Previous Article | Next Article 
Molecular and Cellular Biology, January 2000, p. 113-125, Vol. 20, No. 1
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Alleviation of Human Papillomavirus E2-Mediated Transcriptional
Repression via Formation of a TATA Binding Protein (or TFIID)-TFIIB-RNA
Polymerase II-TFIIF Preinitiation Complex
Samuel Y.
Hou,
Shwu-Yuan
Wu,
Tianyuan
Zhou,
Mary C.
Thomas, and
Cheng-Ming
Chiang*
Department of Biochemistry, University of
Illinois, Urbana, Illinois 61801
Received 22 July 1999/Returned for modification 5 October
1999/Accepted 7 October 1999
 |
ABSTRACT |
Transcription in human papillomaviruses (HPVs) is mainly regulated
by cellular transcription factors and virus-encoded E2 proteins that
act as sequence-specific DNA-binding proteins. Although the functions
of E2 as a transcriptional activator and a repressor have been well
documented, the role of cellular factors involved in E2-mediated
regulation of the HPV promoters and the mechanism by which E2 modulates
viral gene expression remain unclear. Using reconstituted cell-free
transcription systems, we found that cellular enhancer-binding factors
and general cofactors, such as TAFIIs, TFIIA, Mediator, and
PC4, are not required for E2-mediated repression. Unlike other
transcriptional repressors that function through recruitment of histone
deacetylase or corepressor complexes, HPV E2 is able to directly target
components of the general transcription machinery to exert its
repressor activity on the natural HPV E6 promoter. Interestingly,
preincubation of TATA binding protein (TBP) or TFIID with HPV template
is not sufficient to overcome E2-mediated repression, which can be
alleviated only via formation of a minimal TBP (or TFIID)-TFIIB-RNA
polymerase II-TFIIF preinitiation complex. Our data therefore indicate
that E2 does not simply work by displacing TBP or TFIID from binding to
the adjacent TATA box. Instead, E2 appears to function as an active
repressor that directly inhibits HPV transcription at steps after TATA
recognition by TBP or TFIID.
 |
INTRODUCTION |
Transcription in eukaryotes is often
regulated by extracellular molecules that act through distinct signal
transduction pathways to modulate specific gene expression via
controlling the activity of gene-specific transcription factors. These
gene-specific transcription factors then work in conjunction with
general transcription factors (GTFs) and cofactors to enhance or
inhibit the level of transcription. Although many studies have been
conducted to elucidate the mechanisms of transcriptional activation in
eukaryotes, relatively little is known about the mechanisms of
repression. In general, transcriptional repressors can work either
passively to antagonize the activator function or actively to inhibit
the activity of the general transcription machinery (30).
Counteraction of the activator function by passive repressors can be
achieved by direct competition of the same DNA-binding sites
(36, 37, 41, 54, 55), interference of overlapping or
neighboring activator-binding sites (21, 24, 38, 58), modification of the DNA-binding property of the activators
(60), titrating away limiting protein factors required for
activator function (15, 31), or masking and/or altering the
function of the activation domain or blocking the DNA-binding activity of the activators through protein-protein interactions (3, 24, 46,
61). In contrast, active repressors are able to directly inhibit
the activity or the assembly of the general transcription machinery,
with or without the help of corepressors (2, 23, 27, 29, 40, 43,
45, 51). The recruitment of histone deacetylase complexes by some
repressors or corepressors represents another level of gene regulation
via alteration of chromatin structure (48).
To decipher the mechanisms of transcriptional repression, we use human
papillomaviruses (HPVs) as a model system, since repression of HPV
transcription plays a critical role in regulating the expression of
viral oncoproteins that accounts for the pathogenic nature of many
HPV-induced human diseases including benign genital warts and cervical
cancer. E2, encoded by HPVs, is a sequence-specific transcription
factor that recognizes a consensus sequence, ACCN6GGT, found in the upstream regulatory region (URR or long control region) of
all papillomaviruses so far identified (41, 55). Depending on the sequence context of the E2-binding sites, E2 can function as a
transcriptional activator or as a repressor. Four consensus E2-binding
sites, whose positions are highly conserved among HPVs, are located in
the URR (44). Binding of E2 to the promoter-distal sites
enhances, whereas E2 binding to the promoter-proximal elements inhibits, E6 promoter activity. Although activation of the E6 promoter,
which controls the expression of many viral gene products involved in
HPV DNA replication, transcription, and transformation, requires E2
working in conjunction with URR enhancer-binding factors (14, 16,
20, 21, 32, 59, 63, 72), E2-mediated repression of the E6
promoter is believed to occur in the promoter-proximal region by
preventing the binding of adjacent cellular factors such as Sp1 and
TATA binding protein (TBP) that are critical for preinitiation complex
(PIC) assembly (17, 21, 22, 59). Indeed, binding of Sp1 to
its cognate sequence is displaced by increasing amounts of E2 as
demonstrated by electrophoretic mobility shift assays (17, 21,
59), correlating with the observation that mutations on the
Sp1-binding site partially relieve E2-mediated repression while
mutations on the promoter-proximal E2-binding sites enhance E6 promoter
activity during transient transfection assays (17, 21, 50,
59). In addition to passive repression, E2 has been suggested to
function as an active repressor by preventing the assembly of a
functional PIC based on in vitro transcription studies performed with
HeLa nuclear extracts (22). Although preincubation of HPV
DNA templates with HeLa nuclear extracts apparently alleviates
E2-mediated repression, it is not clear whether the inhibitory activity
of E2 is overcome solely by components of the GTFs or by other cellular
proteins, such as Sp1, present in HeLa nuclear extracts. Therefore, the
role of individual cellular factors, including both enhancer-binding
proteins and GTFs, in HPV transcription remains to be investigated.
To elucidate the mechanism of E2-mediated regulation of the E6 promoter
and to define the role of cellular transcription factors in HPV
transcription, we have established E2-dependent cell-free transcription
systems reconstituted either with individually purified GTFs and
cofactors (68) or with a TATA-binding factor (TBP or TFIID)
and preassembled TFIID-deficient RNA polymerase II (pol II) holoenzyme
that contains pol II, a subset of GTFs (TFIIB, TFIIE, TFIIF, and
TFIIH), SRBs (suppressors of RNA polymerase B mutations), and chromatin
remodeling factors (67, 69). Using a combination of these in
vitro transcription systems, we demonstrate that E2 protein, derived
from HPV type 11 (HPV-11), which induces benign genital warts and
laryngeal papillomatosis in infected patients, can suppress the
homologous E6 promoter independently of cellular enhancer-binding
factors, general cofactors such as TAFIIs in TFIID, TFIIA,
Mediator, and USA-derived components, and protein phosphorylation on
E2. The N-terminal domain of E2, which is important for
transactivation, is not required for E2-mediated repression. Only a
subset of GTFs, including TBP, TFIIB, pol II, and TFIIF, are needed and
sufficient for E2-mediated repression of the HPV-11 E6 promoter.
Surprisingly, using order-of-addition and Sarkosyl to manipulate the
sequence of factor assembly in the transcription assays, we find that
preincubation of TBP (or TFIID, which is a multiprotein complex
comprising TBP and approximately a dozen TAFIIs) with DNA
templates cannot overcome E2-mediated repression, indicating that
steric hindrance of TBP (or TFIID) binding to the TATA box may not be
the sole mechanism by which E2 inhibits E6 promoter activity.
Interestingly, alleviation of E2-mediated repression can be achieved
via formation of a minimal TBP (or TFIID)-TFIIB-pol II-TFIIF PIC. These
findings suggest that, unlike other transcriptional repressors that
function through recruitment of histone deacetylase or corepressor
complexes, HPV E2 is able to directly target components of the general
transcription machinery to exert its repressor activity on the natural
HPV E6 promoter.
 |
MATERIALS AND METHODS |
Plasmid constructions.
