Previous Article | Next Article 
Molecular and Cellular Biology, August 1999, p. 5768-5784, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Nup124p Is a Nuclear Pore Factor of
Schizosaccharomyces pombe That Is Important for
Nuclear Import and Activity of Retrotransposon Tf1
David
Balasundaram,1
Michael J.
Benedik,2
Mary
Morphew,3
Van-Dinh
Dang,1 and
Henry L.
Levin1,*
Laboratory of Eukaryotic Gene Regulation,
National Institute of Child Health and Human Development, National
Institutes of Health, Bethesda, Maryland,1
Biochemical and Biophysical Sciences, University of
Houston, Houston, Texas,2 and
Department of Molecular, Cellular, and Developmental
Biology, University of Colorado, Boulder,
Colorado3
Received 12 February 1999/Returned for modification 25 March
1999/Accepted 27 April 1999
 |
ABSTRACT |
The long terminal repeat (LTR)-containing retrotransposon Tf1
propagates within the fission yeast Schizosaccharomyces
pombe as the result of several mechanisms that are typical of
both retrotransposons and retroviruses. To identify host factors that
contribute to the transposition process, we mutagenized cultures of
S. pombe and screened them for strains that were unable to
support Tf1 transposition. One such strain contained a mutation in a
gene we named nup124. The product of this gene contains 11 FXFG repeats and is a component of the nuclear pore complex. In
addition to the reduced levels of Tf1 transposition, the
nup124-1 allele caused a significant reduction in the
nuclear localization of Tf1 Gag. Surprisingly, the mutation in
nup124-1 did not cause any reduction in the growth rate,
the nuclear localization of specific nuclear localization
signal-containing proteins, or the cytoplasmic localization of poly(A)
mRNA. A two-hybrid analysis and an in vitro precipitation assay both
identified an interaction between Tf1 Gag and the N terminus of
Nup124p. These results provide evidence for an unusual mechanism of
nuclear import that relies on a direct interaction between a nuclear
pore factor and Tf1 Gag.
 |
INTRODUCTION |
Retroviruses and long terminal
repeat (LTR)-containing retrotransposons possess similar methods of
propagation that include the conversion of their mRNA into cDNA by
reverse transcriptase (RT) and the insertion of this double-stranded
DNA into the host genome by integrase (IN). Because reverse
transcription occurs in the cytoplasm, the preintegration complexes
(PIC) of cDNA and IN must be transported into the nucleus for
integration to occur. Nuclear pore complexes (NPC) are assemblies of
more than 50 proteins that provide the means for selective passage of
proteins and nucleic acids between the cytoplasm and the nucleus
(55, 58). Although significant progress has been made
describing the families of transport factors that deliver nuclear
localization sequence (NLS)-containing proteins to the nucleus
(13, 21, 51, 53, 65), the current models of nuclear import
do not directly address how macromolecules as large as virus complexes
pass through the nuclear pore.
The length and diameter of the transport channel have been measured by
testing nucleoplasmin-coated gold particles of various sizes for the
ability to pass through the nuclear pore. The maximum diameter of the
channel was found to be 20 to 25 nm, and this passage extends
approximately 50 nm across the nuclear envelope (15, 46).
Large macromolecular substrates that must in some form pass through the
NPCs in intact nuclear envelopes include the 50-nm virus particles of
simian virus 40 (SV40) (24, 49, 70), the 90-nm particles of
adenovirus (24, 60), and the 160S PIC of human
immunodeficiency virus (HIV). Although the adenovirus particles attach
to the NPC and disassemble before the transport of the DNA-protein VII
complex, SV40 appears to pass through the NPC as virion particles
(25, 49, 70). The nuclear import of the HIV PIC reflects not
only the presence of NLS activity in matrix and IN but also the unusual
-karyopherin-like properties of Vpr (8, 17, 18, 28, 30, 54, 61,
62). Recent evidence suggests that the import of the HIV PIC in
nondividing cells relies on an interaction between Vpr and specific
nuclear pore factors that contain FXFG motifs (16, 61).
It is interesting that the passage of retroviruses through the NPCs is
not thought to be important in dividing cells, because retroviruses may
readily access the host genome after breakdown of the nuclear envelope.
Nevertheless, the IN of avian sarcoma virus possesses efficient NLS
activity that contributes to virus replication (34, 35). In
addition, the retrotransposons of Saccharomyces cerevisiae
and Schizosaccharomyces pombe must travel through NPCs to
access the nucleus because the nuclear envelopes of these organisms do
not breakdown during mitosis.
Although these examples of large transport substrates indicate that
multiple mechanisms may exist to allow their import, little is known
about the principal activities required for these mechanisms. Because
LTR-containing retrotransposons produce large virus-like particles
(VLPs) and because these transposons propagate in yeast, the genetic
analysis of transposition may reveal whether specialized host
activities are required for the nuclear import of large transposon complexes. In addition, the extensive similarity between retroviruses and LTR-containing retrotransposons suggests that any information relevant to the import of transposon complexes may lead to a better understanding of retrovirus import. Recent studies of Ty1 transposition in S. cerevisiae revealed that IN contains a bipartite NLS
that is required for Ty1 transposition (33, 47). Although
these results constitute important first steps in the understanding of
the nuclear transport of retrotransposon proteins, little is known
about what components of the NPC contribute to Ty1 import.
The fission yeast S. pombe contains Tf1, an active
LTR-retrotransposon that expresses functional copies of Gag, protease
(PR), reverse transcriptase (RT), and integrase (IN) proteins (39, 41). The transposition activity of a neo-marked copy
of Tf1 can be monitored in vivo, and as many as 4% of the cells
induced for transposition receive Tf1 insertions (40).
Although Tf1 possesses an unusual self-priming mechanism for the
initiation of reverse transcription (36-38), the other
aspects of its reverse transcription and integration appear to model
the general properties of LTR retroelements (2, 3, 39-41).
The results of sucrose gradient fractionation and blotting techniques
indicate that extracts of S. pombe cells induced for
transposition contain large Tf1 particles composed of Gag, RT, IN, Tf1
mRNA, and Tf1 cDNA (3, 37, 40).
To search for host factors that contribute to Tf1 function, we
mutagenized cultures of S. pombe and screened for strains
that were unable to support Tf1 transposition. We identified a mutation in a host gene that lowered Tf1 transposition by 12-fold without reducing the levels of reverse transcription. Immunofluorescence microscopy indicated that this mutation also caused a significant reduction in the nuclear localization of Tf1 Gag. We named this host
gene nup124 (nuclear pore factor of 124 kDa) because this protein localized to the nuclear envelope and because the hypothetical coding sequence included 11 copies of the FXFG repeat that is present
in a large family of nuclear pore factors. The mutant allele of
nup124 caused no alterations in growth rates or in the nuclear localization of other proteins examined. The results of two-hybrid analyses and glutathione S-transferase (GST)
precipitation assays detected an interaction between Tf1 Gag and
Nup124p. This evidence indicates that Nup124p possesses a specialized
activity required for the nuclear import of Tf1 complexes.
 |
MATERIALS AND METHODS |
Media and growth of S. pombe strains.
The
S. pombe minimal liquid and plate media were composed of EMM
(2). For growth rate determinations, overnight cultures in
EMM complete plus vitamin B1 were diluted to an optical
density at 600 nm (OD600) of 0.05 in fresh medium (50 ml).
Growth of all S. pombe strains was conducted at 32°C
unless otherwise stated. To examine temperature sensitivity, strains
were grown on plates incubated at 16, 20, 25, 37, and 42°C. The yeast
strains used in this study are listed in Table
1.
Plasmid constructions.
Many DNA fragments used to create
plasmids for this study were generated by PCR. To avoid complications
due to the inadvertent creation of mutations by the polymerases, we
used the high-fidelity enzymes Turbo Pfu (Stratagene) and Deep Vent
(New England Biolabs). In addition, the plasmids that were generated
with PCR products were created in duplicate from independent PCRs and
the properties of each plasmid were studied in parallel.
The HA-tagged allele of
nup124 included a double copy of the
HA epitope that was inserted into a
BclI site introduced at
the
N terminus of the coding sequence in plasmid pHL1587-18. To create
a FLAG-tagged version of Gag, the sequence encoding 10 amino acids
of
Tf1 Gag in pHL1258 was replaced by creating a
NaeI
restriction
site near the sequence encoding the C terminus of Gag. The
NaeI
site was created within a product of fusion PCR by
using oligonucleotides
HL211 and HL212 for the
NaeI site.
Using two complementary oligonucleotides,
HL220 and HL221, a 24-bp DNA
fragment encoding the FLAG epitope
was cloned into the newly created
NaeI site to generate
pHL1276.
A mutation in
Xenopus nucleoplasmin within the bipartite NLS
amino acids was created by fusion in the context of the green
fluorescent protein (GFP)-nucleoplasmin fusion protein. A 1.3-kb
BamHI-
MscI fragment encoding the wild-type
nucleoplasmin NLS,
KKAGQAKKKK (pREP-GFP-Nucleoplasmin, [Table
2]), was replaced
by a similar fragment
containing the mutated NLS KKAGQA
NNKK to
create pHL1769
(Table
2). The 1.3-kb region generated by PCR
containing the mutation
was confirmed by sequence analysis. This
mutated version of the
nucleoplasmin NLS has been previously reported
to inhibit nuclear
import (
57).
A mutation from cytosine to thymine in the wild-type
nup124
sequence was created by fusion PCR to re-create the
nup124-1
allele.
A 2.6-kb
AvrII-
NcoI fragment containing
the wild-type
nup124 in
pHL1338-3 (Table
2) was replaced by
a fusion PCR fragment containing
the mutated
nup124-1
recreated sequence to form pHL1678 (Table
2). The sequence generated by
fusion PCR containing the mutation
was
confirmed.
Integration of GFP into the C terminal of the
nup124+ product by homologous integration gene
tagging.
A construct designed to contain the 3' end of the
nup124 open reading frame (ORF), pK1 antigen (three
repeats), GFP gene, SV40 poly(A) signal and
ura4+ marker followed by sequence after the
nup124 stop codon was generated by PCR with HL613 and HL614
(Table 3) as primers and pCS2pkSu (Table
2) as template. The PCR-generated fragment was used to transform
S. pombe 461 (Table 3). Stable ura4+
transformants were microscopically examined for GFP fluorescence. Integration of the
nup124-3pk1-GFP-ura4+ construct into
the nup locus in single copy was verified by Southern blot
analysis. Strains carrying the genomically tagged nup124 were then processed for immunoelectron microscopy.
Immunoelectron microscopy.
