Previous Article | Next Article 
Molecular and Cellular Biology, September 1999, p. 6183-6194, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Ectopic Expression of Cdc25A Accelerates the
G1/S Transition and Leads to Premature Activation of Cyclin
E- and Cyclin A-Dependent Kinases
Ida
Blomberg and
Ingrid
Hoffmann*
Forschungsschwerpunkt Angewandte
Tumorvirologie (F0400), Deutsches Krebsforschungszentrum, D-69120
Heidelberg, Germany
Received 5 January 1999/Returned for modification 24 February
1999/Accepted 17 June 1999
 |
ABSTRACT |
Human Cdc25 phosphatases play important roles in cell cycle
regulation by removing inhibitory phosphates from tyrosine and threonine residues of cyclin-dependent kinases. Three human Cdc25 isoforms, A, B, and C, have been discovered. Cdc25B and Cdc25C play
crucial roles at the G2/M transition. In the present study, we have investigated the function of human Cdc25A phosphatase. Cell
lines that express human Cdc25A in an inducible manner have been
generated. Ectopic expression of Cdc25A accelerates the
G1/S-phase transition, indicating that Cdc25A controls an
event(s) that is rate limiting for entry into S phase. Furthermore, we
carried out a detailed analysis of the expression and activation of
human Cdc25A. Activation of endogenous Cdc25A occurs during late
G1 phase and increases in S and G2 phases. We
further demonstrate that Cdc25A is activated at the same time as cyclin
E- and cyclin A-dependent kinases. In vitro, Cdc25A dephosphorylates
and activates the cyclin-Cdk complexes that are active during
G1. Overexpression of Cdc25A in the inducible system,
however, leads to a premature activation of both cyclin E-Cdk2 and
cyclin A-Cdk2 complexes, while no effect of cyclin D-dependent kinases
is observed. Furthermore, Cdc25A overexpression induces a tyrosine
dephosphorylation of Cdk2. These results suggest that Cdc25A is an
important regulator of the G1/S-phase transition and that
cyclin E- and cyclin A-dependent kinases act as direct targets.
 |
INTRODUCTION |
Transitions in the cell cycle of
higher eukaryotic cells are governed by a family of cyclin-dependent
kinases (Cdks). Cdk activities are determined by cyclin-binding, small
Cdk inhibitor proteins and both positive and negative regulatory
phosphorylations (14, 26, 35). There are two families of Cdk
inhibitors which negatively regulate kinase activities. The first
family includes p21, p27, and p57 and acts on a variety of cyclin-Cdk
complexes. The second group consists of p15, p16, and p18 and inhibits
the formation of cyclin D-Cdk4 (Cdk6) complexes (13). The
regulation of Cdks on the phosphorylation level is best characterized
for cyclin B-Cdk1 (Cdc2) but is conserved also in Cdks that are active during G1 and S phases. A stimulatory phosphorylation event
is modulated by the Cdk-activating kinase (Cak), which phosphorylates threonine-161 on Cdk1 (30, 36). Another major regulatory
mechanism is governed by the wee1/mik1 and myt1 protein kinases, which
phosphorylate Cdk1 on threonine-14 and tyrosine-15, thus inactivating
the Cdk kinase activity (22, 24, 27).
The Cdc25 phosphatases are members of the tyrosine phosphatase family
and catalyze dephosphorylation and activation of cyclins-Cdks through
removal of the inhibitory phosphates. In the fission yeast, Schizosaccharomyces pombe, only one type of Cdc25 that
activates Cdk1 at the G2/M-phase transition exists, thus
representing a key determinant of mitotic timing. In human cells, three
Cdc25 homologs called Cdc25A, Cdc25B, and Cdc25C have been identified (6, 28, 33). The three phosphatases have approximately 50%
sequence identity at the amino acid sequence level. The crystal structure of the catalytic domain of human Cdc25A phosphatase has
recently been determined (4). Interestingly, Cdc25A has its
own topology, and only the active site loop, containing the His-Cys-(X)5-Arg motif, shows similarity to the tyrosine
phosphatase family.
Cdc25B and -C are involved in the regulation of the
G2/M-phase transition, while Cdc25A is needed for the
G1/S-phase transition (5, 16, 19, 20, 25).
Cdc25C dephosphorylates cyclin B-Cdk1, thereby activating its kinase
activity. Cdc25C in turn becomes phosphorylated by cyclin B-Cdk1 at
mitosis, and this further stimulates its ability to dephosphorylate
Cdk1, thus creating a positive feedback loop (15, 18, 37).
Recent work indicates that Cdc25B might play the role of a "starter
phosphatase" by activating cyclin B-Cdk1 in order to initiate the
positive feedback mechanism (20, 29).
Cdc25A and -B are putative oncogenes (8). Cdc25A is able to
transform primary mouse embryonic fibroblasts in cooperation with the
Ras oncogene or in a background lacking functional retinoblastoma protein (pRb). It has been reported that the proto-oncogene product c-Myc directly stimulates the expression of Cdc25A (7).
Although Cdc25A seems to play a crucial role at the
G1/S-phase transition, the nature of its substrate(s)
remains unclear. However, likely substrates for Cdc25A are cyclin-Cdk
complexes that are activated during G1 phase. Cdk2, which
forms complexes with cyclins A and E, is regulated by phosphorylation
on sites analogous to those found in Cdk1 (11), suggesting
an activation mechanism similar to that for Cdk1. In addition, the
cyclin E-Cdk2 complex has been shown to physically interact with Cdc25A
in vivo (16). Moreover, cyclin E-Cdk2 phosphorylates Cdc25A,
which leads to an increase of its phosphatase activity (16).
Experiments where immortalized human epithelial cells (MCF-10A) were
treated with transforming growth factor
(TGF-
) revealed a marked
increase in tyrosine phosphorylation of Cdk4 and Cdk6 and an inhibition
of their kinase activities. TGF-
treatment also leads to a
repression of Cdc25A and induction of p15 (17). Upon UV
treatment of rat fibroblasts, Cdk4 is phosphorylated on Tyr, and its
dephosphorylation is required for S-phase entry (37).
Recently, it was reported that Cdc25A also acts on substrates apart
from Cdks. Cdc25A binds to and dephosphorylates the homeodomain
transcription factor cut, which in turn leads to a repression of p21
promoter activity (2).
In this study, we show that Cdc25A phosphatase activity first appears
during the end of G1 phase, at the same time as cyclin E-Cdk2 and cyclin A-Cdk2 kinase activities appear but after cyclin D-Cdk4 or cyclin D-Cdk6 kinase is activated. In order to better understand the role of Cdc25A in the regulation of the
G1/S-transition, we have investigated the effects of
conditional ectopic Cdc25A expression on cell cycle progression of
rat-1 cells. Overexpression of human Cdc25A shortens the G1
phase, thereby advancing S-phase entry. In addition, high levels of
Cdc25A overexpression lead to a premature activation of cyclin E-Cdk2
and cyclin A-Cdk2 kinases and dephosphorylation of Cdk2, suggesting
that these kinases act as in vivo substrates of Cdc25A.
 |
MATERIALS AND METHODS |
Plasmids and site-directed mutagenesis.
A mutant of human
Cdc25A, lacking phosphatase activity, was constructed by mutating the
catalytic cysteine to serine (Cdc25A C430S). A single base mutation was
introduced into a PCR primer (TGTTGTGTTTCACTCCGAGTTTTCTTCTGAG). The PCR
product containing the mutation was used as one of the primers in a
second PCR to produce a larger fragment of the Cdc25A gene. Mutagenesis
was performed by PCR with Pfu DNA polymerase (Stratagene).
The mutation was confirmed by DNA sequencing.
To construct the tetracycline-regulated Cdc25A and Cdc25A C430S
expression vector, we subcloned the blunt-ended
NcoI-XbaI fragment of Bluescript/Cdc25A, which
contains the full-length human Cdc25A, into a blunt-ended
EcoRI pUHD 10-3 plasmid. The pUHD 10-3 plasmid contains
several repeats of the tetracycline operator linked to a
cytomegalovirus minimal promoter (10). Cotransfection of
pUHD 10-3 and the tetracycline repressor vector (pUHD 15-1) led to a
repression of gene expression in the presence of tetracycline. Upon
removal of tetracycline, gene transcription was initiated. The
Tk-hygromycin plasmid contained the hygromycin resistance gene under
control of the thymidine kinase promoter.
Expression and purification of recombinant Cdc25 proteins.
Human Cdc25A and Cdc25 C430S (6) were produced in the
bacterial strain BL21 with the pGEX-2T expression vector. After
isopropyl-
-D-thiogalactoside (IPTG) induction for 4 h (1 mM final concentration), the 95-kDa glutathione
S-transferase (GST)-Cdc25A fusion protein was recovered by
binding to glutathione-Sepharose beads and eluted with 20 mM glutathione in 50 mM Tris-HCl, pH 8.0.
Cell lines, transfection, and selection procedure.
HeLa
cells in suspension were obtained from the Cold Spring Harbor
Laboratory Tissue Culture facility (Cold Spring Harbor, N.Y.) and
cultured in Dulbecco's modified Eagle's medium (DMEM)-5% fetal calf
serum (FCS) containing 1 g of glucose per liter. Human foreskin
fibroblasts (Hs68) and human lung fibroblasts (IMR-90) were purchased
from the American Type Culture Collection and cultivated as described
in reference 20. All media were supplemented with 100 U of penicillin-streptomycin per ml and 2 mM glutamine. rat-1 cells
containing the tetracycline repressor expression vector pUHD 15-1, termed R12 cells (31), were maintained in the presence of
600 µg of G418 (Geneticin; Calbiochem) per ml. R12 cells were maintained in DMEM containing 4.5 g of glucose per liter. The pUHD
10-3 vector containing Cdc25A or Cdc25A C430S was transfected together
with the hygromycin resistance vector (ratio of 1:20) into R12 cells by
using the liposomal transfection reagents (DOSPER or DOTAP; Boehringer
Mannheim). Cells were then cultivated in the presence of tetracycline
(2 µg/ml). Clones were selected in the presence of 150 µg of
hygromycin per ml. Clones showing inducible expression of Cdc25A and
Cdc25A C430S after tetracycline removal for 48 h were screened for
immunoblotting by using specific polyclonal antibodies raised against Cdc25A.
