Previous Article | Next Article 
Molecular and Cellular Biology, January 2000, p. 242-248, Vol. 20, No. 1
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Dbf4p, an Essential S Phase-Promoting Factor, Is
Targeted for Degradation by the Anaphase-Promoting Complex
Miguel
Godinho Ferreira,
Corrado
Santocanale,
Lucy S.
Drury, and
John F. X.
Diffley*
ICRF Clare Hall Laboratories, South Mimms EN6
3LD, United Kingdom
Received 8 February 1999/Returned for modification 8 July
1999/Accepted 1 October 1999
 |
ABSTRACT |
The Dbf4p/Cdc7p protein kinase is essential for the activation of
replication origins during S phase. The catalytic subunit, Cdc7p, is
present at constant levels throughout the cell cycle. In contrast, we
show here that the levels of the regulatory subunit, Dbf4p, oscillate
during the cell cycle. Dbf4p is absent from cells during G1
and accumulates during the S and G2 phases. Dbf4p is rapidly degraded at the time of chromosome segregation and remains highly unstable during pre-Start G1 phase. The rapid
degradation of Dbf4p during G1 requires a functional
anaphase-promoting complex (APC). Mutation of a sequence in the N
terminus of Dbf4p which resembles the cyclin destruction box eliminates
this APC-dependent degradation of Dbf4p. We suggest that the coupling
of Dbf4p degradation to chromosome separation may play a redundant role
in ensuring that prereplicative complexes, which assemble after
chromosome segregation, do not immediately refire.
 |
INTRODUCTION |
In budding yeast, entry into S phase
is brought about by the action of two protein kinases, whose catalytic
subunits are encoded by the CDC28 and CDC7 genes.
Both of these kinases require association with regulatory subunits to
become fully activated. For Cdc28p, the regulatory subunits are a
family of related proteins known as the cyclins (1). As
their name suggests, cyclins are often present during only part of the
cell cycle (18). The B-type cyclins (Clbs) are rapidly
degraded in mitosis and remain highly unstable during pre-Start
G1. This cell cycle-regulated, ubiquitin-mediated degradation is brought about by the action of the multisubunit anaphase-promoting complex (APC), also known as the cyclosome (36).
It is thought that a single protein, Dbf4p, activates the Cdc7 protein
kinase (37, 50). Cdc7p and Dbf4p physically associate with
each other and show a number of genetic interactions (4, 16, 20,
27, 31). Cdc7p was shown to be inactive in extracts from either
dbf4 or cdc7 mutants; however, active kinase
could be reconstituted by mixing these extracts (27). These
experiments strongly support the idea that Dbf4p interacts with and
activates Cdc7p.
In addition to interacting with Cdc7p, Dbf4p interacts with replication
origins in vivo (16, 20). This interaction requires the
essential ARS consensus sequence, which serves in vitro and in vivo as
the binding site for the origin recognition complex (16).
Analysis of Dbf4p deletions indicated that the origin-interacting domain of Dbf4p could be separated from the Cdc7p-interacting domain,
which led to the proposal that in addition to activating Cdc7p, Dbf4p
plays an essential role in recruiting the active kinase to replication
origins (16). This model is consistent with recent
experiments showing that Cdc7p is not simply a global regulator of the
G1-S transition but, instead, is required throughout S
phase for the firing of individual origins (3, 14). Several lines of evidence suggest that at least some of the targets of Cdc7p
are members of the Mcm2 to Mcm7 family of proteins (19, 32)
which are essential components of prereplicative complexes (pre-RCs) at
replication origins (2, 15, 33, 48). Together, these results
suggest that Cdc7p acts directly on pre-RCs to trigger initiation.
Since the Dbf4p-Cdc7p appears to have been conserved in evolution
(4, 25, 29, 34, 43), understanding the regulation of this
kinase is important in understanding how the initiation of DNA
replication is regulated in eukaryotes.
The DBF4 gene is expressed throughout the cell cycle
(47); however, DBF4 transcript levels may show a
modest increase at the end of G1 (5). To date,
Dbf4p levels have not been examined in detail. Here we show that Dbf4p
levels fluctuate during the cell cycle and that part of this
fluctuation is due to cell cycle-regulated proteolysis of Dbf4p. The
cell cycle-regulated degradation of Dbf4p requires the APC. Thus, not
only is Dbf4p similar to cyclins in activating a protein kinase with an
essential role in cell cycle progression but also its degradation
occurs by a related mechanism.
 |
MATERIALS AND METHODS |
Plasmids and strains.
For epitope tagging Dbf4p, the 3' end
of the DBF4 gene was amplified by PCR with two
oligonucleotides (5'AAAAAAGGATCCAAATGCAAATAACTCAATTTTTTG3' and 5'AAAAAAGGATCCCAATATTTGAAATCTGAG3'). After
BamHI digestion, the PCR product was cloned in frame with
the c-Myc epitope and 9 histidine residues in pMHT (15,
35). The plasmid was linearized with Bsu36I and
transformed into W303-1a. This yields a full-length, epitope-tagged
DBF4 gene under the control of its own promoter and a
nonfunctional, untagged fragment of the 3' end of the gene as
previously described (35). For constructing epitope-tagged Gal1,10-driven Dbf4p, the 5' end of the DBF4 gene was
amplified by PCR (primers 5'AAAAAAGGATCCAATGGTTTCTCCAACG3'
and 5'AAAAAAGGATCCTATGTATTTAATGTAAGAAAC3'). After
BamHI digestion the PCR product was cloned into pMHTGal, a
derivative of pMHT in which the Gal1,10 promoter was inserted between
the EcoRI and BamHI sites. The plasmid was
linearized prior to transformation on galactose-containing plates. This
results in the full-length DBF4 gene under the control of
the Gal1,10 promoter and a truncated, nonfunctional 5' fragment of the
DBF4 gene. The resulting strains can grow on
galactose-containing medium but cannot grow on glucose-containing medium.