Cells were prepared for electron
microscopy by freeze-substitution fixation after rapid freezing by
previously published methods (12). The anti-GFP antibodies
(the kind gift of Jason Kahana and Pam Silver) were diluted 200-fold in
blocking buffer, and sections mounted on grids were floated overnight
on a 20-µl drop of this solution (12, 67). The grids were
then rinsed in buffered saline and treated with goat anti-rabbit
immunoglobulin labeled with 10-nm-diameter colloidal gold (12,
67).
Molecular and genetic techniques.
Strains to be tested for
transposition and cDNA recombination were treated as previously
described (2, 11).
The levels of Tf1 cDNA and protein in cells induced for transposition
were measured by DNA blot analysis and Western analysis,
respectively
(
2).
Mutagenesis of S. pombe YHL1858.
The parent
strain YHL1858 was subjected to mutagenesis with ethyl methanesulfonate
(EMS) as described by Moreno et al. (48). The mutagenized
culture exhibited 16% viability compared to the cells not treated with
EMS. The same preparation of cells was plated on EMM
ura medium to
generate colonies of cells that contained the Tf1-neoAI
plasmid. We screened 2,500 of these colonies for reduced transposition
activity by the Tf1 patch assay.
Construction of an S. pombe genomic library.
Genomic DNA was isolated from the wild-type strain 972 in 500 ml of YES
medium. The DNA was subjected to partial digestion with
Sau3A after having established the optimal conditions for the fractionation of a population corresponding to 4 to 6 kb. Sau3A created 3' overhang ends that were partially filled in
with dATP and dGTP by using Klenow enzyme. The resulting DNA was
inserted into the vector pHL1288.
The polylinker and the
nmt1 sequence of the multicopy
plasmid pREP3 (
45) were excised with
PstI and
SacI and replaced with
a 48-base polylinker fragment
composed of HL199 and HL200,
GCAACTAGTTCAGATCTTAGTCGACCGATGTATAAGGATCCCTGAGCT,
containing
the restriction sites
PstI,
SpeI,
BglII,
SalI,
BamHI,
and
SacI. pHL1288 was linearized with
SalI followed
by partial
filling-in of the first two nucleotides with dCTP and dTTP
by
using Klenow. The genomic DNA digested with
Sau3A was
ligated
into pHL1288 overnight at 16°C.
Strain YHL5754 (
nup124-1) was transformed by treatment with
lithium acetate and library DNA in amounts optimized to yield
600 to
800 colonies/plate (
48). The colonies were then put through
the cDNA recombination assay to identify clones able to rescue
the
recombination defect of the strain with
nup124-1. A total
of
54,155 colonies tested in the screen yielded five plasmids
that
complemented both the transposition and recombination defects
of
YHL5754. Plasmid DNA was isolated by extraction from the strains
that
suppressed the
nup124-1 defect (
2).
Deletion of the nup124 sequence in the suppressor
plasmid and creation of a frame shift.
A deletion in the
nup124 sequence of the suppressor plasmid pHL1338-3 was
created by digestion with SnaBI and SmaI followed by ligation. A frameshift mutation was created 375 bases downstream from the start of translation of nup124 in the suppressor
plasmid by linearizing pHL1338-3 with AvrII. The 5'
overhangs were filled with Klenow, and the resulting blunt ends were
ligated to create pHL1343.
To insert a suppressing fragment of
nup124 back into the
genome, an integration vector, pHL481, was created by removing the
742-nucleotide
ClaI fragment from pJK148 (
32).
This plasmid,
contained a multicloning site and the complete sequence
of the
leu1 gene of
S. pombe. A 4.4-kb
SpeI-
BamHI fragment from pHL1338-3
with
nup124 was inserted into pHL481 digested with
XbaI and
BamHI
to produce pHL1342. To integrate
this plasmid, pHL1342 was digested
with
AgeI and transformed
into the wild-type strain YHL912 and
the
nup124-1 mutant
strain YHL5750. Stable Leu
+ transformants were selected,
and stable integrants were identified.
DNA blot analysis of YHL6136
indicated that the integration of
pHL1342 occurred at the genomic
location of
nup124.
Construction of a strain with nup124 deleted.
To
delete the entire ORF of nup124 and replace it with
his3, we used strains and plasmid DNA as described by Ohi et
al. (52). A BglII-NaeI fragment with
the his3 gene of S. pombe was generated by PCR
with oligonucleotides HL447 and HL440 with pAf1 as template. DNA from
pHL1472-6 was digested with BclI and SmaI to
remove the 3.47-kb nup124 ORF, and the remaining DNA was
ligated to the BglII-NaeI fragment of the
his3 sequence to create pHL1572. The 3.6-kb
BglII-Ecl136II fragment was used to transform a
homozygous wild-type his3 diploid. Strains were identified
by DNA blot hybridization in which the nup124-1 allele had
been replaced by the integration of a
nup124::HIS3-disrupted copy.
Immunofluorescence microscopy.
FLAG-tagged Gag was localized
by incubating mutant and wild-type cells induced to overexpress the
FLAG-tagged Gag by the absence of vitamin B1. A total of 5 OD600 units of stationary-phase cells (OD600 = 10 to 11) were harvested and processed
essentially as described previously (5). The cells were
reacted with a 1:1,000 dilution of primary antibody, anti-FLAG M2
monoclonal antibody (no. IB13025; Eastman Kodak, New Haven, Conn.), at
room temperature in a humidified chamber overnight. After five washes,
these cells were incubated with a secondary antibody consisting of
Oregon Green 488 goat anti-mouse immunoglobulin G (Molecular Probes, Eugene, Oreg.) at a 1:500 dilution for 2 h in the dark. Cells were
mounted prior to visualization with 1 mg of
p-phenylenediamine (Sigma P-1519) per ml, 1 µg of
4',6-diamidino-2-phenylindole (DAPI) per ml in 50% glycerol was added,
and the coverslips were sealed with clear nail polish.
The localization of HA-tagged Nup124p was determined by the same method
used to visualize the FLAG-Gag protein. A total of
5 OD
600
units of cells grown in EMM

leu dropout medium were
harvested at an
OD
600 of 0.25. They were fixed for 75 min and
treated with
Zymolyase 100T (Seikagaku Corp.) for 1 h. The primary
antibody was
a 1:5,000 dilution of the monoclonal antibody HA.11
(MMS-101P; BAbCO),
and the secondary antibody was a 1:1,000 dilution
of Oregon Green 488 goat anti-mouse immunoglobulin
G.
To localize the SV40 NLS-GFP-LacZ protein,
nup124-1 and
wild-type strains were transformed with pSGP502-SV40 and
pSGP502-SV40mut
plasmids (kindly supplied by Sally G. Pasion, Salk
Institute,
San Diego, Calif.) (Table
2). To induce the overexpression
of
the GFP-LacZ fusion proteins, the strains were grown in the absence
of vitamin B
1. A total of 5 OD
600 units of
log-phase cells (OD
600,
0.6 to 0.8) were harvested and
fixed for 2 min in 2% (vol/vol)
formaldehyde-0.05% (vol/vol)
glutaraldehyde (G5882; Sigma) in
phosphate-buffered saline. After two
washes with phosphate-buffered
saline, the cells were allowed to adhere
for 40 min at room temperature
to slides coated with 1.0%
polyethylenimine. The slides were rinsed
in distilled water and air
dried. The cells were next mounted
with a solution containing
p-phenylenediamine (1 mg/ml) and DAPI
(1 mg/ml) in 50%
glycerol before the coverslips were sealed with
clear nail
polish.
To study the localization of the GFP-nucleoplasmin protein,
nup124-1 and wild-type strains were transformed with the
pREP-GFP-Nucleoplasmin
plasmid (kindly supplied by Tokio Tani and
Yasumi Ohshima, Kyushu
University, Kyushu, Japan) and pHL1769
(Table
2). After the cells
were induced for Tf1 expression, 5 OD
600 units of log-phase cells
(OD
600 of 0.6 to
0.8) were harvested and directly incubated for
40 min in the dark at
room temperature in Hoechst 33342 (bis-benzimidine;
B2261 [Sigma] at
25 mg/ml in 50% glycerol while adhering to slides
coated with 1.0%
polyethylenimine. The slides were then rinsed
in distilled water and
air dried. The cells were mounted with
12.5 µg of Hoechst 33342 per
ml in 50% glycerol before the coverslips
were sealed with clear nail
polish.
The in situ hybridization assay to detect poly(A) mRNA was conducted as
previously published (
27).
Cells were observed and photographed with a Zeiss Axiophot fluorescence
microscope equipped with a 100× objective. Unless
otherwise mentioned,
Kodak Ektachrome P1600 film was used to capture
the
images.
Two-hybrid analysis.
To screen for the interactions between
Tf1 Gag and the Nup124 protein, the yeast interaction trap two-hybrid
system was used (20, 26). DNA segments encoding full-length
Gag as well as six segments of Nup124p (see Fig. 8) were amplified by
PCR and cloned into activation domain (AD) and binding-domain (BD)
plasmid vectors. To clone these fragments into the two-hybrid vectors, primers for each PCR product were designed to create EcoRI
and XhoI restriction sites at the 5' and 3' ends,
respectively. Duplicates of each PCR product were cloned into the DNA
binding-domain plasmid, pEG202, and activation domain plasmid, pJG4-5
(20). The various combinations of plasmids were transformed
into yeast strain EGY48 (20), which has the upstream
activating sequences of the chromosomal LEU2 gene replaced
with by LexA operators. Potential interactions were scored
by printing patches from galactose plates containing leucine to
galactose plates lacking leucine. The plates were monitored on a daily
basis for up to 5 days. The growth of test interaction patches was
compared to that demonstrated by a known interaction consisting of p53
fused to LexA and SV40 large T antigen fused to B42.
GST precipitation.
The Gag of Tf1 and the two halves of
Nup124p were expressed as C-terminal GST fusions in the BLR (Novagen)
strain of bacteria. A PCR product encoding Gag was generated with
oligonucleotides that produced a BamHI site (HL495) at the
beginning of the Gag gene and a XhoI site (HL496) at the
predicted end of the Gag gene. This product was inserted into the
BamHI and XhoI sites of pGEX-6P-1 (Pharmacia
Biotech) to produce pHL1613-4. A PCR product encoding an N-terminal
portion of Nup124p that corresponded to sections 2 and 3 in Fig. 8 was
created with a BamHI site at its beginning (HL520) and a
SalI site (HL510×) at its 3' end. This product was inserted
into the BamHI and SalI sites of pGEX-6P-1 to
create pHL1623-1. Similarly, a PCR product encoding the C-terminal
section of Nup124p (see Fig. 8, sections 4, 5, and 6) was created with a BamHI site (HL521) at the 5' end and a XhoI
site (HL501) at the 3' end. Insertion of this product into the
BamHI and XhoI sites of pGEX-6P-1 produced
pHL1622-1. The GST-Nup124p proteins were cleaved with PreScission
protease (Pharmacia Biotech) and eluted from the glutathione-Sepharose
4B beads whereas the GST-Gag proteins were purified on the
glutathione-Sepharose 4B beads and used directly in precipitation experiments.