Elutriation and cell synchronization.
G1 HeLa
cells were obtained by centrifugal elutriation with a JE-5.0 rotor
(Beckman) as described previously (3). For the experiments
described in the legend to Fig. 2, cell fractions enriched in early
G1 were resuspended in DMEM-5% FCS at a density of 3 × 105 cells/ml. Samples were taken at the times indicated.
Progression through the cell cycle in the elutriated cells was
monitored by propidium iodide staining and flow cytometry. HeLa cells
arrested in S phase were obtained by blocking the cells for 19 h
in 10 mM hydroxyurea.
R12 clones were synchronized by serum starvation with DMEM containing
0.1% FCS for 48 h. The cells were released through addition
of
DMEM containing 10% FCS and harvested at the indicated time
points.
Hs68 cells were synchronized by serum starvation in DMEM
without FCS
for 36 h. They were then released through addition
of DMEM
supplemented with 20%
FCS.
Cell cycle analysis.
The cell cycle distribution was assayed
by propidium iodide or bromodeoxyuridine (BrdU) incorporation with flow
cytometry. Adherent cells were trypsinized, and HeLa cells grown in
suspension were collected by centrifugation. The cells were then washed
and resuspended in phosphate-buffered saline (PBS). Ice-cold methanol was added to a final concentration of 80%. The cells were incubated for at least 20 min at 4°C and then pelleted and resuspended in 1 ml
of PI mix per 106 cells (50 µg of propidium iodide per
ml, 10 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 10 µg of RNase
A per ml). The cells were incubated for 20 min at room temperature
before measurement. To assay the proportion of cells in S phase, they
were incubated with 30 µM BrdU for 1 h before harvest. The cells
were fixed with 70% cold ethanol. The RNA was degraded by incubation
with 10 µg of RNase A per ml in PBS with 0.5% Tween 20 for 30 min at
37°C. The histones were extracted by incubation with 2 M HCl with
0.5% Tween 20 for 20 min at room temperature. The cells were labelled
with 2 µg of anti-BrdU antibodies from Boehringer Mannheim and
fluorescein isothiocyanate-linked anti-mouse immunoglobulin G from
Jackson Immunoresearch (1:50) per ml. The cells were labelled with 40 µg of propidium iodide per ml. The analysis was performed with FACScan (Becton Dickinson) with the Cell Quest and the Mod Fit software.
Extract preparation and immunochemistry.
For cell
fractionation, cell monolayers were washed twice with ice-cold PBS, and
then cells were harvested by trypsinization.
Cell extracts were prepared by addition of 3 to 5 volumes of lysis
buffer (50 mM Tris-HCl [pH 7.4], 0.5 M NaCl, 0.1% Triton
X-100, 50 mM NaF, 1 mM dithiothreitol [DTT], 0.1 mM
Na
3VO
4) to
a cell pellet. The following
protease inhibitors were added: 0.1
mM phenylmethylsulfonyl fluoride, 1 mg of leupeptin per ml, 10
mg of soybean trypsin inhibitor per ml,
L-1-chlor-3-(4-tosylamido)-4-phenyl-2-butanon
(TPCK), 10 mg
of
L-1-chlor-3-(4-tosylamido)-7-amino-2-heptanon-hydrochloride
(TLCK) per ml, and 1 mg of aprotinin per
ml.
To assay cyclin D-associated kinase activity, the lysates were prepared
according to the method of Matsushime et al. (
23).
Cells
were lysed in 1 ml of IP buffer (50 mM HEPES [pH 7.5], 150
mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% glycerol, 0.1% Tween 20 1
mM DTT, 10 mM

-glycerophosphate, and the same protease and phosphatase
inhibitors
as in the lysis buffer) per 1 × 10
6 to 5 × 10
6 cells. The cells were frozen in dry ice, thawed, and
incubated
for 1 h on ice. The lysates were cleared by
centrifugation for
10 min at 13,000 ×
g.
Total protein concentrations were determined by using the Bio-Rad
protein assay system and bovine serum albumin as the calibration
standard.
The Cdc25A antibodies used in the immunoprecipitation experiments were
generated by injecting rabbits with a peptide coupled
to keyhole limpet
hemocyanin. This peptide corresponds to the
C-terminal sequence of
human Cdc25A protein (CKREMYSRLKKL). This
sequence does not exist in
either Cdc25B or Cdc25C. For use in
immunoblotting experiments, an
antibody against the full-length
human GST-Cdc25A protein was raised in
rabbits. The resulting
polyclonal antiserum was affinity purified by
using the GST-Cdc25A
fusion protein covalently coupled to
CNBr-activated Sepharose.
Cyclins A, B, and D1 and Cdk2 antibodies were
used as described
in reference
16. Cyclin E (HE-111,
HE-12, and M-20), Cdk4 (C-22),
and Cdk6 (C-21) antibodies were from
Santa Cruz Biotechnology,
Inc. p21 (05-345) and antiphosphotyrosine
antibodies (05-321)
were purchased from Upstate Biotechnology Inc.,
Lake Placid, N.Y.
For immunoblotting, 50 µg of total protein from
HeLa, Hs68, or
rat-1 cell lysates was loaded per lane and separated by
sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Proteins were transferred from gels by semidry blotting as described
in
reference
12. As secondary antibodies, horseradish
peroxidase-labelled
anti-rabbit (Amersham) or horseradish
peroxidase-labelled anti-mouse
(Jackson Immunoresearch) antibodies were
used.
Conditions for immunoprecipitation have been previously described
(
3).
Phosphatase and kinase assays.
To prepare the substrate for
a Cdc25A phosphatase assay, cyclin B-Cdk1 was immunoprecipitated with
anti-cyclin B antibodies from HeLa cells that were arrested in S phase
by treatment with 10 mM hydroxyurea for 14 h. Under these
conditions, Cdk1 complexed with cyclin B is phosphorylated on
threonine-14 and tyrosine-15, causing an inactivation of its kinase
activity. The cyclin B immunoprecipitate was incubated with recombinant
or immunoprecipitated Cdc25A for 15 min at 30°C in 50 mM Tris-HCl (pH
8.0)-10 mM DTT, and the resulting activity of the kinase was measured
by phosphorylation of histone H1 as described in reference
15. Briefly, after immunoprecipitations pellets were
incubated at 30°C in the presence of 50 mM Tris-HCl (pH 7.5)-10 mM
MgCl2-1 mM DTT-50 µM ATP-5 µCi of
[
-32P]ATP for 15 min. Samples were resolved by
SDS-PAGE and analyzed by autoradiography. Cyclin E- and cyclin
A-dependent kinase activities were measured on histone H1 as substrate
under the same assay conditions.
For cyclin D-associated kinase assays, lysates prepared with IP buffer
were used and precleared by incubation with Sepharose
CL-4B beads
(Pharmacia) for 1 h and centrifugation at 13,000 ×
g for 1 min. Protein A-Sepharose beads (Pharmacia) were precoated
with antibody for 1 h and then mixed with the precleared lysates
and incubated for 3 h at 4°C. The beads were washed four times
with IP buffer and twice with kinase buffer (50 mM HEPES [pH 7.5],
10 mM MgCl
2, 1 mM DTT). The kinase reaction was performed in
kinase
buffer with addition of 2.5 mM EGTA, 10 mM

-glycerophosphate,
50 µM ATP, 10 µCi of [

-
32P]ATP, and 5 µg of
GST-pRb (amino acids 773 to 928). The kinase
reactions were performed
at 30°C for 30 min. The reactions were
stopped through addition of
Laemmli sample buffer, and reaction
mixtures were analyzed by SDS-PAGE
and
autoradiography.
 |
RESULTS |
Human Cdc25A phosphatase is activated during late G1
phase.
To investigate the function of human Cdc25A phosphatase, we
first characterized the antibodies to be used. The polyclonal rabbit
antibody raised against the full-length human GST-Cdc25A protein was
affinity purified, and its specificity was tested by immunoblotting on
HeLa and Hs68 cell extracts (Fig. 1A,
lanes 1 and 2). The antibody specifically recognizes a doublet band at
68 to 70 kDa that was absent in the preimmune serum (Fig. 1A, lane 3).
This antibody was used for immunoblotting. To be able to determine the
phosphatase activity of human Cdc25A in extracts, an antibody modelled
upon the Cdc25A C-terminal sequence was raised. The peptide sequence
has no homology to sequences in either Cdc25B or Cdc25C phosphatase.