Bacterial expression plasmids
pF:E1-11d, pF:E2-11d, pF:E4-11d, pF:CM-11d, pF:CM2-11d, and pF:CM4-11d,
used for the expression of FLAG-tagged HPV-11 E1, E2, E4,
E1M
E2C, E1Ma
E4, and double-spliced E2C
(ds-E2C) (5, 7), were constructed from p6HisF:E1-11d, p6HisF:E2-11d (11), p6HisF:E4-11d, p6HisF:CM-11d,
p6HisF:CM2-11d, and p6HisF:CM4-11d, respectively, by PCR amplification
with an NcoI site-containing sense primer (5'
CAAGGGAATTCGCCATGGACTACAAA 3') that anneals to the FLAG sequence
and an antisense primer (5' TGCTAGTTATTGCTCAGCGG 3') located
downstream of the BamHI site in p6HisF-11d (11),
after cloning individual PCR products into the NcoI and
BamHI sites of pET-11d (Novagen). The plasmid p6HisF:E1-11d was generated by cloning the NdeI (created at the initiation
codon by PCR)-BglII fragment of the HPV-11 E1 cDNA from
pVL-E1 (6) into the NdeI and BamHI
sites of p6HisF-11d. Plasmids p6HisF:E4-11d, p6HisF:CM-11d,
p6HisF:CM2-11d, and p6HisF:CM4-11d were made by cloning the N-terminal
fragment of each cDNA from pRSE4 (12), pMT2-CM-M849
(7), pMT2-CM2-M849 (same as pMT2-CM-M849 except containing
the E1Ma
E4 splice sites [5]), and
pMT2-CM4 (7), respectively, between NdeI (created
at the initiation codon) and NarI sites together with a
common C-terminal fragment between NarI and XhoI
sites of pCMV-E2 (8) into the NdeI and
XhoI sites of p6HisF-11d.
The transfer plasmids pVL-F:CM, pVL-F:CM2, pVL-F:CM4, and pVL-F:E4,
used for baculoviral expression of FLAG-tagged HPV-11 E1M
E2C, E1Ma
E4, ds-E2C, and E4, were
constructed by substituting the NcoI-BamHI
fragments of HPV inserts isolated from pF:CM-11d, pF:CM2-11d,
pF:CM4-11d, and pF:E4-11d, respectively, for the HPV-11 E2 insert in
pVL-F°:E2 (69) between the NcoI and
BamHI sites. The transfer plasmid pVL-F°:E1, used for
baculoviral expression of FLAG-tagged HPV-11 E1 without a heart muscle
kinase phosphorylation site linked to the FLAG epitope, was made by
first cloning the NdeI-EcoRI fragment of the
full-length E1 cDNA from p6HisF:E1-11d, following partial
NdeI and EcoRI digestion, into the
NdeI-EcoRI-linearized pFLAG°(AS)-7 vector
(66) to create pF°:E1-7. The FLAG-tagged HPV-11 E1-coding
region was then isolated from pF°:E1-7 and cloned into pVL1392
between the BglII and EcoRI sites to generate
pVL-F°:E1.
The transcriptional template pGL7072-161, containing the HPV-11
URR spanning nucleotides 7072 to 7933/1 to 161 linked to a luciferase reporter gene, was constructed by cloning the HPV-11 insert,
amplified from pSVO10/HPV-11 (5) with a KpnI
site-containing sense primer (5' TTCCCGGGTACCGGATCCCTATAAGGATATG
3') and a BglII site-containing antisense primer
(5' CCAAGCTTAGATCTAAACGTCTTGCACAAC 3') by PCR, into
pGL2-Basic (Promega) between the KpnI and
BglII sites. The G-less cassette templates
p7072-70GLess/I+, p7072-70GLess/I
,
p7862-70GLess/I+, and p7862-70GLess/I
(with
numbers corresponding to the first and last nucleotides of the
HPV-11 inserts) used for in vitro transcription were constructed by
cloning the PCR products, generated from HPV-11 URR-containing plasmid
pUR23-3 (13) with an EcoRI site-containing sense
primer (5' TTGGTACCGAATTCGGATCCCTATAAGGATATG 3' for the
cloning of p7072-70GLess/I+ and
p7072-70GLess/I
and 5'
GGAGAGGGTACCGAATTCATGAGTAACCTAAGGTCA 3' for the cloning of
p7862-70GLess/I+ and p7862-70GLess/I
) and a
SacI site-containing antisense primer (5'
GAGAGGAGATCTGAGCTCTTATATATAACCGTTTTC 3'), into either pIGL
(65), which contains the adenovirus major late promoter
(MLP) initiator linked to a G-less cassette of 388 nucleotides, or pGL
(65), which contains a G-less cassette of 377 nucleotides
without the MLP initiator, between EcoRI and
SacI sites. The transcription templates,
p7862-70(2M)GLess/I
,
p7862-70(3M)GLess/I
, p7862-70(4M)GLess/I
, p7862-70(23M)GLess/I
, p7862-70(24M)GLess/I
,
p7862-70(34M)GLess/I
, and
p7862-70(234M)GLess/I
, which contain mutations on
E2-binding sites 2, 3, 4, 2 and 3, 2 and 4, 3 and 4, and 2 and 3 and 4, respectively, were constructed similarly to
p7862-70GLess/I
, except that DNA templates containing
various E2-binding site mutations in the backbone of 24-N
(21) were used for PCR amplification.
Protein purification.
Bacterially expressed FLAG-tagged
HPV-11 proteins E1, E2, E4, E1M
E2C,
E1Ma
E4, and ds-E2C were purified from BL21(DE3)pLysS strains harboring pF:E1-11d, pF:E2-11d, pF:E4-11d, pF:CM-11d, pF:CM2-11d, and pF:CM4-11d, respectively, according to the published protocol (10). Purification of FLAG-tagged HPV-11 E1, E2,
E4, E1M
E2C, and ds-E2C from insect Sf9 cells was
performed by using pVL-F°:E1, pVL-F°:E2, pVL-F:E4, pVL-F:CM, and
pVL-F:CM4, individually, as described elsewhere (69).
Isolation of recombinant FLAG-tagged human GTFs (TFIIB, TBP, TFIIE
,
and TFIIE
), FLAG-tagged multiprotein complexes (TFIID, TFIIH, and
pol II), six-histidine-tagged TFIIF subunits (RAP30 and RAP74),
recombinant PC4, and TFIID-deficient pol II holoenzyme was conducted as
described previously (9, 10, 34, 67, 68).
In vitro transcription with HeLa nuclear extracts.
In vitro
transcription performed with HeLa nuclear extracts and analyzed by
primer extension was carried out in a 25-µl reaction mixture
containing 250 ng of pGL7072-161, 5 ng of pHIV+58 (33), 40 mM HEPES-Na (pH 8.4), 0.2 mg of bovine serum albumin per ml, 60 mM KCl,
3 mM MgCl2, 4 mM dithiothreitol (DTT), 0.6 mM
nucleoside triphosphates (NTPs), 4 U of RNasin (Promega), and 5 µl of HeLa nuclear extracts, prepared as previously described
(18), in the absence or presence of increasing amounts of
baculovirus-expressed HPV-11 E2 protein. After incubation of the
reaction mixture at 30°C for 60 min, the RNA synthesized was
extracted by acid phenol and precipitated with ethanol. Purified RNA
was incubated with 0.06 pmol of each 32P-labeled primer
specific for the luciferase [Luc(AS)-5 primer, 5'
CTCTTCATAGCCTTATGCAG 3'] and the chloramphenicol
acetyltransferase (CAT) gene (5' CAACGGTGGTATATCCAGTG 3') in
10 µl of buffer containing 8.8 mM Tris-HCl (pH 7.5), 0.88 mM EDTA,
and 0.25 M KCl, at 85°C for 2 min, 65°C for 1 h, and finally
at room temperature for 10 min. Primer extension was then performed by
adding 25 µl of reverse transcriptase cocktail containing 5 U of
avian myeloblastosis virus reverse transcriptase (Promega), 10 mM DTT,
10 mM MgCl2, 20 mM Tris-HCl (pH 8.7), 1 mM dNTPs, 1.5 µg
of actinomycin D, and 20 U of RNasin at 42°C for 45 min. The reverse
transcriptase product was then ethanol precipitated, resolved by 8%
polyacrylamide gels containing 50% urea, and detected by
autoradiography. Unless otherwise specified, relative intensity in each
set of reactions is defined as the signal intensity quantitated by
PhosphorImager (Molecular Dynamics) from the HPV templates relative to
that performed in the absence of E2.
