Previous Article | Next Article 
Molecular and Cellular Biology, September 1999, p. 6065-6075, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Interactions of TLC1 (Which Encodes the
RNA Subunit of Telomerase), TEL1, and MEC1 in
Regulating Telomere Length in the Yeast Saccharomyces
cerevisiae
Kim B.
Ritchie,1
Julia C.
Mallory,2 and
Thomas D.
Petes1,2,*
Department of Biology1
and Curriculum in Genetics and Molecular
Biology,2 University of North Carolina at
Chapel Hill, Chapel Hill, North Carolina 27599-3280
Received 3 March 1999/Returned for modification 23 April
1999/Accepted 9 June 1999
 |
ABSTRACT |
In the yeast Saccharomyces cerevisiae, chromosomes
terminate with a repetitive sequence [poly(TG1-3)] 350 to 500 bp in length. Strains with a mutation of TEL1, a
homolog of the human gene (ATM) mutated in patients with
ataxia telangiectasia, have short but stable telomeric repeats.
Mutations of TLC1 (encoding the RNA subunit of telomerase)
result in strains that have continually shortening telomeres and a
gradual loss of cell viability; survivors of senescence arise as a
consequence of a Rad52p-dependent recombination events that amplify
telomeric and subtelomeric repeats. We show that a mutation in
MEC1 (a gene related in sequence to TEL1 and ATM) reduces telomere length and that tel1 mec1
double mutant strains have a senescent phenotype similar to that found
in tlc1 strains. As observed in tlc1 strains,
survivors of senescence in the tel1 mec1 strains occur by a
Rad52p-dependent amplification of telomeric and subtelomeric repeats.
In addition, we find that strains with both tel1 and
tlc1 mutations have a delayed loss of cell viability
compared to strains with the single tlc1 mutation. This
result argues that the role of Tel1p in telomere maintenance is not
solely a direct activation of telomerase.
| |
INTRODUCTION |
Most eukaryotic chromosomes end with
simple repetitive DNA sequences (7). In the yeast
Saccharomyces cerevisiae, wild-type strains have
poly(TG1-3) tracts 350 to 500 bp in length (31, 42,
43). Within a yeast cell population, telomeric tracts, even for a
single chromosome, range in size by about ± 50 bp
(43). This variability in telomere length, as well as the
identification of mutants with telomeric tracts that are longer or
shorter than those in wild-type strains, suggests that telomere length
is likely to reflect a balance between mechanisms that extend or
contract these terminal repeats.
In many eukaryotes, including yeast, the most important mechanism for
extending telomeric repeats is telomerase (7, 45). This
RNA-protein enzyme complex extends the G-rich strand of the telomere 5'
to 3', using telomeric repeats encoded within the RNA component of the
enzyme as a template. The extended G-rich strand is thought to be
copied 5' to 3' by conventional DNA polymerases to yield the
complementary C-rich strand (7). In yeast, the RNA component
of telomerase is encoded by TLC1 (33), and the protein component with reverse transcriptase activity is encoded by
EST2 (16). In strains with mutations in either of
these genes, telomeric tracts shorten with each cell division,
resulting in gradual loss of cell viability (13, 33). This
same senescent phenotype is observed in strains with mutations in
several other EST (ever shorter telomeres) genes, including
EST1, EST3, and CDC13/EST4 (13,
19). Since mutations in all EST genes have the same
phenotype and since double-mutant est strains have the same
phenotype as the single mutants, it has been suggested that all Est
proteins function in the same pathway of telomere maintenance (13,
23, 40), although not necessarily as components of telomerase
(15).
Although yeast strains with a mutation in EST or
TLC1 genes undergo dramatic loss of cell viability
associated with loss of telomeric repeats, fast-growing survivors arise
within the mutant cultures (18, 19). In these survivors,
amplification of telomeric and subtelomeric repeats occurs by a
RAD52-dependent recombinational process (18).
These extra repeats may act as buffers to prevent loss of essential DNA
sequences located near the chromosome ends, a process that is analogous
to the effects of the telomere-specific transposable elements found in
Drosophila (25).
Mutations in several genes result in short telomeric tracts without
leading to cell death. For example, the telomeric tracts in
tel1 strains are about 50 bp in length, about sevenfold
shorter than in wild-type strains (20). In addition,
tel1 strains have slightly higher rates of chromosome loss
and mitotic recombination (6). The TEL1 gene
encodes a very large (322-kDa) protein with homology to the human tumor
suppressor gene ATM (29). Tel1p also shares
homology with a number of lipid and/or protein kinases required for the
function of DNA damage-sensitive checkpoints, including MEC1
(11, 44), and in certain genetic backgrounds, Tel1p affects
the sensitivity of the cell to DNA-damaging agents (21). For
example, tel1 mec1 strains are considerably more sensitive to X rays than mec1 strains, whereas tel1
single-mutant strains are not X-ray sensitive (6, 21). Mec1p
and Tel1p are involved, directly or indirectly, in phosphorylation of
the checkpoint protein Rad53 (28). In addition, other
proteins involved in DNA replication or checkpoint function, including
replication protein A (2), Rad9p (5, 39), and
Ddc1p (24), show Mec1p-dependent phosphorylation.
In contrast to Mec1p (44), Tel1p has a relatively minor role
in the cellular response to DNA damage, and this role is evident only
in strains lacking Mec1p. One interpretation of this result is that the
target protein (or proteins) in the checkpoint pathway involved in the
repair of DNA damage is a poor substrate for Tel1p but a good substrate
for Mec1p. Although there is no direct biochemical evidence that Tel1p
is a protein kinase, point mutations in the kinase domain of Tel1p
result in short telomeres (6). The role of the Tel1p in
telomere replication is not understood. One possibility is that
Tel1p-mediated phosphorylation of a protein subunit of telomerase is
required for the optimal activity of telomerase. As described below,
our comparison of the phenotypes of tel1, tlc1,
and double-mutant tel1 tlc1 strains suggests that this model is unlikely.
Since Tel1p shows homology with a number of other yeast proteins,
including Mec1p, Tor1p, and Tor2p, Greenwell et al. (6) examined telomere lengths in strains mutated for mec1,
tor1, or tor2. Since MEC1 and
TOR2 are essential genes, only nonnull alleles were
examined. No effect on telomere length was observed for any of the
three mutations. We decided to reinvestigate the effect of the
mec1 mutation on telomere length for two reasons. First, the
mec1 strain previously examined was subsequently found to contain two mutations, mec1-1 (an allele eliminating the
essential function of Mec1p) and sml1 (a mutation that
suppressed the lethal effects of mec1-1
[26]); Sml1p is a negative regulator of
deoxynucleoside triphosphate pools (46). Thus, an effect of
the mec1-1 mutation on telomere length could have been
hidden by the coexisting sml1 mutation. Second, mutations in
the Schizosaccharomyces pombe rad3 gene, a homologue of
MEC1 of S. cerevisiae, result in shortened telomeres (3), and strains with mutations in both
rad3 and tel1, an S. pombe homologue
of TEL1, lose all telomeric sequences (22).
As described below, we found that the mec1-21 allele
(28) results in short telomeres and that strains with the
tel1 mec1-21 genotype have telomeres shorter than those of
either single mutant and exhibit an associated senescent phenotype. We
suggest that both Tel1p and Mec1p have two different types of target
proteins, one specific for cellular responses to DNA damage and one
specific for telomere maintenance. In addition, an epistasis analysis
of tel1, mec1, and tlc1 indicates that
the essential role of Tel1p and Mec1p in telomere maintenance is not
exerted by directly activating telomerase.
| |
MATERIALS AND METHODS |
Yeast strains and plasmids.
Yeast strains and plasmids used
in this study are described in Table 1.
All strains were isogenic (except for alterations introduced by
transformation) with W303a (a leu2-3,112 his3-11,15 ura3-1
ade2-1 trp1-1 can1-100 [40]) or AMY125 (
ade5-1 his7-2 leu2-3,112 trp1-289 ura3-52
[39]).
Media and vegetative subculturing conditions.
Standard rich
growth medium (YPD) and omission media (8) were used. Yeast
strains were grown at 30°C, and diploids were sporulated at room
temperature. Tetrad dissection procedures were standard (8).
We examined the senescent phenotype by using two different, although
similar, protocols. For spore cultures derived from the diploid strains
JMY300, JMY302, JMY303, KRY238, or KRY242, spore colonies from the
dissection plates were streaked onto rich growth medium (YPD) in
quarter-plate sectors for single colonies (subcloning 1). After 2 days
of growth at 30°C, a smear of cells derived from the first streak was
restreaked on a second YPD plate (subcloning 2). This procedure was
repeated, usually until 10 subclonings had been performed. Each
subcloning involved about 20 cell divisions. For spore cultures derived
from the diploid strains KRY229 and KRY232, similar procedures were
used except that the incubation period between subclonings was 1 day
instead of 2 days; each subcloning, therefore, involved about 10 cell divisions.
Measurements of comparative growth rates and viability of
tlc1 and tel1 tlc1 strains.
To compare the
growth rates of tlc1 and tel1 tlc1 strains, we
mixed spore colonies containing approximately equal numbers of cells of
tlc1 and tel1 tlc1 strains of the same mating
type (derived by sporulating either the diploid KRY229 or KRY236) and inoculated this mixture into 5 ml of rich growth medium. To maintain exponential growth in the culture, we diluted the cultures 1:100 every
24 h. The ratio between the two strains was determined by removing
samples at 6- to 12-h intervals and plating a dilution of each sample
on rich growth medium. After 2 days of growth at 30°C, the resulting
colonies were replica plated to medium lacking leucine or uracil.
