Previous Article | Next Article 
Molecular and Cellular Biology, September 1999, p. 6174-6182, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of cis and
trans Elements Involved in the Cell Cycle Regulation of
Multiple Genes in Crithidia fasciculata
Riaz
Mahmood,
Jane C.
Hines, and
Dan S.
Ray*
Molecular Biology Institute and Department of
Microbiology, Immunology and Molecular Genetics, University of
California, Los Angeles, Los Angeles, California 90095-1570
Received 31 March 1999/Returned for modification 9 June
1999/Accepted 15 June 1999
 |
ABSTRACT |
Transcripts of several DNA replication genes, including the
RPA1 and TOP2 genes, encoding the large subunit
of nuclear replication protein A and the kinetoplast topoisomerase II,
accumulate periodically during the cell cycle in the trypanosomatid
Crithidia fasciculata. An octamer consensus sequence,
CAUAGAAG, present in the 5' untranslated regions (UTR) of these mRNAs
is required for periodic accumulation of the TOP2 and
RPA1 transcripts and also for binding of a nuclear factor(s) to the 5' UTR RNAs of these genes. We show here that insertion of multiple (six) copies of this octamer sequence (6× octamer) into the 5' UTR of a reporter gene confers periodic
accumulation on its transcript. Competition experiments and UV
cross-linking studies show that the 6× octamer RNA and
TOP2 5' UTR RNA bind to the same nuclear factor(s).
Single-nucleotide substitutions in the 6× octamer that abolish the RNA
gel shift also prevent cyclic accumulation of the reporter gene
transcript. A protein termed cycling element binding protein, purified
by affinity chromatography using 6× octamer RNA as a ligand, binds to
RNAs containing wild-type octamers and not to those with mutant
octamers. These results define a small sequence element in C. fasciculata mRNAs required for their cell cycle regulation and
report the identification and purification of a putative regulatory
protein that binds specifically to these elements.
 |
INTRODUCTION |
Trypanosomes contain a single
mitochondrion with a unique form of DNA called kinetoplast DNA (kDNA)
that consists of two types of circular molecules: interlocked
minicircles and maxicircles (23, 25, 26). In the
trypanosomatid Crithidia fasciculata there are approximately
20 to 30 maxicircles of 37 kbp and about 5,000 minicircles of 2.5 kbp
each. Replication of the minicircles occurs by a mechanism in which
minicircles are released from the network prior to their duplication
(8). After replication the daughter minicircles are rejoined
to the network periphery while they still contain nicks and gaps
(24). Maxicircles appear to replicate while still attached
to the network (11).
An unusual feature of kDNA replication is its coordination with nuclear
DNA synthesis (7, 19). In most eukaryotes, mitochondrial DNA
replication occurs continuously throughout the cell cycle (3, 10,
32). Recent studies with C. fasciculata have shown that mRNA levels of both nuclear DNA and kDNA replication genes are
regulated in a cell cycle-specific manner (19, 20). The steady-state transcript levels of the genes encoding the kinetoplast topoisomerase II (TOP2), dihydrofolate reductase-thymidylate
synthetase (DHFR-TS), and the large and middle subunits
(RPA1 and RPA2) of the nuclear single-strand DNA
binding protein replication protein A (RPA) all begin to accumulate
prior to S phase and then decline rapidly (19). Synthesis of
the kinetoplast topoisomerase II and the large subunit of RPA occurs in
parallel with the accumulation of TOP2 and RPA1
mRNAs, resulting in a doubling of the levels of these proteins during
each S phase (4, 12). A consensus octamer sequence,
CATAGAAG, with a conserved central hexamer core, is present
in the 5' untranslated regions (UTRs) of these genes (20).
Deletion and linker insertion analysis has shown that the octamer
sequence is required for cycling of TOP2 and RPA1 gene transcripts (4, 20).
In trypanosomes, most genes transcribed by RNA polymerase II are
regulated posttranscriptionally (31). Protein-coding genes are often organized in polycistronic units transcribed from the same
promoter but yield very different steady-state mRNA levels or are
differentially expressed during the life cycle of trypanosomes (21). Their regulation is exerted largely at a
posttranscriptional level and is thought to involve pre-mRNA turnover
in combination with differential rates of trans-splicing of
a 39-nucleotide mini-exon to the 5' ends of all mRNAs and
polyadenylation. At present, there is no evidence for any
transcriptional regulation of genes transcribed by RNA polymerase II in trypanosomatids.
The mechanisms involved in regulating the expression of trypanosomatid
genes during the cell cycle are unknown. We have initiated studies to
identify the trans-acting factors involved in conferring periodic expression on kDNA and nuclear DNA replication genes. Using
gel retardation assays, we have previously shown that C. fasciculata nuclear extracts contain a protein factor(s) that binds to the 5' UTR RNAs of the TOP2 and RPA1
genes (17). Mutation of the octamer sequences in the 5' UTRs
of these genes abolished binding of the nuclear factor(s). Competition
experiments showed that the same factor(s) binds to both
TOP2 and RPA1 RNAs. These results suggest the
interesting possibility that nuclear and mitochondrial DNA replication
genes may be coordinately regulated at a posttranscriptional level by a
common trans-acting RNA binding protein(s).
These studies define at the nucleotide level the sequence element
required for periodic accumulation of the TOP2 and
RPA1 mRNAs during the cell cycle. A protein (cycling element
binding protein [CEBP]) purified on the basis of its specific binding to this sequence element is postulated to be a regulator of the levels
of multiple mRNAs during the cell cycle.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmid p
10Not has been described previously
(20). Plasmids pRM18 and pRM18R each contain six copies of
the octamer sequence, separated by 2 bp each, cloned into the
NotI site of p
10Not in opposite orientations (Fig. 1).
They were constructed by annealing oligonucleotides C89
(GGCCGACATAGAAGG GCATAGAAGAACATAGAAGATC A T AGAAGCGCATAGAAG TTCATAGAAGGC)
and C90
(GGCCGCCTTCTATGAACTTCTATGCGCTTCTATGATCTTCTATGTTCTTCTATGCCCTTCTATGTG) and inserting them into the NotI site of p
10Not
(the octamer sequences in C89 and C90 are in boldface). We term this
synthetic DNA sequence the 6× octamer. Plasmids pRM25 and pRM27 are
similar to pRM18 but have mutant 6× octamers (CATcGAAG and
CATAGAcG, respectively) cloned into the NotI site
of p
10Not. (Nucleotide substitutions in the octamer sequence are
indicated in lowercase here and elsewhere in the text.) Plasmids pRM16
and pRM16R contain wild-type 6× octamer sequences cloned into the
NotI site of pGEM13Zf(+) (Promega) in opposite orientations.