To construct the DBF4 R62A L65A mutant, we cloned the
full-length DBF4 gene (the PCR product of primers
5'AAAAAAGGATCCATGGTTTCTCCAACGAAAATG3' and
5'AAAAAAGTCGACTATTTGAAATCTGAGATTTTC3') into the pMHTgal
vector. The resulting plasmid was used as the template for a single
round of site-directed mutagenesis with the PCR primers
5'AGATCTCTTGAGGCCCTCGAGGCCCAACAGCAGC3' and
5'GCTGCTGTTGGGCCTCGAGGGCCTCAAGAGATCT3' as described in the QuikChange site-directed mutagenesis kit (Stratagene).
The yeast strains used are listed in Table
1.
Media and reagents.
Yeast cultures were grown in YP medium
containing the required carbon source (2% glucose or 2%
galactose-2% raffinose). Cell cycle blocks were performed as
previously with
factor at 5 µg/ml, hydroxyurea (Sigma) at 0.2 M,
and nocodazole (Sigma) at 5 µg/ml (13).
iImmunoblotting.
Yeast protein extracts were prepared by
vortexing with glass beads as previously described (17);
extracts were run on sodium dodecyl sulfate-7.5% polyacrylamide gels
and electroblotted onto a Hybond ECL membrane (Amersham). After
electrophoretic transfer, the blots were stained with Ponceau S to
assess the loading and quality of transfer. The primary antibodies used
were the 9E10 monoclonal antibody against the c-myc epitope
(2 µg/ml) and the rabbit polyclonal anti-Dbf4p 36 (1:10 dilution)
raised against the bacterially expressed N-terminal 163 amino acids of
Dbf4p. Conditions for Cdc6p and DNA polymerase
immunoblots have
been described previously (11, 17). Antiactin antibodies
came from Sigma and were used as specified by the manufacturer. The
secondary antibodies used were horseradish peroxidase-conjugated horse
anti-mouse immunoglobulin G (1:4,000 dilution) (Vector Laboratories)
and protein A (1:20,000 dilution) (Amersham). Proteins were detected with the enhanced chemiluminescence system (Amersham). For
quantification, autoradiograms were scanned and analyzed in NIH Image.
After quantification, the membranes were stained with amido black and
destained exactly as described previously (21). The
destaining in methanol causes some warping of the membrane.
 |
RESULTS |
Dbf4p is a phosphoprotein which is absent during
G1.
To detect Dbf4p in crude yeast extracts, we used
two approaches. First, we constructed yeast strains in which the
DBF4 gene was tagged so that the C terminus of the encoded
protein, still expressed under the control of the DBF4
promoter, is fused to a short peptide which contains both an epitope
from the c-myc gene recognized by the 9E10 monoclonal
antibody and 9 histidine residues. Second, we generated polyclonal
antibodies to recombinant Dbf4p. Figure
1a shows that we can detect Dbf4p in
logarithmically growing cells by using both approaches. In Fig. 1a,
lane 2, a polypeptide of approximately 94 kDa was recognized by 9E10
monoclonal antibody in whole-cell extracts. Although this is larger
than the predicted size of tagged Dbf4p (84.1 kDa), this protein could be detected in an extract from a tagged (lane 2) but not an untagged (lane 1) yeast strain. By using the polyclonal antiserum, a polypeptide of the same molecular mass was recognized in extracts from the tagged
strain (lane 4). In extracts from the untagged strain, this 94-kDa band
was absent but a faster-migrating band, not present in extracts from
the tagged strain, was now seen. Additional bands were also detected by
the polyclonal antiserum. Since these were not detected by the 9E10
monoclonal antibody and since the migration of these polypeptides was
not affected by the epitope tag, we conclude that these are nonspecific
cross-reacting proteins. We conclude from these experiments that we can
detect endogenous Dbf4p in whole-cell extracts without overexpression.
We also conclude that the epitope tag does not significantly change the
levels of Dbf4p.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
Immunodetection of Dbf4p. (a) Detection of Dbf4p in
whole-cell extracts. Extracts prepared from asynchronous populations of
either W303-1a or the epitope-tagged derivative
(yMIG07-DBF4myc) were probed with the 9E10 monoclonal
antibody (lanes 1 and 2, respectively). In lanes 3 and 4, the same
extracts were probed with polyclonal antibody to Dbf4p. Arrows indicate
the positions of Dbf4p and Dbf4p-myc. The positions of nonspecific
cross-reacting polypeptides are designated a, b, and c (asterisks). The
relative levels of these background bands are variable due to
differences in the times of incubation with primary antibody. (b) Dbf4p
is absent from factor-arrested cells. Cultures of cells harboring
the epitope-tagged Dbf4p (DBF4myc) and the parental strain
(W303-1a) were arrested in G1 (by factor), S (by
hydroxyurea [ HU]) and in G2/M (by nocodazole
[NOC]), and Dbf4p-myc was detected by immunoblotting with the 9E10
monoclonal antibody.