Spores derived from KRY229 of the tel1 tlc1 genotype were
Ura+ Leu+, and those of the tlc1
genotype were Ura
Leu+; spores derived from
KRY236 of the tel1 tlc1 genotype were Ura
Leu+, and those of the tlc1 genotype were
Ura+ Leu+ (Table 1).
We also performed two different assays of cell viability for
tel1
tlc1 and
tlc1 strains. One assay was to compare the
number
of cells as counted in the hemocytometer with the number of
cells
capable of colony formation; the second was to measure the
fraction
of cells in the culture capable of taking up the dye phloxine
B (Sigma), which stains dead cells red (
12). Cells were
harvested
from growth medium by centrifugation, incubated for 6 h
at 30°C
in YPD medium containing 15 µg of phloxine B per ml, and
examined
microscopically.
Southern analysis of telomere length.
Yeast DNA was isolated
from vegetative cultures by standard methods (8). The DNA
was treated with either XhoI or PstI, and the
resulting fragments were separated by gel electrophoresis in 1%
agarose gel. The fragments were transferred to a Hybond N+ nylon
membrane and hybridized to a probe derived from a region of the Y'
element centromere-distal to the XhoI site. This probe was
prepared by PCR amplification of pYT14 (31) by using the primers 5'ACACACTCTCTCACATCTACC and
5'TTGCGTTCCATGACGAGCGC. We used a Y' probe rather than a
poly(GT) probe (43) for two reasons. First, the poly(GT)
probe hybridizes to both telomeric sequences and nontelomeric poly(GT)
tracts (42); second, the poly(GT) probe hybridizes weakly to
short telomeres. To quantitate the level of Y' amplification in samples
derived from senescence survivors, we rehybridized blots of
PstI-treated DNA (previously hybridized to the Y'-specific
probe) to a single-copy yeast DNA probe prepared by PCR amplification
of genomic DNA with the primers 5'GTGGCGGTAGTTTTGGCGATTTTCTTTTGG and 5'TCACGGGATTTTATGCTCTGTAGTCCAATG. Blots were
scanned with a PhosphorImager and analyzed by using ImageQuaNt software
(Molecular Dynamics).
| |
RESULTS |
Rationale.
Mutations in many different yeast genes result in
telomeres that are either shorter or longer than those in wild-type
strains. With the exception of TLC1 and EST2,
which encode the RNA and protein subunits, respectively, of telomerase,
the roles of most of these genes in telomere maintenance are unknown.
Below, we investigate genetic interactions between three mutations that result in short telomeres: mec1, tel1, and
tlc1. By comparing the phenotypes of strains containing
single- and double-mutant combinations of these genes (epistasis
analysis), we conclude that Tel1p and Mec1p are required for telomere
elongation in roles that are at least partially independent of telomerase.
Telomere length in tel1, mec1, and
tel1 mec1 strains.
There are a number of yeast genes
that encode proteins with C-terminal regions homologous to
lipid/protein kinases (6, 21), including TEL1,
MEC1, TOR1, and TOR2. Since mutations
in the putative kinase domain of Tel1p result in short telomeres, we
previously examined telomere length in strains with mutations in
MEC1, TOR1, or TOR2 (6); no
reduction in telomere length was observed in these strains. A
subsequent analysis of the mec1 strain used in our study
(DLY285; provided by T. Weinert) demonstrated that this strain
contained two mutations (26, 46), the mec1-1 mutation (a recessive lethal) and a mutation in SML1
(suppressor of mec1 lethality). Consequently, we decided to
reexamine telomere length by Southern analysis in a strain containing a
different allele of mec1 in the absence of the
sml1 suppressor.
In addition to the terminal poly(TG
1-3) sequences, yeast
chromosomes have subtelomeric repeats, X and Y' (
17). All
telomeres have X repeats, and about half have one or more Y' elements.
The arrangement of these sequences (telomere to centromere) is
poly(TG
1-3)-Y'
0-3-X. The terminal Y' elements
contain
a
PstI site located about 0.9 kb from the end of the
chromosome.
When genomic DNA is treated with
PstI and
hybridized to a Y'-specific
probe derived from the region
centromere-distal to the site (Fig.
1), the broad region of
hybridization at 0.9 kb represents a composite
of telomeric fragments
from all Y'-containing telomeres. The DNA
fragments of 3.5 and 4.8 kb
represent tandemly arranged Y' elements
of two size classes
(
17).
We generated a series of haploids with wild-type,
tel1,
mec1-21, and
tel1 mec1-21 genotypes by
sporulating a diploid strain
(JMY300) that was doubly heterozygous for
the
tel1 and
mec1-21 mutations. DNA was isolated
from spore cultures and examined by
Southern analysis (Fig.
1). This analysis showed that
mec1-21 strains had slightly (about 50 bp) shorter telomeres
than wild-type
strains. In addition, in strains of the
tel1
mec1 genotype, telomeric
repeats were slightly shorter than those
in the
tel1 single-mutant
strains.
View larger version (78K):
[in this window]
[in a new window]
|
FIG. 1.
Telomere lengths in wild-type, tel1,
mec1-21, and tel1 mec1-21 strains. A diploid
strain heterozygous for tel1 and mec1-21
mutations was sporulated, and tetrads were dissected. In three tetrads
in which all four genotypes were represented, DNA was isolated from
spore cultures without subculturing; the strains had undergone about 35 cell divisions at the time of DNA extraction. The DNA was treated with
PstI, and Southern analysis was performed. Strains analyzed:
W303a (lanes 1 and 16); KRY20a (lanes 2 and 15); JMY300-1a, -2a, -3a
(lanes 3 to 5, respectively); JMY300-1c, -2d, and -3d (lanes 6 to 8, respectively); JMY300-1d, -2b, and -3b (lanes 9 to 11, respectively);
JMY300-1b, -2c, and -3c (lanes 12 to 14, respectively). Since the
tel1 mutation exhibits a long phenotypic lag
(20), the telomeres in the tel1 control strain
KRY20a (lane 2), which had been subcultured for more than 100 doublings, were slightly shorter than those in the tel1
strains derived from the spores, which had not been subcultured.
|
|
Mutations in five yeast genes (
est1 to -
4 and
tlc1), including the RNA and protein subunits of telomerase,
result in continually
shortening telomeres and a senescent phenotype, a
gradual loss
of cell viability during vegetative subculturing (
13,
19,
33). In the senescent cultures, fast-growing survivors are
generated
as a consequence of
RAD52-dependent amplification
of the subtelomeric
Y' repeats (
18). As shown in Fig.
2a, although no senescence
was observed
for wild-type,
mec1-21, or
te11 strains, the
tel1 mec1-21 strains had a senescent phenotype. As observed
for the
est and
tlc1 strains, prolonged
subculturing of the
tel1 mec1-21 strains produced
fast-growing survivors. Survivors of senescence,
either in
tel1
mec1-21 strains or in strains of other genotypes
with the
senescent phenotype described below, invariably contained
amplified
tandem Y' elements (Fig.
3) and/or novel
DNA fragments
that hybridized to a telomeric probe; both classes of
survivors
have been observed previously in
est1 mutants
(
18). To determine
if the appearance of fast-growing
survivors in the
tel1 mec1-21 strains was dependent on
Rad52p, we constructed and sporulated
a diploid strain (KRY242)
heterozygous for
tel1,
mec1-21, and
rad52. All of the nine spores examined with the
triple-mutant
genotype were senescent but did not produce survivors
(Fig.
2b).
Thus, as observed previously for strains with
est
mutations, the
ability to produce survivors in the
tel1
mec1-21 strains is dependent
on Rad52p.
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 2.
Senescent phenotypes of tel1 mec1-21 and
tel1 mec1-21 rad52 strains. Spores derived from JMY300
(JMY300-2a [tel1 mec1-21], JMY300-2b [tel1],
JMY300-2c [wild type], and JMY300-2d [mec1-21]) or
KRY242 (KRY242-8a [wild type], KRY242-8b [mec1-21
rad52], KRY242-8c [tel1 mec1-21 rad52], and
KRY242-8d [tel1]) were vegetatively subcultured by
streaking on plates containing rich growth medium (subcloning 1 [sc
1]). After 2 days at 30°C, each strain was restreaked onto a new
plate (sc 2), and this protocol was continued for 10 subclonings; we
calculate that there are about 20 cell divisions per subcloning.
|
|
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Amplification of Y' elements associated with survivors
in the tel1 mec1-21 genotype. Southern analysis was done on
PstI-treated DNA derived from the tel1 mec1-21
strain JMY300-3a after 1, 4, 7, and 10 subclonings (sc1, sc4, sc7, and
sc10). Following hybridization to a Y'-specific probe, the blot was
boiled to remove the probe and rehybridized to a single-copy probe (as
described in Materials and Methods). By quantitating the hybridization
to these two probes, we concluded that one class of tandem Y' elements
was amplified more than 10-fold in the 10th subcloning relative to the
wild-type strain. By the 10th subcloning, most of the JMY300-3a cells
were fast-growing survivors.
|
|
There was considerable heterogeneity in the rate of growth of different
tel1 mec1-21 spores at different subculturings. About
two-thirds of the
tel1 mec1-21 spores grew more slowly than
the
isogenic wild-type strains even after one subcloning (Fig.