The antibody immunoprecipitated Cdc25A that activated
tyrosine-phosphorylated cyclin B-Cdk1 as determined by histone H1
phosphorylation (Fig. 1B, lane 1). Cdc25A phosphatase activity could
not be immunoprecipitated in the presence of an excess of antigenic
peptide (lane 2). Due to incomplete inactivation of cyclin B-Cdk1,
there is a basal activity in the control immunoprecipitation by
preimmune serum (lane 3). There was no detectable histone H1 kinase
activity coprecipitating along with Cdc25A (data not shown). The
C-terminal antibody was used for immunoprecipitations during this
study.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of Cdc25A antibodies. (A) Extracts of
HeLa cells (lanes 1 and 3) and HS68 cells (lane 2) were resolved by
SDS-PAGE, transferred to nitrocellulose, and probed with
affinity-purified Cdc25A antibodies raised against the full-length
protein (lanes 1 and 2) or preimmune serum (lane 3). (B) Cdc25A was
immunoprecipitated from HeLa cell extracts with a C-terminal peptide
antibody in the absence (lane 1) or presence (lane 2) of antigenic
peptide and incubated with tyrosine-phosphorylated inactive cyclin
B-Cdk1 complex. Activation of cyclin B-Cdk1 caused by Cdc25A was
monitored on histone H1 as substrate. Lane 3 shows a control
immunoprecipitation using preimmune (PI) serum. IP,
immunoprecipitant.
|
|
One important unresolved issue is the nature of the Cdc25A in vivo
substrate(s). To study this, we examined the exact timing
of expression
and activation of the Cdc25A phosphatase in comparison
to the
activation of potential substrates. In a first set of experiments,
Cdc25A protein and phosphatase activity were analyzed at various
time
points during the G
1 and S phases of the cell cycle in HeLa
cells. HeLa cells were synchronized in early G
1 according
to cell
size by centrifugal elutriation. The cells were recultivated,
and samples were taken at the indicated time points. The relative
percentages of G
1-, S-, and G
2- or M-phase
cells in the elutriated
fractions were determined for each time point
by flow cytometric
analysis of nuclear DNA content. Cells started to
synthesize DNA
between 6 and 8 h after G
1
reinoculation (Fig.
2A). The amount
of
Cdc25A protein in the extracts was determined by
immunoblotting
(Fig.
2B). The Cdc25A protein reached maximal levels at
the end
of G
1 phase and in early S phase. This is in
agreement with data
published by Jinno et al. (
19). The
discrepancy between our
new data and earlier published results that
showed constant Cdc25A
levels (
16) might be explained by the
different antibodies used.
Cyclin E protein is present at the end of
G
1 and the beginning
of S phase. Cyclin A protein
accumulates as the cells proceed
through the G
1 and S
phases. The amount of Cdc25A phosphatase
activity continuously
increases, starting during mid-G
1 phase
and reaching a
maximum in late S phase and early G
2 phase. Cyclin
E-dependent kinase activity appears simultaneously with Cdc25A
phosphatase activity and decreases as the cyclin E protein disappears
in S phase. The cyclin A-dependent kinase activity appears slightly
later and increases in parallel with the Cdc25A phosphatase activity
(Fig.
2C). Therefore, it is conceivable that the initial Cdc25A
activity is necessary to activate cyclin E-Cdk2 while the rise
in
Cdc25A activity up to late S/G
2 might be necessary to
further
activate cyclin A-Cdk2.



View larger version (87K):
[in this window]
[in a new window]
|
FIG. 2.
Protein levels and activity of Cdc25A and G1
cyclins-Cdks in HeLa cells. (A) Cell cycle distribution. HeLa cells
grown in suspension were separated on the basis of size by centrifugal
elutriation. G1-enriched cells were reinoculated in fresh
medium and collected at the indicated time intervals. Cells were
stained with propidium iodide and analyzed by flow cytometry. The graph
shows the percentages of cells in G1, S, and
G2/M phases. (B) Immunoblot analysis. Total cell extracts
from the elutriated samples of panel A were analyzed by SDS-PAGE and
immunoblotted with specific antibodies against Cdc25A, cyclins E and A,
and Cdk2. (C) Cdc25A phosphatase activity and cyclin E- and cyclin
A-associated kinase activities. Extracts were prepared at the indicated
times from the elutriated samples, immunoprecipitated with Cdc25A
antiserum, and incubated with tyrosine-phosphorylated inactive cyclin
B-Cdk1 complex. Activation of cyclin B-Cdk1, caused by Cdc25A, was
monitored on histone H1 as substrate. Cyclin E- and cyclin A-associated
kinase activity was tested on histone H1 as substrate. P denotes
control immunoprecipitations with a preimmune serum. The results are
the means of two independent experiments. rein., reinoculation.
|
|
To investigate the timing of Cdc25A protein expression and activity in
a cell line that has functional cyclin D-associated
kinase activity, we
synchronized human fibroblasts (Hs68) by serum
deprivation and release.
Samples were taken at the indicated time
points. In Fig.
3A, the percentages of cells in
G
1, S, and G
2 or M phase are shown. Cells
started entering S phase at 16 h.
The samples were then analyzed
for protein levels and activities
of Cdc25A and G
1
cyclin-Cdk complexes. The protein levels of Cdc25A
were slightly
down-regulated during G
0 but reappeared at 4 h after
serum readdition (Fig.
3B). Cyclin A protein was present during
the
whole time course, but the levels increased markedly at 13
h after
serum readdition. Cyclin D and E proteins were absent
in G
0
but were expressed again at the same time as Cdc25A. The
protein levels
of Cdk2 and Cdk4 remained unchanged. The overall
level of Cdc25A
phosphatase activity in Hs68 cells was noticeably
lower than that in
HeLa cells. An activation of Cdc25A phosphatase
became detectable
between 13 and 16 h after serum readdition (Fig.
3C). Cyclin
E-Cdk2 kinase was activated slightly earlier, and
cyclin A-Cdk2
underwent activation later, than Cdc25A. These results
supports the
finding that cyclin E-Cdk2 activates Cdc25A (
16).
However,
cyclin D-dependent kinases and cyclin D-Cdk6 complexes
were activated
much earlier, at 7 h after serum readdition. From
the timing of
activation of cyclin E- and cyclin A-dependent kinases
and the
activation of Cdc25A in HeLa and Hs68 cells, we conclude
that these
kinases could act as physiological substrates of Cdc25A
phosphatase.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Protein levels and activities of Cdc25A and
G1 cyclins-Cdks in Hs68 human fibroblasts. (A) Hs68 cells
were synchronized by serum starvation and released by addition of DMEM
containing 20% FCS. Samples were taken for flow cytometry at the
indicated times. (B) Total cell extracts were analyzed by SDS-PAGE and
immunoblotted with Cdc25A-specific antibodies or with antibodies
against the different G1 Cdks and cyclins. (C) Phosphatase
and kinase activities from the same time points were determined as
described for Fig. 2C. The activities of cyclin D immunocomplexes were
measured as phosphorylation of pRb.
|
|
Cdc25A activates the G1 cyclin-Cdk complexes in
vitro.
Since the Cdc25A activity appeared during the end of
G1, we were interested in investigating if Cdc25A was able
to activate the G1 cyclin-Cdk complexes that undergo
activation at the same time as Cdc25A. In vitro, Cdc25A reveals a broad
binding specificity for Cdk1 and Cdk2 complexes (39). To
test the ability of GST-Cdc25A to activate G1 cyclin-Cdk
complexes including cyclin D-dependent kinase, immunoprecipitates of
these cyclin-Cdk complexes from exponentially growing HeLa cells or
human lung fibroblasts (IMR-90) were incubated with recombinant
GST-Cdc25A. To demonstrate that this activation was linked to the
phosphatase activity of Cdc25A, a mutant of Cdc25A lacking phosphatase
activity was constructed by changing the catalytic cysteine to a serine
(Cdc25A C430S). Such mutants of Cdc25 phosphatases were previously
shown to lack phosphatase activity (9). The resulting
cyclin-dependent kinase activities were monitored for their ability to
phosphorylate pRb (cyclin D1-Cdk4 or cyclin D1-Cdk6) or histone H1
(cyclin A-Cdk2 and cyclin E-Cdk2). Figure
4A shows that GST-Cdc25A was clearly able
to activate Cdk4 and cyclin D-dependent kinase complexes (lanes 2 and
6) while the cyclin D-Cdk6 kinase could be further activated only
slightly (lane 4) in comparison to the inactive GST-Cdc25A C430S
protein (lanes 1, 3, and 5). Both cyclin E-Cdk2 and cyclin A-Cdk2 could
be activated by recombinant GST-Cdc25A (Fig. 4B, lanes 4 and 6)
compared to GST-Cdc25A C430S (lanes 3 and 5). No activating activity of
Cdc25A C430S in comparison with bovine serum albumin or buffer alone
was observed, indicating that the phosphatase activity of Cdc25A is
critical for its activating capacity (data not shown). In this context,
it should also be mentioned that Cdc25A is able to activate cyclin
B-Cdk1 in vitro (Fig. 1B). Although the cyclin-Cdk complexes are
activated to different extents by recombinant Cdc25A, we cannot draw
conclusions about its preferred in vivo substrate.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Dephosphorylation and activation of cyclin-Cdk complexes
by Cdc25A in vitro. (A) Cyclin D-Cdk4 or cyclin D-Cdk6 complexes were
immunoprecipitated from exponentially growing IMR-90 cells by using
antibodies against Cdk4 (lanes 1 and 2), Cdk6 (lanes 3 and 4), and
cyclin D1 (lanes 5 and 6) or preimmune sera (lanes 7 and 8) and
incubated with GST-Cdc25A (lanes 2, 4, 6, and 8) or GST-Cdc25A (C430S)
(lanes 1, 3, 5, and 7). Activities of the complexes were determined on
pRb as substrate. (B) Cyclin E-Cdk2 and cyclin A-Cdk2 complexes were
immunoprecipitated from exponentially growing HeLa cells by using
antibodies against cyclin A (lanes 3 and 4) and cyclin E (lanes 5 and
6) or preimmune serum (lanes 1 and 2) and incubated with GST-Cdc25A
(lanes 2, 4, and 6) or GST-Cdc25A C430S (lanes 1, 3, and 5). Kinase
activities were measured on histone H1 as substrate. (C) Cdk2 was
immunoprecipitated from exponential HeLa cell extract and incubated
with either GST-Cdc25A (lane 1), GST-Cdc25A (C430S) (lane 2),
GST-Cdc25A in the presence of 1 mM sodium orthovanadate (lane 3), or
buffer alone (lane 4); blotted; and incubated with antiphosphotyrosine
antibodies. In lane 5, the immunoprecipitation was carried out with
preimmune serum. Numbers at left indicate molecular masses in
kilodaltons. IP, immunoprecipitant; PI, preimmune serum; mu, mutant;
wt, wild type.
|
|
We then analyzed the phosphotyrosine levels of Cdk2 after
immunoprecipitation with specific antibodies from HeLa cell extracts
(Fig.