|
|
To begin to address the possibility that Dbf4p levels are cell cycle
regulated, we examined Dbf4p in cells blocked at different points in
the cell cycle. Figure 1b shows that while the tag-specific polypeptide
could be detected in logarithmically growing cells (lanes 1 and 2), it
could not be detected in cells blocked in G1 with the
mating pheromone
factor (lanes 3 and 4). Tag-specific bands could,
however, be detected in cells which were released from the
factor
block into the ribonucleotide reductase inhibitor hydroxyurea (lanes 5 and 6), which arrests cells in early S phase (3, 42) or in
cells blocked in G2/M with the microtubule inhibitor
nocodazole (lanes 7 and 8). To confirm that this is not due to the
epitope tag, we examined Dbf4p levels in an untagged strain. By using
the polyclonal antibody, we showed that the untagged Dbf4p is absent
from
factor-blocked cells and present in nocodazole-blocked cells
(Fig. 2a).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Dbf4p is a phosphoprotein. Absence of Dbf4p from factor-blocked cells is independent of the epitope tag. Cultures of
W303-1a were arrested in G1 ( factor) or
G2/M (Noc) and extracts were probed with the polyclonal
antibody to Dbf4p. (b) Dbf4p is phosphorylated in nocodazole-blocked
cells. Extracts from nocodazole-blocked cells were treated with potato
acid phosphatase as described previously (51) in either the
absence (lane 2) or presence (lane 3) of phosphatase inhibitor (50 mM
NaF) prior to electrophoresis and immunoblotting with anti-Dbf4p
polyclonal antibody. Background bands are designated as in Fig. 1.
|
|
In extracts from both tagged and untagged strains, Dbf4p appears as a
doublet in nocodazole-blocked cells (Fig. 1b and 2a). Figure 2b shows
that treatment of extract from nocodazole-blocked cells with potato
acid phosphatase converts this doublet into a faster-migrating single
band (lanes 1 and 2), which is blocked by inclusion of phosphatase
inhibitor (lane 3). This shows that Dbf4p is a phosphoprotein in
nocodazole-blocked cells.
Dbf4p accumulates during S phase and is degraded at the onset of
anaphase.
To further examine the regulation of Dbf4p levels during
the cell cycle, we synchronized cells in G1 with
factor
and released them from the
factor block. In this experiment, cells
underwent two reasonably synchronous cell cycles after release as
judged by budding index (Fig. 3a).
Consistent with the results in Fig. 1, Dbf4p was absent from cells
blocked in
factor (Fig. 3a, lane 1). Dbf4p was first detectable 20 min after release, approximately when the buds first emerged. This was
just at or before the onset of DNA replication as determined by flow
cytometry (see below). Dbf4p levels continued to rise from 20 to 60 min
after release and began to rapidly decline at approximately 70 min
after release. Figure 3a shows that this sudden drop in the Dbf4p level
corresponds to the first appearance of binucleate cells. This pattern
is repeated in the second cell cycle. Thus, Dbf4p is first synthesized
in late G1/early S phase and is destroyed approximately at
the onset of anaphase.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics of Dbf4p expression during the cell cycle. (a)
Dbf4p levels after factor block and release. Cells expressing
Dbf4p-myc under its endogenous promoter (yMIG07) were grown to mid-log
phase and blocked by factor. The cells were harvested and washed
several times to remove factor and returned to fresh medium to
allow cell cycle progression. Samples were taken every 10 min, and
individual protein levels were determined by immunoblotting with the
9E10 monoclonal antibody (Dbf4p), 9H8/5 (Cdc6p), and anti-actin
antibody. In addition, the Dbf4p blot was stained with amido black
after autoradiography (21). The region between 66 and 116 kDa is shown. At each time point, the percentage of budded cells ( )
and binucleate cells ( ) was assessed by microscopy of
4',6-diamidino-2-phenylindole (DAPI)-stained cells. Samples were taken
and processed for fluorescence-activated cell sorting. (b) Dbf4p is
absent from cells that have undergone anaphase. Cultures of
cdc5ts, cdc14ts, and
cdc15ts mutants grown to logarithmic phase were
arrested in G1 ( ) and in G2/M (NOC), both at
the permissive temperatures, and a third aliquot was arrested at the
restrictive temperature (37°C). Dbf4p was detected in extracts by
immunoblotting with polyclonal antibody against Dbf4p. Background bands
are designated as in Fig. 1.
|
|
This contrasts strongly with the results for Cdc6p. Figure 3a shows
that there was a short burst of Cdc6p expression after release from
factor but that the protein had disappeared by 30 min after release. It
reappeared at 70 min after the release, just as Dbf4p levels declined
and as the chromosomes separated. This near mutual exclusivity of Dbf4p
and Cdc6p nicely illustrates the states of cell competence for pre-RC
assembly and origin firing (12).
The disappearance of Dbf4p occurred at the time of chromosome
separation and was already complete by the time cytokinesis occurred.
To investigate this further, we examined levels of Dbf4p in mutants
which arrested in mitosis after the metaphase to anaphase transition.
Figure 3b shows that while Dbf4p could be detected in all mutants
arrested in G2/M with nocodazole, it was absent from all of
these mutants when arrested at the restrictive temperature. None of
these mutants have pre-RCs assembled at origins at this point (7,
13). From these results, we conclude that Dbf4p is degraded
during mitosis at approximately the time of the metaphase-to-anaphase transition.
Dbf4p degradation in G1 is impaired when APC activity
is compromised.
The precipitous decline in Dbf4p levels at the
onset of anaphase suggested to us that Dbf4p may be targeted for
degradation by the APC. This possibility was supported by the fact that
although Dbf4p could not be detected in wild-type cells blocked in
G1 with
factor (Fig. 1b, 2a, and 3a; Fig.
4a, lane 1), it could readily be detected
in cdc16 mutant cells blocked with
factor even at the
permissive temperature (Fig. 4a, lane 2). We note that this stabilized
form of Dbf4p appears as a doublet. The significance of this is
unknown. Cdc16p is a component of the APC, and previous experiments
have shown that cdc16 mutants are defective in degradation of other mitotic substrates including Clbs, Pds1p, Ase1p, Cdc5p, and
Cdc20p (6, 8, 26, 30, 40, 46). To test the possible involvement of the APC, we examined the rate of Dbf4p degradation during G1 in wild-type cells and a cdc16 mutant.