The pull-down experiments were performed, as described by Rexach and
Blobel (
56), in binding buffer that contained 20 mM
HEPES
(pH 6.8), 150 mM potassium acetate, 2 mM magnesium acetate,
2 mM
dithiothreitol, 0.1 mM Tween 20, and 0.1% Casamino Acids.
After the
beads with GST-Gag were washed in binding buffer and
the Nup124p
proteins were dialyzed in binding buffer, approximately
1 µg of the
Nup124p proteins was added in 15 µl to 15 µl of resin
bed with 1 µg of GST-Gag. The sample was rotated end over end
at room
temperature for 45 min, and after three washes with 250
µl of binding
buffer, the beads and the supernatant fractions
were combined with
sample loading buffer and loaded onto a sodium
dodecyl sulfate-10%
polyacrylamine
gel.
 |
RESULTS |
To identify genes in S. pombe that contribute to the
function of Tf1, we mutagenized cultures with EMS and screened the
strains for reduced levels of transposition. Tf1 activity in individual colonies was monitored by a previously described assay that detected the insertion of neo-marked Tf1 elements into the genome of
S. pombe (40). To measure transposition, a
plasmid-encoded copy of Tf1 that included a bacterial neomycin
resistance gene (Tf1-neoAI) was induced for transposition by
activating Tf1 transcription. After first selecting against cells that
retained the Tf1-neoAI plasmid, we identified cells with
genomic inserts of Tf1-neo by virtue of the resistance to
G418 provided by the neo gene. Figure 1 contains the results of a transposition
assay and shows that a patch of cells that initially contained
wild-type Tf1-neoAI produced confluent growth on a plate
that contained G418 whereas a similar patch of cells that contained
Tf1-neoAI with a frameshift in IN showed significantly less
transposition.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
Transposition and cDNA recombination assays of Tf1. The
genetic manipulations and replica printing required for the
transposition and recombination assays are indicated in parentheses.
The ability of the reverse transcripts in both assays to produce G418
resistance is shown. Although wild-type (wt) Tf1-neoAI
produced G418 resistance in both assays, a mutation that blocked
integrase expression, IN fs, greatly reduced growth on the
transposition plates without significantly reducing growth on the
recombination plates. PR fs is a strain with a frameshift mutation in
Tf1 that blocks the expression of PR, RT, and IN. FOA- 5-fluoroorotic
acid.
|
|
The strains that appeared to have significantly lower transposition
activity were examined for several trivial causes of reduced growth on
the plates that contained G418. Each candidate suspected of possessing
transposition defects was tested for reduced function of the
nmt1 promoter as fused to lacZ. We also
retransformed each candidate with a fresh copy of the
Tf1-neoAI plasmid to identify which strains were defective
for transposition simply due to mutations in the assay plasmid. In
addition, we tested strains with a version of Tf1 that contained
arg3 as a transposition marker. In this way, we could
exclude candidates that showed low growth on the G418/5-fluoroorotic acid (FOA) plates due to alterations specific to the metabolism of G418. One strain that exhibited a genuine reduction in transposition was crossed with a wild-type strain. The
spores of 14 tetrads exhibited a 2:2 segregation of the transposition defect, which indicated that the reduced Tf1 activity was due to a
mutation in a single gene. For reasons described below, we named this
gene nup124.
The transposition activity of cells that contained the
nup124-1 mutation is shown in Fig. 1. To measure the
magnitude of this defect we subjected strains to a
quantitative-transposition assay that was developed previously (2,
43). The results of the quantitative-transposition assay showed
that the strain with the nup124 mutation produced
12-fold-fewer transposition events than did the wild-type strain
(described in Materials and Methods).
After the mutagenized strains were tested for defects in transposition
activity, they were screened by a previously described assay that
detected homologous recombination between Tf1 plasmid sequences and
copies of Tf1 cDNA. The occurrence of wild-type levels of this
recombination indicates that normal levels of Tf1 cDNA are present in
the nucleus (2). The homologous-recombination assay was
performed with the same Tf1-neoAI plasmid that was used for
the transposition assays. The presence of an artificial intron (AI)
disrupted the neo reading frame, and because the intron
orientation was inverted relative to neo, the intron could
not be spliced from the neo transcript. However, strains
induced for Tf1 expression become resistant to G418 because the intron
was in the appropriate orientation to be spliced from the Tf1 mRNA. We
found that if colonies induced for Tf1 expression were replica printed
directly to plates that contained G418, significant levels of G418
resistance occurred that could be attributed to two equally efficient
processes (2). The reverse transcripts of the spliced Tf1
mRNA, if present in the nucleus, could homologously recombine with the
Tf1-neoAI plasmid and generate a G418-resistant version of
the plasmid. The cDNA also was able to serve as the substrate for
conventional transposition events. Although these processes occurred
with about equal proportions in wild-type strains, we could use this
method to measure the levels of homologous cDNA recombination in
strains that were known to be defective for transposition
(2). The feature of the transposition assay that masks the
detection of cDNA recombination was growth on a medium that selects
against the Tf1-neoAI plasmid.
The recombination assay in Fig. 1 shows that a wild-type copy of the
Tf1-neoAI plasmid produced confluent growth on agar medium that contained G418. The confluent growth produced by a version of
Tf1-neoAI that lacked IN due to a frameshift mutation and
the lack of G418 resistance due to a frameshift just upstream of RT (PR
fs) are demonstrations used to indicate that the
homologous-recombination assay detects products of reverse
transcription even in the absence of IN activity (2). Figure
1 also shows that the mutation in nup124 that was
responsible for low transposition activity caused a dramatic reduction
in the homologous recombination of Tf1 cDNA. The magnitude of the
recombination defect was determined by subjecting the strains to a
quantitative version of the homologous-recombination assay
(2). The strain with the nup124-1 mutation
produced 40-fold-lower levels of cDNA recombination than did the
wild-type strain (see Materials and Methods).
The results of the recombination assays suggested either that the
levels of Tf1 reverse transcripts were reduced by the
nup124-1 mutation or that normal levels of cDNA were
produced but did not accumulate in the nucleus. We used a previously
published technique to measure directly the accumulated levels of Tf1
cDNA in cells (2, 38). Liquid cultures of cells induced for
Tf1 expression were extracted for total DNA, which was then digested
with BstXI and subjected to DNA blot analysis. DNA was
extracted from cultures that were in log-phase growth as well as from
cells that had reached stationary phase. The results showed that the
wild-type Tf1-neoAI plasmid produced the same amount of a
2.1-kb fragment of cDNA as did the strain with the mutation in
nup124-1 (Fig. 2A). A 9.5-kb band resulted from the BstXI digestion of the
Tf1-neoAI plasmid, and this served as an internal control
for levels of DNA loaded in each lane.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 2.
Levels of Tf1 cDNA and proteins are not altered by the
mutation in nup124-1. (A) Tf1 cDNA production in wild-type
and nup124-1 cells at the logarithmic and stationary phases
of growth. A DNA blot containing nucleic acid extracted from wild-type
(WT) (YHL1282), PR frameshift (YHL1836), INT frameshift (YHL1554), and
the nup124-1 mutant (YHL5754), is shown. Genomic DNA from
the logarithmic and stationary phases of growth on medium without
vitamin B1 was digested with BstXI and loaded
onto a 0.6% agarose gel, which was transferred to a filter and probed
with a 1.0-kb neo fragment. (B) Tf1 proteins in wild-type
and nup124-1 cells at the logarithmic and stationary phases
of growth. An immunoblot of extracts from the cells used for the Tf1
cDNA determination in panel A is shown. The filter was probed with both
anti-Gag and anti-IN antisera. The arrows marked IN and Gag show the
positions of the IN and Gag proteins.
|
|
Another possibility we considered was that the nup124-1
mutation indirectly caused a reduction in the level of one or all of
the Tf1 proteins. An immunoblot of proteins extracted from cultures
harvested in both stationary and exponential phases showed that the
levels of Gag and IN proteins in cells with the nup124-1 defect were indistinguishable from those in wild-type cells (Fig. 2B).
Since IN is the last protein encoded by the single ORF of Tf1, the
presence of normal levels of IN indicated that all Tf1 proteins were
translated with wild-type efficiency.
Isolation and sequence of the nup124 gene.
To
isolate a wild-type copy of the nup124 gene and determine
its sequence, we transformed a genomic library of plasmids into a
strain with the nup124-1 allele and screened for
complementation of the transposition defect. The strains with high
levels of transposition activity were all found to contain the same
fragment of genomic DNA. Both orientations of the insert were isolated.
Furthermore, these plasmids complemented both the transposition
and cDNA recombination defects caused by the nup124-1
mutation. The sequence of the entire 5,075-bp genomic fragment was
available from the S. pombe genome project.
Figure
3A is a diagram of the fragment
that included the significant ORFs and the restriction sites used to
determine that
each of the complementing plasmids contained the same
insert.
The sequence began with 106 codons of the ORF that corresponded
to the last 64% of a gene for a clathrin coat assembly protein.
The
end of the fragment encoded the last 20% of a 754-amino-acid
protein
with sequence similarity to ATP-dependent RNA helicases.
The center of
the fragment contains the entire gene (encoding
1,159 amino acids) for
a hypothetical protein of 124 kDa. When
a deletion was made from the
SnaBI site to the
SmaI site, the
complete coding
sequence of the central ORF was removed and the
resulting plasmid no
longer complemented the transposition or
recombination defect of the
nup124-1 mutation (Fig.
3B). We also
found that a frameshift
mutation generated near the beginning
of the central ORF in the
AvrII site destroyed the complementation
activity of the
plasmid (Fig.
3B). These data indicated that the
central ORF, encoding
1,159 amino acids, was the source of the
complementation. To test
whether this suppressor gene was allelic
to
nup124, we
subcloned the entire fragment of genomic sequence
shown in Figure
3A
into an integration vector that contained the
leu1 gene of
S. pombe. The resulting plasmid was integrated at
the
genomic site of the complementing ORF in a haploid strain
that
contained the
nup124-1 allele. The structure and position
of
the integrated plasmid were confirmed by DNA blot analysis.
The
single-copy integrated fragment was found to retain its ability
to
complement the
nup124-1 defects in transposition and
homologous
recombination (Fig.
3C). The resulting strain was mated with
a
haploid that possessed a wild-type copy of
nup124, and 20 tetrads
were dissected. All four spores of these tetrads possessed
wild-type
transposition and cDNA recombination activity. Taken
together,
these data indicate that the central ORF from the
complementing
fragment was allelic with
nup124.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Isolation and sequence of the nup124 gene.