In vitro transcription performed with G-less cassette templates in HeLa
nuclear extracts was similarly conducted in a 25-µl reaction
mixture containing 50 ng of HPV-11 G-less cassette template, 50 ng
of pML
53 (42), 25 mM HEPES-Na (pH 8.4), 0.5 mg of
bovine serum albumin per ml, 72 mM KCl, 4 mM MgCl2, 5 mM
DTT, 0.5 mM ATP, 0.5 mM UTP, 25 µM CTP, 1 µl of
[
-32P]CTP (3,000 Ci/mmol; Amersham Pharmacia
Biotech), 0.1 mM 3'-O-methyl-GTP, 20 U of RNasin,
10 U of RNase T1 (Amersham Pharmacia Biotech), and 1 µl
of HeLa nuclear extracts, in the absence or presence of increasing
amounts of baculovirus-expressed HPV-11 E2 protein. Reactions were then
performed and analyzed as described elsewhere (67).
Reconstituted in vitro transcription assays.
In vitro
transcription performed with a TATA-binding factor and TFIID-deficient
pol II holoenzyme (f:pol II [67]) was conducted with
50 ng of HPV-11 G-less cassette template, 50 ng of pML
53, 1 ng of
TBP or an equivalent amount of FLAG-tagged TFIID (normalized by Western
blotting with anti-TBP antibodies), and 3 µl (~90 ng) of f:pol II,
in the absence or presence of HPV-11 proteins as specified in the
figures. Reactions were then conducted and analyzed as described
elsewhere (67). The order-of-addition experiments outlined
in Fig. 6A were similarly conducted as described elsewhere (67) by preincubating 50 ng of p7072-70GLess/I
and 50 ng of pML
53 with TBP and f:pol II, individually or together, at 30°C for 30 min, in the absence or presence of
baculovirus-expressed HPV-11 E2. The remaining transcription components
and ribonucleoside triphosphates were then added, with or without
0.015% Sarkosyl, to initiate transcription. E2, if included (50 ng),
was also added at different time points as indicated.
Unless otherwise specified, in vitro transcription reconstituted with
recombinant GTFs (TFIIB, TBP, TFIIE, and TFIIF) and highly purified
epitope-tagged multiprotein complexes (TFIIH and pol II) was performed
with 50 ng of HPV template, 50 ng of pML
53, 1 ng of TBP, 10 ng of
TFIIB, 5 ng of TFIIE
, 5 ng of TFIIE
, 28 ng of reconstituted TFIIF
(20 ng of RAP74 and 8 ng of RAP30), 15 ng of TFIIH, and 30 ng of pol
II, in the absence or presence of 50 ng of E2. The reactions were then
processed as described previously (68). The
order-of-addition experiment performed with a minimal transcription
system containing TBP, TFIIB, pol II, and TFIIF is outlined at the
bottom of Fig. 8A. Briefly, transcriptional templates
(p7072-70GLess/I+ or p7072-70GLess/I
and
pML
53) were incubated first with TBP, TBP-TFIIB, TBP-TFIIB-pol II, or TBP-TFIIB-pol II-TFIIF individually in different tubes at 30°C
for 30 min. The remaining transcriptional components and NTPs were then
added, in the absence or presence of E2, to initiate transcription and
processed as described above.
Mapping of transcription start sites.
The
transcription start site from pGL7072-161 was mapped by first
performing an in vitro transcription reaction with 50 ng of pGL7072-161
and 5 µl of HeLa nuclear extracts, in the absence or presence of
different amounts of
-amanitin, as described above except that
primer extension was carried out with a different luciferase primer
[Luc(AS)-4, 5' ACCAACAGTACCGGAATGCCA 3']. The same primer
was also used to generate DNA sequencing markers for mapping of the
transcription start site, which was visualized by autoradiography after
separation on a DNA sequencing gel.
For mapping of the transcription start sites from HPV-11 G-less
cassette templates (p7072-70GLess/I+,
p7862-70GLess/I+, p7072-70GLess/I
, and
p7862-70GLess/I
) and pML
53, 250 ng of each
DNA template was incubated with 5 µl of HeLa nuclear
extracts. In vitro transcription and primer extension were similarly
performed as described above except for the use of a primer
(5' TGAGAGTGAATGATGATAGATTTGGG 3') that anneals to the
G-less cassettes. This primer was also used to create DNA sequencing
markers for mapping of the transcription start sites.
DNase I footprinting.
The DNA fragment, spanning nucleotides
7902 to 7933/1 to 161 of HPV-11, used for DNase I footprinting was
generated by PCR amplification of pGL7072-161 with a
KpnI-containing sense primer (5'
TTCCCGGGTACCGGTACATATTGCCCTG 3') and a
BglII-containing antisense primer (5'
CCAAGCTTAGATCTAAACGTCTTGCACAAC 3'). The PCR product was end
labeled with 32P by T4 polynucleotide kinase. The
top-strand specifically end-labeled template was generated by
BglII digestion and further purified by passage through a
MicroSpin G-25 column (Amersham Pharmacia Biotech). Approximately 3 fmol of labeled DNA fragment (~50,000 cpm) was used for DNase I
footprinting analysis according to the same protocol as described
previously (9).
 |
RESULTS |
Establishment of cell-free transcription systems regulated by
HPV-11 E2.
To dissect the mechanisms of E2-mediated regulation of
the natural HPV E6 promoter, we decided to use HPV-11 as a model
system, since multiple forms of HPV-11 E2 proteins that have the same DNA-binding and dimerization domain but differ in their N-terminal amino acid residues have been identified and shown to play distinct roles in viral DNA replication and transcription (5, 7). Three of the HPV-11 E2 family proteins (E2, ds-E2C, and
E1M
E2C) as well as the E1 family proteins (E1,
E1M
E2C, and E1Ma
E4) and E4 (Fig.
1A) to be used as controls for in vitro
transcription assays were purified from both bacteria and insect cells
via FLAG-epitope tagging and peptide elution methods (Fig. 1B). To test
whether our purified FLAG-tagged full-length E2 protein (simply
referred to as E2 throughout the text) was transcriptionally active and was capable of recapitulating E2-mediated regulation of HPV
transcription in cell-free systems, we first performed a transcription
assay with HeLa nuclear extracts, which provide all the cellular
transcription factors and cofactors necessary for E2-mediated
transcription in vitro (22, 56, 63). A DNA template,
pGL7072-161, containing the HPV-11 URR spanning nucleotides 7072 to
7933/1 to 161 linked to a luciferase reporter gene was used for initial
characterization. A human immunodeficiency virus type 1 (HIV-1)
promoter-driven CAT reporter plasmid, pHIV+58, with the HIV-1 upstream
regulatory sequence up to
167 (33) was also included in
the transcription reaction as a negative control for E2-mediated
response. The amounts of transcripts formed in the nuclear extract from
both DNA templates were measured by primer extension with
32P-labeled luciferase and CAT primers and analyzed on an
8% polyacrylamide-urea gel. The expected transcript size is
approximately 200 nucleotides for pGL7072-161 and 129 nucleotides for
pHIV+58. As shown in Fig. 1C, transcription from the HPV-11 template is
enhanced up to 2-fold at low concentrations of E2 but inhibited up to
13-fold at high amounts of E2, as observed previously for transfected
cells (21). Two minor transcripts also responsive to E2 are
caused by strong pausing sites found in the HPV-11 transcript during
reverse transcriptase reactions (data not shown). Transcription from
the internal HIV control template remains constant throughout the
experiment (Fig. 1C, lanes 1 to 6). This result not only confirms a
previous hypothesis for E2 regulation of the HPV-11 E6 promoter
(13) and is consistent with a result similarly obtained
for HeLa nuclear extracts with HPV-18 E2 protein (56) but
also demonstrates that our FLAG-tagged E2 protein, which shows
sequence-specific binding activity as assayed by DNase I footprinting
(see below), indeed has transcriptional activity as expected from a
natural untagged E2 protein. Since the transcription start site of the
HPV-11 E6 promoter has been estimated thus far by RNase protection
assays only to nucleotides between 90 and 99 (13, 19, 53),
we have now precisely mapped the E6 start site to nucleotide 93 (P93) by primer extension and defined the location of the
TATA box (TATATAT,
31 to
25, corresponding to HPV-11 nucleotides 62 to 68) used for specifying the transcription start site of the E6
promoter (Fig. 1D). Initiation at P93 represents an
authentic pol II-specific transcript, as transcription from P93 is completely abolished at low concentrations of
-amanitin (Fig. 1D).




View larger version (24524632K):
[in this window]
[in a new window]
|
FIG. 1.
