanesulfonic acid)
(PIPES; pH 7.4)-160 mM KCl-40 mM NaCl-4 mM EGTA-1 mM
spermidine-0.4 mM spermine-0.2%
-mercaptoethanol-0.1% Triton
X-100. They were then washed three times with PBT (0.3% Triton X-100
in PBS) and blocked for 20 min in PBT that contained 1% bovine serum
albumin. The #Srp antibody was preabsorbed for 1 h with
dechorionated embryos, diluted 1,000-fold in PBT, and incubated with
the tissues overnight at 4°C. Tissues were washed three times for 20 min each with PBT and incubated for 1 h at room temperature with
goat anti-rabbit horseradish peroxidase-conjugated secondary antibodies
(Vector Laboratories) diluted 400-fold in PBT. The tissues were washed
three times for 20 min each with PBS, and peroxidase activity was
detected with PBS supplemented with diaminobenzidine (Sigma) at 0.5 mg/ml and 0.03% H2O2. The reaction was allowed
to proceed for 10 min. Tissues were then washed with PBS and mounted on
slides in glycerol and photographed.
Western analysis.
Samples for developmental Western blotting
were prepared by solubilizing fat bodies dissected from 10 to 20 larvae
at different stages in 20 µl of cracking buffer (0.125 M Tris [pH
6.8], 5%
-mercaptoethanol, 2% SDS, 4 M urea). Samples were
electrophoresed on an SDS-8% polyacrylamide gel and transferred to
nitrocellulose membrane (Schleicher and Schuell) with a Novablot
Electrophoretic Transfer Kit (LKB). All subsequent steps were performed
at room temperature. The membrane was blocked in milk solution (PBS
supplemented with 5% dry milk and 0.1% Tween 20) for 1 h. #Srp
antibody was diluted 1:10,000 in milk solution and incubated with the
membrane for 1 h. The membrane was washed three times for 5 min
each with milk solution and incubated for 1 h with goat
anti-rabbit horseradish peroxidase-conjugated secondary antibodies
(Vector Laboratories) diluted 1,600-fold in milk solution. The membrane
was then washed three times for 5 min each in PBS supplemented with
0.1% Tween 20, and chemiluminescence detection was performed with the
ECL kit (Amersham) in accordance with the manufacturer's instructions. The quantity of protein loaded was estimated by reincubation of the
membrane for 1 h with anti-myosin antibody (53) diluted 1:5,000 in milk solution and chemiluminescence detection as described above.
Germ line transformations, EcR/USP-to-GAL4 substitution, and
GATAb overexpression.
DNAs of the germ line transformation vector
(250 µg/ml) and helper plasmid
2-3 (50 µg/ml) were microinjected
into embryos of the w1118 recipient stock (40). The
w+ transformants were screened for eye color. The number of
transgenes in each line was determined by Southern blotting.
The GAL4-UAS system (10) was used to study the effects of
GAL4-to-EcR/USP substitution and GATAb overexpression. The effect of
GAL4-to-EcR/USP substitution was tested by crossing a line homozygous
for the AE[UAS] transgene with the homozygous GAL4daG32
line expressing GAL4 under the control of the da promoter
(51). Ubiquitous expression of the da-GAL4
transgene was checked by crossing the GAL4daG32 line with a
line transgenic for the pUAST construct in which the lacZ
reporter gene is under the control of the hsp70 promoter and
five UAS sites (10).
For the assay of GATAb overexpression by Western blotting, a line
homozygous for an
hsp70-GAL4 transgene (third chromosome,
line 1799 from Andrea Brand, Bloomington Stock Center) was crossed
with
a line homozygous for a 5UAS-
srp transgene (second
chromosome,
kindly provided by R. Reuter). Heterozygous larvae obtained
from
this cross were raised at 25°C, submitted to a 37°C heat shock
for 1 h, and allowed to recover for an additional 7 h at
25°C.
Tissues were then dissected and treated for Western blot
analysis.
For testing of the effect of overexpression of GATAb on the
activity
of the
Fbp1 promoter, a double homozygous line for
the AE transgene
(
5) and the UAS-
srp transgene
was constructed by genetic crosses.
Larvae obtained from the crossing
of this line with the line homozygous
for the
hsp70-GAL4
transgene were raised at 25°C and submitted
to a 37°C heat shock
for 1 h at various times during the second
or third larval instar.
Larvae were then allowed to recover for
7 h at 25°C, and

-galactosidase activity was determined by either
5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside (X-Gal)
staining
of tissues or quantitative dosage on crude
extracts.
Histochemical and spectrophotometric assays of
-galactosidase
activity.
A histochemical staining assay of
-galactosidase
activity was performed as previously described (6) by using
X-Gal.
A chlorophenol red-

-
D-galactopyranoside (CPRG)
spectrophotometric assay of

-galactosidase activity was performed
essentially
as previously described (
14,
43). At least five
protein extracts,
each prepared from three larvae, were assayed for
each developmental
stage. Larvae at different developmental stages were
homogenized
in 250 µl of buffer (50 mM potassium phosphate [pH
7.5], 1 mM
MgCl
2, 1 mM phenylmethylsulfonyl fluoride) in a
1.5-ml Eppendorf
tube and centrifuged at 12,000 ×
g
for 15 min at 4°C. The supernatant
was transferred to a new Eppendorf
tube. Extract (4 to 100 µl,
depending on activity) was added to a
1-ml final volume of assay
buffer with CPRG at 0.8 mg/ml in a
disposable cuvette, mixed,
and incubated at room temperature.
A574 was recorded for 1 h at
10-min
intervals. Activity was calculated by dividing the slope
of the assay
curve by the amount of protein added for dosage (as
determined by
Bio-Rad protein assay of the extract). Results are
expressed as the
mean value of five independent protein extract
activities divided by an
arbitrary constant for the convenience
of data
reading.
 |
RESULTS |
GAL4 can substitute for EcR/USP in the tissue-specific
activation of the Fbp1 promoter.
In a previous
study (5), we showed that when the Fbp1 enhancer
(sequences between positions
194 and
68) was fused to the
Fbp1 minimal promoter and the lacZ reporter gene,
expression of the resulting AE construct (Fig.
1) took place exclusively in the
late-third instar larval fat body (Fig.
2A, part A).