Figure 4b shows that in
factor-arrested cells, Dbf4p is degraded
rapidly in wild-type cells but is considerably more stable in the
cdc16 mutant. Figure 4b also shows that even in wild-type
cells, Dbf4p is more stable in nocodazole-arrested cells. Moreover, its
degradation in nocodazole-arrested cells is unaffected in the
cdc16 mutant. Very similar results were obtained with a
cdc23 mutant (data not shown). These experiments show that
Dbf4p is rapidly degraded during pre-Start G1 and that this
rapid degradation requires the APC.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Dbf4p is targeted for destruction by APC. (a) Dbf4p is
present in cdc16ts mutants arrested in
G1 at the permissive temperature. Cultures of W303-1a and
cdc16ts mutants grown at 24°C were arrested in
G1 ( ) and in G2/M (Noc). Dbf4p was detected
by immunoblotting with polyclonal antibodies to Dbf4p. Background bands
are designated as in Fig. 1. (b) Dbf4p degradation during
G1 requires the APC. W303-1a and
cdc16ts cell cultures harboring tagged Dbf4p
under the GAL1-10 promoter were grown in galactose medium and arrested
in G1 with factor or in G2/M with
nocodazole at the permissive temperature. The cells were then incubated
at the restrictive temperature for 30 min, after which the promoter was
repressed by harvesting the cells and releasing them into glucose
medium containing cycloheximide. Cell aliquots were taken prior to
changing the carbon source (0 min) and at different times points
thereafter. Dbf4p levels were investigated on immunoblots with the 9E10
monoclonal antibody or the anti-polymerase monoclonal antibody. The
Dbf4p blot was stained with amido black as described in the legend to
Fig. 3. The apparent distortion in the amido black pattern (Amido) is
due to warping of the membrane during destaining (see Materials and
Methods).
|
|
Dbf4p contains a destruction box-like sequence required for its
degradation in G1.
The APC-dependent degradation of
Dbf4p could be due to direct action on Dbf4p. Alternatively, the
effects on Dbf4p degradation could be an indirect consequence of
stabilization of some other protein(s) such as cyclins during
G1 in the apc mutants. One common feature of
many APC substrates is the presence of a "destruction box" near the
N terminus. The destruction box contains two highly conserved amino
acid residues (RXXL) and several other residues which are more
moderately conserved. Within the entire Dbf4p, there are six RXXL
motifs. Two of these are located within the N-terminal 70 amino acids.
Preliminary analysis indicated that deletion of the first 14 amino
acids, which removes the first motif, did not affect the APC-dependent
degradation of Dbf4p in G1 while deletion of the first 67 amino acids, which removes both the first and second motifs, eliminated
APC-dependent degradation of Dbf4p (M. G. Ferreira and J. D. Diffley, unpublished data). This suggested that the second motif plays
a critical role in Dbf4p degradation. To analyze this more precisely,
we constructed a double point mutation in which both the arginine and
leucine residues within box 2 were converted to alanine. Figure
5a shows again that the wild-type Dbf4p
is rapidly degraded in an APC-dependent manner. Figure 5b shows that
the double point mutant is no longer capable of being targeted for
APC-dependent degradation during G1. This stable mutant
could still complement a dbf4 temperature-sensitive mutant,
indicating that it is a functional protein. Furthermore, overproduction
of Dbf4p R62A L65A did not arrest cell growth or result in any
detectable rereplication as determined by flow cytometry (data not
shown).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Dbf4p possesses a destruction box sequence responsible
for APC-dependent degradation in G1. An experiment
identical to that performed with wild-type Dbf4 in Fig. 4 was performed
with wild-type Dbf4p (a) and the Dbf4p R62A L65A mutant (b).
|
|
 |
DISCUSSION |
Previous work has shown that Dbf4p associates with and activates
Cdc7p analogous to the activation of cyclin-dependent kinases by the
binding of cyclins. The analogy to cyclins is extended in this work
with the demonstration that Dbf4p is present during only part of the
cell cycle. This is because Dbf4p is targeted for proteolysis by the
APC, which is also required to target the B cyclins for proteolysis
during mitosis and G1. Thus, although Dbf4p is not related
to the cyclins in its primary amino acid sequence, it performs an
analogous function and is regulated very similarly to the cyclins.
Why is Dbf4p targeted for degradation by the APC at anaphase onset?
Partial rereplication of the genome or the inappropriate activation of
some or all origins prior to Start could be a dangerous, even lethal
event. Consequently, cells appear to utilize multiple mechanisms to
ensure that replication origins fire on schedule and just once in each
cell cycle. The Cdc6 protein, which plays an essential role in DNA
replication by loading the Mcm proteins into prereplication complexes,
is degraded before S phase begins (17), and the Mcm proteins
are present in the nucleus only during G1 and early S
phases (10, 24, 53). In addition to pre-RCs, other
components of the replication machinery appear to be similarly regulated. For example, like the Mcm proteins, DNA polymerase
-primase binds to chromatin during G1 and S phases.
However, unlike the Mcm proteins, this chromatin association is
independent of Cdc6p and therefore of pre-RC assembly (11).
The window of opportunity when pre-RCs can assemble and DNA polymerase
-primase loads onto chromatin coincides with the period when
Cdc28/Clb kinase is inactive (9, 13, 38). Considerable evidence now indicates that Cdc28/Clb kinase blocks both pre-RC assembly and DNA polymerase
-primase loading (9, 11).
Since Cdc28/Clb kinase is also essential for origin firing
(45), origin firing and resetting of the replication
machinery are mutually exclusive processes.
This mutual exclusivity ensures that replication origins do not fire
more than once in any cell cycle. However, the transition from high
kinase to low kinase activity at the end of mitosis is a potentially
dangerous time when, at intermediate kinase levels, newly formed
pre-RCs might be immediately and accidentally activated. We suggest
that Dbf4p degradation provides a second, perhaps redundant, mechanism
whereby newly formed pre-RCs cannot immediately refire. The results
presented in this paper indicate that Dbf4p is targeted for degradation
by the APC at the metaphase-to-anaphase transition and that Dbf4p is
absent from cells blocked in anaphase by using a number of different
temperature-sensitive mutants (Fig. 3b and 6). Clb2 is still present at this time in
these mutants (28). In addition, pre-RCs have not yet
assembled at this time in any of these mutants (7, 13).