Recapitulation of E2-mediated transcriptional
regulation of the homologous E6 promoter in vitro. (A) HPV-11 E2, E1,
and E4 family proteins. Numbers next to carets indicate the nucleotide
positions of exon boundaries adjacent to splice donors and acceptors,
whereas numbers at the beginning and end of each box are the first and
last nucleotides of individual open reading frames. The E2, E1, and E4
open reading frames are shown as white, gray, and black boxes,
respectively. The apparent molecular mass (MW) of each protein,
estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis,
is also listed on the right. (B) Purified recombinant HPV-11 proteins.
Coomassie blue staining of FLAG-tagged HPV-11 proteins purified from
either bacteria (lanes 1 to 6) or Sf9 insect cells (lanes 8 to 12) by
immunoaffinity purification and peptide elution methods (see Materials
and Methods) is shown. The positions of HPV-11 proteins separated by
sodium dodecyl sulfate-15% polyacrylamide gel electrophoresis are
indicated on the left. Prestained protein size markers (in
kilodaltons; from GIBCO-BRL) are depicted on the right. (C)
Transcriptional regulation of the HPV-11 E6 promoter by
homologous E2 protein. In vitro transcription was performed in HeLa
nuclear extracts (N.E.) with pGL7072-161, which contains the
HPV-11 URR spanning nucleotides 7072 to 7933/1 to 161, and an
HIV-1 internal control template, pHIV+58, in the absence ( ) or
presence of increasing amounts of baculovirus-expressed HPV-11 E2
protein. Transcripts derived from the HPV-11 and HIV-1 templates are
indicated, respectively, by arrows. Relative intensity is defined as
the signal intensity quantitated by PhosphorImager (Molecular
Dynamics) from the HPV template relative to that performed in the
absence of E2. (D) Mapping of the HPV-11 E6 promoter start site. In
vitro transcription was performed with HeLa nuclear extracts with
pGL7072-161, and the RNA synthesized was subjected to primer
extension analysis as described in Materials and Methods. Different
amounts of -amanitin (in micrograms per milliliter) were also
included in the reactions to score for pol II-specific transcripts. The
DNA sequencing marker, prepared from the same primer and DNA
template as employed for in vitro transcription, was used for the
assignment of the transcription initiation site. The DNA sequence
surrounding the transcription start site (+1) at P93,
indicated by the arrow, and the TATA box of the E6 promoter are shown
on the left.
|
|
To facilitate the in vitro analysis of HPV transcription, we also
created four DNA templates (Fig. 2A)
containing HPV-11 URR and the E6 TATA box linked to G-less cassettes
with or without an initiator element (Inr) derived from the adenovirus
MLP. The inclusion of the MLP Inr in some of the G-less cassette
templates (p7072-70GLess/I+ and
p7862-70GLess/I+) may strengthen E6 core promoter activity
and further enhance the effect of E2-mediated regulation of the E6
promoter, which does not have an apparent consensus initiator sequence.
To ensure that transcription from these HPV-11 G-less templates is
indeed driven by the homologous E6 promoter, we first mapped the
transcription start sites from each of these DNA templates by in vitro
transcription-primer extension performed with HeLa nuclear extracts. As
shown in Fig. 2B, a cluster of three start sites was found in the
HPV-11 templates, irrespective of the absence or presence of the MLP
Inr sequence (middle and right panels). Although the relative
intensities of these start sites vary slightly among these HPV
templates, the correct spacing of the start sites from the E6 TATA box
(Fig. 2C) indicates that transcription from these G-less cassettes is indeed driven by the E6 promoter. Interestingly, the entire AT-rich sequence of the E6 promoter, which spans 10 nucleotides, is apparently used as TATA boxes. In contrast, only one start site is detected from
the adenovirus MLP in pML
53 (42), which contains only a
single TATA box (TATAAAA) surrounded by GC-rich sequences
(Fig. 2B, left panel). This analysis demonstrates that the HPV-11 E6 promoter is fully active and correctly specifies the transcription start sites in the G-less cassette templates. These four HPV-11 G-less
cassette templates and pML
53, used as an internal control, were then
tested for their response to HPV-11 E2 protein by in vitro
transcription performed with HeLa nuclear extracts. Under a condition
with limiting amounts of cellular factors provided by HeLa nuclear
extracts, we clearly detected E2-mediated repression from all four HPV
templates, although inhibition of the E6 promoter seems to be stronger
in the presence of the MLP Inr sequence (Fig. 2D, compare lanes 1 to 5 with lanes 6 to 10 and lanes 11 to 15 with lanes 16 to 20), whose
presence indeed strengthens the effect of E2-mediated repression
presumably due to the enhancement of basal transcription from the E6
promoter by some Inr-binding proteins present in HeLa nuclear extracts
(Fig. 2D, compare lanes 1 and 6 and lanes 11 and 16). Moreover, since
the inclusion of constitutive enhancer elements I and II (CEI and CEII
[Fig. 2A]), which are functional in vivo (13, 28), does
not enhance E6 promoter activity (Fig. 2D, compare lanes 1 and 11 and
lanes 6 and 16), this result also suggests that the HPV-11 enhancer
elements are not active in vitro when transcriptional assays are
performed on naked DNA templates with HeLa nuclear extracts.
Nevertheless, the experiment shows that E2-mediated repression
of the HPV E6 promoter can indeed be observed with G-less cassette
templates, which can be used for mechanistic studies of HPV
transcription (see below).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Use of G-less cassette templates for
transcriptional analysis of HPV-11 E6 promoter activity. (A) HPV-11
G-less cassettes. Plasmids p7072-70GLess/I+ and
p7072-70GLess/I contain the HPV-11 URR spanning
nucleotides 7072 to 7933/1 to 70 linked to either a G-less cassette of
388 nucleotides preceded by the adenovirus MLP Inr element
(I+) or another G-less cassette of 377 nucleotides without
the MLP Inr (I ). Plasmids
p7862-70GLess/I+ and p7862-70GLess/I
containing a truncated HPV-11 URR from nucleotide 7862 to nucleotide 70 without CEI and CEII were similarly linked to G-less cassettes with or
without the MLP Inr. The compilation of cis-acting elements
and trans-acting factors in the HPV-11 URR is mainly based
on published information (28, 44, 72). The boundaries of CEI
(28) and CEII (13) and the origin of replication
(7) are indicated by brackets. (B) Start site mapping of
HPV-11 and MLP G-less cassette templates. In vitro transcription
reactions were performed with HeLa nuclear extracts with either an
adenovirus MLP-driven G-less cassette template (pML 53
[42]), HPV-11 p7072-70GLess/I+ and
p7862-70GLess/I+ templates (both give the same start sites
and are thus indicated as HPV/I+), or
p7072-70GLess/I and p7862-70GLess/I
templates (both give the same start sites and are thus indicated as
HPV/I ). The transcription start sites (arrows), MLP Inr
(underlined), and TATA boxes (brackets) are shown on the left of each
panel with intensities of relative start sites denoted by dots. (C)
Comparison of nucleotide sequences surrounding the core promoter
elements of the MLP and HPV templates. HPV-11 nucleotides are in
boldface while vector or MLP sequences are in regular type. Brackets
indicate the boundaries of the TATA boxes with lines above the sequence
demarking the MLP initiator element. The promoter-proximal
E2-binding sites (E2-BS 3 and E2-BS 4) are underlined, and the
nucleotides (open arrows) corresponding to HPV-11 number designations
are indicated in parentheses. (D) E2-mediated repression of the
homologous E6 promoter. In vitro transcription was performed with HeLa
nuclear extracts with 50 ng of each HPV and pML 53 templates, in the
absence ( ) or presence of increasing amounts of baculovirus-expressed
E2 protein.
|
|
General cofactors, such as TAFIIs and PC4, and
phosphorylation on E2 are not required for E2-mediated repression of
the E6 promoter.
Although in vitro transcription performed with
nuclear extracts provides a valuable analysis to determine the domains
and concentrations of E2 involved in papillomaviral transcription (22, 56, 57, 63), the molecular mechanisms by which E2 works
in conjunction with cellular proteins and the role of cellular factors
involved in E2-mediated repression of the E6 promoter cannot be easily
addressed in transcription assays with crude nuclear extracts. To
overcome this problem, we resorted to the use of a cell-free
transcription system reconstituted with a TATA-binding factor (TBP or
TFIID) and a preassembled TFIID-deficient pol II holoenzyme complex
(67, 69). This system allows us to address the requirement
of general transcription cofactors, such as the TAFII
components of TFIID and USA-derived cofactor PC4, that are known to
possess both stimulatory and inhibitory activities for E2-mediated
repression. As shown in Fig. 3A,
repression of the E6 promoter could indeed be observed in this
two-component transcription system in a dose-dependent and E2-binding
site-specific manner (Fig. 3A, lanes 1 to 6). Repression of the E6
promoter persisted when TBP was used in place of TFIID, indicating that
TAFIIs are not required for E2-mediated repression (Fig.