-Galactosidase activity
was first detected in 106-h-old larvae and reached a maximum at
puparium formation (Fig. 2B). This pattern faithfully reproduced the
transcriptional response of the endogenous Fbp1 gene to the
major third-instar ecdysone pulse, as shown in earlier studies
(2) and in an RT-PCR assay (see Fig. 4A). Replacement of the
EcR/USP binding site with a UAS site (Fig. 1) resulted in complete
inactivation of the AE[UAS] mutated construct (Fig. 2A, part C),
confirming that binding of the EcR/USP receptor is strictly required
for in vivo activity of the Fbp1 enhancer. Activation of the
AE[UAS] construct by GAL4 was further tested by using the GAL4daG32 driver in which a GAL4 cDNA is expressed in all
tissues throughout development from the ubiquitous
daughterless promoter, as shown in a control cross with a
5UAS-hsp70-lacZ construct (Fig. 2A, part B). When the
GAL4daG32 construct was crossed in three independent
AE[UAS] transgenic lines,
-galactosidase activity was restored
exclusively in the fat bodies of third-instar larvae (Fig. 2A, part D).
Remarkably, the timing of GAL4-driven expression of the AE[UAS]
transgene differed significantly from that of the AE transgene.
Expression was first detected in 72-h-old larvae, after the
second-to-third-instar molt, and subsequently increased gradually
throughout the third larval instar (Fig. 2B, black bars). The
possibility could be excluded that this dynamic profile of expression
was due to variations in the GAL4 level because expression of the
5UAS-hsp70-lacZ control construct remained constant
throughout the third instar in the same da-GAL4 context
(Fig. 2B, open bars).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of lacZ reporter transgenes.
Fbp1 sequences between 194 and +80, including the
138/ 69 enhancer, were fused to the lacZ reporter gene,
giving rise to the AE reporter construct. Replacement of the EcR/USP
binding site (EBS) with the UAS site gave rise to the AE(UAS)
construct. The AE , AE , and AE ' constructs are mutated at
the indicated GATA sites. The 5UAS-hsp70-lacZ construct
consists of five multimerized UAS sites fused to the minimal
hsp70 promoter and the lacZ reporter gene.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Pattern of expression conferred by the wild-type or
mutated Fbp1 enhancers on the lacZ reporter
transgene. (A) Late-third-instar larval tissues from transgenic lines
with the indicated genotypes were dissected and histochemically stained
for determination of -galactosidase activity. (B) Transgenic larvae
with the indicated genotypes were synchronized at eclosion and
recovered during the third larval instar at the indicated times.
-Galactosidase activity was measured in extracts from whole larvae.
Error bars represent the standard error of the mean.
|
|
Two conclusions can be drawn from these results. First, they
demonstrated that a heterologous transactivator can substitute
in vivo
for the liganded EcR/USP heterodimer and activate the
Fbp1
enhancer. Second, the sequences flanking the EcR/USP binding
site are
very probably targets for transcription factors that
modulate in a
tissue-specific manner the activity of an adjacent
transactivator,
whether the ecdysone receptor is in a natural
situation or GAL4 bound
to its target site. Under this hypothesis,
the activity of these
transactivating factors would be acquired
gradually during the third
larval
instar.
An essential GATA binding site is required for enhancer
activation.
Examination of the Fbp1 enhancer sequence
revealed the presence of three putative binding sites for the GATA
family of transcription factors, hereafter referred to as GATA binding
site 1 (GBS1), GBS2, and GBS3 (Fig. 3).
The individual requirement of these sites for the activity of the
enhancer was tested by mutagenesis of GBS1, GBS2, or both GBS2 and GBS3
in the AE construct (Fig. 1). Mutation of GBS1 completely abolished the
ability of the Fbp1 enhancer to drive lacZ
expression in third-instar larvae, as tested by X-Gal staining of
dissected tissues and quantitative assay of
-galactosidase activity
in a crude larval extract (Fig. 2A, part E; data not shown). In
contrast, neither mutation of GBS2 nor double mutation of GBS2 and GBS3
had a significant effect on lacZ expression (Fig. 2A, part F
and G). These results indicated that only GBS1 is crucial for the
enhancer activity in animals and prompted us to identify the factor
involved.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Structure of the Fbp1 enhancer. The sequence
of the Fbp1 enhancer between positions 138 and 69
relative to the Fbp1 transcription start site is in capital
letters. Three GATAb binding sites (boxed; GBS1 to GBS3) were found in
sequences flanking the pseudopalindromic EcR/USP binding site
(horizontal arrows). GBS1 perfectly fits the (A/T)GATA(A/G)
consensus sequence for a GBS (18). GBS2 (as read on
the lower strand) and GBS3 do not fit this consensus but are efficient
binding sites for vertebrate GATA transcription factors
(32). Dashed lines indicate the extent of the GATAb
footprints (see Fig. 5A) on both DNA strands. The positions and lengths
of the competitor oligonucleotides used in gel shift assays are
indicated in the lower part of the scheme. Positions of mutations ,
, and ' are marked by bold lettering in the Fbp1
enhancer, and sequence substitutions are indicated for each mutated
competitor, A , B , or F '.
|
|
Pattern of expression of GATAb/Serpent in third-instar larvae.
dGATAb/Serpent, a member of the GATA family, plays an essential role in
the development of fat body, endodermal gut, and hematopoietic tissues
during embryogenesis (1, 33, 38, 39, 41). dGATAb was also
found to be expressed during the third larval instar and involved in
the transcriptional regulation of the D. muleri and D. melanogaster Adh genes in the fat body tissue (1).
These data prompted us to consider GATAb as a candidate for the role of
a transcription factor that interacts with the Fbp1
regulatory sequences and to establish its tissue and temporal pattern
of expression during larval stages.
Using a quantitative RT-PCR assay, we detected a constant level of
GATAb mRNA in late-second-instar larvae and throughout
the third-instar
larval stage (Fig.
4A). Immunostaining
using
the #Srp anti-GATAb antibody (
21) showed that GATAb
was detectable
in the nuclei of fat body, gonad, gut, lymph gland, and
pericardial
cells of late-third-instar larvae (Fig.
4B). We detected no
staining
in other tissues, such as the central nervous system, imaginal
discs, or salivary glands. In a Western blot assay using the #Srp
antibody, the GATAb protein was revealed in the fat body tissue
as a
double band (Fig.
4C, left side) whose intensity was constant
throughout the third larval instar (Fig.