Plasmids containing mutant 6× octamers cloned into the NotI
site of pGEM13Zf(+) were constructed as described above by annealing
oligonucleotides related to C89 and C90 that differed only in the
octamer sequence. These plasmids are pRM19 (CAgAGAAG), pRM20
(CATcGAAG), pRM21 (CcTAGAAG), pRM22M
(CATAtAAG), pRM23M (CATAGcAG), and pRM24
(CATAGAcG). Plasmid pRM12 contains the wild-type
291-to-
209 region of the TOP2 gene cloned into the
SmaI site of pUC19 (17). All plasmids were
electroporated separately into C. fasciculata as described
elsewhere (19).
PCR to generate templates for in vitro transcription.
Plasmid pRM12, linearized with HindIII, was used as a
template in PCR to generate products that were in turn used as
templates for in vitro synthesis of
291-to-
209 TOP2 RNA
in which both octamers present were either wild type or mutant. The
template for making wild-type TOP2 RNA was prepared by PCR
as described previously (17). The PCR product used as a
template to generate
291-to-
209 TOP2 RNA in which the
two octamers had been changed to CATcGAAG was made by using
oligonucleotides D37
(GGATCCTAATACGACTCACTATAGGGAGGAGCATcGAAGTATTGCGGGT) and D38
(CGGGAGTCGGCCGATCTTCgATGATGGGCTTTCGACACCTCTCT) as
5' and 3' primers, respectively. (The mutant octamer sequences are in
boldface). Mutant TOP2 RNA with CATAGAcG octamers
was made from the PCR product by using oligonucleotides D39
(GGATCC TAATACGACTCAC TATAGGGAGGCGCATAGAcG TAT TGCGGG)
and D40
(CGGGAGTCGGCCGATCgTCTATGGGCTTTCGACACCTCTCT) as 5'
and 3' primers, respectively.
In vitro transcription and gel retardation assay.
Wild-type
and mutant 6× octamer RNA probes were synthesized by using plasmids
linearized with NotI (except for pRM16R and pRM22M, which
were cut with HindIII) as templates for in vitro transcription by T7 RNA polymerase. Wild-type and mutant
TOP2
291-to-
209 RNAs were generated by using PCR
products containing a T7 promoter as templates for transcription by T7
RNA polymerase. The in vitro transcription reactions and gel
retardation assays were performed by using the Maxiscript kit (Ambion)
with [
-32P]ATP as described previously
(17). Gel retardation assays were performed with
32P-labeled RNA probes in the presence of 6.7 mg of
heparin/ml as a nonspecific competitor. After 15 min at 28°C, the
reaction mixtures were electrophoresed at 200 V on nondenaturing 6%
polyacrylamide gels (17).
Purification of CEBP.
Nuclear extracts were prepared from
Nonidet P-40-lysed C. fasciculata Cf-C1 cells essentially as
described previously (17) and were stored at
70°C.
Nuclear extracts were thawed, and solid ammonium sulfate was added (to
40% saturation) with stirring on ice over 15 min. The solution was
stirred for 45 min more and centrifuged at 12,000 rpm in a Sorvall GSA
rotor for 25 min at 4°C. The pellet was resuspended in buffer E (20 mM Tris-HCl [pH 8.0], 1 mM dithiothreitol [DTT], 5 mM
MgCl2, 20% glycerol) and centrifuged at 40,000 rpm for 30 min in a Beckman 45 Ti rotor. The supernatant was carefully removed and
dialyzed against 20 mM Tris-HCl (pH 8.0)-1 mM DTT-5 mM
MgCl2 buffer for 60 min at 4°C. Glycerol was added to a
final concentration of 20% (vol/vol), and the solution was centrifuged
in a Sorvall SS-34 rotor at 15,000 rpm for 10 min to remove insoluble
material. The supernatant was applied on a 40-ml DEAE-cellulose column
equilibrated in buffer E containing 50 mM KCl. The column was washed
with 150 to 200 ml of buffer E plus 50 mM KCl at a flow rate of 1 ml/min to remove unbound proteins. The TOP2 RNA binding
activity was eluted by washing the column with buffer E plus 100 mM
KCl. The proteins, in fractions containing the binding activity, were
precipitated by ammonium sulfate (0 to 40% cut) as described above.
The pellet was redissolved in buffer F (20 mM Tris-HCl [pH 8.0]-1 mM
DTT-1 mM EDTA-20% glycerol) and divided into four aliquots. Each
aliquot was run separately on a 1-ml UNO-Q (Bio-Rad) fast protein
liquid chromatography (FPLC) column equilibrated in buffer F. The
binding activity was eluted with a linear 0 to 300 mM KCl gradient in buffer F.
A 1-ml column of oligo(dT) cellulose was prepared and washed with 10 to
15 ml of 0.1 N NaOH and 15 ml of buffer G (20 mM HEPES [pH 7.9]-1 mM
EDTA-0.25 M KCl). A 6× octamer RNA with a 25-base polyadenylate tail
at the 3' terminus (200 to 300 µg) was ethanol precipitated and
resuspended in buffer G. The RNA was heated to 70°C for 15 min,
slowly cooled to room temperature, and applied on the oligo(dT)
cellulose column and recycled three to four times. The column was then
equilibrated in buffer H (20 mM HEPES [pH 7.9]-1 mM DTT-5 mM
MgCl2-20% glycerol) containing 50 mM KCl. Subsequent operations were carried out at 4°C. The active fractions from the
UNO-Q column were diluted 1:1 with buffer H and loaded on the 6×
octamer RNA affinity column. The flowthrough material was reapplied on
the column. The column was then washed (flow rate, 0.5 ml/min)
successively with 15 to 20 ml of buffer H containing KCl at the
following molar concentrations: 0.05, 0.15, 0.3 (alone or with 4 mg of
heparin/ml), 0.6, and 1. Fractions were collected (0.5 to 1.0 ml), and
5 µl was assayed for binding activity. Proteins were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
(16), and gels were stained with silver (18) or Coomassie blue R-250.
Synthesis of 6× octamer-A25 RNA.
Plasmid
pRM16, containing six copies of wild-type octamer DNA, was linearized
with HindIII. The 6× octamer DNA was amplified by PCR
using HindIII-cut pRM16 as a template with a 5' primer that has a T7 promoter sequence (oligo E3,
TGAATTGTAATACGACTCACTATA) and a 3' primer with 25 T residues
at the 5' end (oligo E4; T25GAGCGGCCGCCTTCTATGAA). This gives a PCR product with a T7 promoter sequence at the 5' end and 25 T residues at the 3' end. In vitro transcription by T7 RNA
polymerase using this PCR product as a template yields 6× octamer RNA
with 25 A residues at the 3' end. Unlabeled 6× octamer-A25 RNA (200 to 300 µg) was synthesized by in
vitro transcription using the above PCR product as a template (160 to
200 ng) with the T7 MEGA shortscript kit from Ambion. After 3 h of
incubation at 37°C, the template DNA was removed by treatment with 2 U of DNase I for 15 min at 37°C. The 6× octamer-A25 RNA
was phenol-chloroform extracted and ethanol precipitated. A 6×
CAUcGAAG-A25 RNA was prepared in the same manner.
Northwestern blotting.