3A, lanes 7 to 12). In agreement with our previous report
(67), the level of basal transcription conducted with TBP
is, in general, higher than that of transcription performed with TFIID
(Fig. 3A, compare lanes 1 and 7), implicating a suppressing role of
TAFIIs in basal transcription (4). To examine
whether PC4 is also dispensable for E2-mediated repression and to
investigate whether phosphorylation on E2 is critical for E2 function,
we conducted a similar experiment by leaving PC4 out of the reaction
and using E2 proteins purified from either bacteria (Escherichia
coli) or insect cells (Sf9) for comparison. As shown in Fig. 3B,
PC4 and phosphorylation on E2 are not needed for E2-mediated repression
(compare Fig. 3A and B, lanes 1 to 12, and Fig. 3B, lanes 7 to 12 with
lanes 13 to 18), as bacterially expressed E2 protein is able to inhibit E6 promoter activity in the absence of PC4. This result is consistent with a previous report indicating that mutations on the phosphorylation sites of bovine papillomavirus type 1 (BPV-1) E2 do not affect the
transcriptional activity of E2 (39). However, it is
important to note that the ability of bacterially expressed E2 protein
to inhibit E6 promoter activity does not rule out the possibility that
phosphorylation may further contribute to the regulatory property of
E2. This issue remains to be further investigated.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
E2-mediated repression of the HPV-11 E6 promoter in a
reconstituted two-component transcription system. (A)
TAFIIs are not required for E2-mediated repression. In
vitro transcription was performed with TFIID-deficient pol II
holoenzyme (f:pol II [67]) and either FLAG-tagged
TFIID (f:TFIID [9]) or FLAG-tagged TBP (f:TBP), in
conjunction with general cofactor PC4 (25, 35), in the
absence ( ) or presence of different amounts of E2. Unless otherwise
specified, baculovirus-expressed FLAG-tagged HPV-11 E2 was used in the
assay. (B) PC4 and phosphorylation on E2 are not required for
E2-mediated repression. In vitro transcription was performed as
described for panel A, except that E2 purified from either insect cells
(Sf9) or bacteria (E. coli) was used and no PC4 was included
in the experiment. (C) The initiator element and CEI and CEII are not
required for E2-mediated repression. In vitro transcription was
performed as described for panel A, except that different HPV-11 DNA
templates were used. (D) E2 mainly acts through the no. 4 E2-binding
site to inhibit E6 promoter activity. DNA templates containing either
wild-type (WT) or mutated E2-binding sites were constructed in the
backbone of p7862-70GLess/I as described in Materials and
Methods. 4M, 3M, 2M, 23M, 24M, 34M, and 234M are DNA templates
containing mutations on the no. 4, no. 3, no. 2, no. 2 and 3, no. 2 and
4, no. 3 and 4, and no. 2 and 3 and 4 E2-binding sites, respectively.
In vitro transcription was performed as described for panel A, except
that different HPV-11 DNA templates were used.
|
|
Since E2 appears to repress E6 promoter activity by excluding TBP or
TFIID from binding to the TATA box (17, 21, 22, 59), we
speculated that the initiator and enhancer elements might not be
involved in E2-mediated repression. Indeed, suppression of the E6
promoter could be observed on all HPV-11 URR-containing templates with
or without the MLP initiator element (Fig. 3C, compare lanes 1 to 6 and
lanes 7 to 12) and in the presence or absence of CEI and CEII (Fig. 3C,
compare lanes 1 to 6 and lanes 13 to 18). The observation that the
levels of basal transcription are the same between those two DNA
templates with or without the initiator element (Fig. 3C, compare lanes
1 and 7) suggests that initiator-binding proteins which are present in
nuclear extracts accounting for the enhanced basal transcription from
the Inr-containing templates (Fig. 2D) are absent in our reconstituted
two-component transcription system. This analysis indicates that
cellular proteins that bind to the initiator element and CEI and CEII
are not absolutely required for E2-mediated repression.
E2-mediated repression of the E6 promoter mainly functions through
the promoter-proximal no. 4 E2-binding site.
To directly
demonstrate that E2-mediated repression indeed acts through its cognate
binding sites and to further evaluate the relative contributions of
individual E2-binding sites in E2-mediated repression, we performed an
in vitro transcription assay with G-less cassette templates
containing individually mutated E2-binding sites introduced
in the backbone of p7862-70GLess/I
. The same set of
mutations linked to a CAT reporter gene was used previously for the
studies of individual E2-binding sites in E2-mediated repression in
transfected cells (21). As shown in Fig. 3D, mutations at
all three E2-binding sites (2, 3, and 4) completely relieve E2-mediated
repression, suggesting that E2 indeed acts through its cognate binding
sites in a sequence-specific manner (compare lanes 1 and 2 and lanes 15 and 16). Interestingly, the no. 4 E2-binding site plays a predominant
role in E2-mediated repression, as single-site mutations in no. 4, but
not no. 2 and 3 sites, alleviate most of the repressing activity (Fig.
3D, lanes 1 to 8). The transcriptional result with pairwise mutations
further suggests that the no. 2 E2-binding site has little or no effect on E2-mediated repression, whereas the no. 3 E2-binding site
contributes to E2-mediated repression in our two-component
transcription system (Fig. 3D, lanes 9 to 14). The difference in the
contributions of no. 2 and 3 E2-binding sites between our in vitro
assay and previous in vivo transfection studies (21) is
likely due to the absence of cellular proteins binding to the sequence
motifs adjacent to no. 2 and 3 E2-binding sites in our two-component transcription system (67). A hierarchy of E2-binding sites
in contributing to E2-mediated repression apparently occurs in the order of no. 4 > no. 3 > no. 2, which likely reflects their
relative distance from the TATA box, as indicated by the facts that 3 and 4 have an identical consensus sequence and affinity for E2
recognition (1) and that the DNase I footprint exhibited by
TBP clearly extends to the no. 4 but not the no. 3 E2-binding site (see
below). It is also likely that binding of an E2 dimer to the no. 3 E2-binding site enhances the stability of the E2 dimer binding to the
no. 4 E2-binding site. This may explain a contributory role of the no.
3 E2-binding site in E2-mediated repression. The same results obtained
here with TBP were also obtained with TFIID as the TATA-binding factor
and with the same set of E2-binding site mutations introduced in the
initiator-containing p7862-70GLess/I+ template (data not shown).
The N-terminal domain of E2 is not directly involved in E2-mediated
repression.
To define the protein domain responsible for
E2-mediated repression, we tested the efficiency of transcriptional
repression by three forms of HPV-11 E2 proteins that have the same
DNA-binding and dimerization domain but differ in their N-terminal
amino acid residues (Fig. 1A). Clearly, all three forms of E2 proteins,
normalized by Western blotting with anti-FLAG antibodies (data not
shown), have comparable activity in suppressing the E6 promoter (Fig. 4A). In contrast, equivalent amounts of
other HPV-11 proteins such as E1, E1Ma
E4, and E4
proteins, also normalized by Western blotting (data not shown), do not
show any effect on E6 promoter activity (Fig. 4B). This result
indicates that the N-terminal domain of E2 is not required for
E2-mediated repression and that the C-terminal domain of E2 is
sufficient for E2-mediated repression.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of HPV-11 proteins in regulating the homologous
E6 promoter. (A) The N-terminal domain of E2 is not required for
E2-mediated repression. In vitro transcription was performed with
p7072-70GLess/I template, as described in the legend to
Fig. 3A, in the absence ( ) or presence of increasing amounts (0.02, 0.10, 0.45, 1.0, and 4.5 pmol) of E2, E1M E2C, or ds-E2C.
(B) E1 family and E4 proteins individually have no effect on HPV-11 E6
promoter activity. In vitro transcription was performed as described
for panel A, in the absence ( ) or presence of increasing amounts
(0.02, 0.10, 0.45, 1.0, and 4.5 pmol) of E1, E1Ma E4, or
E4 proteins.
|
|
Preincubation of HPV templates with TBP or TFIID cannot alleviate
E2-mediated repression of the E6 promoter.