4C, right side). This
doublet
migrated with a much lower mobility than the 102-kDa molecular
mass
predicted from the sequence of the GATAb cDNA (
38). A
confirmation
that this doublet corresponded to GATAb isoforms was
provided
by the detection with the #Srp antibody of an overexpressed
product
migrating at the same position after heat shock induction of a
UAS-GATAb cDNA construct in an
hs-GAL4 transgenic line (Fig.
4C,
left side; data not shown).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of GATAb in third-instar larvae. (A) RT-PCR
analysis. Total expression of mRNAs for GATAb, Fbp1, and the
ribosomal protein L17A was analyzed at specific developmental stages by
quantitative RT-PCR using specific primers. (B) Distribution of GATAb
in late-third-instar tissues. Tissues were dissected from
late-third-instar larvae and stained with the #Srp anti-GATAb antibody.
Nuclear staining was detected in the gut (g), lymph glands (lg),
pericardial cells (pc), gonads (go), and fat body (fb). No staining was
detected in the other tissues (not shown). (C) Western blot analysis.
GATAb-specific bands were identified with the #Srp antibody in a
Western blot analysis by comparing the profiles obtained with fat
bodies from w1118 or UAS-srp/hs-GAL4 larvae at 25°C with
those obtained with fat bodies from UAS-srp/hs-GAL4 larvae
after a 1-h heat shock at 37°C (left). On the right is the temporal
profile of GATAb protein expression in isolated fat bodies as detected
by Western blotting. The protein quantity loaded in each lane was
estimated by detection of myosin. The values on the left are molecular
sizes in kilodaltons.
|
|
GATAb binds in vitro to the Fbp1 enhancer.
Bacterially produced GST-GATAb protein, either in a crude extract or
affinity purified, protected two regions of the Fbp1 enhancer in a DNase I footprint assay (Fig.
5A). One 17-bp region extended over the GBS1 site from
136 to
120 on the upper strand and
from
137 to
121 on the lower strand. A second, larger region included tandemly arranged GBS2 and GBS3 and extended from
92 to
67
on the upper strand and from
90 to
67 on the lower strand.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Bacterially produced or in vitro-translated GATAb
binds to the Fbp1 enhancer. (A) An Fbp1 promoter
fragment 5' end labelled on the upper or lower strand as indicated was
incubated in the absence (lane F) or in the presence of a GST-GATAb
fusion protein in crude bacterial extract (lane crude) or after GST
purification (lane GST-purified). Samples were then treated with DNase
I and analyzed on a sequencing gel. Sequencing reactions (lanes A, T,
G, and C) performed with the free probe were run in parallel in order
to locate GATAb-specific footprints (black lines). Nucleotide positions
are shown on the right. (B) A gel shift assay was performed with the
labelled double-stranded oligonucleotide ADH as a probe in the presence
of unprogrammed rabbit reticulocyte lysate (lane 1, UL) or in
vitro-translated GATAb protein (lanes 2 to 11). A 200-fold molar excess
of competitor oligonucleotides or anti-GATAb antibodies was added as
indicated (Fig. 3 shows the positions and sequences of the competitors
used).
|
|
Binding of in vitro-translated GATAb to a labelled ADH probe previously
shown to contain an efficient TGATAA GATAb target
site
identical to GBS1 (
1) gave rise to the formation of a
single
retarded complex in a gel shift assay (Fig.
5B, lane 4).
This complex
was supershifted in the presence of the #Srp antibody
(lane 3) or the
#2B8 antibody (lane 2), which recognizes both
the GATAb/Serpent and
GATAa/Pannier proteins (see Materials and
Methods). The relative
binding affinity of in vitro-translated
GATAb for GBS1, GBS2, and
GBS3 was further analyzed by competition
with unlabelled
oligonucleotides corresponding to various subregions
(Fig.
3) of the
Fbp1 enhancer. Competition in the presence of
oligonucleotide A was as efficient as that in the presence of
the
unlabelled ADH probe (Fig.
5B, lanes 5 and 6). As expected,
this
competition was relieved by using the A

oligonucleotide
(lane 7)
carrying a mutation destroying GBS1 (Fig.
3). Oligonucleotide
B or F
also competed, although to a lesser extent, for the formation
of the
GATAb retarded complex (compare lanes 8 and 10 with lanes
5 and 6).
These competitions were fully relieved in the presence
of
oligonucleotides B

and F

' carrying mutations destroying GBS2
and
GBS3, respectively (lanes 9 and 11). Taken together, these
results
indicate that GATAb binds with higher affinity to GBS1
than to GBS2 or
GBS3.
The GATAb protein in third-instar fat body nuclear extracts binds
to the Fbp1 enhancer.
When used as a radioactive probe
with nuclear extracts from hand-dissected third-instar larval fat
bodies, the Fbp1 enhancer gave rise to the formation of
three complexes a, b, and c (Fig. 6A,
lanes 1 and 4), that were supershifted in the presence of the #2B8
monoclonal antibody alone (Fig. 6A, lane 2) and further supershifted in
the presence of #2B8 and protein A (Fig. 6A, lane 3). The #2B8
monoclonal antibody recognizes similar epitopes in the
GATAa/Pannier and GATAb/Serpent proteins. However, because GATAa/Pannier expression is undetectable in a third-instar larval fat body (3a), we concluded that all three complexes, a, b, and c, involve the GATAb protein.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
GATAb in third-instar fat body nuclear extracts binds to
the Fbp1 enhancer. (A) Binding of proteins in a nuclear
extract from a late-instar fat body was analyzed by a gel shift assay
using the Fbp1 enhancer ( 138/ 69) as a probe, in the
presence or absence of 2B8 antibody and protein A, as indicated. The
EcR/USP complex and faster-migrating complexes X and Y, whose
identities remain unknown, have been characterized previously by using
mass-prepared fat body nuclear extracts (4). Control
experiments indicated that protein A alone has no effect on the
retardation pattern (not shown). The nuclear extract used in lane 5 was
prepared from heat-shocked hs-GAL4/5UAS-srp
transgenic third-instar larvae overexpressing GATAb. Complexes a and b,
as well as complexes X, Y, and EcR/USP, were markedly decreased or
absent from the retardation pattern obtained with this extract,
indicating that expression or stability of the factors responsible for
their formation was reduced upon heat shock. Both the major retarded
band and the upper minor band were supershifted with the #2B8 antibody
(not shown). This minor band may correspond to the formation of GATAb
dimers under conditions of high GATAb concentrations. UB, unspecific
binding. (B) Oligonucleotides A, B, and F were used as radioactive
probes in a gel shift assay with fat body nuclear extract. Free probes
were run out from the gel.
|
|
GBS1-containing oligonucleotide A (Fig.