4C). Treatment of Cdk2 immunoprecipitates with recombinant
GST-Cdc25A resulted in a marked reduction of phosphotyrosine while
treatment with either GST-Cdc25A C430S or GST-Cdc25A in the presence
of
the tyrosine phosphatase inhibitor sodium orthovanadate did
not reduce
or only slightly reduced phosphotyrosine levels (Fig.
4C). These
results clearly demonstrate that the increase in activity
of
G
1 Cdk-cyclin complexes is concomitant with a reduced
phosphotyrosine
content in Cdk2, indicating that it might be a direct
target of
Cdc25A.
Transfectant cell lines inducibly expressing Cdc25A.
The
tetracycline-inducible system takes advantage of a bacterial
tetracycline resistance operator and transactivator (10). rat-1 cells stably transfected with the tetracycline transactivator were cotransfected with pUHD 10-3 vector containing Cdc25A or Cdc25A
C430S and a hygromycin resistance vector. Hygromycin-resistant clones
were screened by immunoblotting for inducible induction of Cdc25A after
removal of tetracycline from the culture medium for 48 h. The
screen resulted in 7 clones of 37 overexpressing wild-type Cdc25A and 3 clones of 20 overexpressing Cdc25A C430S. For the data presented, clone
M13 expressing Cdc25A C430S and clones 55 and 83 expressing wild-type
Cdc25A were used. These clones displayed highly regulated expression of
Cdc25A. Removal of tetracycline from the medium led to an increase in
Cdc25A protein levels in all clones (Fig.
5A, lanes 2, 4, and 6) over those in noninduced cells (Fig. 5A, lanes 1, 3, and 5). No or very weak leakiness was detected in these clones by immunoblotting. To examine whether the overexpression of Cdc25A leads to an increased Cdc25A activity, phosphatase assays on immunoprecipitated Cdc25A from induced
or noninduced cells were performed (Fig. 5B). Induction of Cdc25A by
tetracycline removal led to a two- to fourfold increase in Cdc25A
phosphatase activity (Fig. 5B, lanes 3 and 6) over that in noninduced
cells (Fig. 5B, lanes 2 and 5) or for immunoprecipitations performed
with preimmune serum (Fig. 5B, lanes 1 and 3). Overexpression of Cdc25A
lacking phosphatase activity did not lead to increased phosphatase
activity (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Inducible expression and activities of human Cdc25A in
R12 cells. Clones M13 (lanes 1 and 2), 55 (lanes 3 and 4), and 83 (lanes 5 and 6) were grown in the presence (no induction of Cdc25A) and
absence (induction of Cdc25A) of tetracycline for 48 h. Cells were
then lysed as described in Materials and Methods. (A) Immunoblot
analysis. Protein extracts from induced (+) and noninduced ( ) cells
were run on an SDS-10% polyacrylamide gel and blotted on
nitrocellulose. The blot was then incubated with Cdc25A antibodies.
HeLa cell lysates (lane 7) were used as controls. (B) Protein (1 mg)
was used to analyze Cdc25A phosphatase activity by using inactive
tyrosine-phosphorylated cyclin B-Cdk1 as substrate. Cyclin B-Cdk1
activation was determined by histone H1 phosphorylation. Lanes 1 and 4, control immunoprecipitations with preimmune serum; lanes 2 and 5, activity without induction of Cdc25A; lanes 3 and 6, activity with
induction of Cdc25A.
|
|
Effects of Cdc25A overexpression on S-phase entry.
Microinjection experiments with Cdc25A-neutralizing antibodies have
shown that Cdc25A is required for entry into S phase (16, 19). Therefore, we wanted to test if Cdc25A is also rate limiting in the process of S-phase entry. To study this, clones 55 and 83 were
synchronized by serum starvation in the presence or absence of
tetracycline for 48 h. Cells were released by serum addition (with
or without tetracycline) and harvested for flow cytometry at the
indicated time points after release (Fig.
6). Cdc25A overexpression was confirmed
by immunoblotting (data not shown). Removal of tetracycline led to an
acceleration of S-phase entry by 1.5 to 2 h in clone 55 (Fig. 6A).
Similar results were obtained when the experiment was carried out with
clone 83 (data not shown). These results indicate that the induced
Cdc25A is functionally active and that Cdc25A performs a rate-limiting
function in progression from quiescence to S phase. Tetracycline
removal from synchronized R12 cells had no effect on S-phase entry
(data not shown), indicating that tetracycline itself does not have any
effect on S-phase entry.


View larger version (42K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of Cdc25A overexpression on cell cycle
progression of rat-1 cells. Clone 55 was arrested in G0
with DMEM containing 0.1% FCS in the presence (+) (no induction of
Cdc25A) or absence ( ) (induction of Cdc25A) of tetracycline (tet) for
48 h. The cells were released with 10% FCS (with or without
tetracycline). Cells were harvested at the indicated times after
release. (A) The samples were fixed, stained with propidium iodide, and
analyzed by flow cytometry. (B) One hour before harvest, 30 µM BrdU
was added. Cells were double labelled with anti-BrdU antibodies and
propidium iodide. BrdU staining of the cells was analyzed by flow
cytometry. The figure indicates the percentage of S-phase
(BrdU)-labelled cells.
|
|
To confirm the acceleration of S-phase entry, an alternative method was
used to assay the number of cells in S phase. Cells
were synchronized
and induced as described above, but they were
incubated with BrdU
1 h before harvest to allow BrdU incorporation
into newly
synthesized DNA. The BrdU-labelled cells were detected
with an
anti-BrdU antibody and a fluorescein isothiocyanate-linked
secondary
antibody by flow cytometry analysis. In agreement with
results in Fig.
6A, we detected an entry into S phase after Cdc25A
overproduction that
was nearly 2 h earlier (Fig.
6B).
Effects of Cdc25A overexpression on G1
cyclin-associated kinase activities.
We have shown that Cdc25A is
able to activate cyclin D1-, E-, and A-associated kinase activities in
vitro (Fig. 4). We now tested whether overexpression of Cdc25A would
lead to activation of any of the G1 cyclins-Cdks in vivo.
Therefore, we compared the cyclin-associated kinase activities of
exponentially growing clones 55 and 83 where Cdc25A was either induced
or not. Cyclin-Cdk complexes were immunoprecipitated with specific
antibodies, and their activity was assayed on histone H1 (for cyclin A-
and cyclin E-dependent kinases) or on pRb (for cyclin D-dependent
kinases). Cyclin A- as well as cyclin E-associated kinase activities
were increased approximately three- to fivefold after Cdc25A
overexpression (Fig. 7A). No effect on
Cdk4- or Cdk6-associated kinase activities could be detected even
though Cdc25A is able to activate Cdk4 complexes in vitro (Fig. 4A).
Activation of cyclin A-dependent kinase activity occurs later in the
cell cycle than cyclin E-Cdk2 activation (Fig. 2C). Therefore, we
cannot exclude the possibility that the activation of cyclin A-Cdk2
observed after overproduction of Cdc25A is a consequence of increased
cyclin E-Cdk2 activity. We did not observe any effect on cyclin A- and
E-dependent kinase activities after overproduction of the inactive
Cdc25A C430S in clone M13 (Fig. 7B). In a further experiment, the
levels of phosphotyrosine in Cdk2 immunoprecipitates were analyzed
after overproduction of wild-type Cdc25A. Figure 7C shows that the
phosphotyrosine levels of Cdk2 markedly decreased after Cdc25A
induction, indicating that the increase of cyclin E-Cdk2 and cyclin
A-Cdk2 kinase activities is due to a direct dephosphorylation of Cdk2.
Taken together, activation of cyclin A and E complexes shows not only
that Cdc25A is involved in their activation but also that there is an
inactive pool of cyclin E and A complexes in exponentially growing
cells that can be activated after Cdc25A overexpression.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of Cdc25A overproduction on cyclin-dependent
kinase activities in asynchronously growing HeLa cells. (A) Wild-type
Cdc25A was not induced (lanes 1 and 3) or induced (lanes 2 and 4) by
tetracycline addition or removal, respectively, for 24 h. The
histone H1 kinase activities associated with cyclin A and cyclin E or
pRb kinase activities associated with Cdk4 and Cdk6 immunoprecipitates
were analyzed. The experiment was performed with clones 55 (lanes 1 and
2) and 83 (lanes 3 and 4). (B) Mutant Cdc25A was either noninduced ( )
or induced (+) as described for panel A, and the histone H1 kinase
activities associated with cyclin A and cyclin E were analyzed. (C)
Wild-type Cdc25A (clone 83) was either noninduced ( ) or induced (+)
as described for panel A. Cdk2 was immunoprecipitated and analyzed by
immunoblotting with antiphosphotyrosine antibodies. P denotes a control
precipitation with preimmune serum.
|
|
Since Cdc25A overexpression causes an acceleration of entry into S
phase, it might be speculated that this is mediated by
a premature
activation of the kinases promoting G
1- to S-phase
progression. In addition, the activation of cyclin E- and cyclin
A-dependent kinases in exponentially growing cells could be due
to a
decrease of the G
1 fraction rather than a direct effect of
Cdc25A overproduction. Therefore, we performed a time course assay
of
G
1 Cdk-cyclin activation in cells released from
G
0 and after
overproduction of Cdc25A. As shown in Fig.
8, the activity of
cyclin A-Cdk complexes
appeared already at 6 h in Cdc25A-overproducing
cells, while in
noninduced cells the activity first appeared after
12 h. The
cyclin E-Cdk2 activity appears almost 3 h earlier in
cells
overexpressing Cdc25A than in noninduced cells. Cyclin D-Cdk4
and
cyclin D-Cdk6 kinase activities are not affected by Cdc25A
overproduction (Fig.