CEBP (50 ng), purified by affinity
column chromatography, was electrophoresed on duplicate 10%
polyacrylamide gels containing 0.1% SDS (16). Northwestern
blotting was performed as described previously (6, 30),
and each nitrocellulose transfer membrane was then incubated for 60 min
at room temperature with 5 ml of binding buffer (20 mM HEPES [pH
7.9]- 50 mM KCl-5 mM MgCl2-0.5 mM DTT-20%
glycerol-2 mg of heparin/ml) containing 1 × 107 to
2 × 107 cpm of 32P-labeled 6× octamer
RNA (wild type) or 6× antisense octamer RNA as a probe. After two
washes of 10 min each with washing buffer (20 mM HEPES [pH 7.9]-20
mM KCl-5 mM MgCl2-0.5 mM DTT-20% glycerol) at room
temperature, the filters were air dried and exposed to X-ray film.
Glycerol gradient sedimentation.
Affinity-purified CEBP was
sedimented for 19 h in a Beckman SW 50.1 rotor through a 4.9-ml 10 to 30% glycerol gradient containing 50 mM HEPES (pH 7.9), 150 mM KCl,
1 mM DTT, and 133 µg of bovine serum albumin/ml at 2°C. T7 RNA
polymerase and the Klenow fragment of DNA polymerase I were sedimented
in a parallel gradient under the same conditions as markers.
Other methods.
Proteins bound to 32P-labeled 6×
octamer RNA were identified by UV cross-linking of gel-purified
complexes and analyzed as described previously (17).
Synchronization of C. fasciculata cultures by hydroxyurea
and Northern blot analysis were performed as described previously
(19, 20). Quantitation of Northern blots was performed with
a Molecular Dynamics PhosphorImager and Image Quant software.
 |
RESULTS |
The 6× octamer confers cyclic accumulation on a reporter
mRNA.
Previous experiments have shown that octamer sequences
present in the 5' UTRs of the RPA1 and TOP2 genes
are required for conferring periodic accumulation on the mRNAs
(4, 20). We next wanted to determine whether the octamer
sequence alone is sufficient to confer periodic accumulation on a
heterologous gene transcript. The p
10Not reporter plasmid used in
these studies contains a partial cDNA sequence of the C. fasciculata homolog of the Trypanosoma cruzi flagellar
calcium binding protein (CaBP) as a reporter (8). The
endogenous CaBP transcript is expressed at a constant level
during the cell cycle in synchronized C. fasciculata cells
(19). The plasmid also contains the TOP2 5' UTR
sequences from
883 to
609 and from
40 to +1 (Fig.
1, upper panel). These sequences include
the major TOP2 splice acceptor site at
668 and an upstream
polypyrimidine tract. However, it lacks the sequences necessary for
periodic accumulation of plasmid-encoded TOP2 transcript (20). A NotI site was introduced at the junction
between
609 and
40, allowing insertion of DNA fragments at this
site.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
The 6× octamer confers cyclic accumulation on a
reporter transcript. Total RNA was isolated from synchronized cells
carrying pRM18 (A and B) or pRM18R (C and D) at the time of release (0 min) or at 30-min intervals after release from hydroxyurea arrest. The
RNAs were subjected to Northern blot analysis (A and C) by hybridizing
to probes that detect the 6× octamer-CaBP chimeric
transcripts and the endogenous CaBP transcripts. The
transcript levels in the Northern blots were quantitated with a
PhosphorImager (Molecular Dynamics) (B and D). Chimeric RNA transcript
levels have been normalized at each time point relative to that of
CaBP transcript, which is expressed at a constant level
during the cell cycle and serves as a loading control. A diagram of the
relevant sequences (not to scale) contained in each plasmid is shown at
the top of the figure. NEO is the neomycin phosphotransferase gene with
5' and 3' flanking sequences from the Leishmania major
DHFR-TS gene for expression of G418 resistance in
Crithidia. AG1 is the major TOP2
splice acceptor site.
|
|
A DNA fragment containing six copies of the octamer sequence, separated
by 2 bp each, was cloned into p

10Not. Plasmids carrying
the 6×
octamers in the sense (RM18) and the antisense (pRM18R)
orientation
were introduced into
C. fasciculata, and the cell
cultures
were synchronized by treatment with hydroxyurea. Figure
1 shows
Northern blot and PhosphorImager quantitation analysis
of RNA isolated
from synchronized cells carrying these plasmids.
The insertion of 6×
octamers in the sense orientation in p

10Not
results in
plasmid-encoded chimeric transcripts that accumulate
periodically
during the cell cycle. The chimeric transcript is
present at high
levels immediately after release from hydroxyurea
arrest and again at
210 min after release. The maximum level at
210 min is 10-fold higher
than the minimum at 120 min. The maximum
and minimum transcript levels
occur at approximately the same
times as those observed for endogenous
TOP2 and
RPA1 transcript
levels (
4,
20). As expected, the endogenous
CaBP transcript
is
present at a constant level as cells progress through the cell
cycle.
In contrast, similar analysis of RNA from synchronized
cells carrying
plasmid pRM18R, in which the 6× octamer is in an
antisense
orientation, shows less than twofold variation in RNA
levels during the
cell cycle (Fig.
1C and D). However, the relative
levels of the
reporter transcript in cells containing pRM18R are
about the same as,
or higher than, the maximum level of the reporter
transcript containing
the sense orientation of the 6× octamer
(Fig.
1B and D). A p

10Not
plasmid containing only a single copy
of the octamer consensus sequence
did not confer periodic accumulation
on the chimeric RNA (data not
shown). These results indicate that
multiple copies of the octamer
sequence can confer periodic accumulation
on a heterologous transcript
in an orientation-dependent
manner.
Factors in nuclear extracts bind to 6× octamer RNA.
Nuclear
extracts of C. fasciculata contain a protein factor(s) that
binds to RNA encoded by 5' UTR elements required for periodic accumulation of TOP2 and RPA1 mRNAs
(17). Mutations in the 5' UTR that abolished cycling of the
reporter gene transcript also eliminated binding of the nuclear
factor(s) to the corresponding mutant RNA probes. Since six copies of
the octamer sequence were able to confer periodic accumulation on a
heterologous gene transcript, it was of interest to determine whether
the nuclear factor(s) would bind to the 6× octamer RNA. Labeled 6×
octamer RNA was incubated with C. fasciculata nuclear
extracts and then electrophoresed on a nondenaturing polyacrylamide gel
to separate free and bound RNA. Two gel-shifted bands are seen,
indicating the presence of a nuclear factor(s) that binds to the 6×
octamer RNA (Fig. 2). No binding to an
antisense 6× octamer RNA probe was observed. When nuclear extracts
were incubated with TOP2
291-to-
209 RNA, two shifted
bands were observed as before (17). Interestingly, severalfold-higher binding of the nuclear factor(s) to the 6× octamer
RNA is observed compared to that of the TOP2 RNA. These results show that nuclear extracts of C. fasciculata contain
a factor(s) that exhibits specific and strong binding to the 6× octamer RNA.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 2.