6B, lane 1) and, to a lesser
extent, GBS3-containing oligonucleotide F (Fig.
6B, lane
2) also gave
rise to the formation of complexes a, b, and c. This
indicated that
GBS1 and GBS3 are involved independently in the
formation of complexes
a, b, and c. In contrast, GBS2-containing
oligonucleotide B gave rise
to the formation of only one retarded
complex, c (Fig.
6B, lane 3). As
expected, these complexes were
supershifted by the #2B8 antibody and
were not formed with any
of the GBS-mutated probes, A

, B

, or
F

' (data not
shown).
Two lines of evidence excluded the possibility that the formation of
distinct GATAb-containing complexes resulted from homodimerization,
as
suggested by examples of GATA family members binding to DNA
as
homodimers (
15). First, we were unable to detect more than
one GATAb retarded complex in gel shift assays using in
vitro-translated
(Fig.
5B) or bacterially produced (not shown) GATAb.
Second, a
fat body nuclear extract prepared from third-instar larvae
overexpressing
GATAb gave rise to a predominant retarded band that
migrated with
the same mobility as complex c (Fig.
6A, lane 5). This
retardation
pattern suggested that complex c resulted from the binding
to
DNA of the GATAb protein alone. If complex a or b corresponded
to
homodimerization or multimerization of GATAb, its intensity
would have
been reinforced like that of complex
c.
Together, these data demonstrated that GATAb was involved in the
differential formation of distinct complexes on GBS1, GBS2,
and GBS3 in
a site-specific
manner.
GATAb is involved in the timing and tissue specificity of
Fbp1 enhancer activation.
The effect of total or
partial loss of function of GATAb on the activity of the enhancer
during the third larval instar could not be studied because all of the
GATAb mutations isolated to date are lethal to embryos (38).
We tested the effect on the AE construct of ubiquitous overexpression
of GATAb in triple transgenic AE/
hs-GAL4/UAS-
srp
larvae.
After heat shock at various times during the second or third
larval
instar followed by a 7-h recovery period, tissues were stained
for
lacZ expression (Fig.
7A)
and the level of

-galactosidase
activity was measured in crude
extracts (Fig.
7B, black bars).
As expected, in the absence of heat
shock, the AE reporter transgene
was specifically expressed in the fat
body at the end of the third
larval instar (Fig.
7A, top).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 7.
GATAb is involved in both the timing and tissue
specificity of Fbp1 gene expression. (A) Larvae heterozygous
for the AE-lacZ, hs-GAL4, and UAS-srp
transgenes were heat shocked for 1 h at 37°C at various
developmental stages and allowed to recover for 7 h at 25°C
(bottom; +HS). Immunostaining of heat-shocked larvae indicated that the
Srp protein was ubiquitously overexpressed (data not shown). Tissues
were dissected and histochemically stained for -galactosidase
activity. The times indicated correspond to the dissection of larvae.
The images at the top show histochemical staining of control larvae
that were not heat shocked ( HS). Abbreviations: P, proventiculus; FB,
fat body; SG, salivary glands. (B) -Galactosidase ( -gal) activity
in extracts from AE/hs-GAL4/UAS-srp larvae
treated as described for panel A with (black bars) or without (open
bars) heat shock treatment. The times indicated at the bottom in hours
correspond to times after egg laying at which larvae were dissected.
(C) -Galactosidase activity in extracts from heat-shocked
AE[UAS]/hs-GAL4/UAS-srp larvae treated as
described for panel A.
|
|
Quantitative measurement indicated that this expression was detectable
108 h after egg laying and reached a maximum 10 h later,
at
puparium formation (Fig.
7B, open bars). In contrast, heat
shock
treatment resulted in premature induction, as early as the
second
larval instar, of the AE reporter transgene in the fat
body (Fig.
7B).
It was also ectopically induced in the salivary
glands and
proventriculus (Fig.
7A, bottom). That this deregulation
was due to the
overexpression of GATAb was confirmed by the fact
that the spatial and
temporal patterns of expression of the AE
transgene were unchanged in a
heat-shocked AE/
hs-GAL4 control
line (data not
shown).
We concluded that a proper level of GATAb is crucial for both the
correct timing and tissue specificity of
Fbp1 expression.
However, quantitative dosage of

-galactosidase activity showed
that
the magnitude of the effect of GATAb overexpression varies
during
development. The significant but limited level of AE expression
detected during the second larval instar and at the beginning
of the
third (Fig.
7B) markedly increased between 78 and 108 h
after egg
laying. At 108 h after egg laying, this level was about
10 times
that in the absence of heat shock. It was only at the
end of the third
larval instar (118 h) that the level of AE expression
in the absence of
heat shock reached a value similar to that in
the presence of
overexpressed GATAb. These results suggested that
the transcriptional
response elicited by the increased amount
of GATAb was restricted at
earlier stages by the availability
of additional factors until the end
of the third larval instar.
The ecdysone receptor possesses all of the
features of such a
factor.
Both GATAb and the ecdysone receptor are limiting factors in
Fbp1 induction.
Two factors are known to limit the
availability of the active EcR/USP receptor during the third larval
instar. First, the expression of the EcR gene increases
during the second half of the third larval instar (2). In
addition, the activity of the EcR/USP heterodimer is triggered by
ecdysteroids, whose concentration peaks during this period of
development. We reasoned that if the effect of GATAb overexpression on
the AE transgene was limited by the level of active ecdysone receptor,
then this dependence should be eliminated in the case of the
GAL4-activated AE[UAS] transgene, in which the EcR/USP binding site
had been replaced with a UAS site (Fig. 1).
To test this hypothesis, expression of AE[UAS] was analyzed after
heat shock-induced expression of GAL4 in triple-transgenic
AE[UAS]/
hs-GAL4/UAS-
srp larvae. Under these
conditions, one would
expect GAL4 expression to produce two
simultaneous effects. The
first is direct activation of the
Fbp1 enhancer resulting from
the binding of GAL4 to the UAS
site in the AE[UAS] construct,
as observed with the
GAL4
daG32 driver (Fig.