These results argue that Dbf4p degradation occurs before Clb2 and, as a
consequence, also occurs prior to assembly of pre-RCs. Therefore, when
pre-RCs finally assemble at the end of mitosis, they will be unable to
immediately refire because these cells lack not only Clbs but also
Dbf4p. The degradation of Dbf4p at the time of sister chromatid
segregation ensures that this essential S phase-promoting signal can be
completely erased before pre-RC assembly even begins.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Dbf4p degradation in the cell cycle. The details of this
model are discussed in the text. Dbf4p levels (solid black lines)
decrease at the metaphase (Meta)-anaphase (Ana) transition as a result
of APC activation. After this, the APC targets Clb2p (dotted black
lines) for degradation, which allows pre-RCs (solid grey lines) to
assemble. Passage through Start inactivates the APC and allows Dbf4 as
well as the S phase-promoting Clb5 and Clb6 to reaccumulate. This
triggers the activation of pre-RCs at individual origins during S
phase.
|
|
Inactivation of the APC has been reported to induce rereplication in
budding yeast (22, 23). Although this is currently a
controversial point (39), it is interesting to consider the possibility that the inability to degrade Dbf4p contributes to the
rereplication phenotype. This is unlikely to be the sole explanation for rereplication in the apc mutants, since constitutive
expression of the Dbf4p destruction box mutant does not cause
spontaneous rereplication.
We note that the timing of Dbf4p degradation is similar to that of
other APC substrates including the anaphase inhibitor Pds1 (8). Two WD-40 repeat proteins, Cdc20p and Hct1/Cdh1, have recently been implicated in activating the APC toward specific substrates; Cdc20 targets Pds1p, while Hct1/Cdh1 targets Clb2 (44,
52). At present, we do not know which, if any, of these targeting
factors is required for Dbf4p degradation; however, the similarity in
timing to Pds1 suggests that Dbf4p may be targeted by Cdc20. Further
experiments are required to test this hypothesis.
The evidence presented in this paper indicates that a second,
APC-independent mode of degradation is revealed when the APC-mediated degradation of Dbf4p is eliminated by either conditional inactivation of APC subunits or mutation of the Dbf4p destruction box. This APC-independent degradation does not appear to be cell cycle regulated, since the half-life of Dbf4p in G2/M is similar to that
seen in G1-arrested cells in either the cdc16
mutant or the Dbf4p destruction box mutant. We do not know the
significance of this degradation. At present, we also do not know how
this second mode of degradation works, except that it does not require
the PEST sequence (41) near the C terminus of Dbf4p (data
not shown). The existence of this second pathway complicates any
interpretation of the fact that the destruction box mutant appears
functional, since this mutant is still degraded by this second pathway.
Characterization of this pathway should help to address this issue.
 |
ACKNOWLEDGMENTS |
We thank Tamara Tugal for advice on phosphatase treatment and
Hiro Yamano and Tim Hunt for discussions.
M.G.F. gratefully acknowledges the support of the Gulbenkian Ph.D.
Program in Biology and Medicine.
 |
ADDENDUM IN PROOF |
While this paper was under consideration, two papers (L. Cheng et
al., Mol. Cell. Biol. 19:4270-4278, 1999, and G. Oshiro et
al., Mol. Cell. Biol. 19:4888-4896, 1999) showing APC-dependent degradation of Dbf4p have been published.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: ICRF Clare Hall
Laboratories, South Mimms, Herts. EN6 3LD, United Kingdom. Phone:
44-171-269-3869. Fax: 44-171-269-3801. E-mail:
J.Diffley{at}icrf.icnet.uk.
 |
REFERENCES |
| 1.
|
Andrews, B., and V. Measday.
1998.
The cyclin family of budding yeast: abundant use of a good idea.
Trends Genet
14:66-72[CrossRef][Medline].
|
| 2.
|
Aparicio, O. M.,
D. M. Weinstein, and S. P. Bell.
1997.
Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM complexes and Cdc45p during S phase.
Cell
91:59-69[CrossRef][Medline].
|
| 3.
|
Bousset, K., and J. F. X. Diffley.
1998.
The Cdc7 protein kinase is required for origin firing during S phase.
Genes Dev.
12:480-490[Abstract/Free Full Text].
|
| 4.
|
Brown, G. W., and T. J. Kelly.
1998.
Purification of Hsk1, a minichromosome maintenance protein kinase from fission yeast.
J. Biol. Chem.
273:22083-22090[Abstract/Free Full Text].
|
| 5.
|
Chapman, J. W., and L. H. Johnston.
1989.
The yeast gene, DBF4, essential for entry into S phase is cell cycle regulated.
Exp. Cell Res.
180:419-428[CrossRef][Medline].
|
| 6.
|
Charles, J. F.,
S. L. Jaspersen,
R. L. Tinker-Kulberg,
L. Hwang,
A. Szidon, and D. O. Morgan.
1998.
The Polo-related kinase Cdc5 activates and is destroyed by the mitotic cyclin destruction machinery in S. cerevisiae.
Curr. Biol.
8:497-507[CrossRef][Medline].
|
| 7.
|
Cocker, J. H.,
S. Piatti,
C. Santocanale,
K. Nasmyth, and J. F. X. Diffley.
1996.
An essential role for the Cdc6 protein in forming the pre-replicative complexes of budding yeast.
Nature
379:180-182[CrossRef][Medline].
|
| 8.
|
Cohen-Fix, O.,
J. M. Peters,
M. W. Kirschner, and D. Koshland.
1996.
Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p.
Genes Dev.
10:3081-3093[Abstract/Free Full Text].
|
| 9.
|
Dahmann, C.,
J. F. X. Diffley, and K. A. Nasmyth.
1995.
S-phase-promoting cyclin-dependent kinases prevent re-replication by inhibiting the transition of origins to a pre-replicative state.
Curr. Biol.
5:1257-1269[CrossRef][Medline].
|
| 10.
|
Dalton, S., and L. Whitbread.
1995.
Cell-cycle-regulated nuclear import and export of Cdc47, a protein essential for initiation of DNA-replication in budding yeast.
Proc. Natl. Acad. Sci. USA
92:2514-2518[Abstract/Free Full Text].
|
| 11.
|
Desdouets, C.,
C. Santocanale,
L. S. Drury,
G. Perkins,
M. Foiani,
P. Plevani, and J. F. X. Diffley.
1998.
Evidence for a Cdc6p-independent mitotic resetting event involving DNA polymerase .
EMBO J.
17:4139-4146[CrossRef][Medline].
|
| 12.
|
Diffley, J. F. X.
1996.
Once and only once upon a time: specifying and regulating origins of DNA replication in eukaryotic cells.
Genes Dev.
10:2819-2830[Free Full Text].
|
| 13.
|
Diffley, J. F. X.,
J. H. Cocker,
S. J. Dowell, and A. Rowley.
1994.
Two steps in the assembly of complexes at yeast replication origins in vivo.
Cell
78:303-316[CrossRef][Medline].
|
| 14.
|
Donaldson, A. D.,
W. L. Fangman, and B. J. Brewer.
1998.
Cdc7 is required throughout the yeast S phase to activate replication origins.
Genes Dev.
12:491-501[Abstract/Free Full Text].
|
| 15.
|
Donovan, S.,
J. Harwood,
L. S. Drury, and J. F. X. Diffley.
1997.
Cdc6-dependent loading of Mcm proteins onto pre-replicative chromatin in budding yeast.
Proc. Natl. Acad. Sci. USA
94:5611-5616[Abstract/Free Full Text].
|
| 16.
|
Dowell, S. J.,
P. Romanowski, and J. F. X. Diffley.
1994.
Interaction of Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo.
Science
265:1243-1246[Abstract/Free Full Text].
|
| 17.
|
Drury, L. S.,
G. Perkins, and J. F. X. Diffley.
1997.
The Cdc4/34/53 pathway targets Cdc6p for proteolysis in budding yeast.
EMBO J.
16:5966-5976[CrossRef][Medline].
|
| 18.
|
Evans, T.,
E. T. Rosenthal,
J. Youngblom,
D. Distel, and T. Hunt.
1983.
Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division.
Cell
33:389-396[CrossRef][Medline].
|
| 19.
|
Hardy, C. F.,
O. Dryga,
S. Seematter,
P. M. Pahl, and R. A. Sclafani.
1997.
Mcm5/Cdc46-bob1 bypasses the requirement for the S phase activator Cdc7p.
Proc. Natl. Acad. Sci. USA
94:3151-3155[Abstract/Free Full Text].
|
| 20.
|
Hardy, C. F. J., and A. Pautz.
1996.
A novel role for Cdc5p in DNA replication.
Mol. Cell. Biol.
16:6775-6782[Abstract].
|
| 21.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 22.
|
Heichman, K. A., and J. M. Roberts.
1998.
CDC16 controls initiation at chromosome replication origins.
Mol. Cell
1:457-463[CrossRef][Medline].
|
| 23.
|
Heichman, K. A., and J. M. Roberts.
1996.
The yeast CDC16 and CDC27 genes restrict DNA replication to once per cell cycle.
Cell
85:39-48[CrossRef][Medline].
|
| 24.
|
Hennessy, K. M.,
C. D. Clark, and D. Botstein.
1990.
Subcellular localization of yeast CDC46 varies with the cell cycle.
Genes Dev.
4:2252-2263[Abstract/Free Full Text].
|
| 25.
|
Hess, G. F.,
R. F. Drong,
K. L. Weiland,
J. L. Slightom,
R. A. Sclafani, and R. E. Hollingsworth.
1998.
A human homolog of the yeast CDC7 gene is overexpressed in some tumors and transformed cell lines.
Gene
211:133-140[CrossRef][Medline].
|
| 26.
|
Irniger, S.,
S. Piatti,
C. Michaelis, and K. Nasmyth.
1995.
Genes involved in sister chromatid separation are needed for B-type cyclin proteolysis in budding yeast.
Cell
81:269-278[CrossRef][Medline].
|
| 27.
|
Jackson, A. L.,
P. M. Pahl,
K. Harrison,
J. Rosamond, and R. A. Sclafani.
1993.
Cell cycle regulation of the yeast CDC7 protein kinase by association with the DBF4 protein.
Mol. Cell. Biol.
13:2899-2908[Abstract/Free Full Text].
|
| 28.
|
Jaspersen, S. L.,
J. F. Charles,
R. L. Tinker-Kulberg, and D. O. Morgan.
1998.
A late mitotic regulatory network controlling cyclin destruction in Saccharomyces cerevisiae.
Mol. Biol. Cell.
9:2803-2817[Abstract/Free Full Text].
|
| 29.
|
Jiang, W., and T. Hunter.
1997.
Identification and characterization of a human protein kinase related to budding yeast Cdc7p.
Proc. Natl. Acad. Sci. USA
94:14320-14325[Abstract/Free Full Text].
|
| 30.
|
Juang, Y. L.,
J. Huang,
J. M. Peters,
M. E. McLaughlin,
C. Y. Tai, and D. Pellman.
1997.
APC-mediated proteolysis of Ase1 and the morphogenesis of Ase1 and the morphogenesis of the mitotic spindle.