8). After Cdc25A overexpression, cyclin
A-associated
kinase starts to get activated 6 h earlier than in
nonoverproducing
cells, indicating that Cdc25A is a rate-limiting
factor for the
activation of cyclin A-associated kinases. Although less
striking,
cyclin E-associated kinase activity appears at least as much
earlier
as the premature S-phase entry occurs (Fig.
6) after Cdc25A
overexpression.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of Cdc25A overproduction on the activities of
G1 Cdks-cyclins in synchronized R12 cells. Cells were
synchronized and induced as described in the legend to Fig. 6. Extracts
were prepared after the times indicated and used to determine
G1 Cdk-cyclin activities. The kinases were
immunoprecipitated with cyclin A, cyclin E, Cdk4, and Cdk6 antibodies.
Cyclin A- and cyclin E-associated kinase activities were measured on
histone H1 as substrate, and Cdk4 and Cdk6 activities were measured on
pRb as substrate.
|
|
While this work was in progress, it was reported that Cdc25A modulates
p21 expression through dephosphorylation of the transcription
factor
cut, which then leads to a down-regulation of p21 promoter
activity
(
2). Therefore, we tested whether the effects of Cdc25A
overexpression on cyclin E- and A-dependent kinase activities
could be
due to a decrease of p21 levels in the cell. Figure
9A
shows that equal amounts of p21
protein were detected in cells
with and without Cdc25A overproduction.
Our results suggest that
Cdc25A overproduction does not lead to a
down-regulation of p21
protein levels in this particular system. It has
previously been
reported that Cdc25A competes with p21 for cyclin
binding (
34).
We therefore investigated if Cdc25A
overproduction might cause
a decrease of the amount of p21 bound to
Cdk2. This was tested
by immunoprecipitation of cyclin E- or
A-dependent kinases from
induced or noninduced clone 83, followed by
SDS-PAGE and immunoblotting
with p21-specific antibodies. We did not
observe any difference
in p21 binding to cyclin A-Cdk2 in
Cdc25A-overproducing cells
(Fig.
9B), while a slight difference was
observed in the amounts
of p21 binding to cyclin E-Cdk2 (Fig.
9B).
However, this small
difference in binding cannot account for the strong
activation
of cyclin E-dependent kinases that we observed. Taken
together,
our data show that dephosphorylation of inhibitory phosphates
on Cdk2 catalyzed by the Cdc25A phosphatase rather than displacement
of
p21 binding is critical for the observed activation of cyclin-Cdk2
kinases.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 9.
Expression and cyclin binding of p21 in
Cdc25A-overproducing cells. (A) Clones 55 and 83 were induced (+) or
noninduced ( ) by tetracycline removal and addition for 24 h.
Total levels of p21 after immunoblotting with p21 antibodies without
induction (lanes 1 and 3) and with induction of Cdc25A (lanes 2 and 4)
are shown. (B) Clone 83 was induced as described above. Amounts of p21
bound to immunoprecipitated cyclin A-Cdk2 (lanes 1 and 2) or cyclin
E-Cdk2 (lanes 5 and 6) complexes or to control immunoprecipitations
(with preimmune [P] serum) (lanes 3 and 7) were determined by
immunoblotting with p21 antibodies. Lane 4 shows the migration and
levels of p21 in whole rat-1 cell (C) lysates. IP, immunoprecipitant.
|
|
 |
DISCUSSION |
Our results suggest that human Cdc25A phosphatase plays an
important role in the control of cell cycle progression at the G1/S-phase transition. We show that induced expression of
Cdc25A, utilizing a tetracycline conditional expression system, in a
serum starvation-stimulation experiment resulted in an accelerated
entry into S phase by shortening the G1 phase by 10 to
15%, in comparison with that for noninduced cells. A decrease of the
length of the G1 phase has also been observed by
overproduction of the G1 cyclins D1, E, and A (31,
32). It is conceivable that additive effects of G1
cyclin expression would have a stronger impact on shortening the
G1 phase. Induction of a Cdc25A protein lacking phosphatase activity (Cdc25A C430S [data not shown]) resulted in a modest retardation of S-phase entry. The slight effect observed with the
inactive Cdc25A mutant protein suggests that a possible
dominant-negative effect might be titrated out by the presence of
endogenous Cdc25A protein in the R12 cell lines. Taken together, these
results show that the phosphatase activity of Cdc25A is a critical
regulator of entry into S phase. A similar role for Cdc25A has
previously been proposed based on microinjection studies with specific
antibodies against Cdc25A. Ablation of Cdc25A function blocks entry
into S phase (16, 19). Our data are in good agreement with
these previous findings and further suggest that Cdc25A is a
rate-limiting, positive regulator of the G1- to S-phase progression.
The physiological target(s) of the Cdc25A phosphatase remained unclear
for a long time. In NRK cells, treated with UV light, an increased
tyrosine phosphorylation of Cdk4 (on Tyr-17) was observed, resulting in
a G1 arrest (38). Microinjection of Cdc25A antibodies blocked the wild-type cells but not cells expressing the
Cdk4Y15F mutant, suggesting that Cdk4 might be a target for
Cdc25A. After TGF-
treatment, down-regulation of Cdc25A might be
involved in an event causing the phosphorylation of Cdk4 and Cdk6 on
Tyr-17 and Tyr-24, respectively, leading to cell cycle arrest in
G1 (17). Induction of a nonphosphorylatable
mutant of Cdk6 is not able to rescue the cell from a TGF-
-induced
arrest. In contrast, induction of Cdc25A partly allows the cells to
circumvent the arrest, indicating that Cdc25A also acts on other
targets. However, the increase in phosphorylation(s) in Cdk4 and Cdk6
could also be caused by an activation of the inhibiting kinase. To
date, the nature of the inhibiting kinase(s) acting on G1
Cdks is unclear. Cdc25A is transcriptionally regulated by c-Myc
(7). Coexpression of c-Myc and Ras in quiescent cells causes
a cell cycle progression (21). While Ras alone leads to an
activation of the cyclin D-Cdk4 (or Cdk6)/pRB/E2F pathway, c-Myc is
needed for cyclin E-Cdk2 activation, possibly via Cdc25A induction
(21). In order to assess the in vivo role of Cdc25A, we
studied the exact timing of activation of Cdc25A during G1
and S phase after serum stimulation of G0-arrested human
foreskin fibroblasts (Hs68) and in synchronized HeLa cells. In both
cell lines, activation of Cdc25A occurred simultaneously with the
activation of cyclin E-Cdk2 but before cyclin A-Cdk2 and, as shown in
Hs68 cells, after cyclin D-Cdk4 and cyclin D-Cdk6 activation. In
addition, inducible overexpression of Cdc25A leads to activation of
cyclin E-Cdk2 and cyclin A-Cdk2. No activation of cyclin D-Cdk4 or
cyclin D-Cdk6 could be detected after Cdc25A overexpression. This
observation is supported by the fact that neither Cdk4 nor Cdk6 is
phosphorylated on Tyr-17 or Tyr-24, respectively, in an exponentially
growing immortalized epithelial cell line (MCF-10A) and NRK cells. On
the other hand, Cdk2 is phosphorylated on Tyr-15 in exponentially
growing cells, indicating that Cdc25A is necessary for full activation
of Cdk2 (11, 38). Moreover, Cdc25A has a transforming
activity in an Rb
/
background (8). Since pRb
is directly inactivated by cyclin D-dependent kinases, this would
suggest that Cdc25A plays a role different from that of
dephosphorylation of cyclin D-Cdk4 or cyclin D-Cdk6. Our results
suggest that cyclin E-Cdk2 and cyclin A-Cdk2 act as critical targets
for Cdc25A in both cycling cells and serum-induced cells. We can,
however, not exclude the possibility that, as a consequence of external
factors, Cdc25A functions on different targets.
Recent work indicates that Cdc25A also acts on substrates apart from
Cdks. Cdc25A dephosphorylates the homeodomain transcription factor cut,
leading to a decrease in p21 promoter activity (2). According to our data, overexpression of Cdc25A in exponentially growing cells does not affect the p21 protein levels, but we cannot exclude the possibility that Cdc25A is involved in regulation of p21
promoter activity. Cdc25A and p21 have also been shown to
counterbalance each other by competing for the same binding site on the
cyclin-Cdk complexes in vitro (34). p21 disrupts the
interaction of Cdc25A with the cyclin-Cdk complex, thus blocking the
removal of inhibitory phosphate groups on Cdk2. In our in vivo system,
Cdc25A overexpression causes only a minor displacement of p21 from
cyclin E-Cdk2.
Cdk2 is phosphorylated on Thr-14 and Tyr-15, and both phosphorylations
lead to an inactivation of Cdk2 kinase activity since replacement of
Thr-14 and Tyr-15 on Cdk2 with nonphosphorylatable residues results in
elevated Cdk2 kinase activity (11). This suggests that Cdk2
is regulated by a Cdc25 phosphatase family member, similar to the
regulation of Cdk1 by Cdc25C. From the timing of activation, the Cdc25A
phosphatase would be a good candidate for regulating Cdk2 kinase
activity. Furthermore, our results show that both cyclin E-Cdk2 and
cyclin A-Cdk2 immunoprecipitates can be dephosphorylated and activated
by treatment with Cdc25A but not by treatment with a Cdc25A mutant
lacking phosphatase activity (Cdc25A C430A). This indicates that Cdc25A
expression directly leads to an increase in activity of cyclin E-Cdk2
and/or cyclin A-Cdk2. The inactive mutant Cdc25A C430S protein strongly interacts with both cyclin A-Cdk2 and cyclin E-Cdk2 but does not lead
to an activation of Cdk2 kinase activity (39). This
indicates that although p21 can be competed out from cyclin E-Cdk2
complexes, this step is not sufficient to activate the kinase activity.