2). The second is overexpression of
the UAS-
srp transgene, also resulting in activation of the
Fbp1 enhancer,
as demonstrated above. Following heat shocks
during the second
and third larval instars, simultaneous
activation of the AE[UAS]
transgene by both GAL4 and GATAb
resulted in
lacZ induction in
the fat body, salivary glands,
and proventriculus (data not shown).
In addition, quantitative
measurements indicated that a high level
of
lacZ expression
was obtained throughout this period (Fig.
7C).
It should be stressed
that this high level of
lacZ induction in
the second and
early third instars required the simultaneous overexpression
of GAL4
and GATAb. It was not obtained for either the AE[UAS]
transgene upon
activation by GAL4 alone (Fig.
2B) or the AE transgene
upon activation
by overexpressed GATAb alone (Fig.
7B). Together,
these results
strongly suggested that both GATAb and the EcR/USP
heterodimer are
limiting factors in the activation of the
Fbp1 enhancer.
 |
DISCUSSION |
Tissue- and time-specific factors modulate the primary ecdysone
response.
Understanding the mechanisms that control the
tissue-specific expression of ecdysone response genes represents a
major challenge, given the fact that ecdysone exercises its signaling
activity on virtually all larval and imaginal tissues at pupariation.
The EcR gene encodes three different isoforms, EcR-A, B1,
and B2, that differ in the N-terminal part. Differential expression of EcR isoforms in larval and imaginal tissues during development and
analysis of EcR isoform-specific mutants have led to the proposal that
the tissue specificity of ecdysone target genes could rely in part on
selective activation by a given EcR isoform heterodimerized with USP
(8, 42, 44). However, a number of genes are differentially induced in response to ecdysone in various larval tissues where only
the EcR-B1 isoform predominates. These genes include, for example, the
Fbp1 gene in the fat body and the sgs genes in
the salivary glands (25). Hence, it is clear that
differential expression of EcR isoforms is not sufficient to specify
the activation of a given ecdysone response gene in a given tissue.
Lehmann and Korge (
26) showed that the transcription factor
Forkhead specifies the ecdysone responsiveness of the
Sgs4
gene
in the salivary glands, providing the first molecular evidence
that a primary ecdysone response is controlled not only by the
EcR/USP
heterodimer but also by other tissue-specific transcription
factors.
Our study adds strong support to this model. The replacement
of the
EcR/USP target site with a UAS site in the
Fbp1 enhancer
allowed us to functionally substitute the yeast transcription
factor
GAL4 for the ecdysone receptor. Yet, in a genetic context
where GAL4
was ubiquitously expressed, the modified
Fbp1 enhancer
still
directed transcription specifically in the fat body. In
addition, the
activity of this modified enhancer was restricted
to the third larval
instar. These results indicate that one or
several transcription
factors modulate, both spatially and temporally,
the GAL4-driven
activation of the
Fbp1 enhancer and strongly suggest
that
the same factors play this specific role in a natural context
where the
ecdysone receptor binds to the
Fbp1 enhancer. Because
GAL4
and the ecdysone receptor are completely unrelated, it is
very unlikely
that these modulating factors are direct partners
of EcR/USP. This
leads us to conclude that the genetic response
to ecdysone is
controlled not only by the EcR/USP heterodimer
and the concentration of
its ligand but also by other tissue-
and time-specific transcription
factors targeted to sequences
flanking EcR/USP binding
sites.
We have identified GATAb as belonging to this class of factors.
The
Fbp1 enhancer encompasses three distinct GATAb
binding
sites, but only GBS1 is functionally required in our
assay. The
fact that the tandemly repeated GATAb binding sites GBS2 and
GBS3
are not essential is at odds with the observation that pairs of
GATA sites arranged in tandem have been found to be involved in
the
regulation of mammalian genes in hematopoietic cells (
35)
and
Drosophila yolk protein genes in ovaries
(
28). Nevertheless,
the possibility that GBS2 and GBS3 play
a functional role in the
proper expression of the endogenous
Fbp1 gene is still open to
question.
During the third larval instar, GATAb is expressed not only in the fat
body but also in the gonads, lymph glands, and anterior
midgut. This is
in contrast with the restriction of
Fbp1 expression
to the
fat body and rules out the hypothesis that
Fbp1 tissue
specificity is simply determined by GATAb transactivation. However,
ubiquitous overexpression of GATAb in second- and third-instar
larvae
leads to ectopic expression of the
Fbp1-lacZ transgene
in
the salivary glands and the proventriculus, indicating that
a proper
expression pattern of this transcription factor is required
to achieve
the correct tissue specificity of
Fbp1 expression.
The
absence of ectopic induction of
Fbp1-lacZ in other tissues
suggests that the presence of negative regulators and/or the lack
of
other transactivators prevented the switching on of the
Fbp1 enhancer by GATAb in these tissues. Interestingly, the functional
importance of GBS1 in vivo correlates with the efficient formation
of
GATAb-containing complexes a and b in vitro. By comparison,
the
formation of these retarded complexes is much less efficient
with GBS3
and not detectable with GBS2. This result suggests that
the factors
involved in the formation of GATAb-containing complexes
a and b may be
the regulators whose activity is necessary, in
addition to that of
GATAb and EcR/USP, for activation of the
Fbp1 enhancer. As
we have shown that these additional complexes do
not correspond to
multimers of GATAb, two nonexclusive hypotheses
can be put forward to
explain their formation. One is that they
result from the preferential
binding of distinct GATAb isoforms
to GBS1. Although a single GATAb
mRNA species was revealed by
Northern blot analysis in third-instar
larvae (
1), the GATAb
protein is detected as a double band
in a Western blot assay,
indicating that different GATAb isoforms may
exist in the fat
body. A second is that cofactors associate with GATAb
to form
complexes a and b that preferentially bind to GBS1. Yet,
overexpression
of the GATAb cDNA does not result in the reinforcement
of complexes
a and b, suggesting that the quantity of the factors
responsible
for their formation is limiting in the fat body. Multiple
interactions
between GATA factors and protein partners have been
described
recently (
17,
20,
36,
45,
48,
49). It is thus
tempting
to speculate that protein-protein interactions with partners
modulate
the fat body-specific activity of
GATAb.