Science
275:1311-1314[Abstract/Free Full Text].
|
| 31.
|
Kitada, K.,
L. H. Johnston,
T. Sugino, and A. Sugino.
1992.
Temperature-sensitive cdc7 mutations of Saccharomyces cerevisiae are suppressed by the DBF4 gene, which is required for the G1/S cell cycle transition.
Genetics
131:21-29[Abstract].
|
| 32.
|
Lei, M.,
Y. Kawasaki,
M. R. Young,
M. Kihara,
A. Sugino, and B. K. Tye.
1997.
Mcm2 is a target of regulation by Cdc7-Dbf4 during the initiation of DNA synthesis.
Genes Dev.
11:3365-3374[Abstract/Free Full Text].
|
| 33.
|
Liang, C., and B. Stillman.
1997.
Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants.
Genes Dev.
11:3375-3386[Abstract/Free Full Text].
|
| 34.
|
Masai, H.,
T. Miyake, and K.-I. Arai.
1995.
hsk1+, a Schizosaccharomyces pombe gene related to Saccharomyces cerevisiae CDC7, is required for chromosomal replication.
EMBO J.
14:3094-3104[Medline].
|
| 35.
|
Micklem, G.,
A. Rowley,
J. Harwood,
K. Nasmyth, and J. F. X. Diffley.
1993.
Yeast origin recognition complex is involved in DNA replication and transcriptional silencing.
Nature
366:87-89[CrossRef][Medline].
|
| 36.
|
Peters, J. M.
1998.
SCF and APC: the yin and yang of cell cycle regulated proteolysis.
Curr. Opin. Cell. Biol.
10:759-768[CrossRef][Medline].
|
| 37.
|
Piatti, S.
1997.
Cell cycle regulation of S phase entry in Saccharomyces cerevisiae.
Prog. Cell. Cycle Res.
3:143-156[Medline].
|
| 38.
|
Piatti, S.,
T. Bohm,
J. H. Cocker,
J. F. X. Diffley, and K. Nasmyth.
1996.
Activation of S-phase promoting CDKs in late G1 defines a "point of no return" after which Cdc6 synthesis cannot promote DNA replication in yeast.
Genes Dev.
10:1516-1531[Abstract/Free Full Text].
|
| 39.
|
Pichler, S.,
S. Piatti, and K. Nasmyth.
1997.
Is the yeast anaphase promoting complex needed to prevent re-replication during G2 and M phases?
EMBO J.
16:5988-5997[CrossRef][Medline].
|
| 40.
|
Prinz, S.,
E. S. Hwang,
R. Visintin, and A. Amon.
1998.
The regulation of Cdc20 proteolysis reveals a role for APC components Cdc23 and Cdc27 during S phase and early mitosis.
Curr. Biol.
8:750-760[CrossRef][Medline].
|
| 41.
|
Rechsteiner, M., and S. W. Rogers.
1996.
Pest sequences and regulation by proteolysis.
Trends Biochem. Sci.
21:267-271[CrossRef][Medline].
|
| 42.
|
Santocanale, C., and J. F. X. Diffley.
1998.
A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication.
Nature
395:615-618[CrossRef][Medline].
|
| 43.
|
Sato, N.,
K. Arai, and H. Masai.
1997.
Human and Xenopus cDNAs encoding budding yeast cdc7-related kinases in-vitro phosphorylation of mcm subunits by a putative human homolog of cdc7.
EMBO J.
16:4340-4351[CrossRef][Medline].
|
| 44.
|
Schwab, M.,
S. L. Annegret, and W. Seufert.
1997.
Yeast Hct1 is a regulator of Clb2 cyclin proteolysis.
Cell
90:683-693[CrossRef][Medline].
|
| 45.
|
Schwob, E.,
T. Bohm,
M. D. Mendenhall, and K. Nasmyth.
1994.
The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae.
Cell
79:233-244[CrossRef][Medline].
|
| 46.
|
Shirayama, M.,
W. Zachariae,
R. Ciosk, and K. Nasmyth.
1998.
The Polo-like kinase Cdc5p and the WD-repeat protein Cdc20p/fizzy are regulators and substrates of the anaphase promoting complex in Saccharomyces cerevisiae.
EMBO J.
17:1336-1349[CrossRef][Medline].
|
| 47.
|
Spellman, P. T.,
G. Sherlock,
M. Q. Zhang,
V. R. Iyer,
K. Anders,
M. B. Eisen,
P. O. Brown,
D. Botstein, and B. Futcher.
1998.
Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization.
Mol. Biol. Cell.
9:3273-3297[Abstract/Free Full Text].
|
| 48.
|
Tanaka, T.,
D. Knapp, and K. Nasmyth.
1997.
Loading of an Mcm protein onto DNA-replication origins is regulated by Cdc6p and CDKs.
Cell
90:649-660[CrossRef][Medline].
|
| 49.
|
Thomas, B. J., and R. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
56:619-630[CrossRef][Medline].
|
| 50.
|
Toone, W. M.,
B. L. Aerne,
B. A. Morgan, and L. H. Johnston.
1997.
Getting started: regulating the initiation of DNA replication in yeast.
Annu. Rev. Microbiol.
51:125-149[CrossRef][Medline].
|
| 51.
|
Tugal, T.,
X. H. Zou-Yang,
D. Pappin,
B. Canas,
R. Kobayashi,
T. Hunt, and B. Stillman.
1998.
The Orc4p and Orc5p subunits of the Xenopus and human origin recognition complex are related to Orc1p and Cdc6p.
J. Biol. Chem.
273:32421-32429[Abstract/Free Full Text].
|
| 52.
|
Visintin, R.,
S. Prinz, and A. Amon.
1997.
CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis.