6× octamer RNA binds factors in nuclear extracts. RNA
probes were incubated with nuclear extracts (NE) for 15 min at 28°C
and analyzed by nondenaturing PAGE. Probes used were 6× octamer sense
RNA, 6× octamer antisense RNA, and 291-to- 209 TOP2 RNA.
The retarded complexes are indicated by a bracket.
|
|
Effect of mutations on cycling of reporter gene mRNA and binding of
a nuclear factor(s) to 6× octamer RNA.
The role of individual
nucleotides in the binding of RNA to a nuclear factor(s) was
investigated by using mutant 6× octamer RNA probes in the gel
retardation assay. Single-nucleotide substitutions were introduced into
the central hexamer core of the octamer, since the hexamer is
completely conserved in several C. fasciculata gene
transcripts that show periodic accumulation during the cell cycle
(20). RNA probes in which all six octamers contained the same single-nucleotide substitution were prepared. The wild-type and
mutant 6× octamer RNA probes were incubated with nuclear extracts and
analyzed for binding by gel retardation assay. Mutation of any of the
first 5 nucleotides of the hexamer abolished the formation of specific
RNA-protein complexes (Fig. 3). More
rapidly migrating minor bands observed with each of these five mutant
RNAs were not characterized further. Binding of nuclear factors to 6×
CAUAGAcG RNA was observed but was significantly reduced
compared to their binding to wild-type 6× octamer RNA. Therefore, the
first 5 nucleotides of the hexamer core appear to be critical for the
binding of a factor(s) to the 6× octamer RNA.

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 3.
Single-nucleotide substitutions in the 6× octamer RNA
prevent binding by nuclear factors. Wild-type or mutant 6× octamer RNA
probes were incubated in the absence ( ) or presence (+) of 17 µg of
nuclear extracts (NE) and analyzed by nondenaturing PAGE.
|
|
We next determined the effect of these substitutions on the ability of
mutant 6× octamers to confer periodic accumulation
on the reporter
gene transcript. Two mutations were selected based
on results of the
gel retardation assay: CAUcGAAG, which abolished
specific
complex formation, and CAUAGAcG, which reduced the binding
of a factor(s) to 6× octamer RNA. DNA fragments containing 6×
CATcGAAG or 6× CATAGAcG were cloned into
p

10Not in the sense
orientation to give plasmids pRM25 and pRM27,
respectively. These
plasmids were then electroporated separately into
C. fasciculata.
RNA was isolated from
hydroxyurea-synchronized cells carrying
pRM25 or pRM27 and subjected to
Northern blot analysis (Fig.
4).
Cloning
of 6× CATAGAcG into p

10Not (plasmid pRM27) conferred
periodic accumulation on the chimeric transcript. The maximum
transcript level at 210 min after release from hydroxyurea block
is
10.6-fold higher than the minimum transcript level at 120 min
(Fig.
4B). The chimeric transcript levels in synchronized
C. fasciculata cells carrying pRM27 are similar to those from cells
carrying
pRM18 (compare Fig.
1B and
4B). In contrast, plasmid pRM25
produced
a chimeric transcript that did not accumulate in the manner
seen
for pRM18 and pRM27 (Fig.
4D). In this case the trough was shifted
to 150 min, and the transcript levels increased by only approximately
twofold thereafter, although, as for pRM18R, the reporter transcript
levels expressed from pRM25 were generally at or above the maximum
level of the transcript from the construct that cycles (pRM27).
Since
the mutant 6× CATAGAcG could confer periodic accumulation
on the chimeric transcript, the reduced level of binding by the
corresponding mutant 6× octamer RNA is apparently sufficient to
confer
periodic accumulation on the transcript.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot analysis of total RNA isolated from
hydroxyurea-synchronized C. fasciculata strains carrying
plasmid pRM25 or pRM27. RNA was isolated from synchronized cells
carrying pRM27 (A and B) or pRM25 (C and D) and analyzed by Northern
blotting as in Fig. 1.
|
|
The same nuclear factor(s) binds to wild-type 6× octamer RNA and
TOP2 5' UTR RNA.
UV cross-linking of the 6× octamer
RNA to bound proteins was performed to identify the proteins in
gel-shifted complexes. The binding activity was partially purified by
ammonium sulfate precipitation of proteins in nuclear extracts followed
by chromatography on a DEAE-cellulose column (17). The
partially purified protein was used in the gel retardation assay with
wild-type 6× octamer RNA as a probe. The gel slice containing the
RNA-protein complexes was irradiated with UV light for 1 min, and the
cross-linked complex was eluted from the gel. After digestion with
RNases A and T1, the labeled proteins were electrophoresed
on SDS-polyacrylamide gels and visualized by autoradiography. Two
polypeptides of approximately 74 and 38 kDa were labeled by the 6×
octamer RNA (Fig. 5). Similar-sized proteins have been shown to be cross-linked to TOP2
291-to-
209 RNA (17). Thus, the 6× octamer and
TOP2 RNA probes bind to proteins of the same molecular mass.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
UV cross-linking of proteins to 6× octamer RNA.
Proteins cross-linked to 32P-labeled 6× octamer RNA were
analyzed by SDS-PAGE and autoradiography after digestion of
gel-isolated complexes with RNases A and T1.
|
|
To confirm that the 6× octamer RNA and
TOP2 RNA probes bind
to the same protein(s), nuclear extracts were incubated with a
labeled

291-to-

209
TOP2 RNA probe in the absence or presence
of
unlabeled 6× CAUAGAAG (wild type) or 6× CAUcGAAG
(mutant) RNA.
The 6× CAUcGAAG RNA was used as a
control, since it does not bind
to a nuclear factor(s) (see Fig.
3).
The presence of unlabeled
6× CAUAGAAG RNA reduced the
binding of the nuclear factor(s) to
the
TOP2 RNA probe (Fig.
6, lanes 3 and 4), but unlabeled 6×
CAUcGAAG
RNA did not have a significant effect (lanes 5 and
6), indicating
that the
TOP2 RNA and 6× octamer RNA bind to
the same factor(s).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Competition between TOP2 5' UTR and 6×
octamer RNAs for binding to a factor(s) in nuclear extracts. The
32P-labeled 291-to- 209 TOP2 RNA probe was
incubated with 17 µg of nuclear extract in the absence (lane 2) or
presence of a three- or sixfold molar excess of unlabeled wild-type
(lanes 3 and 4) or mutant (CAUcGAAG) (lanes 5 and 6) 6×
octamer RNAs. The complexes formed were analyzed by nondenaturing PAGE.
Lane 1, TOP2 RNA probe in the absence of nuclear extract.
|
|
Effects of point mutations on binding to TOP2 5' UTR
RNA.