To define the mechanism
of E2-mediated repression, we would like to first confirm by DNase I
footprinting whether binding of HPV-11 E2 and human TBP to the
homologous E6 promoter is indeed mutually exclusive, similar to a
previous result showing that binding of TBP could be displaced by an
increasing amount of BPV-1 E2 in an electrophoretic mobility shift
assay with an oligonucleotide containing the TATA box and an E2-binding
site derived from the HPV-18 E6 promoter (22). As shown in
Fig. 5, the DNase I footprints generated
by E2 and TBP, individually, indeed overlap (compare lanes 4 and 5 with
lanes 10 and 11). But interestingly, E2 apparently has higher affinity
toward its two binding sites than that of TBP for the TATA box in the
E6 promoter, as demonstrated by an efficient displacement of TBP by
increasing amounts of E2 (Fig. 5, lanes 4 to 8) yet an inefficient
exclusion of E2 by molar excess of TBP (Fig. 5, lanes 10 to 14). Given
the observation that an efficient repression of E6 promoter activity
occurs only at high concentrations (at least 20 to 50 ng) of E2,
relative to 1 ng of TBP used in the transcription assays (Fig. 3), the
footprinting data also indicate that steric hindrance of TBP binding by
E2 is unlikely to be the sole mechanism for E2-mediated repression. This viewpoint has indeed been further supported by order-of-addition experiments (see below).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 5.
Binding of TBP and HPV-11 E2 to the HPV-11 E6 promoter
is mutually exclusive. DNase I footprinting of the HPV-11 E6 promoter
was performed with different amounts (in nanograms) of
baculovirus-expressed FLAG-tagged E2 and bacterially expressed
FLAG-tagged TBP as described in Materials and Methods. The
Maxam-Gilbert sequencing method (52) was used to prepare the
C and A/G footprinting markers (lanes 1 and 2). No protein (lanes 3 and
9) or increasing amounts of TBP or E2 or of a combination of these two
proteins were included in the footprinting reactions. Sequence motifs
in the E6 promoter-proximal region recognized by TBP (TATA), E2 (E2BS 3 and E2BS 4), and Sp1 (Sp1) are marked on the left, whereas the actual
DNase I footprints observed by TBP (thick line) and E2 (thin line) are
indicated on the right. The asterisk denotes a hypersensitive site
induced by E2 binding.
|
|
If exclusion of TBP or TFIID binding to the adjacent TATA box by E2 is
indeed the mechanism of E2-mediated repression, we speculated that
preincubation of DNA template with TBP or TFIID would relieve
E2-mediated repression. To address this important issue, we performed
an order-of-addition experiment as outlined in Fig.
6A. In this experiment, transcriptional
templates, p7072-70GLess/I
and pML
53, were
preincubated with TBP and TFIID-deficient pol II-holoenzyme (f:pol
II), individually or together, at 30°C for 30 min. The remaining
transcription components and NTPs were then added to initiate
transcription. E2 was included at different steps of the reaction to
evaluate its repressive activity prior to or after PIC assembly. As
expected, PIC formation prior to the addition of E2 almost completely
overcomes E2-mediated repression (Fig. 6B, lanes 3 to 6). A residual
twofold repression observed by E2 added after PIC formation (Fig. 6B,
compare lane 3 with lanes 5 and 6) was likely due to inhibition of
reinitiation of transcription, since approximately two rounds of
transcription were typically observed in this two-component
transcription system (67) (see also below). Surprisingly,
preincubation of TBP alone with transcriptional templates was not
sufficient to alleviate E2-mediated repression (Fig. 6B, compare lane 7 with lanes 8 and 9), indicating that TBP binding to the TATA box could
not prevent E2 from binding to its cognate sequence, consistent with
the result of DNase I footprinting (Fig. 5). Preincubation of f:pol II
with DNA templates could not relieve E2-mediated repression (Fig. 6B, lanes 11 to 14), consistent with our previous finding that pol II
holoenzyme alone could not stably bind to the DNA template in the
absence of a TATA-binding factor (67, 69). The decreased levels of overall basal transcription when pol II holoenzyme was preincubated with DNA templates (Fig. 6B, compare lanes 3 to 6 with
lanes 11 to 14) are likely due to its nonspecific DNA-binding activity
that appears to titrate out pol II holoenzyme available for
promoter-specific transcription. Interestingly, when E2 was added 5 min
after including the remaining transcription component and NTPs, most of
the E2-mediated repression was alleviated (Fig. 6B, compare lanes 9 and
10 and lanes 13 and 14). This observation suggests that PIC formation
can readily occur within 5 min. The same result was also obtained when
TFIID was used in place of TBP as the TATA-binding factor (data not
shown).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 6.
Preincubation of TBP with transcriptional templates
cannot overcome E2-mediated repression. (A) Outline of the
order-of-addition experiment. Transcriptional templates
(p7072-70GLess/I and pML 53) were incubated with TBP
and TFIID-deficient pol II holoenzyme (f:pol II), individually or
together, at 30°C for 30 min. The remaining transcription components
and ribonucleoside triphosphates (NTPs) were then added, in the absence
( ) or presence (+) of 0.015% Sarkosyl, to initiate transcription.
E2, if included (50 ng), was added at different time points
(T0, T30, or T35) during the
incubation. Reactions were then processed as described in Materials and
Methods. (B) Preincubation of TBP alone with the transcriptional
templates is unable to overcome E2-mediated repression. The
order-of-addition experiment was conducted as described for panel A. Two regular reactions performed in the absence ( ) or presence (+) of
E2 were also conducted (lanes 1 and 2) for comparison. (C) E2 inhibits
multiple rounds of transcription. The order-of-addition experiment was
carried out as described for panel B, with (+) or without ( ) 0.015%
Sarkosyl added at T30.
|
|
If E2 indeed inhibits the assembly of PIC, it should be capable of
suppressing reinitiation of transcription, which requires the
reassembly of transcriptional components. As predicted, when 0.015%
Sarkosyl was added 30 min after PIC assembly to prevent reinitiation of
transcription (67), E2 no longer inhibited the E6 promoter
after PIC formation (Fig. 6C, lanes 5 to 8). Again, preincubation of
TBP alone could not overcome E2-mediated repression (Fig. 6C, lanes 9 to 16). In this experiment, approximately 2.5 rounds of transcription
were observed (Fig. 6C, compare lanes 1 and 5).
E2-mediated repression requires only components of the general
transcription machinery.
The findings that corepressors are often
implicated in repressor function and that pol II holoenzyme apparently
contains many undefined components that may be functionally involved in
E2-mediated repression prompted us to use a more refined in vitro
transcription system to further define the role of cellular factors in
E2-mediated repression. To this end, we performed an in vitro
transcription assay with only recombinant GTFs (TBP, TFIIB, TFIIE, and
TFIIF) and highly purified epitope-tagged multiprotein TFIIH and pol II
complexes (34, 68), considering the fact that
enhancer-binding factors and general cofactors such as
TAFIIs and PC4 are not required for E2-mediated repression
in our two-component transcription system (Fig. 3). Remarkably, we are
able to detect for the first time that E2-mediated repression on the
natural HPV-11 promoter can be observed in a completely defined
cell-free transcription system containing only TBP, TFIIB, TFIIE,
TFIIF, TFIIH, and pol II in a dose-dependent manner, irrespective of
the presence or absence of an initiator element (Fig.
7A) and similar to the levels of
repression detected in the two-component transcription system (Fig. 3)
and in HeLa nuclear extracts (Fig. 2D). This finding suggests that
E2-mediated repression does not require corepressors, nor general
cofactors TFIIA and Mediator, which are not present in our highly
purified in vitro transcription system (68), and that E2 can
indeed act as an active repressor to directly inhibit the activity or
the assembly of the general transcription machinery.



View larger version (342138K):
[in this window]
[in a new window]
|
FIG. 7.