(A) Restriction fragment of the genomic sequence that complemented the
nup124-1 defect, with the locations of the ORFs indicated by
large arrows. The C-terminal sections of the ATP-dependent helicase and
the clathrin assembly protein are shown with shaded arrows, and the
nup124 ORF is shown with a black arrow. Also shown are the
positions of restriction sites including AvrII,
SnaBI, and SmaI, the sites used to disrupt the
nup124 ORF. (B) All strains were assayed for transposition
activity. The strains represented in the upper panel are as follows
(from left to right); wild type (wt) (YHL5533), nup124a
(YHL6106, a nup124-1 strain expressing the entire
complementing fragment, nup124b (YHL6061, a strain with an
empty vector, pSP1), nup124c (YHL6110, a strain with the
empty library vector pHL1288); a wild-type strain containing Tf1 PR fs
(YHL4990); and a wild-type strain containing Tf1 IN fs (YHL4992). The
strains in the top row of the lower panel are, from left to right, two
transformants of a wild-type strain with the complementing fragment
that contained the frameshift mutation at the AvrII site (YHL6404) and
two transformants of a strain with the nup124-1 mutation and
the plasmid with the complementing fragment and the frameshift mutation
at the AvrII site (YHL6406). The strains in the lower row of
the bottom panel are two transformants of a wild-type strain with the
plasmid copy of the complementing fragment that contained the
SnaBI-SmaI deletion (YHL6405) and two
transformants of a strain with the nup124-1 mutation and the
plasmid that contained the SnaBI-SmaI deletion
(YHL6407). (C) The strain with the nup124-1 allele was
transformed with an integrating plasmid containing the entire
complementing sequence. A stable transformant (YHL6136), shown to
contain an integration of the suppressor sequence into the
nup124-1 loci, was transformed with the Tf1-neoAI
plasmid pHL449 (YHL6620) and assayed for transposition (upper panel)
and recombination (lower panel). aTwo independent
transformants are shown. Also represented in both top and bottom
sections are (from left to right) strains with wild-type (wt) and
nup124-1 alleles (YHL1282 and YHL5754, respectively) and the
standard control strains consisting of Tf1 IN fs (YHL1554) and Tf1 PR
fs (YHL1836).
|
|
The predicted amino acid sequence encoded by
nup124 was
analyzed by TFASTA, and a low but measurable level of similarity to
several nuclear pore factors was found. Further examination of
the
alignments revealed that the nuclear pore factors all possessed
FXFG
motifs, and it was primarily these sequences that aligned
with
nup124. The predicted amino acid sequence of the
nup124 product
is shown in Fig.
4 and the positions of 11 repeats of FXFG
are
shown. The FXFG is one type of the FG repeat motifs found in
nuclear
pore factors (
65).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Amino acid sequence of the Nup124p (Q09904) protein as
predicted with annotation software that identified a small intron
marked here with an asterisk. The 11 FXFG repeats at the C-terminal end
are underlined. The mutation site of the nup124-1 allele is
indicated by a short vertical line before the Q where the codon CAG
coding for Q is mutated to a Stop codon, TAG.
|
|
The mutation in the nup124-1 allele introduced a stop
codon that truncated the protein between the second and third FXFG
repeats.
To determine the nature of the defect in the protein
expressed by nup124-1, we used PCR to produce four
overlapping regions of nup124, using as the template genomic
DNA from a strain of S. pombe that contained the
nup124-1 allele. Two independent PCR products of each region
were cloned and sequenced. The sequences of the cloned PCR products
were compared to the sequence of the wild-type nup124
isolated from the S. pombe library. A single-nucleotide substitution was found that converted codon 722 into a termination codon. The result of this nonsense mutation was predicted to remove 9 of the 11 FXFG repeats (Fig. 4). To test whether this single-nucleotide substitution was indeed the cause of the transposition defect, we
regenerated the mutation in the context of the original plasmid with
nup124, which complemented the genomic nup124-1
allele. We found that the single-nucleotide substitution did inactivate
the ability of the plasmid to complement the transposition defect caused by nup124-1 (results not shown).
Nup124p is a nuclear pore factor.
To test whether Nup124p was
a component of nuclear pores, we determined its cellular localization
by indirect-immunofluorescence microscopy. A double HA tag was fused to
the N terminus of nup124 as expressed from its own promoter
on the same plasmid that complemented the nup124-1 mutation.
The addition of the HA tag did not reduce the ability of
nup124 to complement the transposition or cDNA recombination
defects caused by nup124-1. Cells were fixed and prepared
for visualization with an anti-HA monoclonal antibody. The fluorescence
image showed punctate foci that encircled the position of the nucleus
as visualized by DAPI staining (Fig. 5). This signal was specific for the HA-tagged nup124 since the
control strain that contained the vector without HA-tagged
nup124 produced no fluorescence signal. The punctate
localization of HA-tagged Nup124p around the edge of the nucleus is
typical of the signals produced by antibodies that recognize nuclear
pore proteins.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Cellular location of Nup124p. Two strains, YHL965
(bottom, vector without nup124) and YHL6576 (top, plasmid
with HA-tagged nup124) were grown in EMM leu dropout
medium and prepared for immunofluorescence microscopy. The left two
panels show the FITC signal produced by the anti-HA antibody, and the
right two panels contain images of the DAPI signals.
|
|
Although the appearance of HA-Nup124p at the nuclear rim was consistent
with a localization at the NPCs, the resolution of
light microscopy did
not allow us to determine whether Nup124p
was specifically a component
of the NPCs. For this purpose, we
examined the localization of Nup124p
at high resolution by immunological
electron microscopy. We constructed
a strain that expressed GFP
fused to the C terminus of Nup124p. The
fusion protein was expressed
by the
nup124 promoter from its
genomic location. Figure
6 shows
a thin
section that was treated with the anti-GFP antibody and
goat
anti-rabbit immunoglobulin labeled with 10-nm-diameter colloidal
gold.
A significant number of the gold particles localized to
the nuclear
pore structures. The positions of gold particles on
21 sections were
examined. The density of gold particles directly
associated with
nuclear pore structures was determined, and the
average value was found
to be 24 gold particles per µm
2 of NPC surface. Compared
to the density of particles specifically
associated with nuclear pore
structures (252 gold particles; 24
particles/µm
3) the
gold particles were 18 times less likely to be found in
the nucleoplasm
(180 particles; 1.3 particles/µm
3) and 40-fold less
likely to be found in the cytoplasm (169 particles;
0.6 particle/µm
3). The large numbers of gold particles
associated with the nuclear
pore structures indicated that Nup124p is a
component of the NPC.

View larger version (128K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoelectron microscopy demonstrating the presence of
a Nup124-GFP fusion protein within nuclear pores. Strain YHL6876
expressed a single-copy allele of GFP fused to the end of Nup124p.
Cells were grown in EMM and processed for immunoelectron microscopy
with an antibody specific for GFP. (A) A thin section of a cell shows a
ring of reduced density that indicates the position of the nuclear
envelope. The dark structures embedded in the ring are the nuclear
pore. A high concentration of gold particles are associated with the
nuclear pores (arrows). The square indicated the region shown at higher
magnification in panel B. Bar, 1.0 µm. (B) The inset from panel A was
enlarged to allow inspection of the gold particles associated with two
nuclear pores. Bar, 0.1 µm.
|
|
The nup124-1 mutation reduced the nuclear localization
of Gag.
To pursue the possibility that the mutation in
nup124 reduced the nuclear localization of Tf1 complexes, we
surveyed Tf1 Gag and IN for their tendency to localize to the nucleus
of wild-type cells grown at 32°C, the same temperature used during
the transposition assays. Because levels of Gag are substantially
greater than those of IN, we found it much more reliable to monitor the
localization of Gag. A FLAG epitope was inserted near the C terminus of
Gag, and the resulting transposon, Tf1(FLAG)-neoAI,
possessed wild-type levels of transposition and homologous
recombination activity (data not shown). Wild-type cells that were
induced for the expression of Tf1(FLAG)-neoAI were grown to
saturation and prepared for immunofluorescence microscopy with the M2
anti-flag monoclonal antibody (Kodak). We found that the majority of
the wild-type cells produced a single strong focused signal (Fig.
7). The fluorescence image produced by
the anti-FLAG antibody was merged with an inverted black-and-white image of the nucleus generated by DAPI staining. The merged image showed that the majority of the FLAG-based signal was entirely overlapped by the nucleus. We found that the anti-FLAG signals were
specific for Tf1 since no signal was observed from cells that did not
include Tf1(FLAG)-neoAI (results not shown). In sharp contrast to the wild-type cells, the strain with the mutation in
nup124 showed almost no FLAG signal within the nucleus (Fig. 7). Table 4 contains a compilation of
localization data that includes 99 nuclei from wild-type cells and 79 nuclei from cells with the nup124-1 mutation. Only the
nuclei from cells that produced a FLAG signal were tabulated for
localization. These data indicate that Gag in the wild-type cells
localized to the nucleus while the mutation in nup124
reduced the number of nuclei with nuclear localization of Gag by
7.3-fold. Interestingly, the 7.3-fold drop was associated with a
4.6-fold increase in the number of nuclei that not only lacked Gag but
also appeared to be directly attached to aggregates of cytoplasmic Gag.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 7.
Immunofluorescence of Tf1 FLAG-Gag in wild-type cells.
(Top) Strain YHL5895 contained a wild-type allele of nup124
and the Tf1-neoAI FLAG-Gag plasmid, pHL1276. The green
signal is specific for the FLAG-Gag protein, and the blue signal is
produced by DAPI and indicates the position of the nucleus. The panel
on the right is a merge of the FLAG-Gag signal produced by YHL5895 with
an inverted black-and-white image of its DAPI stain. The merge was
generated with Adobe Photoshop 4.0 with the screen function set at 65%
opacity. (Bottom) Same experiment as in the top three panels, except
that strain YHL6565 (bottom) contained the nup124-1
allele.
|
|
The nup124-1 allele does not cause a general defect in
the function of the NPC.
One fundamental question about the
nuclear import of Tf1 Gag was how a mutation in a nuclear pore factor
could cause a significant defect in the import of a particular protein
without resulting in a general loss of import function and viability.
We tested whether cells with the nup124-1 allele had reduced
growth. The doubling time of these strains at 32°C was measured in
liquid cultures that contained EMM plus a complete mixture of
supplements. The nup124-1 mutation did not cause any
reduction in growth rate (results not shown). In addition, the colony
sizes of cells with the nup124-1 mutation were tested after
growth at 25, 32, and 37°C. The mutant cells formed the same-sized
colonies as the wild-type cells at all three temperatures (results not shown).