2a),
although the growth rate after additional subclonings was even
lower in
most of these cultures. About one-third grew at approximately
the same
rate as the wild type during early subculturings, although
growth
slowed in the later subculturings. Several arguments support
the
conclusion that the
tel1 mec1-21 strains have a senescent
phenotype similar to that of
tlc1, rather than a
nonsenescent
slow-growth phenotype. First, as discussed below, we
observed
similar growth variation in spores of the
tel1
mec1-21 and
tlc1 genotypes (otherwise isogenic); in
previous studies of
tlc1 strains
(
33), stochastic
variation in growth rates was also observed.
In a comparison of 40 pairs of spores derived from sporulating
the diploid KRY238, we found
that
tel1 mec1-21 spores grew more
slowly than
tlc1 spores in 12 pairs, more rapidly than
tlc1
spores
in 15 pairs, and at about the same rate as
tlc1
spores in 13 pairs.
In addition, pairs of
tlc1 spores
derived from the same tetrad
of KRY228 senesced at different rates in
eight pairs and at approximately
the same rate in four pairs. Second,
the observed eventual death
of all cells in the
tel1 mec1-21
rad52 spore cultures is not consistent
with a nonsenescent
slow-growth
pattern.
In
S. pombe,
tel1 rad3 strains (equivalent to
S. cerevisiae tel1 mec1 strains) grow slowly and lose
telomeric sequences (
22).
In fast-growing survivors of the
tel1 rad3 strains, the chromosomes
circularize and diploid
strains with these circular chromosomes
have greatly reduced spore
viability. In
S. cerevisiae, strains
heterozygous for a
single circular chromosome have reduced spore
viability (61% viable
spores) compared to a wild-type strain (90%),
since recombination
between a circular and a linear chromosome
results in dicentric
chromosomes (
9). Thus, strains heterozygous
for 16 circular
chromosomes would be expected to have very poor
spore viability. We
crossed a
tel1 mec1-21 survivor (JMY300-3aS)
to W303
. The
resulting diploid (KRY246) was sporulated, tetrads
were dissected, and
spore viability was determined. We also examined
spore viability in an
isogenic diploid strain (KRY300) resulting
from a cross of two
wild-type haploid parents. The percentages
of spore viability were 80 for KRY246 and 92 for KRY300. In this
survivor, therefore, it is
unlikely that there is even a single
circular
chromosome.
Effect of sml1 on telomere length and cellular
senescence.
The lethal effect of mec1-1 is suppressed
by a mutation in the sml1 gene (26, 46). Since
mutations of sml1 lead to elevations in deoxynucleoside
triphosphate pools, Zhao et al. (46) suggested that Sml1p is
a negative regulator of nucleotide pools and Mec1p and Rad53p are
required to relieve this inhibition. To examine interactions between
the tel1, mec1, and sml1 mutations, we
analyzed spores derived from diploids (JMY302 and JMY303) heterozygous for all three mutations, resulting in strains of eight different genotypes.
As shown in Fig.
4, of the eight
genotypes, only
tel1 mec1-21 or
tel1 mec1-21 sml1
strains had a senescent phenotype. In eight
tetrads that were analyzed
with these genotypes, the triple mutant
senesced more slowly than the
double mutant in five tetrads (as
in Fig.
4b) and at approximately the
same rate in three tetrads.
Thus, the
sml1 mutation often
delayed but did not suppress senescence.
Telomere lengths in strains of
eight genotypes are shown in Fig.
5. In
general,
sml1 had little effect on telomere length, although
the telomeres of the
mec1-21 sml1 strains were slightly
longer
(about 50 bp), resulting in telomeres of wild-type length. This
effect is consistent with our earlier observation that telomeres
in the
mec1-1 sml1 strain were approximately the same length as
those in the wild-type strain (
6). In addition, the telomere
lengths in
tel1 mec1-21 sml1 strains had broader size
distributions
than those in the
tel1 mec1-21 strains,
possibly accounting for
the delay in senescence described above.
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of the sml1 mutation on cellular
senescence. The diploid strains JMY302 and JMY303 (heterozygous for
tel1, mec1-21, and sml1) were
sporulated, and tetrads were dissected. Spore cultures of the eight
expected genotypes were vegetatively subcultured as described in
Materials and Methods. In most tetrads, the rate of senescence in
sml1 tel1 mec1-21 strains was delayed relative to the rate
in tel1 mec1-21 strains. Strains analyzed: JMY302-11a
(mec1 sml1), -11b (mec1), -11c (tel1),
and -11d (tel1 sml1); JMY303-6a (wild-type), -6b
(sml1), -6c (tel1 mec1), and -6d (tel1 mec1
sml1).
|
|
View larger version (75K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of the sml1 mutation on telomere
length. DNA was isolated from cultures of spores derived from the
diploid JMY302 (heterozygous for tel1, mec1-21,
and sml1). These samples were treated with PstI
and examined by Southern analysis as described previously. Strains
analyzed (from left to right): JMY302-6d, -11b, -25c, -11a, -22a, -11c,
-22b, -11d, -25b, -6c, -9d, -12d, -6a, -9c, -12b, -6b, -9b, -12c, and
-9a.
|
|
In conclusion, although
tel1 and
mec1-21 strains
have short stable telomeres and do not undergo senescence, strains with
both
mutations undergo continual loss of telomeric repeats and an
associated
senescence. One interpretation of this result (discussed
further
below) is that Tel1p and Mec1p have functionally redundant
roles
in a pathway that is essential for telomere elongation. One model
is that phosphorylation of a protein subunit of telomerase is
essential
for its function and that Tel1p or Mec1p is required
for this
phosphorylation. One prediction of this model is that
the phenotype of
a strain with a mutation in both
TEL1 and a telomerase
subunit should be identical to the phenotype of a strain with
a single
mutation eliminating telomerase activity such as
tlc1 (
33). If Tel1p and telomerase promote telomere elongation by
independent pathways, one would expect the double mutant to have
a
different phenotype (for example, shorter telomeres and faster
senescence) than either single mutant. Below, we describe evidence
that
tel1 tlc1 strains have an unexpected phenotype: the
double-mutant
strains have delayed senescence relative to
tlc1 strains.
Genetic interactions between tel1 and tlc1.
A diploid strain (KRY229) heterozygous for null mutations of
TEL1 and TLC1 was sporulated to generate isogenic
strains with various combinations of these mutations. As shown in Fig.
6, cultures derived from spores of the
tel1 tlc1 genotype underwent a delay in the onset of
senescence compared to those of the tlc1 genotype. The
difference in the growth behavior of the strains was usually evident at
the first subculturing (about 30 cell divisions). We examined the
patterns of senescence in 33 tetrads in which all four genotypes (wild
type, tel1, tlc1, and tel1 tlc1) were
represented. In 22 of these tetrads, the tel1 tlc1 strain
had obviously delayed senescence. In 11 tetrads, the double mutant had
only a slight delay or no obvious delay of senescence relative to the
tlc1 strain. The double mutants were never observed to
senesce faster than the tlc1 single mutants. In addition to
the delay in onset of senescence, tel1 tlc1 strains had a
corresponding delay in accumulation of telomerase-independent
survivors. For example, in Fig. 6, survivors (large colonies) were much
more common in subcultures 4 and 5 for the tlc1 strain than
for the tel1 tlc1 strain.
View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of senescence phenotypes of tlc1
and tel1 tlc1 strains. A diploid heterozygous for
tlc1 and tel1 mutations was sporulated, and
tetrads were dissected. Spore colonies (KRY229-6a [wild-type],
KRY229-6b [tel1], KRY229-6c [tlc1], and
KRY229-6d [tel1 tlc1]) were subcloned as described in the
legend to Fig. 2 except that each subcloning was done at 24-h
intervals. In general, strains with the tel1 tlc1 genotype
had a delay in senescence compared to those of the tlc1
genotype. In addition, the fast-growing survivor strains appeared more
quickly in the tlc1 strains than in the tel1 tlc1
strains.
|
|
To confirm the difference in phenotypes between
tlc1 and
tel1 tlc1 strains, we also examined the relative growth
rates of
the two strains grown in competition in the same culture (Fig.
7). The genotypes of spore colonies
derived from KRY229 could
be rapidly tested on omission media, since
the
tlc1 was disrupted
with a
LEU2 insertion and
tel1 was disrupted with
URA3. Spore
colonies with
tlc1 and
tel1 tlc1 genotypes derived from the
same
tetrad were resuspended in water, mixed, and inoculated into
liquid
rich growth medium. Since we found that the cultures had a
doubling
time of about 3 to 4 h, we diluted the cultures 1:100
every 24
h. The fraction of cells with each genotype was
determined at
6- to 12-h intervals. During the first 80 h of
growth, the
tel1 tlc1 mutant grew more rapidly than the
tlc1 strain. After 80 h
of culturing, this trend was
reversed. Our interpretation of this
result, consistent with the
observations described above, is that
the
tlc1 strain had an
earlier onset of senescence and therefore
a lower effective growth rate
than the
tel1 tlc1 strain during
the early stages of
subculturing. The switch in relative growth
rates at later times (after
80 h) reflects the earlier production
of survivors in the
tlc1 strain relative to the
tel1 tlc1 strain.
In
nine of nine competitive subculturing experiments, in the first
60 to
70 h, the
tel1 tlc1 strain grew better than the
tlc1 strain.