The TOP2
291-to-
209 5' UTR RNA contains two
octamers, one at either end of the RNA. We have previously shown that
mutation of both octamers to a different sequence eliminated binding of a factor(s) to the mutant RNA (17). Since the same nuclear
factor(s) binds to the TOP2 5' UTR and the 6× octamer RNA,
it was important to determine whether single-nucleotide substitutions
would have a similar effect on binding to mutant TOP2 RNA as
they did on binding to mutant 6× octamer RNA. Both octamers in
TOP2 RNA were changed either to CAUcGAAG or to
CAUAGAcG. These two mutations were selected because the 6×
CAUcGAAG RNA shows no binding, while 6× CAUAGAcG
shows reduced binding, to a nuclear factor(s) (see Fig. 3). The
TOP2 RNA in which both octamers were CAUcGAAG
does not bind to a nuclear factor(s) (Fig.
7, lanes 3 and 4). In contrast, the
TOP2 RNA with both CAUAGAcG octamers shows
binding that is significantly reduced compared to that seen with
wild-type TOP2 RNA (Fig. 7; compare lanes 2 and 6).
Therefore, mutations that eliminate or reduce binding to 6× octamer
RNA have similar effects on binding to TOP2 RNA containing
the corresponding mutant octamers.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 7.
Gel retardation assay with wild-type or mutant
TOP2 5' UTR RNA. The 291-to- 209 TOP2 RNA
probes containing both wild-type (CAUAGAAG) or mutant
(CAUcGAAG or CAUAGAcG) octamer sequences were
incubated in the absence ( ) or presence (+) of 17 µg of nuclear
extracts (NE) and analyzed by nondenaturing PAGE.
|
|
The binding activity varies during the cell cycle.
Since the
mRNA levels of several DNA replication genes vary during the cell
cycle, with maximum levels present at G1/S phase (19), we wanted to determine whether the specific RNA
binding activity observed here also varied during the cell cycle.
Nuclear extracts were prepared from synchronous cultures at 30-min
intervals after release from hydroxyurea block and were assayed for
binding activity by using the
291-to-
209 TOP2 RNA probe.
Total RNA was also isolated from the synchronized cells and subjected
to Northern blot analysis to detect TOP2 RNA. As shown in
Fig. 8, the TOP2 RNA binding
activity varies during the cell cycle (Fig. 8A) and follows the same
pattern as TOP2 mRNA levels (Fig. 8B).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 8.
(A) TOP2 5' UTR RNA binding activity in
nuclear extracts prepared from hydroxyurea-synchronized cells. Cultures
of C. fasciculata were synchronized with hydroxyurea, and
nuclear extracts were prepared at 30-min intervals after release from
hydroxyurea arrest. The nuclear extracts (8 µg) were assayed for
binding activity with the TOP2 291-to- 209 RNA probe. (B)
Total RNA was isolated from synchronized cells and subjected to
Northern blot analysis by hybridizing with a probe that detects
TOP2 mRNA.
|
|
Purification of CEBP.
The TOP2 RNA binding activity
was purified from crude nuclear extracts of C. fasciculata
cultures by successive chromatography on a DEAE-cellulose column, a
UNO-Q FPLC anion-exchange column, and an RNA affinity column by using
6× octamer RNA as a ligand. SDS-PAGE analysis and silver staining of
protein fractions containing the binding activity from the affinity
column demonstrated the presence of two polypeptides with molecular
masses of approximately 38 and 48 kDa (Fig.
9B) that were eluted with 0.6 M KCl.
During this purification scheme, it was important to partially purify the binding protein before applying it to the affinity column; otherwise, several other polypeptides were present in fractions containing the binding activity. Control experiments were also done to
determine the specificity of binding. A 6× CAUcGAAG RNA affinity column was prepared as described above, and the partially purified proteins (FPLC fractions) were applied to it. A 6×
CAUcGAAG RNA column was prepared, since no binding is seen
to the 6× CAUcGAAG RNA (Fig. 3). When the 6× CAUcGAAG
column was washed with KCl, most of the specific RNA binding
activity eluted in the 0.15 M wash and some eluted in 0.3 M KCl
fractions. No binding activity was observed in 0.6 M KCl fractions.
SDS-PAGE analysis of 0.6 M KCl fractions showed the absence of the 38- and 48-kDa polypeptides (data not shown). When the 0.15 and 0.3 M KCl
fractions were pooled and applied on a 6× CAUAGAAG column,
the binding activity eluted in the 0.6 M KCl fraction and contained the
38- and 48-kDa polypeptides (data not shown). These results suggest
that the two polypeptides are subunits of the binding protein.

View larger version (116K):
[in this window]
[in a new window]
|
FIG. 9.
Purification of CEBP. Samples from each stage of
purification were separated on 10% polyacrylamide gels containing
0.1% SDS. (A) Coomassie blue-stained gel showing proteins in nuclear
extracts (NE), ammonium sulfate precipitate (A.S.), DEAE-cellulose
pooled fractions, and UNO-Q FPLC column fractions. (B) Silver-stained
gel showing proteins in the 0.6 M KCl wash of the 6× octamer RNA
affinity column. The numbers indicate the sizes of the molecular weight
markers (in kilodaltons).
|
|
To confirm the association of these two polypeptides with the binding
activity, purified CEBP was subjected to glycerol gradient
sedimentation in order to estimate the native molecular mass of
the
binding protein. Purified CEBP was sedimented through a 10
to 30%
glycerol gradient containing 133 µg of bovine serum albumin
per ml
(Fig.
10). The position of CEBP in the
gradient was determined
by gel retardation assay of fractions after
centrifugation. CEBP
sedimented at approximately the same rate as T7
RNA polymerase
in a parallel gradient. Within the uncertainty of such
measurements,
this result is consistent with CEBP being a heterodimer
with subunits
of approximately 38 and 48 kDa. A small peak of more
rapidly sedimenting
binding activity may represent a higher oligomeric
form of CEBP.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 10.
Glycerol gradient sedimentation of CEBP. Purified CEBP
was sedimented through a 10 to 30% glycerol gradient as described in
the text. Fractions were collected through a 21-gauge needle and
assayed immediately for CEBP binding activity. T7 RNA polymerase (pol)
and DNA polymerase I Klenow fragment were sedimented in a parallel
gradient as sedimentation markers.
|
|
Binding specificity of purified CEBP.
Gel retardation analysis
shows that purified CEBP binds to TOP2 and RPA1
RNAs containing wild-type octamers (Fig.
11). No binding was seen to
corresponding RNAs in which both octamers were mutated to a different
sequence. Similarly, binding was seen to the wild-type 6×
CAUAGAAG RNA but not to the mutant 6× CAUcGAAG
RNA. These results are consistent with previous observations
where no binding was seen when crude nuclear extracts were incubated
with mutant TOP2 and RPA1 RNAs (17) or
6× CAUcGAAG RNA. Purified CEBP binds more strongly to 6×
CAUAGAAG RNA than to TOP2 RNA, as seen earlier with nuclear extracts. Interestingly, the binding of CEBP to wild-type RPA1 RNA is stronger than that to TOP2 RNA (Fig.