The wild-type growth rate of cells with the
nup124-1
mutation suggested that the mutation did not cause a defect in the bulk
import of proteins into the nucleus. To determine directly whether
nuclear import was altered, we asked whether the
nup124-1
allele
reduced the nuclear localization of specific proteins in cells
grown at 32°C. To test whether the mutation in
nup124-1
altered
the nuclear import of a substrate with a canonical monopartite
NLS, we monitored the cellular localization of a fusion protein
that
included the SV40 NLS, GFP, and

-galactosidase. Fluorescence
micrographs showed that the GFP fusion localized to the nuclei
of
wild-type cells (results not shown). This nuclear localization
was due
to the function of the SV40 NLS, since amino acid substitutions
in the
NLS resulted in a cytoplasmic localization. We found that
the cells
with the
nup124-1 allele showed the same localization
of the
GFP fusion protein in the nucleus as did the wild-type
cells (results
not shown). The effect of the
nup124-1 allele on
the nuclear
localization of the NLS-GFP-

-galactosidase was evaluated
for a large
number of nuclei, and this tabulation (Table
4) confirmed
the finding
that no change in nuclear localization resulted from
the
nup124-1 mutation.
To evaluate the effect of the
nup124-1 allele on the nuclear
localization of a protein with a bipartite NLS, we examined the
behavior of GFP fused to nucleoplasmin, a protein of
Xenopus
(
57).
In wild-type cells, GFP-nucleoplasmin localized to the
nucleus
(Table
4). This nuclear localization was dependent on the
function
of the nucleoplasmin NLS since amino acid substitutions in
this
sequence resulted in cytoplasmic localization (Table
4). In
addition
to causing a cytoplasmic localization, the altered
nucleoplasmin
NLS generated punctate fluorescence that may have
resulted from
aggregation (results not shown). The localization of
GFP-nucleoplasmin
in cells with the
nup124-1 mutation was
nuclear and appeared indistinguishable
from the pattern seen in
wild-type cells (Table
4). Here, too,
the nuclear localization in cells
with the
nup124-1 mutation was
dependent on the function of
the nucleoplasmin NLS. These data
clearly show that the
nup124-1 allele did not reduce the nuclear
localization of
GFP-nucleoplasmin.
In addition to alterations in the nuclear import of proteins, mutations
in proteins of the NPC reduce the nuclear export of
poly(A) mRNA. In
fact, mutations in several nuclear pore factors
of
S. cerevisiae cause obvious defects in the export of mRNA without
noticeably lowering the import of proteins (
65). We
therefore
tested the possibility that the
nup124-1 allele
generated a defect
in NPC function that could be observed as the
accumulation of
poly(A) mRNA in the nucleus. To visualize the
localization of
mRNA, cells grown at 32°C were fixed and treated with
deoxygenin-labeled
oligo(dT) and fluroescein isothiocyanate
(FITC)-conjugated anti-deoxygenin
antisera. Cells that contained the
nup124-1 mutation did not accumulate
poly(A) mRNA in the
nucleus and were indistinguishable from wild-type
cells (Table
4). As
an example of cells that do accumulate poly(A)
mRNA in the nucleus, we
included a strain with a mutation in the
nuclear pore protein Rae1p.
This
rae1-1 allele causes a defect
in the nuclear export of
poly(A) mRNA when cells are shifted to
the nonpermissive temperature of
35°C (
7,
68). Taken together,
the unaltered localizations
of poly(A) mRNA, SV40 NLS-GFP-LacZ,
and GFP-nucleoplasmin in cells with
the
nup124-1 allele indicated
that this mutation did not
cause a general defect in the transport
of material in and out of the
nucleus.
To ask whether the defect in
nup124 caused any gross
alteration in the positioning or distribution of the NPCs within the
nuclear envelope, we treated cells with the FXFG-specific antibody
MAb414 and examined them by immunofluorescence. Cells with the
nup124-1 allele showed a nuclear-rim pattern that was
typical
of proteins in the NPC, and this staining was indistinguishable
from the pattern observed for wild-type cells (results not
shown).
nup124 is not an essential gene.
To test whether
nup124 is required for viability, we deleted just the ORF of
nup124 from one allele of a diploid strain and replaced it
with the his3 gene. The structure and position of the
deletion were confirmed by using DNA blots that were probed separately
with his3 and nup124 sequences. Each of 48 tetrads produced two viable spores and two dead spores (results not
shown). Although this result suggested that nup124 was
essential for viability, we tested the possibility that Nup124p protein
was important only for spore germination and not for vegetative growth.
The diploid that contained a deletion in one allele of
nup124 was transformed with a plasmid that contained a
wild-type copy of nup124. Spores derived from this strain
were germinated on medium that required the presence of the plasmid for
growth. Among the resulting colonies were haploid cells that contained
the chromosomal deletion of nup124 but retained the copy of
nup124 in the plasmid. Subsequent growth on rich medium
demonstrated that cells possessed viability even after loss of the
plasmid that carried the only remaining copy of nup124
(results not shown). The absence of nup124 coding sequence
in this strain was verified by DNA blot analysis (results not shown).
These results indicated that nup124 is not required for
vegetative growth and, as a result, may be important for spore germination.
Nup124p interacts directly with Tf1 Gag.
The possibility
existed that the nup124-1 allele did not directly cause the
defect in nuclear localization of Gag but instead caused a reduction in
import of another protein that, in turn, was required for Gag import.
However, the following observation suggested that Nup124p contributed
directly to the nuclear localization of Gag. We noted that the
nup124-1 allele caused a substantial reduction in colony
size in cells that were subjected to multiple cycles of Tf1 induction
(results not shown). A single cycle of growth on induction medium, as
was typical of the transposition assay, did not result in a reduction
in growth or viability. This genetic interaction of Tf1 expression with
the defect in Nup124p may have resulted from the overaccumulation of
Gag and its association with Nup124p. Additional experiments were
developed to test directly for an interaction between Gag and Nup124p.
We used the two-hybrid system of
S. cerevisiae to identify
sequences within Nup124p that may interact with Gag. The coding
sequence of
nup124 was divided into six segments that were
individually
fused to the DNA BD of LexA. The Gag protein was fused to
a transcriptional
AD, B42 and tested for interactions with each of the
six segments
of Nup124p (Fig.
8A). Segments 2 and 3 of
nup124 interacted strongly
with Gag, as indicated by
expression of a reporter gene that allowed
growth on medium lacking
leucine (Fig.
8B). In addition, segments
5 and 6 showed weak
interaction with Gag. All the interactions
observed were specific in
that they required the expression of
both fusion proteins and that the
fusion proteins include the
Nup124p and Gag sequences.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 8.
Analysis of interactions between Gag and Nup124p. (A)
Segments 1 through 6 of Nup124p correspond to the following amino acids
of Nup124p: 1, 1 to 91; 2, 92 to 306; 3, 307 to 521; 4, 522 to 736; 5, 737 to 951; 6, 952 to 1152. Corresponding nucleotide sequence were
fused to the transcription activation domain B42. Numbers above and
below the arrowheads indicate the primers used to generate the PCR
products that were inserted into the two-hybrid vectors. (B) Summary of
two-hybrid interactions between segments 1 to 6 of Nup124p expressed as
fusions to the LexA binding domain and the Tf1 Gag expressed as a
fusion to the B42 activation domain. Potential interactions were scored
as growth on SC medium containing galactose and lacking leucine. All
fusions were tested for intrinsic or nonspecific activation. The AD
plasmids were cotransformed with LexA fused to the Bicoid protein to
test for specificity of interaction with each of the BD fusions, while
all the BD plasmids were cotransformed with an empty AD to test for
intrinsic activation. The BD fusion with the Gag protein resulted in
significant intrinsic activation and therefore could not be used in
this study. All other fusions used did not intrinsically or
nonspecifically activate expression of the LEU2 reporter.
Additionally, a positive control was used in these two-hybrid
experiments based on the strong interaction of murine p53 and SV40
large T antigen. Plasmids containing p53 fused to LexA and SV40 large T
antigen fused to B42 (Clontech) were cotransformed into EGY48 and
tested for growth on medium lacking leucine. Strains containing these
fusion proteins showed visible growth in approximately 1 to 2 days. (C)
GST precipitation analysis of interactions between purified samples of
Gag and two portions of Nup124p. The N-terminal and C-terminal portions
of Nup124p as well as GST and GST-Gag were purified from bacteria. The
GST and GST-Gag proteins were coupled to glutathione-Sepharose and combined
with either the C-terminal or N-terminal fragments of Nup124p. The
samples were incubated at room temperature for 45 min and washed three
times in binding buffer. The beads and the supernatant were combined
with 2× sample-loading buffer and loaded in equal proportions onto an
SDS-10% polyacrylamide gel that was stained with Coomassie blue. The
brackets over S and P indicate the pairs of supernatant and pellet
fractions from separate binding reactions. The components of each
binding reaction are indicated by plus signs above each bracket. The
positions of molecular mass standards are indicated on the left of the
panel.
|
|
The results of the two-hybrid analysis indicated that Gag may interact
with segments of
nup124. However, it was possible that
the
interaction was mediated by additional factors. We asked whether
Gag
could interact directly with regions of
nup124 by expressing
the proteins in bacteria as GST fusions and subjecting them to
precipitation analysis. An N-terminal domain (segments 2 and 3)
and a
C-terminal domain (segments 4 to 6) of Nup124p, as well
as the intact
Gag, were fused to the C terminus of GST and expressed
in bacteria. All
three fusion proteins were purified from bacterial
extracts by using
glutathione-Sepharose, and the GST domains were
cleaved off the two
segments of Nup124p. Gag bound to the Sepharose
beads was mixed
separately with the N-terminal and C-terminal
domains of Nup124p, and
after an incubation of 45 min, the beads
were pelleted and washed.
Figure
8C shows that a fraction of the
N-terminal domain of Nup124p did
pellet with GST-Gag but not with
GST alone attached to beads. This
direct interaction was specific
in that the C-terminal domain of
Nup124p did not precipitate with
the GST-Gag. The coprecipitation of
Gag with segments 2 and 3
of Nup124p coincided with the observation
that the strongest interaction
detected by two-hybrid analysis was
between Gag and segments 2
and 3 of
Nup124p.
 |
DISCUSSION |
Nup124p is a nuclear pore factor required for nuclear localization
of Tf1.
The nup124 gene was predicted to encode a
protein of 124 kDa with 11 copies of the FXFG repeats in a family of
nuclear pore factors. BLAST-based alignments confirmed that Nup124p was
most closely related to a large class of nuclear pore factors that possess variable numbers and arrangements of FXFG repeats. The nuclear
pore proteins with FXFG repeats encoded in the genome of S. cerevisiae include Nup1p, Nup2p, Nsp1p, and Nup159p. Some mammalian nuclear pore factors with FXFG repeats are Nup153p, Nup358p,
Nup62, and Nup214p. The results of in vitro binding experiments led to
the current model that the FXFG repeats of the factors in the NPC serve
as docking sites for karyopherin proteins associated with transport
cargo (1, 56, 59, 71). A related class of nuclear pore
proteins possesses repeats of GLFG and also participates in nuclear
transport. Members of this class of factors bind karyopherin complexes
in vitro and appear to participate in nuclear export (65).