In six of the nine experiments, after 80 h, there was a switch
in relative growth rates in favor of the
tlc1 strain, reflecting
the earlier appearance of survivors
in the
tlc1 strain. In the
other three experiments, the
tlc1 strain grew more slowly than
the
tel1 tlc1
strain for the course of the experiment (usually
150 to 200 h of
subculturing).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Comparative growth rates of tlc1 and
tel1 tlc1 strains in mixed cultures. The diploia KRY229 was
sporulated, and spores of the same mating type with the genotypes
tlc1::LEU2 and tel1::URA3
tlc1::LEU2 were identified. Equal number of cells of
pairs of such strains were mixed and inoculated into rich growth
medium. The cultures were grown at 30°C. Exponential growth was
maintained by dilution of the culture 1:100 into fresh medium every
24 h. Samples were taken every 6 to 12 h, and the ratio of
the two strains was determined as described in Materials and Methods.
Dotted lines and solid lines represent the data for the tlc1
(KRY229-13c) and tel1 tlc1 (KRY229-13d) strains,
respectively.
|
|
In the competition experiments described above, the
tel1
tlc1 strain had the wild-type
URA3 and
LEU2
genes, whereas the
tlc1 strain had only the wild-type
LEU2 gene. To rule out the possibility
that the
URA3 gene resulted in a selective advantage for the
tel1 tlc1 strain, we performed competitive growth
experiments with
strains (derived by sporulating the diploid strain
KRY236) of
the genotypes
tel1::ura3
tlc1::LEU2 and
tlc1::LEU2 URA3. In
three
of three such experiments, the
tel1::ura3
tlc1::LEU2 strain grew
better than the
tlc1::LEU2 URA3 strain during the early stages
of
subculturing. This result demonstrates that the more rapid
growth of
the double mutant strains derived from KRY229 is not
a consequence of
the
URA3 gene used to make the
tel1 mutation.
The more rapid growth of the
tel1 tlc1 strains than of the
tlc1 strains (Fig.
6 and
7) could reflect less cell death, a
more
rapid cell cycle, or both factors. To examine this issue, we
measured
doubling times and cell viability of wild-type,
tlc1, and
tel1 tlc1 strains subcultured
separately for 3 days in liquid medium.
In Table
2, we show data for strains derived from
two different
tetrads; except for the relevant mutations, all strains
are isogenic.
Although, as in other experiments, there was considerable
stochastic
variation in growth rates of
tlc1 and
tel1
tlc1 strains, certain
patterns were consistent. The doubling time
of the wild-type strains
(measured by cell counts with a hemocytometer)
was about 90 min
and constant for each day of subcloning. In addition,
cell viability
measured by CFU or by the ability of the cells to
exclude the
dye phloxine B (
15) was 100%. In contrast,
tlc1 strains had
a low growth rate on day 1, an extremely
low growth rate on day
2, and a higher growth rate (reflecting the
appearance of survivors)
on day 3. The very low growth rate observed
for the
tlc1 strains
on day 2 was associated with a very low
percentage of cells (about
1%) capable of forming colonies; many of
the cells incapable of
colony formation, however, were capable of dye
exclusion. On day
3, the increased fraction of
tlc1 cells
capable of colony formation
correlated with the increased growth rate.
In the
tel1 tlc1 strains,
the growth rate and cell viability
were higher than observed for
the
tlc1 strains on days 1 and
2. In comparison to the
tlc1 strains,
the
tel1
tlc1 strains had a lower growth rate and a smaller fraction
of
cells capable of colony formation on day 3 than on day 2, reflecting
the delayed appearance of survivors. These results strongly suggest
that at least part of the growth rate difference observed between
tlc1 and
tel1 tlc1 strains reflects differences
in the rate of
cell death. We cannot rule out the possibility that the
cell cycle
times of the two strains are also different. One
complicating
factor is that in examining the rate of division of
individual
cells microscopically, we observed considerable intrastrain
heterogeneity
in both
tlc1 and
tel1 tlc1 strains
(data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Cell division time and cell viability of wild-type,
tlc1, and tel1 tlc1 strains during vegetative
subculturing in liquid mediuma
|
|
We also measured telomere lengths in
tel1 tlc1 and
tlc1 strains after various amounts of subculturing (Fig.
8a).
Spore colonies
derived from KRY229
were inoculated into liquid medium and grown
continuously. Since
cultures were diluted 1:100 every 24 h, each
subcloning reflects
about seven cell generations. Southern analysis,
using a Y'-specific
hybridization probe, was performed as described
above. In both
tel1 tlc1 and
tlc1 strains, telomeres shortened
during subcloning. Although telomere lengths in the two strains
were
similar, there were several differences in the details of
the patterns.
First, the amount of the terminal Y'-hybridizing
fragment was greatly
reduced in the
tlc1 strain by the fourth
subculturing; this
fragment was retained through the seventh subculturing
in the
tel1 tlc1 strain. Second, amplification of
Y'/poly(TG
1-3)-hybridizing
fragments greater than 1 kb in
size was detected in the
tlc1 strain
by the fourth
subcloning; this amplification was associated with
fast-growing
survivors. In the
tel1 tlc1 strain, amplification
was
delayed until the seventh subcloning. Third, the distribution
of
telomere lengths of the Y'-hybridizing terminal fragment appeared
broader in the
tel1 tlc1 strain than in the
tlc1
strain. These
results suggest that the delay of senescence observed in
tel1 tlc1 strains likely reflects a delay in the generation
of cells
that completely lack telomeric repeats.
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of subculturing tlc1 and
tel1 tlc1 strains on telomere length phenotypes. Strains of
the tel1, tlc1, tel1 tlc1, and
wild-type genotypes derived from the diploids KRY229 (W303a background)
(a) and KRY232 (AMY125 background) (b) were inoculated into rich growth
medium and grown at 30°C. Cultures were diluted 1:100 into fresh
medium every 24 h, and samples for DNA isolation were harvested
every 24 h. Each subculturing (SC) represents about 10 cell
divisions. Southern analysis was performed on XhoI-treated
DNA samples. In such samples, the terminal fragments from Y'-bearing
telomeres are about 1.2 kb in size and the tandemly arranged Y'
elements yield DNA fragments of about 5.4 and 6.7 kb. Strains analyzed:
(a) KRY229-6b (lanes 1 and 2), KRY229-6a (lanes 3 and 4), KRY229-6c
(lanes 5 to 11), and KRY229-6d (lanes 12 to 18); (b) KRY232-7d (lanes
1, 2, and 25), KRY232-7b (lanes 3 and 4), KRY232-7c (lanes 5 to 14),
and KRY232-7a (lanes 15 to 24).
|
|
In addition to examining the relative growth rates of
tel1
tlc1 and
tcl1 strains, we compared the growth rates of
tel1 mec1 tlc1 and
mec1 tlc1 strains to those of
tlc1 strains. These strains
were constructed by sporulating
a diploid strain (KRY238) heterozygous
for
tel1,
tlc1, and
mec1 mutations. The growth rates of
pairs
of spores (each pair of spores derived from a different tetrad)
with the relevant genotypes were compared in double-blind experiments.
In a total of 37 pairwise comparisons,
tel1 mec1 tlc1
strains
grew much more slowly than
tlc1 strains in 34 pairs
and at about
the same rate in 3 pairs. Strains with the
mec1
tlc1 genotype
usually senesced more rapidly than
tlc1
strains, although the
effect was not statistically significant
(
P = 0.1); strains with
the
mec1 tlc1
genotype grew more slowly than strains with the
tlc1
genotype in 13 pairs, more rapidly in 5 pairs, and at approximately
the
same rate in 27 pairs. Thus, although both
tel1 and
mec1 mutations
result in short telomeres as single mutants,
these mutations result
in different phenotypes in combination with
tlc1.
Analysis of the phenotypic effects of tel1 tlc1 and
tlc1 mutations in a different genetic background.
All
of the strains described above were isogenic with W303a. To generalize
our results, we constructed tel1 tlc1 and tlc1 strains in a different genetic background, that of the haploid strain
AMY125 (36). We examined spores derived from a diploid (KRY232) of this genetic background that was heterozygous for tel1 and tlc1 mutations. The onset of senescence
was delayed for both tel1 tlc1 and tlc1 strains
in this background relative to the W303a background, but the tel1
tlc1 strains still senesced later than the tlc1 strain
in six of nine spore pairs examined and at about the same time in three
of nine pairs. In addition, survivors of senescence appeared more
quickly in the tlc1 strains than in the tel1 tlc1
strains in nine of nine spore pairs.
We also examined telomere length in wild-type,
tel1,
tel1 tlc1, and
tlc1 strains (Fig.
8b). Wild-type
strains derived from
AMY125 had telomeres that were about 150 bp longer
than those
in wild-type W303 strains; this difference is likely to
account
for the greater delay in senescence. In addition, as observed
for the W303a-derived strains, we found that (i) the Y'-hybridizing
telomeric fragment persisted through more subculturing for the
tel1 tlc1 strain than for the
tlc1 strain, (ii)
the amplification
of Y'/poly(TG
1-3)-hybridizing fragments
was observed later
for the
tel1 tlc1 strain than for the
tlc1 strain, and (iii) the
size distribution of the
Y'-hybridizing telomeric fragment was
greater for the
tel1
tlc1 strain than for the
tlc1 strain. In
summary, the
interactions between the
tel1 and
tlc1 mutations
appear similar in the two different genetic
backgrounds.
| |
DISCUSSION |
From the studies described above, we conclude that (i) both Tel1p
and Mec1p are required to maintain wild-type telomere length, (ii)
tel1 mec1 strains have very short telomeres and senesce at approximately the same rate as tlc1 strains, (iii)
recombination is required to produce survivors in tel1 mec1
strains, (iv) at early subclonings, tlc1 strains have a
lower growth rate than tel1 tlc1 strains, and (v) at early
subclonings, tel1 mec1 tlc1 strains have a lower growth rate
than tlc1 strains. These conclusions will be discussed below.