The phosphatase activity of Cdc25A is necessary for Cdk2 activation, most likely due to dephosphorylation on Tyr-15 and Thr-14 of Cdk2. Since p21 levels do not change dramatically during the cell cycle (1), our favorite hypothesis is that when Cdc25A protein
levels and activity rise, Cdc25A overcomes the inhibition of Cdk2 by p21, leading to G1 progression and entry into S phase. This
would explain the observed acceleration of S-phase entry after Cdc25A overexpression.
 |
ACKNOWLEDGMENTS |
We are grateful to Harald zur Hausen for his support, to Manfred
Gossen and Herrman Bujard for pUHD 10-3, to Dalia Resnitzky and Steve
Reed for providing the R12 cell line, and to Carol Murphy for the
hygromycin resistance vector. We thank Tareg Bashir for technical
advice and many discussions. Christiane Lammer is thanked for excellent
technical assistance. We thank Martin Scheffner and the members of our
lab for critically reading the manuscript.
This work was supported by a grant from the Deutsche
Forschungsgemeinschaft (Ho1299/3-3).
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Forschungsschwerpunkt Angewandte Tumorvirologie (F0400), Deutsches
Krebsforschungszentrum, Im Neuenheimer Feld 242, D-69120 Heidelberg, Germany.
 |
REFERENCES |
| 1.
|
Cai, G., and B. Dynlacht.
1998.
Activity and nature of p21 WAF1 complexes during the cell cycle.
Proc. Natl. Acad. Sci. USA
95:12254-12259[Abstract/Free Full Text].
|
| 2.
|
Coqueret, O.,
G. Bérubé, and A. Nepveu.
1998.
The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which downmodulates p21WAF1/CIP/SDI1 in S phase.
EMBO J.
17:4680-4694[Medline].
|
| 3.
|
Draetta, G., and D. Beach.
1988.
Activation of cdc2 protein kinase during mitosis in human cells: cell cycle-dependent phosphorylation and subunit rearrangement.
Cell
54:17-26[Medline].
|
| 4.
|
Fauman, E.,
J. Cogswell,
B. Lovejoy,
W. Rocque,
W. Holmes,
V. Montana,
H. Piwnica-Worms,
M. Rink, and M. Saper.
1998.
Crystal structure of the catalytic domain of the human cell cycle control phosphatase, Cdc25A.
Cell
93:617-625[Medline].
|
| 5.
|
Gabrielli, B.,
C. De Souza,
I. Tonks,
J. Clark,
N. Hayward, and K. Ellem.
1996.
Cytoplasmic accumulation of Cdc25B phosphatase in mitosis triggers centrosomal microtubule nucleation in HeLa cells.
J. Cell Sci.
109:1081-1093[Abstract].
|
| 6.
|
Galaktionov, K., and D. Beach.
1991.
Specific activation of Cdc25 tyrosine phosphatase by B-type cyclins: evidence for multiple roles of mitotic cyclins.
Cell
67:1181-1194[Medline].
|
| 7.
|
Galaktionov, K., and D. Beach.
1996.
Cdc25 cell-cycle phosphatase as a target of c-Myc.
Nature
382:511-517[Medline].
|
| 8.
|
Galaktionov, K.,
A. Lee,
J. Eckstein,
G. Draetta,
J. Meckler,
M. Loda, and D. Beach.
1995.
Cdc25 phosphatases as potential human oncogenes.
Science
269:1575-1577[Abstract/Free Full Text].
|
| 9.
|
Gautier, J.,
M. J. Solomon,
R. N. Booher,
J. F. Bazan, and M. W. Kirschner.
1991.
Cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2.
Cell
67:197-211[Medline].
|
| 10.
|
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci USA
89:5547-5551[Abstract/Free Full Text].
|
| 11.
|
Gu, Y.,
J. Rosenblatt, and D. Morgan.
1992.
Cell cycle regulation of Cdk2 activity by phosphorylation of Thr160 and Tyr15.
EMBO J.
11:3995-4005[Medline].
|
| 12.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 13.
|
Harper, J.
1997.
Cyclin dependent kinase inhibitors.
Cancer Surv.
29:91-107[Medline].
|
| 14.
|
Hoffmann, I.
1996.
Cyclin-dependent protein kinases and the regulation of the eukaryotic cell cycle, p. 179-201.
In
F. Marks (ed.), Protein phosphorylation. Verlag Chemie, Weinheim, Germany.
|
| 15.
|
Hoffmann, I.,
P. R. Clarke,
M. J. Marcote,
E. Karsenti, and G. Draetta.
1993.
Phosphorylation and activation of human Cdc25-C by cdc2-cyclin B and its involvement in the self-amplification of MPF at mitosis.
EMBO J.
12:53-63[Medline].
|
| 16.
|
Hoffmann, I.,
G. Draetta, and E. Karsenti.
1994.
The tyrosine phosphatase activity of human Cdc25A is activated by cyclin E/Cdk2 during the G1/S transition.
EMBO J.
13:4302-4310[Medline].
|
| 17.
|
Iavarone, A., and J. Massague.
1997.
Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF- in cells lacking the CDK inhibitor p15.
Nature
387:417-422[Medline].
|
| 18.
|
Izumi, T., and J. Maller.
1993.
Elimination of cdc2 phosphorylation sites in the Cdc25 phosphatase blocks initiation of M-phase.
Mol. Biol. Cell
4:1337-1350[Abstract].
|
| 19.
|
Jinno, S.,
K. Suto,
A. Nagata,
M. Igarashi,
Y. Kanaoka,
H. Nojima, and H. Okayama.
1994.
Cdc25A is a novel phosphatase functioning early in the cell cycle.
EMBO J.
13:1549-1556[Medline].
|
| 20.
|
Lammer, C.,
S. Wagerer,
R. Saffrich,
D. Mertens,
W. Ansorge, and I. Hoffmann.
1998.
The Cdc25B phosphatase is essential for the G2/M phase transition in human cells.
J. Cell Sci.
111:2445-2453[Abstract].
|
| 21.
|
Leone, G.,
J. DeGregori,
R. Sears,
L. Jakoi, and J. Nevins.
1997.
Myc and Ras collaborate in inducing accumulation of active cyclin E/CDK2 and E2F.
Nature
387:422-426[Medline].
|
| 22.
|
Liu, F.,
J. Stanton,
Z. Wu, and H. Piwnica-Worms.
1997.
The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex.
Mol. Cell. Biol.
17:571-583[Abstract].
|
| 23.
|
Matsushime, H.,
D. Quelle,
S. Shurtleff,
M. Shibuya, and J. Kato.
1994.
D-type cyclin-dependent kinase activity in mammalian cells.
Mol. Cell. Biol.
14:2066-2076[Abstract/Free Full Text].
|
| 24.
|
McGowan, C. H., and P. Russell.
1993.
Human wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15.
EMBO J.
12:75-85[Medline].
|
| 25.
|
Millar, J. B. A.,
J. Blevitt,
L. Gerace,
K. Sadhu,
C. Featherstone, and P. Russell.
1991.
p55Cdc25 is a nuclear protein required for initiation of mitosis in human cells.
Proc. Natl. Acad. Sci. USA
88:10500-10504[Abstract/Free Full Text].
|
| 26.
|
Morgan, D.
1997.
Cyclin-dependent kinases: engines, clocks, and microprocessors.
Annu. Rev. Cell Dev. Biol.
13:261-291[Medline].
|
| 27.
|
Mueller, P. R.,
T. Coleman,
A. Kumagai, and W. Dunphy.
1995.
Myt1: a membrane-associated inhibitory kinase that phosphorylates cdc2 on both threonine-14 and tyrosine-15.
Science
270:86-90[Abstract/Free Full Text].
|
| 28.
|
Nagata, A.,
M. Igarashi,
S. Jinno,
K. Suto, and H. Okayama.
1991.
An additional homolog of the fission yeast Cdc25 gene occurs in humans and is highly expressed in some cancer cells.
New Biol.
3:959-967[Medline].
|
| 29.
|
Nishijima, H.,
H. Nishitani,
T. Seki, and T. Nishimototo.
1997.
A dual-specificity phosphatase Cdc25B is an unstable protein and triggers p34cdc2/cyclin B activation in hamster BHK21 cells arrested with hydroxyurea.
J. Cell Biol.
138:1105-1116[Abstract/Free Full Text].
|
| 30.
|
Poon, R.,
K. Yamashita,
J. Adamczewski,
T. Hunt, and J. Shuttleworth.
1993.
The cdc2-related protein p40Mo15 is the catalytic subunit of a protein kinase that can activate p33Cdk2 and p34Cdc2.
EMBO J.
12:3123-3132[Medline].
|
| 31.
|
Resnitzky, D.,
M. Gossen,
H. Bujard, and S. Reed.
1994.
Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol.
14:1669-1679[Abstract/Free Full Text].
|
| 32.
|
Resnitzky, D.,
L. Hengst, and S. Reed.
1995.
Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1.
Mol. Cell. Biol.
15:4347-4352[Abstract].
|
| 33.
|
Sadhu, K.,
S. Reed,
H. Richardson, and P. Russell.
1990.
Human homolog of fission yeast Cdc25 is predominantly expressed in G1.
Proc. Natl. Acad. Sci. USA
87:5139-5143[Abstract/Free Full Text].
|
| 34.
|
Saha, P.,
Q. Eichbaum,
E. Silberman,
B. Mayer, and A. Dutta.
1997.
p21 and Cdc25A: competition between an inhibitor and an activator of cyclin-dependent kinases.
Mol. Cell. Biol.
17:4338-4345[Abstract].
|
| 35.
|
Sherr, C., and J. Roberts.
1995.
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
9:1149-1163[Free Full Text].
|
| 36.
|
Solomon, M.,
J. Harper, and J. Shuttleworth.
1993.
CAK, the p34cdc2 activating kinase, contains a protein identical or closely related to p40MO15.
EMBO J.