11), and at present we do not know the significance of this
observation. At the level of CEBP used in these experiments, only a
single gel-shifted band is seen with TOP2 RNA, but two are
seen with 6× octamer RNA and three with RPA1 RNA. The
additional bands seen with 6× octamer and RPA1 RNAs appear
to represent higher-order complexes due to binding of additional
protein molecules. At higher levels of CEBP, a second gel-shifted band
is observed with a TOP2 RNA probe; this likely represents
the binding of CEBP to both of the octamer elements on the RNA probe
(17).

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 11.
Interaction of purified CEBP with RNA. RNA probes were
incubated in the absence ( ) or presence (+) of 10 µg of CEBP and
analyzed by nondenaturing PAGE. Probes used are TOP2
291-to- 209 RNA with both wild-type (TOP2 wt) or both
mutant (TOP2 mut) octamers, RPA1 341-to- 231
RNA with both wild-type (RPA1 wt) or both mutant
(RPA1 mut) octamers, 6× CAUAGAAG RNA (6× oct
wt), and 6× CAUcGAAG RNA (6× oct mut).
|
|
The 38-kDa protein binds to RNA.
Northwestern blotting was
performed to identify the protein containing the RNA binding activity.
Purified CEBP was subjected to SDS-PAGE to separate the 38- and 48-kDa
proteins and then transferred to a nitrocellulose filter. The filter
was probed with 32P-labeled 6× octamer RNA and subjected
to autoradiography. A band of approximately 38 kDa was observed on the
autoradiograph (Fig. 12A, lane 2). This
band corresponds to the 38-kDa protein in purified CEBP. The same band
was detected by the probe when proteins present in the 0 to 40%
ammonium sulfate precipitate were resolved by SDS-PAGE (Fig. 12A, lane
1). Control experiments in which the filters were probed with 6×
octamer antisense RNA showed no binding to any polypeptide (Fig. 12B).
Thus, the 38-kDa protein contains the RNA binding activity and can bind
to RNA even in the absence of the 48-kDa protein.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 12.
Northwestern blot analysis. Proteins were resolved by
SDS-PAGE, transferred to a nitrocellulose membrane, and probed with
32P-labeled 6× octamer RNA (wild type) (A) or with
32P-labeled 6× octamer RNA (antisense) (B). Lane 1, ammonium sulfate cut (20 µg); lane 2, purified CEBP (50 ng).
|
|
 |
DISCUSSION |
We have initiated studies to identify the cis-acting
elements and trans-acting factors involved in conferring
periodic expression on DNA replication genes in C. fasciculata. An investigation into the mechanism regulating the
TOP2 and RPA1 genes has revealed two common
features that could serve to mediate the coordinate regulation of these
genes. First, octamer sequences within the 5' UTRs of these genes have
been shown to be required for conferring periodic accumulation of their
mRNAs (4, 20). Second, the same nuclear factor(s) binds
to the 5' UTR RNAs of both these genes (17). To further
characterize the cis sequences involved in this unusual cell
cycle regulatory mechanism, we have inserted multiple copies of the
octamer into the 5' UTR of a reporter gene of a plasmid transfected
into C. fasciculata. We have shown here that six copies of
the octamer sequence cloned into the 5' UTR confer strong cycling on a
reporter gene transcript only when they are present in the sense
orientation. The 6× octamer RNA also showed strong and specific
binding to a nuclear factor(s). Thus, multiple copies of the octamer
sequence can both confer cycling on a reporter gene transcript and
binding to a specific nuclear factor(s). In addition, a single-base
change in this sequence element is sufficient to abolish both the
binding of specific nuclear factors in vitro and cycling of a reporter
gene in vivo. Since the 6× octamer is a small sequence with just 2 nucleotides separating the octamers, specific RNA secondary structures
do not appear to be critical for its function. To our knowledge, this
is the first report of the identification of a small (<10-nucleotide) posttranscriptional regulatory element in trypanosomes whose function has been studied at the single-nucleotide level.
We have exploited the strong binding of the nuclear factor to the 6×
octamer RNA to affinity purify the binding protein. Purified CEBP binds
to TOP2, RPA1, and 6× octamer RNAs but not to
RNA probes with mutant octamers. Proteins with molecular masses of
approximately 38 and 48 kDa copurify with the binding activity,
consistent with a multimeric structure for CEBP. The 38-kDa protein
contains the RNA binding activity and binds RNA even in the absence of
the 48-kDa protein. The high specificity of binding of 6× octamer RNA
to the 38-kDa protein is illustrated by the specific binding to this
protein even in crude nuclear extracts.
In other eukaryotes, specific RNA binding proteins have been found to
regulate gene expression posttranscriptionally by activating splicing
enhancer elements. Multiple copies of RNA binding sites have been shown
to function as strong splicing enhancers for two different members of
the SR family of splicing factors (27, 28). Also, multiple
copies of the hexamer TGCATG have been shown to regulate the
alternative splicing of fibronectin pre-mRNA and a heterologous
preprotachykinin pre-mRNA (15). Trypanosome genes do not
contain introns, and splicing of primary transcripts is limited to the
trans splicing of the 39-nucleotide mini-exon sequence at
alternate splice acceptor sites in the 5' flanking region of each gene
(21). The cell cycle regulation of specific trypanosomatid mRNAs observed here is unlikely to involve a cell cycle regulation of
trans splicing of primary transcripts for the following
reasons. First, consensus octamer sequences are present between distal and proximal splice acceptor sites in the 5' flanking sequences of both
the TOP2 and RPA1 constructs examined earlier,
yet mRNAs spliced at the distal sites contain the octamer sequences and cycle while mRNAs spliced at the proximal splice acceptor sites lack
the octamer sequences and do not cycle (4, 20). Thus, the
presence of the octamer sequences on the primary transcript is not
sufficient to confer cycling; the octamer sequences must be present on
the mRNA. Second, recombinant constructs in which the octamer sequences
are transposed from the 5' UTR to the 3' UTR still express mRNAs that
cycle, indicating that proximity of the octamer sequences to splice
acceptor sites is not essential for conferring cycling on the mRNA
level (4).
Studies of the developmental regulation of mRNA levels in trypanosomes
have shown that regulation is determined posttranscriptionally and that
the sequences responsible are usually contained within the 3' UTR of
the transcripts under investigation (2, 14, 22). In the case
of procyclins, the major surface glycoproteins of the insect form of
Trypanosoma brucei, both positive and negative regulatory
elements are contained in the procyclin 3' UTR (9). Both a
conserved 16-mer in the 3' UTR of procyclin transcripts and the first
40 nucleotides of the 3' UTR serve as positive elements in regulating
the mRNA level, while a separate element within a 73-nucleotide
sequence (LII) negatively regulates the mRNA level. A 26-nucleotide
polypyrimidine tract within this negative element acts to accelerate
turnover of the procyclin mRNA in bloodstream forms (13).