Tel1p and Mec1p are very large proteins (about 300 kDa) with
significant regions of homology, particularly near the C terminus (9, 24). The conserved C-terminal domain is also found in other proteins (such as DNA-specific protein kinase) that have lipid
and/or protein kinase activity. Strains with the mec1
mutation are sensitive to various DNA-damaging agents because of a
defective checkpoint function (44). Strains with the
tel1 mutation are not sensitive to DNA-damaging agents, but
addition of a single extra copy of TEL1 can partially
suppress the damage sensitivity of mec1 strains (24,
31). The phosphorylation of Rad53p, another checkpoint protein,
is dependent on Mec1p function, although overexpression of Tel1p
results in phosphorylation of Rad53p in the absence of Mec1p
(31). These results suggest that Mec1p and Tel1p can both phosphorylate Rad53p in response to DNA damage but that Rad53p is a
better substrate for Mec1p than for Tel1p.
Based on the phenotypes of the tel1, mec1, and
tel1 mec1 strains, one interpretation of our results is that
Mec1p and Tel1p both phosphorylate a protein required for telomere
elongation. Telomeres in tel1 strains are much shorter than
those in mec1 strains, suggesting that the Tel1p kinase
operates on this substrate more efficiently than the Mec1p kinase. It
should be emphasized, however, that there is no biochemical evidence
that either Tel1p or Mec1p has kinase activity, although point
mutations within the kinase domain of Tel1p result in short telomeres
(9). One explanation of the observation that tel1
mec1 strains senesce with approximately the same kinetics as
tlc1 strains is that the common substrate is a protein
subunit of telomerase that cannot function unless phosphorylated. The
simplest form of this model predicts that the rate of senescence will
be the same for tlc1, tel1 tlc1, mec1
tlc1, and tel1 mec1 tlc1 strains, a
prediction that is violated by our data. Although we cannot rule out a
role of Tel1p and/or Mec1p in the telomerase pathway, the epistasis results are inconsistent with the possibility that the only function of
Tel1p and Mec1p in regulating telomere length is to activate telomerase.
Although the hypothesis that Tel1p and Mec1p share a common substrate
involved in regulating telomere length is appealing, some details of
the epistasis results are difficult to explain by this model. For
example, tel1 tlc1 strains senesce slower than tlc1 strains, whereas mec1 tlc1 strains senesce
faster than tlc1 strains. For this reason, we prefer a model
in which Tel1p and Mec1p have different target molecules. Although we
do not understand the roles of Tel1p and Mec1p in regulating telomere
length, we will discuss one possibility in detail and mention briefly a
few other possibilities.
The model that will be discussed in detail is that Tel1p and Mec1p
control accessibility of the telomeric sequences to telomerase (to
lengthen the telomeric repeats) and cellular exonucleases (to shorten
the telomeric tracts) by phosphorylation of target proteins (TelXp for
Tel1p and TelYp for Mec1p) (Fig. 9); by
this model, the Tel1p and Mec1p behave analogously to the protein
complexes that control accessibility of promoters to the recombination
machinery (41). We suggest that in tel1 strains
(unphosphorylated TelXp, phosphorylated TelYp), access of the telomeres
to telomerase is greatly reduced and access to exonucleases is slightly
reduced, resulting in net telomere shortening. We suggest that in
mec1 strains (phosphorylated TelXp, unphosphorylated TelYp),
access of the telomeres to exonucleases is slightly increased with
little effect on access to telomerase. Finally, in tel1 mec1
strains (unphosphorylated TelXp and TelYp), access of the telomeres to telomerase is severely reduced (although not eliminated) and access to
exonucleases is substantially increased.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 9.
Telomere accessibility model for the functions of Tel1p
and Mec1p. In this model, Tel1p and Mec1p affect the accessibility of
the telomeres to telomerase and exonucleases by phosphorylation of
target proteins (TelXp for Tel1p and TelYp for Mec1p) located at the
telomeres. Phosphorylated forms of TelXp and TelYp are indicated by
encircled "P's."
|
|
Reduction in telomere length can be achieved either by reducing the
rate of telomere elongation or by increasing the rate of telomere
degradation. In the model described above, the short telomeres in
tel1 strains reflect the first mechanism and the short
telomeres in mec1 strains reflect the second. The senescent phenotype of tel1 mec1 reflects the superimposition of a
decrease in telomere elongation and an increase in telomere
degradation. Since the tel1 mutation reduces access of the
telomeres to exonucleases, as well as to telomerase, in the absence of
telomerase, tel1 tlc1 strains would be expected to growth
faster than tlc1 strains during early subculturings (as
observed). In contrast, since mec1 strains have an increased
rate of telomere degradation, one would expect that the mec1
mutation would accelerate the senescence of tlc1 strains. To
explain the lower growth rates of tel1 mec1 tlc1 strains than of tlc1 strains, we hypothesize that a small amount of
telomerase-mediated telomere elongation occurs in tel1 mec1
strains; this level of elongation delays but does not prevent
senescence. Elimination of telomerase in tel1 mec1 strains,
therefore, leads to an accelerated rate of senescence.
Many variants of the model shown in Fig. 9 could be proposed. The
restriction of telomere elongation or promotion of telomere degradation
may involve mechanisms other than telomere accessibility. For example,
Mec1p could directly inhibit exonucleases involved in telomere
degradation. It is also possible that there are some overlaps in the
functions of Tel1p and Mec1p, in addition to functional differences.
Finally, it is possible that Tel1p and Mec1p or both proteins have more
than one role in telomere elongation. For example, Tel1p could have an
essential and direct function in activating a subunit of telomerase and
an indirect effect on telomere length (possibly by affecting some
parameter of the cell cycle).
Based on its homology to checkpoint genes and its overlapping function
with Mec1p, an obvious alternative model is that Tel1p regulates a
checkpoint that results in cell cycle arrest if telomeres are too short
(6). If this checkpoint is similar to those involved in the
response to DNA damage (44), several predictions can be
made: (i) tlc1 strains with the checkpoint would have longer telomeres and would survive better than those lacking the checkpoint (tel1 mec1 tlc1 strains), (ii) tel1 tlc1 or
mec1 tlc1 strains would have a phenotype intermediate
between those of wild-type and tel1 mec1 tlc1 strains, and
(iii) many of the cells in tlc1 strains would be arrested at
a discrete part of the cell cycle; in cells lacking this checkpoint,
cell cycle arrest would not occur. Although we observe that
tlc1 strains senesce more slowly than the tel1 mec1
tlc1 strains (consistent with the checkpoint model), the
observation that tlc1 strains have more dead cells during
the early stages of subculturing than tel1 tlc1 strains is
not explained by the simplest form of this model. The observation that
tel1 tlc1 strains, although dividing more rapidly than
tlc1 strains, have telomeres that are as long as or longer
than those of tlc1 strains is also not expected if the
tel1 mutation results in a partial checkpoint defect.
Finally, we find cells arrested as doublets in cultures containing
senescent cells in both tlc1 and tel1 mec1 tlc1
cultures (data not shown), suggesting the existence of an active
checkpoint in both types of strains. Since tlc1 strains generate survivors more quickly than tel1 tlc1 strains, we
cannot rule out versions of the checkpoint model in which the
checkpoint response involves early activation of telomere elongation by recombination.
Regardless of the mechanistic details, our results demonstrate that
Tel1p and Mec1p have important roles in telomere maintenance in
S. cerevisiae. In a recent study, Naito et al.
(22) identified a homolog of TEL1 in S. pombe. Strains with mutations in this gene and in rad3
(a homolog of MEC1) rapidly lose telomeric repeats and grow
very slowly (22). The importance of the Tel1p and Mec1p in
telomere elongation, therefore, is conserved between two distantly related fungi. In addition, since human cell lines expressing dominant-negative fragments of ATM (a homolog of Tel1p) have short telomeres and normal levels of telomerase (37), similar
pathways may also exist in mammals. Activation of telomerase is found
in many human cancers, and it has been suggested that telomerase may be
a good target for anticancer drugs (6). Our results suggest
that the pathways involving Tel1p and Mec1p may represent a good
alternative target.
| |
ACKNOWLEDGMENTS |
We thank D. Gottschling for plasmid pBLUE61::LEU2, D. Kirkpatrick for plasmids pDTK102 and pDTK103, and Y. Sanchez and S. Elledge for S. cerevisiae Y604. We also thank R. Craven and
V. Lundblad for helpful discussions and comments on the manuscript.
This research was supported by NIH grant GM24110.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3280. Phone: (919) 962-1445. Fax: (919) 962-8472. E-mail: tompetes{at}emailunc.edu.
| |
REFERENCES |
| 1.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 2.
|
Brush, G. S.,
D. M. Morrow,
P. Heiter, and T. J. Kelly.
1996.
The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast.