Dual requirement of GATAb and EcR/USP for specific activation of
the Fbp1 enhancer.
Disruption of either GATAb binding
site GBS1 or the EcR/USP binding site result in complete inactivation
of the Fbp1 enhancer, indicating that both GATAb and the
ecdysone receptor are strictly required for its activity. What are the
contributions of both of these factors to the induction of
Fbp1 expression?
Fbp1 is only induced at the end of the third larval instar.
In contrast, GATAb is expressed at a constant level in the fat
body
from the mid-second larval instar to pupariation. Thus, it
is clear
that the precise transcription timing of
Fbp1 is not
controlled solely by GATAb. Consistently during GATAb overexpression,
the premature activation of the AE transgene is gradual and remains
limited during the second larval instar and the first half of
the third
larval instar (Fig.
7). Thus, although this result provides
additional
evidence that GATAb is involved in
Fbp1 transactivation,
it
also shows that other transcription factors are required at
the end of
the third larval instar for maximal induction of
Fbp1.
A
number of findings demonstrate that one of these factors is
the
ecdysone receptor which is activated by its ligand only during
the
second part of the third larval instar. First, the disruption
of the
EcR/USP binding site in the
Fbp1 enhancer results in its
complete inactivation. Second, in ecdysone-deficient mutant strains,
induction of the
Fbp1 gene is abolished and this induction
can
be restored by feeding larvae with exogenous ecdysteroids
(
24).
Third, we show here that the AE[UAS] construct, in
which the EcR/USP
target site has been replaced with a GAL4 binding
site, is prematurely
induced at the beginning of the third larval
instar upon activation
by constantly expressed
GAL4.
However, our results indicate clearly that the active EcR/USP receptor
is not the only factor involved in the switching on
of
Fbp1.
The premature induction of AE[UAS] by GAL4 also remains
gradual
during the third larval instar. This distinctly suggests
that, in
addition to GATAb and EcR/USP, other transcription factors
whose
activity increases gradually through the third larval instar
are
involved in the fine tuning of the timing of
Fbp1
expression.
Yet, upon simultaneous overexpression of GATAb and GAL4,
the AE[UAS]
transgene becomes expressed at a constant level from the
mid-second
instar until puparium formation. These data have two
implications.
First, they indicate that the requirement for these other
transcription
factors, whose identity remains to be determined, can be
bypassed
under nonphysiological conditions. Second, they add further
evidence
that GATAb and EcR/USP act together to turn on the
Fbp1 enhancer,
the ecdysone receptor being the ultimate
timer for its
induction.
Physical interactions between the vertebrate GATA-1 factor and nuclear
receptors for glucocorticoids (
13) and estrogen
(
9)
have been described. The close proximity of the DNA
target sites
for GATAb and the EcR/USP ecdysone receptor in the
Fbp1 enhancer
makes it feasible that GATAb and EcR/USP
establish similar contacts.
However, the fat body-specific expression
of the AE[UAS] transgene
in a GAL4 genetic context suggests that
protein-protein interactions
between the ecdysone receptor and GATAb
are not required for the
achievement of tissue
specificity.
 |
ACKNOWLEDGMENTS |
We are grateful to M. D. Brennan and J. Hu for the gift of
the #Srp antibody, to P. Ramain for the gift of the #2B8 antibody, and
to R. Reuter and K.-P. Rehorn for the gift of the srp cDNA and the UAS-srp Drosophila line. We thank R. Reuter, K.-P.
Rehorn, Y. Engström, and U.-M. Petersen for helpful discussions
and for sharing information during the course of this work. We thank F. Schweisguth and A. Kropfinger for critical reading of the manuscript and M. Sémériva for expert advice on pericardial cells and
lymph glands in dissections of fat bodies.
V. Brodu is a predoctoral fellow of the Ministère de la Recherche
et de l'Enseignement. This work was supported by grants to J.-A.
Lepesant from the Association pour la Recherche contre le Cancer (grant
6294), the Ligue Nationale Contre le Cancer, and the Centre National de
la Recherche Scientifique.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut Jacques
Monod, Laboratoire de Biologie du Développement, CNRS UMR 7592, Universités Paris 6 et Paris 7, 2 place Jussieu, 75251 Paris
Cedex 05, France. Phone: (33 1) 44 27 78 12. Fax: (33 1) 44 27 52 65. E-mail: antoniewski{at}ijm.jussieu.fr.
 |
REFERENCES |
| 1.
|
Abel, T.,
A. M. Michelson, and T. Maniatis.
1993.
A Drosophila GATA family member that binds to Adh regulatory sequences is expressed in the developing fat body.
Development
119:623-633[Abstract/Free Full Text].
|
| 2.
|
Andres, A. J.,
J. C. Fletcher,
F. D. Karim, and C. S. Thummel.
1993.
Molecular analysis of the initiation of insect metamorphosis: a comparative study of Drosophila ecdysteroid-regulated transcription.
Dev. Biol.
160:388-404[Medline].
|
| 3.
|
Andres, A. J., and C. S. Thummel.
1992.
Hormones, Puffs and flies: the molecular control of metamorphosis by ecdysone.
Trends Genet.
8:132-138[Medline].
|
| 3a.
| Antoniewski, C. Unpublished data.
|
| 4.
|
Antoniewski, C.,
M. Laval,
A. Dahan, and J. A. Lepesant.
1994.
The ecdysone-response enhancer of the Fbp1 gene of Drosophila melanogaster is a direct target for the EcR/USP nuclear receptor.
Mol. Cell. Biol.
14:4465-4474[Abstract/Free Full Text].
|
| 5.
|
Antoniewski, C.,
B. Mugat,
F. Delbac, and J.-A. Lepesant.
1996.
Direct repeats bind the EcR/USP receptor and mediate ecdysteroid responses in Drosophila melanogaster.
Mol. Cell. Biol.
16:2977-2986[Abstract].
|
| 6.
|
Ashburner, M.
1989.
Drosophila: a laboratory handbook, p. 1331.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 7.
|
Barnett, S. W.,
K. Flynn,
M. K. Webster, and S. K. Beckendorf.
1990.
Noncoordinate expression of Drosophila glue genes: sgs4 is expressed at many stages and in two different tissues.
Dev. Biol.