The differential expression of the genes for the glycoproteins gp63 and
gp46 in Leishmania chagasi is posttranscriptionally regulated by elements in their 3' UTRs (1, 22). The 3' UTR elements also posttranscriptionally regulate expression of the amastin
genes, which encode an abundant protein on the surface of T. cruzi in the amastigote stage of the parasite (29).
Similarly, A2 genes in Leishmania donovani, which encode an
amastigote-specific protein, are posttranscriptionally regulated by 3'
UTR elements (5). However, in none of these cases has a
protein factor(s) that binds to sequences performing the regulatory
function been identified and purified. To our knowledge, the present
studies represent the first example for trypanosomes of the
purification of a protein shown to bind to sequences affecting gene expression.
We suggest that the octamer sequences in TOP2 and
RPA1 5' UTRs play a negative role in regulating mRNA levels
during the cell cycle and that binding of CEBP to these sequences
overcomes the negative regulation. Cycling of the binding activity
would therefore result in a parallel cycling of target mRNA levels,
consistent with results presented here and in earlier studies
(17). Also, mutation of the octamer sequences in a target
mRNA would be expected to eliminate cycling of the mRNA and to result
in mRNA levels similar to the maximum levels achieved by the wild-type
mRNA during the cell cycle. This model is supported by the observations
in Fig. 1 and 4 and in previous studies (20) showing that
mutation of octamer sequences in reporter constructs reduces the
cycling and results in mRNA levels throughout the cell cycle near the maximum level attained by the wild-type construct. The availability of
purified CEBP should now facilitate the cloning of the genes encoding
the subunits of CEBP and the further analysis of this novel mechanism
of gene regulation.
 |
ACKNOWLEDGMENTS |
We thank Lisa Brown for performing the experiment with a single
octamer cloned in p
10Not.
This research was supported by NIH grant GM53254.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Biology Institute, 611 Charles E. Young Dr. East, UCLA, Los Angeles, CA
90095-1570. Phone: (310) 825-4178. Fax: (310) 206-7286. E-mail:
danray{at}mbi.ucla.edu.
 |
REFERENCES |
| 1.
|
Beetham, J. K.,
K. S. Myung,
J. J. McCoy,
M. E. Wilson, and J. E. Donelson.
1997.
Glycoprotein 46 mRNA abundance is post-transcriptionally regulated during development of Leishmania chagasi promastigotes to an infectious form.
J. Biol. Chem.
272:17360-17366[Abstract/Free Full Text].
|
| 2.
|
Berberof, M.,
L. Vanhamme,
P. Tebabi,
A. Pays,
D. Jefferies,
S. Welburn, and E. Pays.
1995.
The 3'-terminal region of the mRNAs for VSG and procyclin can confer stage specificity to gene expression in Trypanosoma brucei.
EMBO J.
14:2925-2934[Medline].
|
| 3.
|
Bogenhagen, D., and D. A. Clayton.
1977.
Mouse L cell mitochondrial DNA molecules are selected randomly for replication throughout the cell cycle.
Cell
11:719-727[Medline].
|
| 4.
|
Brown, L. M., and D. S. Ray.
1997.
Cell cycle regulation of RPA1 transcript levels in the trypanosomatid Crithidia fasciculata.
Nucleic Acids Res.
25:3281-3289[Abstract/Free Full Text].
|
| 5.
|
Charest, H.,
W. W. Zhang, and G. Matlashewski.
1996.
The developmental expression of Leishmania donovani A2 amastigote-specific genes is post-transcriptionally mediated and involves elements located in the 3'-untranslated region.
J. Biol. Chem.
271:17081-17090[Abstract/Free Full Text].
|
| 6.
|
Chen, X.,
J. Sadlock, and E. A. Schon.
1993.
RNA-binding patterns in total human tissue proteins: analysis by Northwestern blotting.
Biochem. Biophys. Res. Commun.
191:18-25[Medline].
|
| 7.
|
Cosgrove, W. B., and M. J. Skeen.
1970.
The cell cycle in Crithidia fasciculata. Temporal relationships between synthesis of deoxyribonucleic acid in the nucleus and in the kinetoplast.
J. Protozool.
17:172-177[Medline].
|
| 8.
|
Englund, P. T.
1979.
Free minicircles of kinetoplast DNA networks in Crithidia fasciculata.
J. Biol. Chem.
254:4895-4900[Abstract/Free Full Text].
|
| 9.
|
Furger, A.,
N. Schurch,
U. Kurath, and I. Roditi.
1997.
Elements in the 3' untranslated region of procyclin mRNA regulate expression in insect forms of Trypanosoma brucei by modulating RNA stability and translation.
Mol. Cell. Biol.
17:4372-4380[Abstract].
|
| 10.
|
Guttes, E. W.,
P. C. Hanawalt, and S. Guttes.
1967.
Mitochondrial DNA synthesis and the mitotic cycle in Physarum polycephalum.
Biochim. Biophys. Acta
142:181-194[Medline].
|
| 11.
|
Hajduk, S. L.,
V. A. Klein, and P. T. Englund.
1984.
Replication of kinetoplast DNA maxicircles.
Cell
36:483-492[Medline].
|
| 12.
|
Hines, J. C., and D. S. Ray.
1997.
Periodic synthesis of kinetoplast DNA topoisomerase II during the cell cycle.
Mol. Biochem. Parasitol.
88:249-252[Medline].
|
| 13.
|
Hotz, H. R.,
C. Hartmann,
K. Huober,
M. Hug, and C. Clayton.
1997.
Mechanisms of developmental regulation in Trypanosoma brucei: a polypyrimidine tract in the 3'-untranslated region of a surface protein mRNA affects RNA abundance and translation.
Nucleic Acids Res.
25:3017-3026[Abstract/Free Full Text].
|
| 14.
|
Hug, M.,
V. B. Carruthers,
C. Hartmann,
D. S. Sherman,
G. A. Cross, and C. Clayton.
1993.
A possible role for the 3'-untranslated region in developmental regulation in Trypanosoma brucei.
Mol. Biochem. Parasitol.
61:87-95[Medline].
|
| 15.
|
Huh, G. S., and R. O. Hynes.
1994.
Regulation of alternative pre-mRNA splicing by a novel repeated hexanucleotide element.
Genes Dev.
8:1561-1574[Abstract/Free Full Text].
|
| 16.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of the bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 17.
|
Mahmood, R., and D. S. Ray.
1998.
Nuclear extracts of Crithidia fasciculata contain factors that bind to the 5' untranslated regions of TOP2 and RPA1 mRNAs containing sequences required for their cell cycle regulation.
J. Biol. Chem.
273:23729-23734[Abstract/Free Full Text].
|
| 18.
|
Merril, C. R.
1990.
Gel-staining techniques.
Methods Enzymol.
182:477-488[Medline].
|
| 19.
|
Pasion, S. G.,
G. W. Brown,
L. M. Brown, and D. S. Ray.
1994.
Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle.