That
nup124 encoded a component of the NPC was indicated by
the nuclear-rim signal produced by the HA-Nup124p protein in
immunolocalization
experiments and by the results of immunoelectron
microscopy studies.
The identification of Nup124p as a nuclear pore
factor supports
the evidence that
nup124-1 caused a defect
in the transport of
FLAG-Gag to the nucleus. The immunofluorescence of
cells treated
with anti-FLAG antibodies revealed that the
nup124-1 allele caused
a 7.3-fold drop in the number of
nuclei with high levels of FLAG-Gag.
The drop in the number of nuclei
with significant concentrations
of FLAG-Gag correlated well with the
4.6-fold increase in the
number of cells with large aggregates of
FLAG-Gag attached to
the outside of the nuclear
envelope.
Although we have no direct evidence that the nuclear import of Gag is
required for transposition, the presence of Gag in the
nucleus supports
this possibility. The capsid proteins of many
viruses form complexes
with viral RNA or DNA that are imported
into the nucleus. For example,
the matrix protein of HIV is a
component of the preintegration complex
and possesses NLS activity
that may contribute to the infectivity of
nondividing cells (
9,
18,
19). The behavior of Tf1 proteins
in sucrose gradients
indicated that in cells grown to stationary phase,
the bulk of
Gag and IN are coassembled into VLPs that also contain cDNA
(
40).
Therefore, the results of the sucrose gradient
fractionation and
the immunolocalization of Gag indicate that these
components are
probably present together in the nucleus as VLPs.
Unfortunately,
we have been unable, by immunofluorescence microscopy,
to detect
Tf1 IN in wild-type cells that were grown to stationary
phase.
The level of IN in stationary-phase cells is very low due to a
regulated degradation process that lowers the amount of IN by
more than
20-fold (
3). The results of the cDNA recombination
assays
indicated that the
nup124-1 mutation also disrupted the
nuclear import of the Tf1 reverse transcripts. If the cDNA is
imported
into the nucleus as a component of the preintegration
complex, as
suggested above, the mislocalization of this complex
could greatly
reduce the potential for homologous recombination
between cDNA and
plasmid sequences of
Tf1.
The nuclear import of Tf1 is specifically inhibited by the
nup124-1 allele.
Because most proteins larger than 40 kDa are thought to require active transport through the NPC before they
can accumulate in the nucleus, we expected that a mutation in an
individual pore factor could lead to defects in the import of many
cellular proteins. Nevertheless, the wild-type growth of strains with
the nup124-1 allele indicated that the bulk of nuclear
import was unaffected by the mutation. We also examined the nuclear
import of two proteins that possessed two different types of NLSs. We
found that the nup124-1 mutation did not reduce the nuclear
localization of SV40 NLS-GFP-LacZ or GFP-nucleoplasmin. These result
indicated that the karyopherin functions required for the transport of
proteins with classical or bipartite NLSs were unaffected by the
nup124-1 allele.
Two other properties of the NPC that were investigated were the ability
to export poly(A) mRNA and the distribution of the
NPCs within the
nuclear envelope. These characteristics were examined
in cells with the
nup124-1 mutation, because a number of strains
of
S. cerevisiae with defects in nuclear pore proteins show increased
levels of poly(A) mRNA in the nucleus as well as clustering of
NPCs in
the nuclear envelope (
6,
14,
22,
27,
42,
63,
64). The
observation that the
nup124-1 mutation did not visibly
alter
the export of mRNA from the nucleus or the gross distribution
of the
NPCs in the nuclear envelope provided further evidence
that this
mutation did not reduce the ability of the pore complexes
to transport
material in and out of the nucleus. In addition,
these results indicate
that Nup124p possesses an activity required
for the nuclear import of
Tf1 that does not appear to be required
for the overall function of the
NPCs.
The defect in the transport of Tf1 material might not have been
directly due to a lack of Nup124p function but, instead, might
have
been caused by the mislocalization of another protein that
contributed
to Tf1 import. The results of two-hybrid analysis
revealed strong
interactions between Gag and amino acid residues
92 to 521 of Nup124p
(Fig.
8). These results correlated well with
results of experiments
that showed that, as purified proteins
from bacteria, the
N-terminal half of Nup124p bound and coprecipitated
with Gag fused to
GST. The detection of this interaction by direct
binding in vitro and
by two-hybrid analysis in vivo suggested
that Nup124p contributes
directly to the nuclear import of
Gag.
The mutation in the
nup124-1 allele was found to be a
nonsense mutation that shortened the ORF by 32% and as a result
removed
9 of the 11 copies of the FXFG repeats. Therefore, the
nup124-1 mutation left intact the coding sequence for the
portion of the
protein that interacted with Gag in the two-hybrid and
GST precipitation
analyses. The presence of the interaction domain in
the defective
form of Nup124-1 suggests that the drop in the nuclear
localization
of Gag due to the mutation in
nup124-1 was not
the result of reduced
binding of Gag caused by an altered conformation
of the binding
surface of Nup124p. The accumulation of Gag outside the
nucleus
in cells with the
nup124-1 allele suggests the
possibility that
the N-terminal domain of Nup124p was present in the
NPC and bound
Gag, but the absence of the C-terminal portion of Nup124p
may
have inhibited the release of Gag and its subsequent import.
Alternatively,
the C-terminal domain of Nup124p may contribute to the
binding
of Gag, and although this interaction was not detected by our
binding assays, it may be important for binding in vivo. Another
possibility is that the truncation of Nup124p caused a change
in the
localization of the protein. For example, the C-terminal
truncation of
Nup124p may remove structures necessary for its
interaction with the
NPC. As a result, Gag would not be able to
complete its process of
nuclear
import.
If FXFG domains play an important role in docking the substrates of
nuclear transport, why did the
nup124-1 mutation block
the
nuclear import of Gag but not of other proteins? The answer
to the
specificity of the import defect may lie in the interaction
between Tf1
Gag and Nup124p. This particular interaction may play
a central role in
the docking of Tf1 VLPs to the NPC. The import
of cellular proteins may
not require interactions with specific
nuclear pore proteins, but
instead, may occur via proteins with
redundant function. Evidence that
FXFG and GLFG motifs possess
redundant functions exists for Nsp1p (FXFG
protein), Nup49p (GLFG
protein), Nup57p (GLFG protein), and Nup145p
(GLFG protein) of
S. cerevisiae. Although all four of these
proteins are essential
for viability (
23,
50,
66,
69),
deletion of the FXFG or
GLGF repeats in these proteins does not reduce
viability (
23,
29,
50,
63,
66). As a result of these
observations, the
essential functions that mapped to the nonrepeat
portions of the
pore proteins are thought to be
structural.
We propose that Tf1 evolved an import strategy that relies on a
specific interaction between Gag and the N terminus of Nup124p.
We
predict that the interaction between Gag and Nup124p is required
for
import of Gag. Future experiments will be conducted to test
the impact
of mutations in the N-terminal domain of Nup124p on
the localization of
Gag in the
nucleus.
Although little is known about the nuclear pore proteins that are
directly responsible for the import of large viral complexes,
recent
results indicate that the Vpr protein of HIV-1 plays a
unique role in
the nuclear import of the HIV-1 proteins (
16,
30,
54,
61).
Although the matrix (MA) and IN proteins of
HIV carry conventional NLSs
and probably use the karyopherin

/
pathway for nuclear import
(
17,
18), Vpr has karyophilic properties
that contribute
significantly to the HIV infection of nondividing
cells (
18,
61). Vpr localizes at the nuclear envelope of yeast
and human
cells, and this behavior is thought to lead to the import
of
preintegration complexes (
16,
61). Evidence for this model
includes the finding that Vpr is a component of the preintegration
complex and that Vpr also interacts with FXFG repeat nucleoporins
(
19,
28,
61). Recently, Vpr was found to interact directly
with Pom121, a nuclear pore factor that contains FXFG repeats
(
16). This result suggests that Vpr may contribute to the
import
of HIV preintegration complex by causing a direct interaction
between the preintegration complex and FXFG-containing proteins
in the
NPC. Consistent with this model is the finding that Vpr
uses an import
pathway distinct from classical NLS or M9 substrates
(
30).
This specialized role of Vpr in the nuclear import of
HIV is
surprisingly similar to the importance of
nup124 for the
import of Tf1 Gag and suggests that large viral complexes may
require
direct contacts with FXFG proteins to successfully navigate
through the
NPC. Nevertheless, our result that the nuclear import
of a VLP can be
inhibited without affecting the import of other
proteins suggests that
the reduction of nuclear import may prove
to be an effective strategy
for antiviral
therapies.
 |
ACKNOWLEDGMENTS |
Portions of this work was supported by National Institutes of
Health grant RR-0592 to J. Richard McIntosh.
Cindy Troxell and Richard McIntosh kindly provided pCS2pkSu before
publication. We thank Shelley Sazer and Susan Forsburg for many helpful
suggestions. We are grateful to Ravi Dhar and William Whalen for
providing the strain with the rae1-1 allele and for guidance
with the analysis of poly(A) mRNA. Sally Pasion and Susan Forsburg
generously provided SV40-NLS-GFP-lacZ plasmids in advance of
publication. We also thank Mary Dasso for reading the manuscript and
providing helpful suggestions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Eukaryotic Gene Regulation, National Institute of Child Health and
Human Development, NIH, Bethesda, MD 20892. Phone: (301) 402-4281. Fax: (301) 496-8576. E-mail: Henry_Levin{at}nih.gov.
 |
REFERENCES |
| 1.
|
Aitchison, J. D.,
G. Blobel, and M. P. Route.
1996.
Kap104p: a karyopherin involved in the nuclear transport of messenger RNA binding proteins.
Science
274:624-627[Abstract/Free Full Text].
|
| 2.
|
Atwood, A.,
J. Choi, and H. L. Levin.
1998.
The application of a homologous recombination assay revealed amino acid residues in a long terminal repeat retrotransposon that were critical for integration.
J. Virol.
72:1324-1333[Abstract/Free Full Text].
|
| 3.
|
Atwood, A.,
J. Lin, and H. Levin.
1996.
The retrotransposon Tf1 assembles virus-like particles with excess Gag relative to integrase because of a regulated degradation process.
Mol. Cell. Biol.
16:338-346[Abstract].
|
| 4.
|
Azad, A. K.,
T. Tani,
N. Shiki,
S. Tsuneyoshi,
S. Urushiyama, and Y. Ohshima.
1997.