140:362-373[Medline].
|
| 8.
|
Bender, M.,
F. B. Imam,
W. S. Talbot,
B. Ganetzky, and D. S. Hogness.
1997.
Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms.
Cell
91:777-788[Medline].
|
| 9.
|
Blobel, G. A.,
C. A. Sieff, and S. H. Orkin.
1995.
Ligand-dependent repression of the erythroid transcription factor GATA-1 by the estrogen receptor.
Mol. Cell. Biol.
15:3147-3153[Abstract].
|
| 10.
|
Brand, A. H., and N. Perrimon.
1993.
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
|
| 11.
|
Broadus, J.,
J. R. McCabe,
B. Endrizzi,
C. S. Thummel, and C. T. Woodard.
1999.
The Drosophila beta FTZ-F1 orphan nuclear receptor provides competence for stage-specific responses to the steroid hormone ecdysone.
Mol. Cell
3:143-149[Medline].
|
| 11a.
| Brodu, V., and C. Antoniewski. Unpublished data.
|
| 12.
| Burmester, T., C. Antoniewski, and J.-A.
Lepesant. Ecdysone-regulation of synthesis and processing of fat
body protein 1, the larval serum protein receptor of Drosophila
melanogaster. Eur. J. Biochem., in press.
|
| 13.
|
Chang, T. J.,
B. M. Scher,
S. Waxman, and W. Scher.
1993.
Inhibition of mouse GATA-1 function by the glucocorticoid receptor: possible mechanism of steroid inhibition of erythroleukemia cell differentiation.
Mol. Endocrinol.
7:528-542[Abstract/Free Full Text].
|
| 14.
|
Coschigano, K. T., and P. C. Wensink.
1993.
Sex-specific transcriptional regulation by the male and female doublesex proteins of Drosophila.
Genes Dev.
7:42-54[Abstract/Free Full Text].
|
| 15.
|
Crossley, M.,
M. Merika, and S. H. Orkin.
1995.
Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains.
Mol. Cell. Biol.
15:2448-2456[Abstract].
|
| 16.
|
Desplan, C.,
J. Theis, and P. H. O'Farrell.
1985.
The drosophila developmental gene, engrailed, encodes a sequence-specific DNA binding activity.
Nature
318:630-635[Medline].
|
| 17.
|
Durocher, D.,
F. Charron,
R. Warren,
R. J. Schwartz, and M. Nemer.
1997.
The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors.
EMBO J.
16:5687-5696[Medline].
|
| 18.
|
Evans, T.,
G. Felsenfeld, and M. Reitman.
1990.
Control of globin gene transcription.
Annu. Rev. Cell Biol.
6:95-124.
|
| 19.
|
Glass, C. K.,
D. W. Rose, and M. G. Rosenfeld.
1997.
Nuclear receptor coactivators.
Curr. Op. Cell Biol.
9:222-232[Medline].
|
| 20.
|
Haenlin, M.,
Y. Cubadda,
F. Blondeau,
P. Heitzler,
Y. Lutz,
P. Simpson, and P. Ramain.
1997.
Transcriptional activity of Pannier is regulated negatively by heterodimerization of the GATA DNA-binding domain with a cofactor encoded by the u-shaped gene of Drosophila.
Genes Dev.
11:3096-3108[Abstract/Free Full Text].
|
| 21.
|
Hu, J.
1995.
The role of DNA/protein interactions in transcription from the larval promoter of the D. Affinidisjuncta alcohol dehydrogenase gene. Ph.D. thesis.
University of Louisville, Louisville, Ky.
|
| 22.
|
Koelle, M. R.,
W. S. Talbot,
W. A. Segraves,
M. T. Bender,
P. Cherbas, and D. S. Hogness.
1991.
The drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily.
Cell
67:59-77[Medline].
|
| 23.
|
Lam, G. T.,
C. Jiang, and C. S. Thummel.
1997.
Coordination of larval and prepupal gene expression by the DHR3 orphan receptor during Drosophila metamorphosis.
Development
124:1757-1769[Abstract].
|
| 24.
|
Laval, M.,
F. Pourrain,
J. Deutsch, and J. A. Lepesant.
1993.
In vivo functional characterization of an ecdysone-response enhancer in the proximal upstream region of the Fbp1 gene of D. melanogaster.
Mech. Dev.
44:123-138[Medline].
|
| 25.
|
Lehmann, M.
1996.
Drosophila Sgs genes: stage and tissue specificity of hormone responsiveness.
Bioessays
18:47-54[Medline].
|
| 26.
|
Lehmann, M., and G. Korge.
1996.
The fork head product directly specifies the tissue-specific hormone responsiveness of the Drosophila Sgs-4 gene.
EMBO J.
15:4825-4834[Medline].
|
| 27.
|
Lepesant, J. A.,
F. Maschat,
J. Kejzlarovà-Lepesant,
H. Benes, and C. Yanicostas.
1986.
Developmental and ecdysteroid regulation of gene expression in the larval fat body of Drosophila melanogaster.
Arch. Insect Biochem. Physiol.
s1:133-141.
|
| 28.
|
Lossky, M., and P. C. Wensink.
1995.
Regulation of Drosophila yolk protein genes by an ovary-specific GATA factor.
Mol. Cell. Biol.
15:6943-6952[Abstract].
|
| 29.
|
Lucas, P. C., and D. K. Granner.
1992.
Hormone response domains in gene transcription.
Annu. Rev. Biochem.
61:1131-1173[Medline].
|
| 30.
|
Mangelsdorf, D. J.,
C. Thummel,
M. Beato,
P. Herrlich,
G. Schutz,
K. Umesono,
B. Blumberg,
P. Kastner,
M. Mark,
P. Chambon, et al.
1995.
The nuclear receptor superfamily: the second decade.
Cell
83:835-839[Medline].
|
| 31.
|
Maschat, F.,
M. L. Dubertret,
P. Thérond,
J. M. Claverie, and J. A. Lepesant.
1990.
Structure of the ecdysone-inducible P1 gene of Drosophila melanogaster.
J. Mol. Biol.
214:359-372[Medline].
|
| 32.
|
Merika, M., and S. H. Orkin.
1993.
DNA-binding specificity of GATA family transcription factors.
Mol. Cell. Biol.
13:3999-4010[Abstract/Free Full Text].
|
| 33.
|
Moore, L. A.,
H. T. Broihier,
M. Van Doren, and R. Lehmann.
1998.