Proc. Natl. Acad. Sci. USA
93:15075-15080[Abstract/Free Full Text].
|
| 3.
|
Dahlen, M.,
T. Olsson,
G. Kanter-Smoler,
A. Ramne, and P. Sunnerhagen.
1998.
Regulation of telomere length by checkpoint genes in Schizosaccharomyces pombe.
Mol. Biol. Cell
9:611-621[Abstract/Free Full Text].
|
| 4.
|
De Lange, T.
1998.
Telomeres and senescence: ending the debate.
Science
279:334-335[Free Full Text].
|
| 5.
|
Emili, A.
1998.
MEC1-dependent phosphorylation of Rad9p in response to DNA damage.
Mol. Cell
2:183-189[Medline].
|
| 6.
|
Greenwell, P. W.,
S. L. Kronmal,
S. E. Porter,
J. Gassenhuber,
B. Obermaier, and T. D. Petes.
1995.
TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene.
Cell
82:823-829[Medline].
|
| 7.
|
Greider, C. W.
1996.
Telomere length regulation.
Annu. Rev. Biochem.
65:337-365[Medline].
|
| 8.
|
Guthrie, C., and G. R. Fink (ed.).
1991.
Guide to yeast genetics and molecular biology.
Academic Press, Inc., San Diego, Calif.
|
| 9.
|
Haber, J. E.,
P. C. Thorburn, and D. Rogers.
1984.
Meiotic and mitotic behavior of dicentric chromosomes in Saccharomyces cerevisiae.
Genetics
106:185-205[Abstract/Free Full Text].
|
| 10.
|
Herskowitz, I., and R. E. Jensen.
1991.
Putting the HO gene to work: practical uses for mating-type switching.
Methods Enzymol.
194:132-146[Medline].
|
| 11.
|
Kato, R., and H. Ogawa.
1994.
An essential gene, ESR1, is required for mitotic cell growth, DNA repair and meiotic recombination in Saccharomyces cerevisiae.
Nucleic Acids Res.
22:3104-3112[Abstract/Free Full Text].
|
| 12.
|
Kohli, J.,
H. Hottinger,
P. Munz,
A. Strauss, and P. Thuriaux.
1977.
Genetic mapping in Schizosaccharomyces pombe by mitotic and meiotic analysis and induced haploidization.
Genetics
87:471-489[Abstract/Free Full Text].
|
| 13.
|
Lendvay, T. S.,
D. K. Morris,
J. Sah,
B. Balasubramanian, and V. Lundblad.
1996.
Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes.
Genetics
144:1399-1412[Abstract].
|
| 14.
|
Lin, J. J., and V. A. Zakian.
1996.
The Saccharomyces CDC13 protein is a single-strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo.
Proc. Natl. Acad. Sci. USA
93:13760-13765[Abstract/Free Full Text].
|
| 15.
|
Lingner, J.,
T. R. Cech,
T. R. Hughes, and V. Lundblad.
1997.
Three Ever Shorter Telomere (EST) genes are dispensable for in vitro telomerase activity.
Proc. Natl. Acad. Sci. USA
94:11190-11195[Abstract/Free Full Text].
|
| 16.
|
Lingner, J.,
T. R. Hughes,
A. Shevchenko,
M. Mann,
V. Lundblad, and T. R. Cech.
1997.
Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science
276:561-567[Abstract/Free Full Text].
|
| 17.
|
Louis, E. J.
1995.
The chromosome ends of Saccharomyces cerevisiae.
Yeast
11:1553-1573[Medline].
|
| 18.
|
Lundblad, V., and E. H. Blackburn.
1993.
An alternative pathway for yeast telomere maintenance rescues est1 senescence.
Cell
73:347-360[Medline].
|
| 19.
|
Lundblad, V., and J. W. Szostak.
1989.
A mutant with a defect in telomere elongation leads to senescence in yeast.
Cell
57:633-643[Medline].
|
| 20.
|
Lustig, A. J., and T. D. Petes.
1986.
Identification of yeast mutants with altered telomere structure.
Proc. Natl. Acad. Sci. USA
83:1398-1402[Abstract/Free Full Text].
|
| 21.
|
Morrow, D. M.,
D. A. Tagle,
Y. Shiloh,
F. S. Collins, and P. Hieter.
1995.
TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1.
Cell
82:831-840[Medline].
|
| 22.
|
Naito, T.,
A. Matsuura, and F. Ishikawa.
1998.
Circular chromosome formation in a fission yeast mutant defective in two ATM homologues.
Nat. Genet.
20:203-206[Medline].
|
| 23.
|
Nugent, C. I.,
T. R. Hughes,
N. F. Lue, and V. Lundblad.
1996.
Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance.
Science
274:249-252[Abstract/Free Full Text].
|
| 24.
|
Paciotti, V.,
G. Lucchini,
P. Plevani, and M. P. Longhese.
1998.
Mec1 is essential for phosphorylation of the yeast DNA damage checkpoint protein Ddc1p, which physically interacts with Mec3p.
EMBO J.
17:4199-4209[Medline].
|
| 25.
|
Pardue, M. L.,
O. N. Danilevskaya,
K. Lowenhaupt,
F. Slot, and K. L. Traverse.
1996.
Drosophila telomeres: new views on chromosome evolution.
Trends Genet.
12:48-52[Medline].
|
| 26.
|
Paulovich, A. G.,
R. U. Margulies,
B. M. Garvik, and L. H. Hartwell.
1997.
RAD9, RAD17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage.
Genetics
145:45-62[Abstract].
|
| 27.
|
Porter, S. E.,
P. W. Greenwell,
K. B. Ritchie, and T. D. Petes.
1996.
The DNA-binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae.
Nucleic Acids Res.
24:582-585[Abstract/Free Full Text].
|
| 28.
|
Sanchez, Y.,
B. A. Desany,
W. L. Jones,
Q. Liu,
B. Wang, and S. J. Elledge.
1996.
Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways.
Science
271:357-360[Abstract].
|
| 29.
|
Savitsky, K., et al.
1995.
A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science
268:1749-1753[Abstract/Free Full Text].
|
| 30.
|
Schiestl, R. H., and T. D. Petes.
1991.
Integration of DNA fragments by illegitimate recombination in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
88:7585-7589[Abstract/Free Full Text].
|
| 31.
|
Shampay, J.,
J. W. Szostak, and E. H. Blackburn.
1984.
DNA sequences of telomeres maintained in yeast.
Nature
310:154-157[Medline].
|
| 32.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 33.
|
Singer, M. S., and D. E. Gottschling.
1994.
TLC1: template RNA component of Saccharomyces cerevisiae telomerase.
Science
266:404-409[Abstract/Free Full Text].
|
| 34.
|
Smilenov, L. B.,
S. E. Morgan,
W. Mellado,
S. G. Sawant,
M. B. Kastan, and T. K. Pandita.
1997.
Influence of ATM function on telomere metabolism.
Oncogene
15:2659-2665[Medline].
|
| 35.
|
Stapleton, A., and T. D. Petes.
1991.
The Tn3  -lactamase gene acts as a hotspot for meiotic recombination in yeast.
Genetics
127:39-51[Abstract].
|
| 36.
|
Strand, M.,
T. A. Prolla,
R. M. Liskay, and T. D. Petes.
1993.
Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair.
Nature
365:274-276[Medline].
|
| 37.
|
Thomas, B. J., and R. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
56:619-630[Medline].
|
| 38.
|
Tsukiyama, T., and C. Wu.
1997.
Chromatin modeling and transcription.
Curr. Opin. Genet. Dev.
7:182-191[Medline].
|
| 39.
|
Vialard, J. E.,
C. S. Gilbert,
C. M. Green, and N. F. Lowndes.
1998.
The budding yeast Rad9 checkpoint protein is subjected to Mec1/Tel1-dependent hyperphosphorylation and interacts with Rad53 after DNA damage.
EMBO J.
17:5679-5688[Medline].
|
| 40.
|
Virta-Pearlman, V.,
D. K. Morris, and V. Lundblad.
1996.
Est1 has the properties of a single-stranded telomere end-binding protein.
Genes Dev.
10:3094-3104[Abstract/Free Full Text].
|
| 41.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[Medline].
|
| 42.
|
Walmsley, R. M.,
C. S. M. Chan,
B.-K. Tye, and T. D. Petes.
1984.
Unusual DNA sequences associated with the ends of yeast chromosomes.
Nature
310:157-160[Medline].
|
| 43.
|
Walmsley, R. M., and T. D. Petes.
1985.
Genetic control of telomere length in yeast.
Proc. Natl. Acad. Sci. USA
82:506-510[Abstract/Free Full Text].
|
| 44.
|
Weinert, T. A.,
G. L. Kiser, and L. H. Hartwell.
1994.
Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair.
Genes Dev.
8:652-665[Abstract/Free Full Text].
|
| 45.
|
Zakian, V. A.
1996.
Structure, function, and replication of Saccharomyces cerevisiae telomeres.
Annu. Rev. Genet.
30:141-172[Medline].
|
| 46.
|
Zhao, X.,
E. G. Muller, and R. Rothstein.
1998.
A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools.
Mol. Cell
2:329-340[Medline].
|
Molecular and Cellular Biology, September 1999, p. 6065-6075, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ma, Y., Greider, C. W.
(2009). Kinase-Independent Functions of TEL1 in Telomere Maintenance. Mol. Cell. Biol.
29: 5193-5202
[Abstract]
[Full Text]
-
Seidel, J. J., Anderson, C. M., Blackburn, E. H.