12:3133-3142[Medline].
|
| 37.
|
Strausfeld, U.,
A. Fernandez,
J.-P. Capony,
F. Girard,
N. Lautredou,
J. Derancourt,
L. J. C., and N. Lamb.
1994.
Activation of p34cdc2 protein kinase by microinjection of human Cdc25C into mammalian cells.
J. Biol. Chem.
269:5989-6000[Abstract/Free Full Text].
|
| 38.
|
Terada, Y.,
M. Tatsuka,
S. Jinno, and H. Okayama.
1995.
Requirement for tyrosine phosphorylation of Cdk4 in G1 arrest induced by ultraviolet irradiation.
Nature
376:358-362[Medline].
|
| 39.
|
Xu, X., and S. Burke.
1996.
Roles of active site residues and the NH2-terminal domain in the catalysis and substrate binding of human Cdc25.
J. Biol. Chem.
271:5118-5124[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 1999, p. 6183-6194, Vol. 19, No. 9
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Demidova, A. R., Aau, M. Y., Zhuang, L., Yu, Q.
(2009). Dual Regulation of Cdc25A by Chk1 and p53-ATF3 in DNA Replication Checkpoint Control. J. Biol. Chem.
284: 4132-4139
[Abstract]
[Full Text]
-
Shreeram, S., Hee, W. K., Bulavin, D. V.
(2008). Cdc25A Serine 123 Phosphorylation Couples Centrosome Duplication with DNA Replication and Regulates Tumorigenesis. Mol. Cell. Biol.
28: 7442-7450
[Abstract]
[Full Text]
-
Boutros, R., Lobjois, V., Ducommun, B.
(2007). CDC25B Involvement in the Centrosome Duplication Cycle and in Microtubule Nucleation. Cancer Res.
67: 11557-11564
[Abstract]
[Full Text]
-
Welburn, J. P. I., Tucker, J. A., Johnson, T., Lindert, L., Morgan, M., Willis, A., Noble, M. E. M., Endicott, J. A.
(2007). How Tyrosine 15 Phosphorylation Inhibits the Activity of Cyclin-dependent Kinase 2-Cyclin A. J. Biol. Chem.
282: 3173-3181
[Abstract]
[Full Text]
-
Ray, D., Terao, Y., Fuhrken, P. G., Ma, Z.-Q., DeMayo, F. J., Christov, K., Heerema, N. A., Franks, R., Tsai, S. Y., Papoutsakis, E. T., Kiyokawa, H.
(2007). Deregulated CDC25A Expression Promotes Mammary Tumorigenesis with Genomic Instability. Cancer Res.
67: 984-991
[Abstract]
[Full Text]
-
Brisson, M., Foster, C., Wipf, P., Joo, B., Tomko, R. J. Jr., Nguyen, T., Lazo, J. S.
(2007). Independent Mechanistic Inhibition of Cdc25 Phosphatases by a Natural Product Caulibugulone. Mol. Pharmacol.
71: 184-192
[Abstract]
[Full Text]
-
Cheng, Y. S., Kuo, P. L., Teng, Y. N., Kuo, T. Y., Chung, C. L., Lin, Y. H., Liao, R. W., Lin, J. S. N., Lin, Y. M.
(2006). Association of spermatogenic failure with decreased CDC25A expression in infertile men. Hum Reprod
21: 2346-2352
[Abstract]
[Full Text]
-
Dekanty, A., Sauane, M., Cadenas, B., Coluccio, F., Barrio, M., Casala, J., Paciencia, M., Rogers, F., Coso, O. A., Piwien-Pilipuk, G., Rudland, P. S., de Asua, L. J.
(2006). Leukemia Inhibitory Factor Induces DNA Synthesis in Swiss Mouse 3T3 Cells Independently of Cyclin D1 Expression through a Mechanism Involving MEK/ERK1/2 Activation. J. Biol. Chem.
281: 6136-6143
[Abstract]
[Full Text]
-
Teer, J. K., Machida, Y. J., Labit, H., Novac, O., Hyrien, O., Marheineke, K., Zannis-Hadjopoulos, M., Dutta, A.
(2006). Proliferating Human Cells Hypomorphic for Origin Recognition Complex 2 and Pre-replicative Complex Formation Have a Defect in p53 Activation and Cdk2 Kinase Activation. J. Biol. Chem.
281: 6253-6260
[Abstract]
[Full Text]
-
Khaled, A. R., Bulavin, D. V., Kittipatarin, C., Li, W. Q., Alvarez, M., Kim, K., Young, H. A., Fornace, A. J., Durum, S. K.
(2005). Cytokine-driven cell cycling is mediated through Cdc25A. JCB
169: 755-763
[Abstract]
[Full Text]
-
Van Dross, R., Yao, S., Asad, S., Westlake, G., Mays, D. J., Barquero, L., Duell, S., Pietenpol, J. A., Browning, P. J.
(2005). Constitutively Active K-cyclin/cdk6 Kinase in Kaposi Sarcoma-Associated Herpesvirus-Infected Cells. JNCI J Natl Cancer Inst
97: 656-666
[Abstract]
[Full Text]
-
Ray, D., Terao, Y., Nimbalkar, D., Chu, L.-H., Donzelli, M., Tsutsui, T., Zou, X., Ghosh, A. K., Varga, J., Draetta, G. F., Kiyokawa, H.
(2005). Transforming Growth Factor {beta} Facilitates {beta}-TrCP-Mediated Degradation of Cdc25A in a Smad3-Dependent Manner. Mol. Cell. Biol.
25: 3338-3347
[Abstract]
[Full Text]
-
Ferguson, A. M., White, L. S., Donovan, P. J., Piwnica-Worms, H.
(2005). Normal Cell Cycle and Checkpoint Responses in Mice and Cells Lacking Cdc25B and Cdc25C Protein Phosphatases. Mol. Cell. Biol.
25: 2853-2860
[Abstract]
[Full Text]
-
Syljuasen, R. G., Sorensen, C. S., Nylandsted, J., Lukas, C., Lukas, J., Bartek, J.
(2004). Inhibition of Chk1 by CEP-3891 Accelerates Mitotic Nuclear Fragmentation in Response to Ionizing Radiation. Cancer Res.
64: 9035-9040
[Abstract]
[Full Text]
-
Koch, M. A., Wittenberg, L.-O., Basu, S., Jeyaraj, D. A., Gourzoulidou, E., Reinecke, K., Odermatt, A., Waldmann, H.
(2004). Compound library development guided by protein structure similarity clustering and natural product structure. Proc. Natl. Acad. Sci. USA
101: 16721-16726
[Abstract]
[Full Text]
-
Tosti, E., Waldbaum, L., Warshaw, G., Gross, E. A., Ruggieri, R.
(2004). The Stress Kinase MRK Contributes to Regulation of DNA Damage Checkpoints through a p38{gamma}-independent Pathway. J. Biol. Chem.
279: 47652-47660
[Abstract]
[Full Text]
-
Parsels, L. A., Parsels, J. D., Tai, D. C.-H., Coughlin, D. J., Maybaum, J.
(2004). 5-Fluoro-2'-Deoxyuridine-Induced cdc25A Accumulation Correlates with Premature Mitotic Entry and Clonogenic Death in Human Colon Cancer Cells. Cancer Res.
64: 6588-6594
[Abstract]
[Full Text]
-
Coulonval, K., Bockstaele, L., Paternot, S., Roger, P. P.
(2003). Phosphorylations of Cyclin-dependent Kinase 2 Revisited Using Two-dimensional Gel Electrophoresis. J. Biol. Chem.
278: 52052-52060
[Abstract]
[Full Text]
-
Arlander, S. J. H., Eapen, A. K., Vroman, B. T., McDonald, R. J., Toft, D. O., Karnitz, L. M.
(2003). Hsp90 Inhibition Depletes Chk1 and Sensitizes Tumor Cells to Replication Stress. J. Biol. Chem.
278: 52572-52577
[Abstract]
[Full Text]
-
Balmanno, K., Millar, T., McMahon, M., Cook, S. J.
(2003). {Delta}Raf-1:ER* Bypasses the Cyclic AMP Block of Extracellular Signal-Regulated Kinase 1 and 2 Activation but Not CDK2 Activation or Cell Cycle Reentry. Mol. Cell. Biol.
23: 9303-9317
[Abstract]
[Full Text]
-
Chen, M.-S., Ryan, C. E., Piwnica-Worms, H.
(2003). Chk1 Kinase Negatively Regulates Mitotic Function of Cdc25A Phosphatase through 14-3-3 Binding. Mol. Cell. Biol.
23: 7488-7497
[Abstract]
[Full Text]
-
Chow, J. P. H., Siu, W. Y., Ho, H. T. B., Ma, K. H. T., Ho, C. C., Poon, R. Y. C.
(2003). Differential Contribution of Inhibitory Phosphorylation of CDC2 and CDK2 for Unperturbed Cell Cycle Control and DNA Integrity Checkpoints. J. Biol. Chem.
278: 40815-40828
[Abstract]
[Full Text]
-
Scrivens, P. J., Alaoui-Jamali, M. A., Giannini, G., Wang, T., Loignon, M., Batist, G., Sandor, V. A.
(2003). Cdc25A-inhibitory properties and antineoplastic activity of bisperoxovanadium analogues. Molecular Cancer Therapeutics
2: 1053-1059
[Abstract]
[Full Text]
-
Baars, S., Bachmann, A., Levitzki, A., Rosl, F.
(2003). Tyrphostin AG 555 Inhibits Bovine Papillomavirus Transcription by Changing the Ratio between E2 Transactivator/Repressor Function. J. Biol. Chem.
278: 37306-37313
[Abstract]
[Full Text]
-
Hassepass, I., Voit, R., Hoffmann, I.
(2003). Phosphorylation at Serine 75 Is Required for UV-mediated Degradation of Human Cdc25A Phosphatase at the S-phase Checkpoint. J. Biol. Chem.