Requirement of GTFs for HPV-11 E2-mediated repression of
the homologous E6 promoter. (A) E2-mediated repression in a highly
purified in vitro transcription system. In vitro transcription was
conducted with recombinant TFIIB, TBP, TFIIE, TFIIF, and FLAG-tagged
TFIIH and FLAG-tagged pol II as described in Materials and Methods, in
the absence ( ) or presence of increasing amounts of E2. Relative
intensity in each set of reactions is defined as the ratio of the HPV
signal, which is quantitated first by PhosphorImager and then
normalized with the internal control, obtained in each reaction to that
performed in the absence of E2 (i.e., the first lane of each reaction
set). (B) TFIIE and TFIIH are not required for transcription from
supercoiled HPV DNA templates. Transcription reactions were performed
as described for panel A. The transcription components indicated above
the lanes were then left out from the complete reaction (All). The
subunits of TFIIF, RAP30 (F30) and RAP74 (F74),
were also selectively left out from the complete reaction. (C)
E2-mediated repression of the E6 promoter can be observed in a
minimal transcription system containing only TBP, TFIIB, TFIIF, and pol
II. In vitro transcription reactions were performed with TBP, TFIIB,
TFIIF, and pol II, with or without ( ) 50 ng of E2 and in the
absence (M) or presence (C) of both TFIIE and TFIIH.
|
|
To define which components of the general transcription machinery are
essential for transcription from the HPV-11 E6 promoter, we conducted a
leave-out experiment by omitting individual transcription components
from a complete reaction that contained TBP, TFIIB, TFIIE, TFIIF,
TFIIH, and pol II. As shown in Fig. 7B, TFIIE and TFIIH are not
absolutely required for HPV transcription (compare lane 1 with lanes 6 and 7 and lane 10 with lanes 15 and 16), consistent with the
observation that TFIIE and TFIIH are dispensable for transcription from
supercoiled DNA templates in our highly purified in vitro
transcription system (34, 68). In contrast, TBP, TFIIB, pol
II, and both subunits of TFIIF (RAP30 and RAP74) are essential
for HPV transcription (Fig. 7B). To see whether a minimal transcription
system containing only TBP, TFIIB, pol II, and TFIIF is indeed
sufficient to support HPV transcription and whether E2-mediated
repression of the E6 promoter can still occur with only four components
of the general transcription machinery, we directly compared the
transcription activity of the HPV template in a minimal system with
that in a complete system that additionally contained TFIIE and TFIIH.
As shown in Fig. 7C, although the overall level of basal transcription
was lower in the minimal system than in the complete system (compare
lanes 1 and 3 and lanes 5 and 7), E2-mediated repression in the minimal
system still persisted to an extent similar to that observed in the
complete system (compare lanes 2 and 4 and lanes 6 and 8). This result
suggests that E2-mediated repression requires only four
components of the cellular proteins, TBP, TFIIB, pol II, and TFIIF.
Formation of a minimal PIC composed of TBP (or TFIID), TFIIB, pol
II, and TFIIF is necessary to overcome E2-mediated repression.
To
define the steps of PIC assembly targeted by E2, we conducted a
two-step order-of-addition experiment as outlined at the bottom of Fig.
8A. In this experiment, DNA templates
were preincubated respectively with TBP, TBP plus TFIIB, TBP plus
TFIIB and pol II, and TBP plus TFIIB/pol II and TFIIF,
following the order of PIC assembly, in separate tubes.
After a 30-min incubation, the remaining GTFs and NTPs were added, with
or without E2, to initiate transcription. Reactions were then continued
for an hour before they were analyzed for RNA synthesis. As shown in
Fig. 8A, preincubation of TBP with TFIIB or TBP with TFIIB and pol II,
which further stabilized TBP binding to the TATA box, was not
sufficient to overcome E2-mediated repression (lanes 3 to 8 and 13 to
18). Only when a minimal transcription complex was formed on the E6
promoter was E2-mediated repression alleviated (Fig. 8A, compare lanes 9 and 10 and lanes 19 and 20). The same result was also obtained with
TFIID as the TATA-binding factor (Fig. 8B). This study further demonstrates that E2-mediated repression does not simply work by
displacing TBP (or TFIID) binding to the TATA box. Other mechanisms affecting the stability of the assembled PIC are also involved in
E2-mediated repression of the E6 promoter.


View larger version (2126K):
[in this window]
[in a new window]
|
FIG. 8.
E2-mediated repression of the HPV-11 E6 promoter can be
alleviated by forming a promoter-bound TBP (or TFIID)-TFIIB-pol
II-TFIIF complex. (A) TBP as the TATA-binding factor for PIC assembly.
In vitro transcription was performed as outlined at the bottom by
preincubating transcriptional templates with TBP (T), TBP-TFIIB (T/B),
TBP-TFIIB-pol II (T/B/II), or TBP-TFIIB-pol II-TFIIF (T/B/II/F), in
different reaction tubes at 30°C for 30 min. The remaining components
and NTPs were then added, in the absence ( ) or presence (+) of HPV-11
E2, to initiate transcription. The reactions were processed as
described in Materials and Methods. Regular E2-mediated reactions with
all four protein components but without a two-step incubation were also
conducted for comparison (lanes 1 and 2 and lanes 11 and 12). (B) TFIID
as the TATA-binding factor for PIC assembly. In vitro transcription was
performed as outlined in panel A, except that TFIID (D) was used as the
TATA-binding factor.
|
|
 |
DISCUSSION |
Using reconstituted cell-free transcription systems, we are able
to identify cellular proteins directly involved in E2-mediated repression of the HPV E6 promoter that regulates the expression of many
viral gene products involved in DNA replication, transcription, and
transformation. Surprisingly, E2-mediated repression does not require
either gene-specific or general transcription cofactors, such as
TAFIIs, TFIIA, Mediator, and USA-derived cofactors,
normally implicated in activator-dependent transcription. This
inhibitory activity of E2 is also independent of transcriptional
corepressors, sometimes required for repressor function, and does not
simply work by displacing adjacent Sp1 and TBP from binding to their cognate sequences. Instead, E2 appears to inhibit multiple steps of PIC
assembly until the formation of a minimal TBP (or TFIID)-TFIIB-pol II-TFIIF complex.
Multiple tiers of transcriptional regulation.
Our finding that
a common C-terminal domain present in E2, E1M
E2C, and
ds-E2C is sufficient for E2-mediated repression suggests that the
N-terminal domain of E2, which is important for transactivation, is not
essential for E2-mediated repression. This conclusion is distinct from
a previous result indicating that the N-terminal domain of BPV-1 E2
also plays a role in E2-mediated repression of the HPV-18 E6 promoter
experimentally conducted with virus-infected or transiently transfected
HeLa cells (26). It is likely that the endogenous HPV-18 E6
promoter in HeLa cells and the introduced HPV-18 promoter during
transient transfection assays are packaged into chromatin. Therefore,
E2 may need to work in conjunction with chromatin remodeling factors
that either help mobilize the promoter-proximal nucleosomes, thereby
allowing E2 to bind to its cognate binding sites, or in turn recruit
histone deacetylase complexes to further enhance nucleosome-mediated
repression of the HPV promoter. This possibility is supported by the
recent findings that only the N-terminal, not the C-terminal, domain of
HPV-11 E2 can efficiently interact with SWI/SNF chromatin remodeling factor (S.-Y. Wu, S. Y. Hou, and C.-M. Chiang, unpublished data) and that some chromatin remodeling factors can associate with histone
deacetylase complexes (62, 64, 70, 71). These observations
may explain why mutations at the N-terminal domain of BPV-1 E2 affect
E2-mediated repression of the HPV-18 promoter in HeLa cells. It thus
seems to be a common theme for both transcriptional activators and
repressors to work in conjunction with chromatin remodeling factors to
regulate promoter activity in a chromatin context. Once the promoter
region is exposed, many cellular proteins, including both positive and
negative regulatory factors and cofactors, then constitute another
level of gene regulation. Frequently, gene activity reflects a
counterbalance between positive and negative regulatory factors in a
complicated cellular environment or in a crude cell extract that has
multiple protein activities. Therefore, it is of vital importance to
define the role of individual transcription factors at each tier of
gene regulation. The development of highly purified and well-defined in
vitro transcription systems allows us to pinpoint the role of
transcriptional regulators directly involved in the transcriptional
process. We found that only four components of the general
transcription machinery, TBP, TFIIB, pol II, and TFIIF, are absolutely
required for E2-mediated repression on the homologous E6 promoter.
Active repression mediated by E2.
An active role of
E2-mediated repression does not work simply by displacing TBP and Sp1
from binding to their cognate sequences adjacent to the
promoter-proximal E2-binding sites. Despite the fact that an equivalent
amount of HPV-11 E2 efficiently prevents TBP from binding to the TATA
box (Fig. 5), inhibition of the homologous E6 promoter can be achieved
only at high concentrations (20 to 50 ng) of E2, relative to 1 ng of
TBP used in the transcription assays (Fig. 3), indicating that steric
exclusion of TBP binding by E2 is not the sole mechanism for
E2-mediated repression. This argument is further supported by the
finding that preincubation of TBP (or TFIID) alone with transcriptional
templates is not sufficient to overcome E2-mediated repression (Fig.