Gonadal mesoderm and fat body initially follow a common developmental path in drosophila.
Development
125:837-844[Abstract].
|
| 34.
|
Noselli, S., and A. Vincent.
1992.
The Drosophila melanogaster ribosomal protein L17A-encoding gene.
Gene
118:273-278[Medline].
|
| 35.
|
Orkin, S. H.
1992.
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575-581[Free Full Text].
|
| 36.
|
Osada, H.,
G. Grutz,
H. Axelson,
A. Forster, and T. H. Rabbitts.
1995.
Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA1.
Proc. Natl. Acad. Sci. USA
92:9585-9589[Abstract/Free Full Text].
|
| 37.
|
Ramain, P.,
P. Heitzler,
M. Haenlin, and P. Simpson.
1993.
Pannier, a negative regulator of achaete and scute in Drosophila, encodes a zinc finger protein with homology to the vertebrate transcription factor GATA-1.
Development
119:1277-1291[Abstract].
|
| 38.
|
Rehorn, K. P.,
H. Thelen,
A. M. Michelson, and R. Reuter.
1996.
A molecular aspect of hematopoiesis and endoderm development common to vertebrates and Drosophila.
Development
122:4023-4031[Abstract].
|
| 39.
|
Riechmann, V.,
K. P. Rehorn,
R. Reuter, and M. Leptin.
1998.
The genetic control of the distinction between fat body and gonadal mesoderm in Drosophila.
Development
125:713-723[Abstract].
|
| 40.
|
Rubin, G. M., and A. C. Spradling.
1982.
Genetic transformation of Drosophila with transposable element vectors.
Science
218:348-353[Abstract/Free Full Text].
|
| 41.
|
Sam, S.,
W. Leise, and D. K. Hoshizaki.
1996.
The serpent gene is necessary for progression through the early stages of fat-body development.
Mech. Dev.
60:197-205[Medline].
|
| 42.
|
Schubiger, M.,
A. A. Wade,
G. E. Carney,
J. W. Truman, and M. Bender.
1998.
Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis.
Development
125:2053-2062[Abstract].
|
| 43.
|
Simon, J. A., and J. T. Lis.
1987.
A germline transformation analysis reveals flexibility in the organization of heat shock consensus elements.
Nucleic Acids Res.
15:2971-2988[Abstract/Free Full Text].
|
| 44.
|
Talbot, W. S.,
E. A. Swyryd, and D. S. Hogness.
1993.
Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms.
Cell
73:1323-1337[Medline].
|
| 45.
|
Tevosian, S. G.,
A. E. Deconinck,
A. B. Cantor,
H. I. Rieff,
Y. Fujiwara,
G. Corfas, and S. H. Orkin.
1999.
FOG-2: a novel GATA-family cofactor related to multitype zinc-finger proteins Friend of GATA-1 and U-shaped.
Proc. Natl. Acad. Sci. USA
96:950-955[Abstract/Free Full Text].
|
| 46.
|
Thomas, H. E.,
H. G. Stunnenberg, and A. F. Stewart.
1993.
Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle.
Nature
362:471-475[Medline].
|
| 47.
|
Thummel, C. S.
1996.
Flies on steroids drosophila metamorphosis and the mechanisms of steroid hormone action.
Trends Genet.
12:306-310[Medline].
|
| 48.
|
Tsang, A. P.,
J. E. Visvader,
C. A. Turner,
Y. Fujiwara,
C. Yu,
M. J. Weiss,
M. Crossley, and S. H. Orkin.
1997.
FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation.
Cell
90:109-119[Medline].
|
| 49.
|
Wadman, I. A.,
H. Osada,
G. G. Grutz,
A. D. Agulnick,
H. Westphal,
A. Forster, and T. H. Rabbitts.
1997.
The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins.
EMBO J.
16:3145-3157[Medline].
|
| 50.
|
White, K. P.,
P. Hurban,
T. Watanabe, and D. S. Hogness.
1997.
Coordination of Drosophila metamorphosis by two ecdysone-induced nuclear receptors.
Science
276:114-117[Abstract/Free Full Text].
|
| 51.
|
Wodarz, A.,
U. Hinz,
M. Engelbert, and E. Knust.
1995.
Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila.
Cell
82:67-76[Medline].
|
| 52.
|
Yao, T. P.,
B. M. Forman,
Z. Jiang,
L. Cherbas,
J.-D. Chen,
M. McKeown,
P. Cherbas, and R. M. Evans.
1993.
Functional ecdysone receptor is the product of EcR and Ultraspiracle genes.
Nature
336:476-479.
|
| 53.
|
Young, P. E.,
T. C. Pesacreta, and D. P. Kiehart.
1991.
Dynamic changes in the distribution of cytoplasmic myosin during Drosophila embryogenesis.
Development
111:1-14[Abstract].
|
Molecular and Cellular Biology, August 1999, p. 5732-5742, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Carre, C., Szymczak, D., Pidoux, J., Antoniewski, C.
(2005). The Histone H3 Acetylase dGcn5 Is a Key Player in Drosophila melanogaster Metamorphosis. Mol. Cell. Biol.
25: 8228-8238
[Abstract]
[Full Text]
-
Lycett, G. J., Kafatos, F. C., Loukeris, T. G.
(2004). Conditional Expression in the Malaria Mosquito Anopheles stephensi With Tet-On and Tet-Off Systems. Genetics
167: 1781-1790
[Abstract]
[Full Text]
-
Cakouros, D., Daish, T. J., Kumar, S.
(2004). Ecdysone receptor directly binds the promoter of the Drosophila caspase dronc, regulating its expression in specific tissues. JCB
165: 631-640
[Abstract]
[Full Text]
-
ROIGNANT, J.-Y., CARRE, C., MUGAT, B., SZYMCZAK, D., LEPESANT, J.-A., ANTONIEWSKI, C.
(2003). Absence of transitive and systemic pathways allows cell-specific and isoform-specific RNAi in Drosophila. RNA
9: 299-308
[Abstract]
[Full Text]
-
Brodu, V., Mugat, B., Fichelson, P., Lepesant, J.-A., Antoniewski, C.
(2001). A UAS site substitution approach to the in vivo dissection of promoters: interplay between the GATAb activator and the AEF-1 repressor at a Drosophila ecdysone response unit. Development
128: 2593-2602
[Abstract]
[Full Text]