278: 29824-29829
[Abstract]
[Full Text]
-
Lazo, J. S., Ducruet, A. P., Koldamova, R. P.
(2003). Sleuthful Pharmacology. Mol. Pharmacol.
64: 199-201
[Full Text]
-
Efferth, T., Sauerbrey, A., Olbrich, A., Gebhart, E., Rauch, P., Weber, H. O., Hengstler, J. G., Halatsch, M.-E., Volm, M., Tew, K. D., Ross, D. D., Funk, J. O.
(2003). Molecular Modes of Action of Artesunate in Tumor Cell Lines. Mol. Pharmacol.
64: 382-394
[Abstract]
[Full Text]
-
Turowski, P., Franckhauser, C., Morris, M. C., Vaglio, P., Fernandez, A., Lamb, N. J. C.
(2003). Functional cdc25C Dual-Specificity Phosphatase Is Required for S-Phase Entry in Human Cells. Mol. Biol. Cell
14: 2984-2998
[Abstract]
[Full Text]
-
Xiao, Z., Chen, Z., Gunasekera, A. H., Sowin, T. J., Rosenberg, S. H., Fesik, S., Zhang, H.
(2003). Chk1 Mediates S and G2 Arrests through Cdc25A Degradation in Response to DNA-damaging Agents. J. Biol. Chem.
278: 21767-21773
[Abstract]
[Full Text]
-
Xu, X., Yamamoto, H., Sakon, M., Yasui, M., Ngan, C. Y., Fukunaga, H., Morita, T., Ogawa, M., Nagano, H., Nakamori, S., Sekimoto, M., Matsuura, N., Monden, M.
(2003). Overexpression of CDC25A Phosphatase Is Associated with Hypergrowth Activity and Poor Prognosis of Human Hepatocellular Carcinomas. Clin. Cancer Res.
9: 1764-1772
[Abstract]
[Full Text]
-
Qu, Z., Weiss, J. N., MacLellan, W. R.
(2003). Regulation of the mammalian cell cycle: a model of the G1-to-S transition. Am. J. Physiol. Cell Physiol.
284: C349-C364
[Abstract]
[Full Text]
-
Pu, L., Amoscato, A. A., Bier, M. E., Lazo, J. S.
(2002). Dual G1 and G2 Phase Inhibition by a Novel, Selective Cdc25 Inhibitor 7-Chloro-6-(2-morpholin-4-ylethylamino)- quinoline-5,8-dione. J. Biol. Chem.
277: 46877-46885
[Abstract]
[Full Text]
-
Lents, N. H., Keenan, S. M., Bellone, C., Baldassare, J. J.
(2002). Stimulation of the Raf/MEK/ERK Cascade Is Necessary and Sufficient for Activation and Thr-160 Phosphorylation of a Nuclear-targeted CDK2. J. Biol. Chem.
277: 47469-47475
[Abstract]
[Full Text]
-
Melkun, E., Pilione, M., Paulson, R. F.
(2002). A naturally occurring point substitution in Cdc25A, and not Fv2/Stk, is associated with altered cell-cycle status of early erythroid progenitor cells. Blood
100: 3804-3811
[Abstract]
[Full Text]
-
Zhao, H., Watkins, J. L., Piwnica-Worms, H.
(2002). Disruption of the checkpoint kinase 1/cell division cycle 25A pathway abrogates ionizing radiation-induced S and G2 checkpoints. Proc. Natl. Acad. Sci. USA
99: 14795-14800
[Abstract]
[Full Text]
-
Wu, K., Wang, C., D'Amico, M., Lee, R. J., Albanese, C., Pestell, R. G., Mani, S.
(2002). Flavopiridol and Trastuzumab Synergistically Inhibit Proliferation of Breast Cancer Cells: Association with Selective Cooperative Inhibition of Cyclin D1-dependent Kinase and Akt Signaling Pathways. Molecular Cancer Therapeutics
1: 695-706
[Abstract]
[Full Text]
-
Nieborowska-Skorska, M., Hoser, G., Kossev, P., Wasik, M. A., Skorski, T.
(2002). Complementary functions of the antiapoptotic protein A1 and serine/threonine kinase pim-1 in the BCR/ABL-mediated leukemogenesis. Blood
99: 4531-4539
[Abstract]
[Full Text]
-
Wang, Z., Wang, M., Lazo, J. S., Carr, B. I.
(2002). Identification of Epidermal Growth Factor Receptor as a Target of Cdc25A Protein Phosphatase. J. Biol. Chem.
277: 19470-19475
[Abstract]
[Full Text]
-
Guo, N., Faller, D. V., Vaziri, C.
(2002). Carcinogen-induced S-Phase Arrest Is Chk1 Mediated and Caffeine Sensitive. Cell Growth Differ.
13: 77-86
[Abstract]
[Full Text]
-
Sandal, T.
(2002). Molecular Aspects of the Mammalian Cell Cycle and Cancer. The Oncologist
7: 73-81
[Abstract]
[Full Text]
-
Nguyen, D. X., Westbrook, T. F., McCance, D. J.
(2002). Human Papillomavirus Type 16 E7 Maintains Elevated Levels of the cdc25A Tyrosine Phosphatase during Deregulation of Cell Cycle Arrest. J. Virol.
76: 619-632
[Abstract]
[Full Text]
-
Ma, Z.-Q., Liu, Z., Ngan, E. S. W., Tsai, S. Y.
(2001). Cdc25B Functions as a Novel Coactivator for the Steroid Receptors. Mol. Cell. Biol.
21: 8056-8067
[Abstract]
[Full Text]
-
Wang, Z., Southwick, E. C., Wang, M., Kar, S., Rosi, K. S., Wilcox, C. S., Lazo, J. S., Carr, B. I.
(2001). Involvement of Cdc25A Phosphatase in Hep3B Hepatoma Cell Growth Inhibition Induced by Novel K Vitamin Analogs. Cancer Res.
61: 7211-7216
[Abstract]
[Full Text]
-
Moon, N. S., Premdas, P., Truscott, M., Leduy, L., Berube, G., Nepveu, A.
(2001). S Phase-Specific Proteolytic Cleavage Is Required To Activate Stable DNA Binding by the CDP/Cut Homeodomain Protein. Mol. Cell. Biol.
21: 6332-6345
[Abstract]
[Full Text]
-
Zou, X., Tsutsui, T., Ray, D., Blomquist, J. F., Ichijo, H., Ucker, D. S., Kiyokawa, H.
(2001). The Cell Cycle-Regulatory CDC25A Phosphatase Inhibits Apoptosis Signal-Regulating Kinase 1. Mol. Cell. Biol.
21: 4818-4828
[Abstract]
[Full Text]
-
Chen, M.-S., Hurov, J., White, L. S., Woodford-Thomas, T., Piwnica-Worms, H.
(2001). Absence of Apparent Phenotype in Mice Lacking Cdc25C Protein Phosphatase. Mol. Cell. Biol.
21: 3853-3861
[Abstract]
[Full Text]
-
Foster, J. S., Henley, D. C., Bukovsky, A., Seth, P., Wimalasena, J.
(2001). Multifaceted Regulation of Cell Cycle Progression by Estrogen: Regulation of Cdk Inhibitors and Cdc25A Independent of Cyclin D1-Cdk4 Function. Mol. Cell. Biol.
21: 794-810
[Abstract]
[Full Text]
-
Shi, Z., Azuma, A., Sampath, D., Li, Y.-X., Huang, P., Plunkett, W.
(2001). S-Phase Arrest by Nucleoside Analogues and Abrogation of Survival without Cell Cycle Progression by 7-Hydroxystaurosporine. Cancer Res.
61: 1065-1072
[Abstract]
[Full Text]
-
Leduc, I., Karsunky, H., Mathieu, N., Schmidt, T., Verthuy, C., Ferrier, P., Moroy, T.
(2000). The Pim-1 kinase stimulates maturation of TCR{beta}-deficient T cell progenitors: implications for the mechanism of Pim-1 action. Int Immunol
12: 1389-1396
[Abstract]
[Full Text]
-
Takemasa, I., Yamamoto, H., Sekimoto, M., Ohue, M., Noura, S., Miyake, Y., Matsumoto, T., Aihara, T., Tomita, N., Tamaki, Y., Sakita, I., Kikkawa, N., Matsuura, N., Shiozaki, H., Monden, M.
(2000). Overexpression of CDC25B Phosphatase as a Novel Marker of Poor Prognosis of Human Colorectal Carcinoma. Cancer Res.
60: 3043-3050
[Abstract]
[Full Text]
-
Santoni-Rugiu, E., Falck, J., Mailand, N., Bartek, J., Lukas, J.
(2000). Involvement of Myc Activity in a G1/S-Promoting Mechanism Parallel to the pRb/E2F Pathway. Mol. Cell. Biol.
20: 3497-3509
[Abstract]
[Full Text]
-
Lane, M. E., Elend, M., Heidmann, D., Herr, A., Marzodko, S., Herzig, A., Lehner, C. F.
(2000). A Screen for Modifiers of Cyclin E Function in Drosophila melanogaster Identifies Cdk2 Mutations, Revealing the Insignificance of Putative Phosphorylation Sites in Cdk2. Genetics
155: 233-244
[Abstract]
[Full Text]
-
Korner, K., Jerome, V., Schmidt, T., Muller, R.
(2001). Cell Cycle Regulation of the Murine cdc25B Promoter. ESSENTIAL ROLE FOR NUCLEAR FACTOR-Y AND A PROXIMAL REPRESSOR ELEMENT. J. Biol. Chem.
276: 9662-9669
[Abstract]
[Full Text]
-
Keenan, S. M., Bellone, C., Baldassare, J. J.
(2001). Cyclin-dependent Kinase 2 Nucleocytoplasmic Translocation Is Regulated by Extracellular Regulated Kinase. J. Biol. Chem.
276: 22404-22409
[Abstract]
[Full Text]