6B). The inability of TBP-bound templates to relieve E2-mediated
repression is not due to the instability of TBP binding to the
transcriptional templates, since inclusion of TFIIB, which has been
shown to stabilize TBP binding to the TATA box (47, 49),
during the preincubation period is still unable to alleviate
E2-mediated repression (Fig. 8A). It is likely that E2 may target a
protein surface that is masked only when a minimal TBP-TFIIB-pol
II-TFIIF complex has been formed. Alternatively, E2 binding may cause
conformational change on the DNA template, which can be reversed only
by forming a TBP-TFIIB-pol II-TFIIF complex, not by intermediate PICs.
These interesting possibilities are currently under investigation.
Role of cellular proteins in E2-mediated repression.
In
transcriptional assays performed with HeLa nuclear extracts, efficient
repression of the HPV E6 promoter could be observed only when limiting
amounts of cellular factors, provided by nuclear extracts, were used in
the assay (Fig. 2D). Inhibition of the E6 promoter by E2 was not
detected when an excess amount of nuclear extracts was used (data not
shown), suggesting that some cellular proteins present in HeLa nuclear
extracts may functionally antagonize E2-mediated repression. This
notion is further supported by the observation that only E2-mediated
repression, not transactivation, was observed in our reconstituted
cell-free transcription systems with TBP as the TATA-binding factor,
presumably due to the lack of cellular cofactors critical for
E2-mediated activation or required to counteract E2-mediated
repression. Although cellular enhancer-binding factors and
initiator-binding proteins are not directly involved in E2-mediated
repression, they may potentiate PIC assembly, when reaching a critical
concentration in vitro or in vivo, to counteract E2-mediated
repression. The observations that deletion of the HPV-11 CEII allows
homologous E2 to function as a repressor in cervical carcinoma cell
line C-33A (13) and that overexpression of HPV-11 E2 can
antagonize the nullifying effect of CEII on E2-mediated repression in
transient transfection assays (21) further indicate a
complicated regulatory circuit between viral E2 and cellular enhancer-binding proteins. The current challenge is to recapitulate the
enhancer effect in our highly purified in vitro transcription system by
introducing either nucleosome-assembled HPV chromatin templates or
enhanceosome-like transcription complexes to dissect the regulatory
circuits exerted by various viral and cellular proteins.
 |
ACKNOWLEDGMENTS |
We are grateful to G. Dong, T. R. Broker, and L. T. Chow for DNA templates containing various E2-binding site mutations;
M. W. Van Dyke for pIGL and pGL plasmids; E. Kershnar for
FLAG-tagged TFIIH; and J. Kim for advice on DNase I footprinting.
C.-M.C. is a Pew Scholar in the Biomedical Sciences. This research is
supported in part by the American Cancer Society Research Project Grant
RPG-97-135-01-MBC and in part by National Institutes of Health grant CA81017.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, 430 Roger Adams Laboratory, University of Illinois, 600 South Mathews Ave., Urbana, IL 61801. Phone: (217) 244-3085. Fax: (217)
244-5858. E-mail: c-chiang{at}uiuc.edu.
 |
REFERENCES |
| 1.
|
Alexander, K. A., and W. C. Phelps.
1996.
A fluorescence anisotropy study of DNA binding by HPV-11 E2C protein: a hierarchy of E2-binding sites.
Biochemistry
35:9864-9872[CrossRef][Medline].
|
| 2.
|
Auble, D. T.,
K. E. Hansen,
C. G. F. Mueller,
W. S. Lane,
J. Thorner, and S. Hahn.
1994.
Mot1, a global repressor of RNA polymerase II transcription, inhibits TBP binding to DNA by an ATP-dependent mechanism.
Genes Dev.
8:1920-1934[Abstract/Free Full Text].
|
| 3.
|
Barsoum, J.,
S. S. Prakash,
P. Han, and E. J. Androphy.
1992.
Mechanism of action of the papillomavirus E2 repressors: repression in the absence of DNA binding.
J. Virol.
66:3941-3945[Abstract/Free Full Text].
|
| 4.
|
Burley, S. K., and R. G. Roeder.
1998.
TATA box mimicry by TFIID: autoinhibition of pol II transcription.
Cell
94:551-553[CrossRef][Medline].
|
| 5.
|
Chiang, C.-M.,
T. R. Broker, and L. T. Chow.
1991.
An E1M E2C fusion protein encoded by human papillomavirus type 11 is a sequence-specific transcription repressor.
J. Virol.
65:3317-3329[Abstract/Free Full Text].
|
| 6.
|
Chiang, C.-M.,
T. R. Broker, and L. T. Chow.
1992.
Properties of bovine papillomavirus E1 mutants.
Virology
191:964-967[CrossRef][Medline].
|
| 7.
|
Chiang, C.-M.,
G. Dong,
T. R. Broker, and L. T. Chow.
1992.
Control of human papillomavirus type 11 origin of replication by the E2 family of transcription regulatory proteins.
J. Virol.
66:5224-5231[Abstract/Free Full Text].
|
| 8.
|
Chiang, C.-M.,
M. Ustav,
A. Stenlund,
T. F. Ho,
T. R. Broker, and L. T. Chow.
1992.
Viral E1 and E2 proteins support replication of homologous and heterologous papillomaviral origins.
Proc. Natl. Acad. Sci. USA
89:5799-5803[Abstract/Free Full Text].
|
| 9.
|
Chiang, C.-M.,
H. Ge,
Z. Wang,
A. Hoffmann, and R. G. Roeder.
1993.
Unique TATA-binding protein-containing complexes and cofactors involved in transcription by RNA polymerases II and III.
EMBO J.
12:2749-2762[Medline].
|
| 10.
|
Chiang, C.-M., and R. G. Roeder.
1993.
Expression and purification of general transcription factors by FLAG epitope-tagging and peptide elution.
Peptide Res.
6:62-64.
|
| 11.
|
Chiang, C.-M., and R. G. Roeder.
1995.
Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators.
Science
267:531-536[Abstract/Free Full Text].
|
| 12.
|
Chin, M. T.,
R. Hirochika,
H. Hirochika,
T. R. Broker, and L. T. Chow.
1988.
Regulation of human papillomavirus type 11 enhancer and E6 promoter by activating and repressing proteins from the E2 open reading frame: functional and biochemical studies.
J. Virol.
62:2994-3002[Abstract/Free Full Text].
|
| 13.
|
Chin, M. T.,
T. R. Broker, and L. T. Chow.
1989.
Identification of a novel constitutive enhancer element and an associated binding protein: implications for human papillomavirus type 11 enhancer regulation.
J. Virol.
63:2967-2976[Abstract/Free Full Text].
|
| 14.
|
Chong, T.,
D. Apt,
B. Gloss,
M. Isa, and H.-U. Bernard.
1991.
The enhancer of human papillomavirus type 16: binding sites for the ubiquitous transcription factors oct-1, NFA, TEF-2, NF1, and AP-1 participate in epithelial cell-specific transcription.
J. Virol.
65:5933-5943[Abstract/Free Full Text].
|
| 15.
|
Cooney, A. J.,
X. Leng,
S. Y. Tsai,
B. W. O'Malley, and M.-J. Tsai.
1993.
Multiple mechanisms of chicken ovalbumin upstream promoter transcription factor-dependent repression of transactivation by the vitamin D, thyroid hormone, and retinoic acid receptors.
J. Biol. Chem.
268:4152-4160[Abstract/Free Full Text].
|
| 16.
|
Cripe, T. P.,
A. Alderborn,
R. D. Anderson,
S. Parkkinen,
P. Bergman,
T. H. Haugen,
U. Pettersson, and L. P. Turek.
1990.
Transcriptional activation of the human papillomavirus 16 P97 promoter by an 88-nucleotide enhancer containing distinct cell-dependent and AP-1 responsive modules.
New Biol.
2:450-463[Medline].
|
| 17.
|
Demeret, C.,
M. Yaniv, and F. Thierry.
1994.
The E2 transcriptional repressor can compensate for Sp1 activation of the human papillomavirus type 18 early promoter.
J. Virol.
68:7075-7082[Abstract/Free Full Text].
|
| 18.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 19.
|
DiLorenzo, T. P., and B. M. Steinberg. |