Isolation and molecular characterization of mRNA transport mutants in Schizosaccharomyces pombe.
Mol. Biol. Cell
8:825-841[Abstract].
|
| 5.
|
Berkower, C.,
D. Loayza, and S. Michaelis.
1994.
Metabolic instability and constitutive endocytosis of STE6, the a-factor transporter of Saccharomyces cerevisiae.
Mol. Biol. Cell
5:1185-1198[Abstract].
|
| 6.
|
Bogerd, A. M.,
J. A. Hoffman,
D. C. Amberg,
G. R. Fink, and L. I. Davis.
1994.
nup1 mutants exhibit pleiotropic defects in nuclear pore complex function.
J. Cell Biol.
127:319-332[Abstract/Free Full Text].
|
| 7.
|
Brown, J. A.,
A. Bharathi,
A. Ghosh,
W. Whalen,
E. Fitzgerald, and R. Dhar.
1995.
A mutation in the Schizosaccharomyces pombe rae1 gene causes defects in poly(A)+ RNA export and in the cytoskeleton.
J. Biol. Chem.
270:7411-7419[Abstract/Free Full Text].
|
| 8.
|
Bukrinsky, M. I.,
S. Haggerty,
M. P. Demsey,
N. Sharova,
A. Adzhubel,
L. Spitz,
P. Lewis,
D. Goldfarb,
M. Emerman, and M. Stevenson.
1993.
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells.
Nature
365:666-669[Medline].
|
| 9.
|
Bukrinsky, M. I.,
N. Sharova,
T. L. McDonald,
T. Pushkarskaya,
W. G. Tarpley, and M. Stevenson.
1993.
Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection.
Proc. Natl. Acad. Sci. USA
90:6125-6129[Abstract/Free Full Text].
|
| 10.
|
Cottarel, G.,
D. Beach, and U. Deuschle.
1993.
Two new multi-purpose multicopy Schizosaccharomyces pombe shuttle vectors, pSP1 and pSP2.
Curr. Genet.
23:547-548[Medline].
|
| 11.
|
Dang, V. D.,
M. J. Benedik,
K. Ekwall,
J. Choi,
R. C. Allshire, and H. L. Levin.
1999.
A new member of the sin3 family of corepressors is essential for cell viability and required for retroelement propagation in fission yeast.
Mol. Cell. Biol.
19:2351-2365[Abstract/Free Full Text].
|
| 12.
|
Ding, R.,
R. R. West,
D. M. Morphew,
B. R. Oakley, and J. R. McIntosh.
1997.
The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds.
Mol. Biol. Cell
8:1461-1479[Abstract].
|
| 13.
|
Doye, V., and E. Hurt.
1997.
From nucleoporins to nuclear pore complexes.
Curr. Opin. Cell Biol.
9:401-411[Medline].
|
| 14.
|
Fabre, E.,
W. C. Boelens,
C. Wimmer,
I. W. Mattaj, and E. C. Hurt.
1994.
Nup145p is required for nuclear export of mRNA and binds homopolymeric RNA in vitro via a novel conserved motif.
Cell
78:275-289[Medline].
|
| 15.
|
Feldherr, C. M.,
E. Kallenback, and N. Schulz.
1984.
Movement of a karyophilic protein through the nuclear pores of oocytes.
J. Cell Biol.
99:2216-2222[Abstract/Free Full Text].
|
| 16.
|
Fouchier, R.,
B. Meyer,
J. Simon,
U. Fischer,
A. Albright,
F. González-Scarano, and M. Malim.
1998.
Interaction of the human immunodeficiency virus type 1 Vpr protein with the nuclear pore complex.
J. Virology
72:6004-6013[Abstract/Free Full Text].
|
| 17.
|
Gallay, P.,
T. Hope,
D. Chin, and D. Trono.
1997.
HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway.
Proc. Natl. Acad. Sci. USA
94:9825-9830[Abstract/Free Full Text].
|
| 18.
|
Gallay, P.,
V. Stitt,
C. Mundy,
M. Oettinger, and D. Trono.
1996.
Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import.
J. Virol.
70:1027-1032[Abstract].
|
| 19.
|
Gallay, P.,
S. Swingler,
J. Song,
F. Bushman, and D. Trono.
1995.
HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase.
Cell
83:569-576[Medline].
|
| 20.
|
Golemis, E.,
J. Gyuris, and R. Brent (ed.).
1996.
Interaction trap/two-hybrid system to identify interacting proteins.
John Wiley & Sons, Inc., New York, N.Y.
|
| 21.
|
Gorlich, D.
1997.
Nuclear protein import.
Curr. Opin. Cell Biol.
9:412-419[Medline].
|
| 22.
|
Gorsch, L. C.,
T. C. Dockendorff, and C. N. Cole.
1995.
A conditional allele of the novel repeat-containing yeast nucleoporin RAT7/NUP159 causes both rapid cessation of mRNA export and reversible clustering of nuclear pore complexes.
J. Cell. Biol.
129:939-955[Abstract/Free Full Text].
|
| 23.
|
Grandi, P.,
N. Schlaich,
H. Tekotte, and E. C. Hurt.
1995.
Functional interaction of Nic96p with a core nucleoporin complex consisting of Nsp1p, Nup49p and a novel protein Nup57p.
EMBO J.
14:76-87[Medline].
|
| 24.
|
Greber, U. F., and H. Kasamatsu.
1996.
Nuclear targeting of SV40 and adenovirus.
Trends Cell Biol.
6:189-195.
[Medline] |
| 25.
|
Greber, U. F.,
M. Suomalainen,
R. P. Stidwell,
K. Boucke,
M. W. Ebersold, and A. Helenius.
1997.
The role of the nuclear pore complex in adenovirus DNA entry.
EMBO J.
16:5998-6007[Medline].
|
| 26.
|
Gyuris, J.,
E. Golmis,
H. Chertkov, and R. Brent.
1993.
Cdi1, a human G1- and S-phase protein phosphatase that associates with Cdk2.
Cell
75:791-803[Medline].
|
| 27.
|
Heath, C. V.,
C. S. Copeland,
D. C. Amberg,
V. Del Priore,
M. Snyder, and C. N. Cole.
1995.
Nuclear pore complex clustering and nuclear accumulation of poly(A)+ RNA associated with mutation of the Saccharomyces cerevisiae RAT2/NUP120 gene.
J. Cell Biol.
131:1677-1697[Abstract/Free Full Text].
|
| 28.
|
Heinzinger, N. K.,
M. I. Bukinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M. A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 29.
|
Iovine, M. K.,
J. L. Watkins, and S. R. Wente.
1995.
The GLFG repetitive region of the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import factor.
J. Cell Biol.
131:1699-1713[Abstract/Free Full Text].
|
| 30.
|
Jenkins, Y.,
M. McEntee,
K. Weis, and W. C. Greene.
1998.
Characterization of HIV-1 vpr nuclear import: analysis of signals and pathways J.
Cell Biol.
143:875-885.
|
| 31.
|
Joyce, C. M., and N. Grindley.
1984.
Method for determining whether a gene of Escherichia coli is essential: application to the polA gene.
J. Bacteriol.
158:636-643[Abstract/Free Full Text].
|
| 32.
|
Keeney, J. B, and J. D. Boeke.
1994.
Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe.
Genetics
136:849-856[Abstract].
|
| 33.
|
Kenna, M. A.,
C. B. Brachmann,
S. E. Devine, and J. D. Boeke.
1998.
Invading the yeast nucleus: a nuclear localization signal at the C terminus of Ty1 integrase is required for transposition in vivo.
Mol. Cell. Biol.
18:1115-1124[Abstract/Free Full Text].
|
| 34.
|
Kukolj, G.,
K. S. Jones, and A. M. Skalka.
1997.
Subcellular localization of avian sarcoma virus and human immunodeficiency virus type 1 integrases.
J. Virol.
71:843-847[Abstract].
|
| 35.
|
Kukolj, G.,
R. A. Katz, and A. M. Skalka.
1998.
Characterization of the nuclear localization signal in the avian sarcoma virus integrase.
Gene
223:157-163[Medline].
|
| 36.
|
Levin, H. L.
1997.
It's prime for reverse transcriptase.
Cell
88:5-8[Medline].
|
| 37.
|
Levin, H. L.
1995.
A novel mechanism of self-primed reverse transcription defines a new family of retroelements.
Mol. Cell. Biol.
15:3310-3317[Abstract].
|
| 38.
|
Levin, H. L.
1996.
An unusual mechanism of self-primed reverse transcription requires the RNase H domain of reverse transcriptase to cleave an RNA duplex.
Mol. Cell. Biol.
16:5645-5654[Abstract].
|
| 39.
|
Levin, H. L., and J. D. Boeke.
1992.
Demonstration of retrotransposition of the Tf1 element in fission yeast.
EMBO J.
11:1145-1153[Medline].
|
| 40.
|
Levin, H. L.,
D. C. Weaver, and J. D. Boeke.
1993.
Novel gene expression mechanism in a fission yeast retroelement: Tf1 proteins are derived from a single primary translation product.
EMBO J.
12:4885-4895[Medline]. (Erratum, 13:1494, 1994.)
|
| 41.
|
Levin, H. L.,
D. C. Weaver, and J. D. Boeke.
1990.
Two related families of retrotransposons from Schizosaccharomyces pombe.
Mol. Cell. Biol.
10:6791-6798[Abstract/Free Full Text].
|
| 42.
|
Li, O.,
C. V. Heath,
D. C. Amberg,
T. C. Dockendorff,
C. S. Copeland,
M. Snyder, and C. N. Cole.
1995.
Mutation or deletion of the Saccharomyces cerevisiae RAT3/NUP133 gene causes temperature-dependent nuclear accumulation of poly(A)+ RNA and constitutive clustering of nuclear pore complex.
Mol. Biol. Cell
6:401-417[Abstract].
|
| 43.
|
Lin, J. H., and H. L. Levin.
1997.
A complex structure in the mRNA of Tf1 is recognized and cleaved to generate the primer of reverse transcription.
Genes Dev.
11:270-285[Abstract/Free Full Text].
|
| 44.
|
Losson, R., and F. Lacroute.
1983.
Plasmids carrying the yeast OMP decarboxylase structural and regulatory genes: transcription regulation in a foreign environment.
Cell
32:371-377[Medline].
|
| 45.
|
Maundrell, K.
1993.
Thiamine-repressible expression vector pREP and pRIP for fission yeast.
Gene
123:127-130[Medline].
|
| 46.
|
Mehlin, H.,
B. Dandeholt, and U. Skoglund.
1992.
Translocation of a specific premessenger ribonucleoprotein particle through the nuclear pore studied with electron microscope tomography.