(2008). A Novel Tel1/ATM N-Terminal Motif, TAN, Is Essential for Telomere Length Maintenance and a DNA Damage Response. Mol. Cell. Biol.
28: 5736-5746
[Abstract]
[Full Text]
-
Mori, C., Takanami, T., Higashitani, A.
(2008). Maintenance of Mitochondrial DNA by the Caenorhabditis elegans ATR Checkpoint Protein ATL-1. Genetics
180: 681-686
[Abstract]
[Full Text]
-
Vernon, M., Lobachev, K., Petes, T. D.
(2008). High Rates of "Unselected" Aneuploidy and Chromosome Rearrangements in tel1 mec1 Haploid Yeast Strains. Genetics
179: 237-247
[Abstract]
[Full Text]
-
Longhese, M. P.
(2008). DNA damage response at functional and dysfunctional telomeres. Genes Dev.
22: 125-140
[Abstract]
[Full Text]
-
Baldo, V., Testoni, V., Lucchini, G., Longhese, M. P.
(2008). Dominant TEL1-hy Mutations Compensate for Mec1 Lack of Functions in the DNA Damage Response. Mol. Cell. Biol.
28: 358-375
[Abstract]
[Full Text]
-
Chang, M., Arneric, M., Lingner, J.
(2007). Telomerase repeat addition processivity is increased at critically short telomeres in a Tel1-dependent manner in Saccharomyces cerevisiae. Genes Dev.
21: 2485-2494
[Abstract]
[Full Text]
-
Viscardi, V., Bonetti, D., Cartagena-Lirola, H., Lucchini, G., Longhese, M. P.
(2007). MRX-dependent DNA Damage Response to Short Telomeres. Mol. Biol. Cell
18: 3047-3058
[Abstract]
[Full Text]
-
Bianchi, A., Shore, D.
(2007). Increased association of telomerase with short telomeres in yeast. Genes Dev.
21: 1726-1730
[Abstract]
[Full Text]
-
Hirano, Y., Sugimoto, K.
(2007). Cdc13 Telomere Capping Decreases Mec1 Association but Does Not Affect Tel1 Association with DNA Ends. Mol. Biol. Cell
18: 2026-2036
[Abstract]
[Full Text]
-
Reis, C. C., Campbell, J. L.
(2007). Contribution of Trf4/5 and the Nuclear Exosome to Genome Stability Through Regulation of Histone mRNA Levels in Saccharomyces cerevisiae. Genetics
175: 993-1010
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2007). Control of the yeast telomeric senescence survival pathways of recombination by the Mec1 and Mec3 DNA damage sensors and RPA. Nucleic Acids Res
35: 822-838
[Abstract]
[Full Text]
-
Kedde, M., le Sage, C., Duursma, A., Zlotorynski, E., van Leeuwen, B., Nijkamp, W., Beijersbergen, R., Agami, R.
(2006). Telomerase-independent Regulation of ATR by Human Telomerase RNA. J. Biol. Chem.
281: 40503-40514
[Abstract]
[Full Text]
-
Tseng, S.-F., Lin, J.-J., Teng, S.-C.
(2006). The telomerase-recruitment domain of the telomere binding protein Cdc13 is regulated by Mec1p/Tel1p-dependent phosphorylation. Nucleic Acids Res
34: 6327-6336
[Abstract]
[Full Text]
-
Budd, M. E., Reis, C. C., Smith, S., Myung, K., Campbell, J. L.
(2006). Evidence Suggesting that Pif1 Helicase Functions in DNA Replication with the Dna2 Helicase/Nuclease and DNA Polymerase {delta}.. Mol. Cell. Biol.
26: 2490-2500
[Abstract]
[Full Text]
-
Feldser, D., Strong, M. A., Greider, C. W.
(2006). Ataxia telangiectasia mutated (Atm) is not required for telomerase-mediated elongation of short telomeres. Proc. Natl. Acad. Sci. USA
103: 2249-2251
[Abstract]
[Full Text]
-
Kirchmaier, A. L., Rine, J.
(2006). Cell Cycle Requirements in Assembling Silent Chromatin in Saccharomyces cerevisiae. Mol. Cell. Biol.
26: 852-862
[Abstract]
[Full Text]
-
GREIDER, C.W.
(2006). Telomerase RNA Levels Limit the Telomere Length Equilibrium. Cold Spring Harb Symp Quant Biol
71: 225-229
[Abstract]
-
Nakada, D., Hirano, Y., Tanaka, Y., Sugimoto, K.
(2005). Role of the C Terminus of Mec1 Checkpoint Kinase in Its Localization to Sites of DNA Damage. Mol. Biol. Cell
16: 5227-5235
[Abstract]
[Full Text]
-
Bi, X., Srikanta, D., Fanti, L., Pimpinelli, S., Badugu, R., Kellum, R., Rong, Y. S.
(2005). Drosophila ATM and ATR checkpoint kinases control partially redundant pathways for telomere maintenance. Proc. Natl. Acad. Sci. USA
102: 15167-15172
[Abstract]
[Full Text]
-
Vespa, L., Couvillion, M., Spangler, E., Shippen, D. E.
(2005). ATM and ATR make distinct contributions to chromosome end protection and the maintenance of telomeric DNA in Arabidopsis. Genes Dev.
19: 2111-2115
[Abstract]
[Full Text]
-
Chen, Y.-B., Yang, C.-P., Li, R.-X., Zeng, R., Zhou, J.-Q.
(2005). Def1p Is Involved in Telomere Maintenance in Budding Yeast. J. Biol. Chem.
280: 24784-24791
[Abstract]
[Full Text]
-
Zhao, X., Blobel, G.
(2005). From The Cover: A SUMO ligase is part of a nuclear multiprotein complex that affects DNA repair and chromosomal organization. Proc. Natl. Acad. Sci. USA
102: 4777-4782
[Abstract]
[Full Text]
-
York, S. J., Armbruster, B. N., Greenwell, P., Petes, T. D., York, J. D.
(2005). Inositol Diphosphate Signaling Regulates Telomere Length. J. Biol. Chem.
280: 4264-4269
[Abstract]
[Full Text]
-
Toussaint, M., Dionne, I., Wellinger, R. J.
(2005). Limited TTP supply affects telomere length regulation in a telomerase-independent fashion. Nucleic Acids Res
33: 704-713
[Abstract]
[Full Text]
-
Nakada, D., Hirano, Y., Sugimoto, K.
(2004). Requirement of the Mre11 Complex and Exonuclease 1 for Activation of the Mec1 Signaling Pathway. Mol. Cell. Biol.
24: 10016-10025
[Abstract]
[Full Text]
-
Hao, L.-Y., Strong, M. A., Greider, C. W.
(2004). Phosphorylation of H2AX at Short Telomeres in T Cells and Fibroblasts. J. Biol. Chem.
279: 45148-45154
[Abstract]
[Full Text]
-
d'Adda di Fagagna, F., Teo, S.-H., Jackson, S. P.
(2004). Functional links between telomeres and proteins of the DNA-damage response. Genes Dev.
18: 1781-1799
[Abstract]
[Full Text]
-
Oikemus, S. R., McGinnis, N., Queiroz-Machado, J., Tukachinsky, H., Takada, S., Sunkel, C. E., Brodsky, M. H.
(2004). Drosophila atm/telomere fusion is required for telomeric localization of HP1 and telomere position effect. Genes Dev.
18: 1850-1861
[Abstract]
[Full Text]
-
Baroni, E., Viscardi, V., Cartagena-Lirola, H., Lucchini, G., Longhese, M. P.
(2004). The Functions of Budding Yeast Sae2 in the DNA Damage Response Require Mec1- and Tel1-Dependent Phosphorylation. Mol. Cell. Biol.
24: 4151-4165
[Abstract]
[Full Text]
-
Grossi, S., Puglisi, A., Dmitriev, P. V., Lopes, M., Shore, D.
(2004). Pol12, the B subunit of DNA polymerase {alpha}, functions in both telomere capping and length regulation. Genes Dev.
18: 992-1006
[Abstract]
[Full Text]
-
Bah, A., Bachand, F., Clair, E., Autexier, C., Wellinger, R. J.
(2004). Humanized telomeres and an attempt to express a functional human telomerase in yeast. Nucleic Acids Res
32: 1917-1927
[Abstract]
[Full Text]
-
Bai, Y., Murnane, J. P.
(2003). Telomere Instability in a Human Tumor Cell Line Expressing NBS1 With Mutations at Sites Phosphorylated by ATM. Mol Cancer Res
1: 1058-1069
[Abstract]
[Full Text]
-
Bitterman, K. J., Medvedik, O., Sinclair, D. A.
(2003). Longevity Regulation in Saccharomyces cerevisiae: Linking Metabolism, Genome Stability, and Heterochromatin. Microbiol. Mol. Biol. Rev.
67: 376-399
[Abstract]
[Full Text]
-
Viscardi, V., Baroni, E., Romano, M., Lucchini, G., Longhese, M. P.
(2003). Sudden Telomere Lengthening Triggers a Rad53-dependent Checkpoint in Saccharomyces cerevisiae. Mol. Biol. Cell
14: 3126-3143
[Abstract]
[Full Text]
-
Dahlen, M., Sunnerhagen, P., Wang, T. S.-F.
(2003). Replication Proteins Influence the Maintenance of Telomere Length and Telomerase Protein Stability. Mol. Cell. Biol.