Science
278:460-463[Abstract/Free Full Text].
|
| 53.
|
Yan, H.,
A. M. Merchant, and B.-K. Tye.
1993.
Cell cycle-regulated nuclear localisation of MCM2 and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast.
Genes Dev.
7:2149-2160[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 2000, p. 242-248, Vol. 20, No. 1
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sullivan, M., Holt, L., Morgan, D. O.
(2008). Cyclin-Specific Control of Ribosomal DNA Segregation. Mol. Cell. Biol.
28: 5328-5336
[Abstract]
[Full Text]
-
Kakusho, N., Taniyama, C., Masai, H.
(2008). Identification of Stimulators and Inhibitors of Cdc7 Kinase in Vitro. J. Biol. Chem.
283: 19211-19218
[Abstract]
[Full Text]
-
Sullivan, M., Morgan, D. O.
(2007). A Novel Destruction Sequence Targets the Meiotic Regulator Spo13 for Anaphase-promoting Complex-dependent Degradation in Anaphase I. J. Biol. Chem.
282: 19710-19715
[Abstract]
[Full Text]
-
Cho, W.-H., Lee, Y.-J., Kong, S.-I., Hurwitz, J., Lee, J.-K.
(2006). CDC7 kinase phosphorylates serine residues adjacent to acidic amino acids in the minichromosome maintenance 2 protein. Proc. Natl. Acad. Sci. USA
103: 11521-11526
[Abstract]
[Full Text]
-
Havens, C. G., Ho, A., Yoshioka, N., Dowdy, S. F.
(2006). Regulation of Late G1/S Phase Transition and APCCdh1 by Reactive Oxygen Species. Mol. Cell. Biol.
26: 4701-4711
[Abstract]
[Full Text]
-
Araki, M., Yu, H., Asano, M.
(2005). A novel motif governs APC-dependent degradation of Drosophila ORC1 in vivo. Genes Dev.
19: 2458-2465
[Abstract]
[Full Text]
-
Forsburg, S. L.
(2004). Eukaryotic MCM Proteins: Beyond Replication Initiation. Microbiol. Mol. Biol. Rev.
68: 109-131
[Abstract]
[Full Text]
-
Furukohri, A., Sato, N., Masai, H., Arai, K.-i., Sugino, A., Waga, S.
(2003). Identification and Characterization of a Xenopus Homolog of Dbf4, a Regulatory Subunit of the Cdc7 Protein Kinase Required for the Initiation of DNA Replication. J Biochem
134: 447-457
[Abstract]
[Full Text]
-
Biswas, N., Sanchez, V., Spector, D. H.
(2003). Human Cytomegalovirus Infection Leads to Accumulation of Geminin and Inhibition of the Licensing of Cellular DNA Replication. J. Virol.
77: 2369-2376
[Abstract]
[Full Text]
-
Duncker, B. P., Shimada, K., Tsai-Pflugfelder, M., Pasero, P., Gasser, S. M.
(2002). An N-terminal domain of Dbf4p mediates interaction with both origin recognition complex (ORC) and Rad53p and can deregulate late origin firing. Proc. Natl. Acad. Sci. USA
99: 16087-16092
[Abstract]
[Full Text]
-
Harper, J. W., Burton, J. L., Solomon, M. J.
(2002). The anaphase-promoting complex: it's not just for mitosis any more. Genes Dev.
16: 2179-2206
[Full Text]
-
Sclafani, R. A., Tecklenburg, M., Pierce, A.
(2002). The mcm5-bob1 Bypass of Cdc7p/Dbf4p in DNA Replication Depends on Both Cdk1-Independent and Cdk1-Dependent Steps in Saccharomyces cerevisiae. Genetics
161: 47-57
[Abstract]
[Full Text]
-
Nakamura, T., Nakamura-Kubo, M., Nakamura, T., Shimoda, C.
(2002). Novel Fission Yeast Cdc7-Dbf4-Like Kinase Complex Required for the Initiation and Progression of Meiotic Second Division. Mol. Cell. Biol.
22: 309-320
[Abstract]
[Full Text]
-
Huang, J. N., Park, I., Ellingson, E., Littlepage, L. E., Pellman, D.
(2001). Activity of the APCCdh1 form of the anaphase-promoting complex persists until S phase and prevents the premature expression of Cdc20p. J. Cell Biol.
154: 85-94
[Abstract]
[Full Text]
-
Sørensen, C. S., Lukas, C., Kramer, E. R., Peters, J.-M., Bartek, J., Lukas, J.
(2001). A Conserved Cyclin-Binding Domain Determines Functional Interplay between Anaphase-Promoting Complex-Cdh1 and Cyclin A-Cdk2 during Cell Cycle Progression. Mol. Cell. Biol.
21: 3692-3703
[Abstract]
[Full Text]
-
Lei, M, Tye, B.
(2001). Initiating DNA synthesis: from recruiting to activating the MCM complex. J. Cell Sci.
114: 1447-1454
[Abstract]
-
Sørensen, C. S., Lukas, C., Kramer, E. R., Peters, J.-M., Bartek, J., Lukas, J.
(2000). Nonperiodic Activity of the Human Anaphase-Promoting Complex-Cdh1 Ubiquitin Ligase Results in Continuous DNA Synthesis Uncoupled from Mitosis. Mol. Cell. Biol.
20: 7613-7623
[Abstract]
[Full Text]
-
Sclafani, R.
(2000). Cdc7p-Dbf4p becomes famous in the cell cycle. J. Cell Sci.
113: 2111-2117
[Abstract]
-
Ogino, K., Takeda, T., Matsui, E., Iiyama, H., Taniyama, C., Arai, K.-i., Masai, H.
(2001). Bipartite Binding of a Kinase Activator Activates Cdc7-related Kinase Essential for S Phase. J. Biol. Chem.
276: 31376-31387
[Abstract]
[Full Text]