Cell
69:605-613[Medline].
|
| 47.
|
Moore, S. P.,
L. A. Rinckel, and D. J. Garfinkel.
1998.
A Ty1 integrase nuclear localization signal required for retrotransposition.
Mol. Cell. Biol.
18:1105-1114[Abstract/Free Full Text].
|
| 48.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
194:795-823[Medline].
|
| 49.
|
Nakanishi, A.,
J. Clever,
M. Yamada,
P. P. Li, and H. Kasamatsu.
1996.
Association with capsid proteins promotes nuclear targeting of simian virus 40 DNA.
Proc. Natl. Acad. Sci. USA
93:96-100[Abstract/Free Full Text].
|
| 50.
|
Nehrbass, U.,
H. Kern,
A. Mutvei,
H. Horstmann,
B. Marshallsay, and E. C. Hurt.
1990.
NSP1: a yeast nuclear envelope protein localized at the nuclear pores exerts its essential function by its carboxy-terminal domain.
Cell
61:979-989[Medline].
|
| 51.
|
Nigg, E. A.
1997.
Nucleoplasmic transport: signals, mechanisms and regulation.
Nature
386:779-787[Medline].
|
| 52.
|
Ohi, R.,
A. Feoktistova, and K. L. Gould.
1996.
Construction of vectors and a genomic library for use with his3-deficient strains of Schizosaccharomyces pombe.
Gene
174:315-318[Medline].
|
| 53.
|
Ohno, M.,
M. Fornerod, and I. W. Mattaj.
1998.
Nucleocytoplasmic transport: the last 200 nanometers.
Cell
92:327-336[Medline].
|
| 54.
|
Popov, S.,
M. Rexach,
G. Zybarth,
N. Reiling,
M. A. Lee,
L. Ratner,
C. M. Lane,
M. S. Moore,
G. Blobel, and M. Burkrinsky.
1998.
Viral protein R regulates nuclear import of the HIV-1 pre-integration complex.
EMBO J.
17:909-917[Medline].
|
| 55.
|
Reichelt, R.,
A. Holzenburg,
E. L. Buhle,
M. Jarnik,
A. Engel, and U. Aebi.
1990.
Correlation between structure and mass distribution of the nuclear pore complex and of distinct pore complex components.
J. Cell Biol.
110:883[Abstract/Free Full Text].
|
| 56.
|
Rexach, M., and G. Blobel.
1995.
Protein import into nuclei: association and dissociation reactions involving transport substrate, transport factors, and nucleoporins.
Cell
83:683-692[Medline].
|
| 57.
|
Robbins, J.,
S. M. Dilworth,
R. A. Laskey, and C. Dingwall.
1991.
Two interdependent basic domains in nucleoplasmin nuclear targeting.
Cell
64:615-623[Medline].
|
| 58.
|
Rout, M. P., and G. Blobel.
1993.
Isolation of the yeast nuclear pore complex.
J. Cell Biol.
123:771-783[Abstract/Free Full Text].
|
| 59.
|
Rout, M. P.,
G. Blobel, and J. D. Aitchison.
1997.
A distinct nuclear import pathway used in ribosomal proteins.
Cell
89:715-725[Medline].
|
| 60.
|
Stevenson, M.
1996.
Portals of entry: uncovering HIV transport pathways.
Trends Cell Biol.
6:9-15.
|
| 61.
|
Vodicka, M. A.,
D. M. Koepp,
P. A. Silver, and M. Emerman.
1998.
HIV-1 Vpr interacts with the nuclear transport pathway to promote macrophage infection.
Genes Dev.
12:175-185[Abstract/Free Full Text].
|
| 62.
|
von Schwedler, U.,
R. S. Kornbluth, and D. Trono.
1994.
The nuclear localization signal of the matrix protein of human immunodeficiency virus type 1 allows the establishment of infection in macrophages and quiescent T lymphocytes.
Proc. Natl. Acad. Sci. USA
91:6992-6996[Abstract/Free Full Text].
|
| 63.
|
Wente, S. R., and G. Blobel.
1994.
NUP145 encodes a novel yeast glycine-leucine-phenylalanine-glycine (GLFG) nucleoporin required for nuclear envelope structure.
J. Cell Biol.
125:955-969[Abstract/Free Full Text].
|
| 64.
|
Wente, S. R., and G. Blobel.
1993.
A temperature-sensitive NUP116 null mutant forms a nuclear envelope seal over the yeast nuclear pore complex thereby blocking nucleocytoplasmic traffic.
J. Cell Biol.
123:275-284[Abstract/Free Full Text].
|
| 65.
|
Wente, S. R.,
S. M. Gasser, and A. J. Caplan.
1997.
The nucleus and nucleocytoplasmic transport in Saccharomyces cerevisiae, p. 471-546.
In
J. Pringle, J. Broach, and E. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 66.
|
Wente, S. R.,
M. P. Rout, and G. Blobel.
1992.
A new family of yeast nuclear pore complex proteins.
J. Cell Biol.
119:705-723[Abstract/Free Full Text].
|
| 67.
|
West, R. R.,
E. V. Vaisberg,
R. Ding,
P. Nurse, and J. R. McIntosh.
1998.
cut11(+): A gene required for cell cycle-dependent spindle pole body anchoring in the nuclear envelope and bipolar spindle formation in Schizosaccharomyces pombe.
Mol. Biol. Cell
9:2839-2855[Abstract/Free Full Text].
|
| 68.
|
Whalen, W. A.,
A. Bharathi,
D. Danielewicz, and R. Dhar.
1997.
Advancement through mitosis require rae1 gene function in fission yeast.
Yeast
13:1167-1179[Medline].
|
| 69.
|
Wimmer, C.,
V. Doye,
P. Grandi,
U. Nehrbass, and E. C. Hurt.
1992.
A new subclass of nucleoporins that functionally interact with nuclear pore protein NSP1.
EMBO J.
11:5051-5061[Medline].
|
| 70.
|
Yamada, M., and H. Kasamatsu.
1993.
Role of nuclear pore complex in simian virus 40 nuclear targeting.
J. Virol.
67:119-130[Abstract/Free Full Text].
|
| 71.
|
Yaseen, N. R., and G. Blobel.
1997.
Cloning and characterization of human karyopherin beta3.
Proc. Natl. Acad. Sci. USA
94:4451-4456[Abstract/Free Full Text].
|
Molecular and Cellular Biology, August 1999, p. 5768-5784, Vol. 19, No. 8
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Beliakova-Bethell, N., Terry, L. J., Bilanchone, V., DaSilva, R., Nagashima, K., Wente, S. R., Sandmeyer, S.
(2009). Ty3 Nuclear Entry Is Initiated by Viruslike Particle Docking on GLFG Nucleoporins. J. Virol.
83: 11914-11925
[Abstract]
[Full Text]
-
Low, C. P., Shui, G., Liew, L. P., Buttner, S., Madeo, F., Dawes, I. W., Wenk, M. R., Yang, H.
(2008). Caspase-dependent and -independent lipotoxic cell-death pathways in fission yeast. J. Cell Sci.
121: 2671-2684
[Abstract]
[Full Text]
-
Sistla, S., Pang, J. V., Wang, C. X., Balasundaram, D.
(2007). Multiple Conserved Domains of the Nucleoporin Nup124p and Its Orthologs Nup1p and Nup153 Are Critical for Nuclear Import and Activity of the Fission Yeast Tf1 Retrotransposon. Mol. Biol. Cell
18: 3692-3708
[Abstract]
[Full Text]
-
Levesque, L., Bor, Y.-C., Matzat, L. H., Jin, L., Berberoglu, S., Rekosh, D., Hammarskjold, M.-L., Paschal, B. M.
(2006). Mutations in Tap Uncouple RNA Export Activity from Translocation through the Nuclear Pore Complex. Mol. Biol. Cell
17: 931-943
[Abstract]
[Full Text]
-
Du, X., Rao, M. R.K. S., Chen, X. Q., Wu, W., Mahalingam, S., Balasundaram, D.
(2006). The Homologous Putative GTPases Grn1p from Fission Yeast and the Human GNL3L Are Required for Growth and Play a Role in Processing of Nucleolar Pre-rRNA. Mol. Biol. Cell
17: 460-474
[Abstract]
[Full Text]
-
Kim, M.-K., Claiborn, K. C., Levin, H. L.
(2005). The Long Terminal Repeat-Containing Retrotransposon Tf1 Possesses Amino Acids in Gag That Regulate Nuclear Localization and Particle Formation. J. Virol.
79: 9540-9555
[Abstract]
[Full Text]
-
Varadarajan, P., Mahalingam, S., Liu, P., Ng, S. B. H., Gandotra, S., Dorairajoo, D. S. K., Balasundaram, D.
(2005). The Functionally Conserved Nucleoporins Nup124p from Fission Yeast and the Human Nup153 Mediate Nuclear Import and Activity of the Tf1 Retrotransposon and HIV-1 Vpr. Mol. Biol. Cell
16: 1823-1838
[Abstract]
[Full Text]
-
Aye, M., Irwin, B., Beliakova-Bethell, N., Chen, E., Garrus, J., Sandmeyer, S.
(2004). Host Factors That Affect Ty3 Retrotransposition in Saccharomyces cerevisiae. Genetics
168: 1159-1176
[Abstract]
[Full Text]
-
Wang, H., Tang, X., Balasubramanian, M. K.
(2003). Rho3p Regulates Cell Separation by Modulating Exocyst Function in Schizosaccharomyces pombe. Genetics
164: 1323-1331
[Abstract]
[Full Text]
-
Teysset, L., Dang, V.-D., Kim, M. K., Levin, H. L.
(2003). A Long Terminal Repeat-Containing Retrotransposon of Schizosaccharomyces pombe Expresses a Gag-Like Protein That Assembles into Virus-Like Particles Which Mediate Reverse Transcription. J. Virol.
77: 5451-5463
[Abstract]
[Full Text]
-
Singleton, T. L., Levin, H. L.
(2002). A Long Terminal Repeat Retrotransposon of Fission Yeast Has Strong Preferences for Specific Sites of Insertion. Eukaryot Cell
1: 44-55
[Abstract]
[Full Text]
-
Dang, V.-D., Levin, H. L.
(2000). Nuclear Import of the Retrotransposon Tf1 Is Governed by a Nuclear Localization Signal That Possesses a Unique Requirement for the FXFG Nuclear Pore Factor Nup124p. Mol. Cell. Biol.
20: 7798-7812
[Abstract]
[Full Text]
-
Wang, H., Tang, X., Liu, J., Trautmann, S., Balasundaram, D., McCollum, D., Balasubramanian, M. K.
(2002). The Multiprotein Exocyst Complex Is Essential for Cell Separation in Schizosaccharomyces pombe. Mol. Biol. Cell
13: 515-529
[Abstract]
[Full Text]