23: 3031-3042
[Abstract]
[Full Text]
-
Qi, H., Li, T.-K., Kuo, D., Nur-E-Kamal, A., Liu, L. F.
(2003). Inactivation of Cdc13p Triggers MEC1-dependent Apoptotic Signals in Yeast. J. Biol. Chem.
278: 15136-15141
[Abstract]
[Full Text]
-
Hand, R. A., Jia, N., Bard, M., Craven, R. J.
(2003). Saccharomyces cerevisiae Dap1p, a Novel DNA Damage Response Protein Related to the Mammalian Membrane-Associated Progesterone Receptor. Eukaryot Cell
2: 306-317
[Abstract]
[Full Text]
-
Forstemann, K., Zaug, A. J., Cech, T. R., Lingner, J.
(2003). Yeast telomerase is specialized for C/A-rich RNA templates. Nucleic Acids Res
31: 1646-1655
[Abstract]
[Full Text]
-
Masrouha, N., Yang, L., Hijal, S., Larochelle, S., Suter, B.
(2003). The Drosophila chk2 Gene loki Is Essential for Embryonic DNA Double-Strand-Break Checkpoints Induced in S Phase or G2. Genetics
163: 973-982
[Abstract]
[Full Text]
-
IJpma, A. S., Greider, C. W.
(2003). Short Telomeres Induce a DNA Damage Response in Saccharomyces cerevisiae. Mol. Biol. Cell
14: 987-1001
[Abstract]
[Full Text]
-
Symington, L. S.
(2002). Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair. Microbiol. Mol. Biol. Rev.
66: 630-670
[Abstract]
[Full Text]
-
Tsai, Y.-L., Tseng, S.-F., Chang, S.-H., Lin, C.-C., Teng, S.-C.
(2002). Involvement of Replicative Polymerases, Tel1p, Mec1p, Cdc13p, and the Ku Complex in Telomere-Telomere Recombination. Mol. Cell. Biol.
22: 5679-5687
[Abstract]
[Full Text]
-
Nakamura, T. M., Moser, B. A., Russell, P.
(2002). Telomere Binding of Checkpoint Sensor and DNA Repair Proteins Contributes to Maintenance of Functional Fission Yeast Telomeres. Genetics
161: 1437-1452
[Abstract]
[Full Text]
-
Enomoto, S., Glowczewski, L., Berman, J.
(2002). MEC3, MEC1, and DDC2 Are Essential Components of a Telomere Checkpoint Pathway Required for Cell Cycle Arrest during Senescence in Saccharomyces cerevisiae. Mol. Biol. Cell
13: 2626-2638
[Abstract]
[Full Text]
-
Craven, R. J., Greenwell, P. W., Dominska, M., Petes, T. D.
(2002). Regulation of Genome Stability by TEL1 and MEC1, Yeast Homologs of the Mammalian ATM and ATR Genes. Genetics
161: 493-507
[Abstract]
[Full Text]
-
Myung, K., Kolodner, R. D.
(2002). Inaugural Article: Suppression of genome instability by redundant S-phase checkpoint pathways in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
99: 4500-4507
[Abstract]
[Full Text]
-
Hathcock, K. S., Hemann, M. T., Opperman, K. K., Strong, M. A., Greider, C. W., Hodes, R. J.
(2002). Haploinsufficiency of mTR results in defects in telomere elongation. Proc. Natl. Acad. Sci. USA
99: 3591-3596
[Abstract]
[Full Text]
-
Kishi, S., Lu, K. P.
(2002). A Critical Role for Pin2/TRF1 in ATM-dependent Regulation. INHIBITION OF Pin2/TRF1 FUNCTION COMPLEMENTS TELOMERE SHORTENING, RADIOSENSITIVITY, AND THE G2/M CHECKPOINT DEFECT OF ATAXIA-TELANGIECTASIA CELLS. J. Biol. Chem.
277: 7420-7429
[Abstract]
[Full Text]
-
Schramke, V., Neecke, H., Brevet, V., Corda, Y., Lucchini, G., Longhese, M. P., Gilson, E., Geli, V.
(2001). The set1{Delta} mutation unveils a novel signaling pathway relayed by the Rad53-dependent hyperphosphorylation of replication protein A that leads to transcriptional activation of repair genes. Genes Dev.
15: 1845-1858
[Abstract]
[Full Text]
-
Ray, A., Runge, K. W.
(2001). Yeast telomerase appears to frequently copy the entire template in vivo. Nucleic Acids Res
29: 2382-2394
[Abstract]
[Full Text]
-
Craven, R. J., Petes, T. D.
(2001). The Saccharomyces cerevisiae Suppressor of Choline Sensitivity (SCS2) Gene Is a Multicopy Suppressor of mec1 Telomeric Silencing Defects. Genetics
158: 145-154
[Abstract]
[Full Text]
-
Hande, M. P., Balajee, A. S., Tchirkov, A., Wynshaw-Boris, A., Lansdorp, P. M.
(2001). Extra-chromosomal telomeric DNA in cells from Atm-/- mice and patients with ataxia-telangiectasia. Hum Mol Genet
10: 519-528
[Abstract]
[Full Text]
-
Gallego, M. E., White, C. I.
(2001). RAD50 function is essential for telomere maintenance in Arabidopsis. Proc. Natl. Acad. Sci. USA
98: 1711-1716
[Abstract]
[Full Text]
-
Mallory, J. C., Petes, T. D.
(2000). Protein kinase activity of Tel1p and Mec1p, two Saccharomyces cerevisiae proteins related to the human ATM protein kinase. Proc. Natl. Acad. Sci. USA
10.1073/pnas.250475697v1
[Abstract]
[Full Text]
-
San-Segundo, P. A., Roeder, G. S.
(2000). Role for the Silencing Protein Dot1 in Meiotic Checkpoint Control. Mol. Biol. Cell
11: 3601-3615
[Abstract]
[Full Text]
-
Longhese, M. P., Paciotti, V., Neecke, H., Lucchini, G.
(2000). Checkpoint Proteins Influence Telomeric Silencing and Length Maintenance in Budding Yeast. Genetics
155: 1577-1591
[Abstract]
[Full Text]
-
Fritz, E., Friedl, A. A., Zwacka, R. M., Eckardt-Schupp, F., Meyn, M. S.
(2000). The Yeast TEL1 Gene Partially Substitutes for Human ATM in Suppressing Hyperrecombination, Radiation-Induced Apoptosis and Telomere Shortening in A-T Cells. Mol. Biol. Cell
11: 2605-2616
[Abstract]
[Full Text]
-
Xia, J., Peng, Y., Mian, I. S., Lue, N. F.
(2000). Identification of Functionally Important Domains in the N-Terminal Region of Telomerase Reverse Transcriptase. Mol. Cell. Biol.
20: 5196-5207
[Abstract]
[Full Text]
-
Forstemann, K., Hoss, M., Lingner, J.
(2000). Telomerase-dependent repeat divergence at the 3' ends of yeast telomeres. Nucleic Acids Res
28: 2690-2694
[Abstract]
[Full Text]
-
Gasser, S. M.
(2000). A Sense of the End. Science
288: 1377-1379
[Abstract]
[Full Text]
-
Ritchie, K. B., Petes, T. D.
(2000). The Mre11p/Rad50p/Xrs2p Complex and the Tel1p Function in a Single Pathway for Telomere Maintenance in Yeast. Genetics
155: 475-479
[Abstract]
[Full Text]
-
Craven, R. J., Petes, T. D.
(2000). Involvement of the Checkpoint Protein Mec1p in Silencing of Gene Expression at Telomeres in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 2378-2384
[Abstract]
[Full Text]
-
BLACKBURN, E.H., CHAN, S., CHANG, J., FULTON, T.B., KRAUSKOPF, A., MCEACHERN, M., PRESCOTT, J., ROY, J., SMITH, C., WANG, H.
(2000). Molecular Manifestations and Molecular Determinants of Telomere Capping. Cold Spring Harb Symp Quant Biol
65: 253-264
[Abstract]
-
DUBOIS, M.L., DIEDE, S.J., STELLWAGEN, A.E., GOTTSCHLING, D.E.
(2000). All Things Must End: Telomere Dynamics in Yeast. Cold Spring Harb Symp Quant Biol
65: 281-296
[Abstract]
-
WEINERT, T., LITTLE, E., SHANKS, L., ADMIRE, A., GARDNER, R., PUTNAM, C., MICHELSON, R., NYBERG, K., SUNDARESHAN, P.
(2000). Details and Concerns Regarding the G2/M DNA Damage Checkpoint in Budding Yeast. Cold Spring Harb Symp Quant Biol
65: 433-442
[Abstract]
-
Ray, A., Runge, K. W.
(1999). Varying the number of telomere-bound proteins does not alter telomere length in tel1Delta cells. Proc. Natl. Acad. Sci. USA
96: 15044-15049
[Abstract]
[Full Text]
-
Myung, K., Kolodner, R. D.
(2002). Inaugural Article: Suppression of genome instability by redundant S-phase checkpoint pathways in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
99: 4500-4507
[Abstract]
[Full Text]
-
Mallory, J. C., Petes, T. D.
(2000). Protein kinase activity of Tel1p and Mec1p, two Saccharomyces cerevisiae proteins related to the human ATM protein kinase. Proc. Natl. Acad. Sci. USA
97: 13749-13754
[Abstract]
[Full Text]
Top
Abstract
Introduction