J. Cell Sci.
107:3515-3520[Abstract].
|
| 20.
|
Pasion, S. G.,
J. C. Hines,
X. Ou,
R. Mahmood, and D. S. Ray.
1996.
Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.
Mol. Cell. Biol.
16:6724-6735[Abstract].
|
| 21.
|
Pays, E.
1993.
Genome organization and control of gene expression in trypanosomatids, p. 127-160.
In
P. Broda, S. G. Oliver, and P. F. G. Sims (ed.), The eukaryotic genome: organization and regulation. Press Syndicate of the University of Cambridge, Cambridge, United Kingdom.
|
| 22.
|
Ramamoorthy, R.,
K. G. Swihart,
J. J. McCoy,
M. E. Wilson, and J. E. Donelson.
1995.
Intergenic regions between tandem gp63 genes influence the differential expression of gp63 RNAs in Leishmania chagasi promastigotes.
J. Biol. Chem.
270:12133-12139[Abstract/Free Full Text].
|
| 23.
|
Ray, D. S.
1987.
Kinetoplast DNA minicircles: high-copy-number mitochondrial plasmids.
Plasmid
17:177-190[Medline].
|
| 24.
|
Shapiro, T. A., and P. T. Englund.
1995.
The structure and replication of kinetoplast DNA.
Annu. Rev. Microbiol.
49:117-143[Medline].
|
| 25.
|
Simpson, L.
1987.
The mitochondrial genome of kinetoplastid protozoa: genomic organization, transcription, replication, and evolution.
Annu. Rev. Microbiol.
41:363-382[Medline].
|
| 26.
|
Stuart, K.
1983.
Kinetoplast DNA, mitochondrial DNA with a difference.
Mol. Biochem. Parasitol.
9:93-104[Medline].
|
| 27.
|
Tacke, R.,
Y. Chen, and J. L. Manley.
1997.
Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer.
Proc. Natl. Acad. Sci. USA
94:1148-1153[Abstract/Free Full Text].
|
| 28.
|
Tacke, R., and J. L. Manley.
1995.
The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities.
EMBO J.
14:3540-51[Medline].
|
| 29.
|
Teixeira, S. M.,
L. V. Kirchhoff, and J. E. Donelson.
1995.
Post-transcriptional elements regulating expression of mRNAs from the amastin/tuzin gene cluster of Trypanosoma cruzi.
J. Biol. Chem.
270:22586-22594[Abstract/Free Full Text].
|
| 30.
|
Towbin, H.,
T. Staehlin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 31.
|
Vanhamme, L., and E. Pays.
1995.
Control of gene expression in trypanosomes.
Microbiol. Rev.
59:223-240[Abstract/Free Full Text].
|
| 32.
|
Williamson, D. H., and E. Moustacchi.
1971.
The synthesis of mitochondrial DNA during the cell cycle in the yeast Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
42:195-201[Medline].
|
Molecular and Cellular Biology, September 1999, p. 6174-6182, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Li, Y., Sun, Y., Hines, J. C., Ray, D. S.
(2007). Identification of New Kinetoplast DNA Replication Proteins in Trypanosomatids Based on Predicted S-Phase Expression and Mitochondrial Targeting. Eukaryot Cell
6: 2303-2310
[Abstract]
[Full Text]
-
Sinha, K. M., Hines, J. C., Ray, D. S.
(2006). Cell Cycle-Dependent Localization and Properties of a Second Mitochondrial DNA Ligase in Crithidia fasciculata. Eukaryot Cell
5: 54-61
[Abstract]
[Full Text]
-
Folgueira, C., Quijada, L., Soto, M., Abanades, D. R., Alonso, C., Requena, J. M.
(2005). The Translational Efficiencies of the Two Leishmania infantum HSP70 mRNAs, Differing in Their 3'-Untranslated Regions, Are Affected by Shifts in the Temperature of Growth through Different Mechanisms. J. Biol. Chem.
280: 35172-35183
[Abstract]
[Full Text]
-
Zick, A., Onn, I., Bezalel, R., Margalit, H., Shlomai, J.
(2005). Assigning functions to genes: identification of S-phase expressed genes in Leishmania major based on post-transcriptional control elements. Nucleic Acids Res
33: 4235-4242
[Abstract]
[Full Text]
-
WEBB, H., BURNS, R., KIMBLIN, N., ELLIS, L., CARRINGTON, M.
(2005). A novel strategy to identify the location of necessary and sufficient cis-acting regulatory mRNA elements in trypanosomes. RNA
11: 1108-1116
[Abstract]
[Full Text]
-
Mittra, B., Ray, D. S.
(2004). Presence of a Poly(A) Binding Protein and Two Proteins with Cell Cycle-Dependent Phosphorylation in Crithidia fasciculata mRNA Cycling Sequence Binding Protein II. Eukaryot Cell
3: 1185-1197
[Abstract]
[Full Text]
-
Mishra, K. K., Holzer, T. R., Moore, L. L., LeBowitz, J. H.
(2003). A Negative Regulatory Element Controls mRNA Abundance of the Leishmania mexicana Paraflagellar Rod Gene PFR2. Eukaryot Cell
2: 1009-1017
[Abstract]
[Full Text]
-
Hanke, T., Ramiro, M. J., Trigueros, S., Roca, J., Larraga, V.
(2003). Cloning, functional analysis and post-transcriptional regulation of a type II DNA topoisomerase from Leishmania infantum. A new potential target for anti-parasite drugs. Nucleic Acids Res
31: 4917-4928
[Abstract]
[Full Text]
-
Avliyakulov, N. K., Hines, J. C., Ray, D. S.
(2003). Sequence Elements in both the Intergenic Space and the 3' Untranslated Region of the Crithidia fasciculata KAP3 Gene Are Required for Cell Cycle Regulation of KAP3 mRNA. Eukaryot Cell
2: 671-677
[Abstract]
[Full Text]
-
Mittra, B., Sinha, K. M., Hines, J. C., Ray, D. S.
(2003). Presence of Multiple mRNA Cycling Sequence Element-binding Proteins in Crithidia fasciculata. J. Biol. Chem.
278: 26564-26571
[Abstract]
[Full Text]
-
Gaziova, I., Lukes, J.
(2003). Mitochondrial and Nuclear Localization of Topoisomerase II in the Flagellate Bodo saltans (Kinetoplastida), a Species with Non-catenated Kinetoplast DNA. J. Biol. Chem.
278: 10900-10907
[Abstract]
[Full Text]
-
Milone, J., Wilusz, J., Bellofatto, V.
(2002). Identification of mRNA decapping activities and an ARE-regulated 3' to 5' exonuclease activity in trypanosome extracts. Nucleic Acids Res
30: 4040-4050
[Abstract]
[Full Text]
-
Mahmood, R., Mittra, B., Hines, J. C., Ray, D. S.
(2001). Characterization of the Crithidia fasciculata mRNA Cycling Sequence Binding Proteins. Mol. Cell. Biol.
21: 4453-4459
[Abstract]
[Full Text]