Next Article 
Molecular and Cellular Biology, May 2000, p. 3331-3344, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Role of the Cyclic AMP Response Element Binding Complex and
Activation of Mitogen-Activated Protein Kinases in Synergistic
Activation of the Glycoprotein Hormone
Subunit Gene by
Epidermal Growth Factor and Forskolin
Mark S.
Roberson,*
Makiko
Ban,
Tong
Zhang, and
Jennifer M.
Mulvaney
Department of Biomedical Sciences, College of
Veterinary Medicine, Cornell University, Ithaca, New York 14853
Received 25 October 1999/Returned for modification 10 December
1999/Accepted 17 February 2000
 |
ABSTRACT |
The aim of these studies was to elucidate a role for epidermal
growth factor (EGF) signaling in the transcriptional regulation of the
glycoprotein hormone
subunit gene, a subunit of
chorionic gonadotropin. Studies examined the effects of EGF and the
adenylate cyclase activator forskolin on the expression of a
transfected
subunit reporter gene in a human choriocarcinoma cell
line (JEG3). At maximal doses, administration of EGF resulted in a 50%
increase in a subunit reporter activity; forskolin administration
induced a fivefold activation; the combined actions of EGF and
forskolin resulted in synergistic activation (greater than eightfold)
of the
subunit reporter. Mutagenesis studies revealed that the cyclic AMP response elements (CRE) were required and sufficient to
mediate EGF-forskolin-induced synergistic activation. The combined actions of EGF and forskolin resulted in potentiated activation of
extracellular signal-regulated kinase (ERK) enzyme activity compared
with EGF alone. Specific blockade of ERK activation was sufficient to
block EGF-forskolin-induced synergistic activation of the
subunit
reporter. Pretreatment of JEG3 cells with a p38 mitogen-activated
protein kinase inhibitor did not influence activation of the
reporter. However, overexpression of c-Jun N-terminal kinase
(JNK)-interacting protein 1 as a dominant interfering molecule abolished the synergistic effects of EGF and forskolin on the
subunit reporter. CRE binding studies suggested that the CRE complex
consisted of CRE binding protein and EGF-ERK-dependent recruitment of
c-Jun-c-Fos (AP-1) to the CRE. A dominant negative form of c-Fos
(A-Fos) that specifically disrupts c-Jun-c-Fos DNA binding inhibited
synergistic activation of the
subunit. Thus, synergistic activation
of the
subunit gene induced by EGF-forskolin requires the ERK and
JNK cascades and the recruitment of AP-1 to the CRE binding complex.
 |
INTRODUCTION |
Chorionic gonadotropin (CG) is a
heterodimeric glycoprotein hormone consisting of an
subunit common to other glycoprotein hormone family members
noncovalently linked to a CG-specific
subunit (58). CG
is synthesized and secreted by placental syncytiotrophoblast cells
during the first trimester of pregnancy in women and nonhuman primates.
CG is a luteotropin required for maintenance of progesterone production
by the ovarian corpus luteum in early gestation. An important factor in
the establishment of early pregnancy appears to be the timing and rate
of increase in the secretion of CG that is highly correlated with a
rise in progesterone levels in peripheral circulation (42).
Insufficient progesterone production during early pregnancy is
correlated with the potential for early or recurrent pregnancy loss in
women (6, 7, 27, 47). Thus, endocrine mechanisms that
potentiate the synthesis of CG subunits and CG secretion are essential
for the establishment of pregnancy. Despite the clear importance of CG
to early pregnancy, the specific ligands and signaling mechanisms that
regulate the expression of CG subunit genes in placental cells have not
been fully elucidated.
The
subunit of the glycoprotein hormones is a unique
and useful transcriptional model for the study of tissue-specific gene expression because the
subunit gene is expressed in placental and
pituitary cells, albeit by various mechanisms. Analysis of the
architecture of the
subunit promoter revealed the presence of
multiple promoter elements that are required for transcriptional regulation. These include the pituitary glycoprotein
hormone basal element, which binds members of the LIM class of
homeobox-containing proteins (67, 71, 72); the
basal
element (32); the gonadotrope-specific element, which binds
steroidogenic factor 1 (9, 36); the upstream regulatory
element (URE) (12, 26, 38, 59); the GATA element, which
binds several GATA factors (75); the dual tandem cyclic AMP
(cAMP) response elements (CREs), which bind CRE binding protein (CREB)
(5, 10, 12, 13, 22, 25, 32, 35, 52, 59, 74); the junctional
regulatory element (JRE) (4, 12); and a unique CAAT box
(12, 40). Extensive mutagenesis studies have begun to
unravel the specific requirements for different combinations of
cis-acting elements in cell-specific
subunit expression.
In pituitary cells, for example, analysis of the human
subunit
promoter revealed that pituitary-specific expression required the
pituitary glycoprotein hormone basal element,
basal
element, gonadotrope-specific element, CREs, and URE (32, 71). In cells of placental origin, the URE, GATA, dual CREs, JRE,
and a unique CAAT box all contribute to basal trophoblast-specific promoter regulation to the human
subunit (4, 12, 22, 32). However, the absolute contribution of each of these five regulatory elements varies in level of transcriptional importance. For
example, mutations within the dual CREs render the
subunit promoter
essentially silent in placental cells, providing evidence for the
absolute importance of the CREs. Interestingly, mutations within the
URE or the JRE/CAAT box result in 80 to 90% loss in promoter activity
despite the presence of a wild-type CRE (12). Thus, the
importance of the CREs in regulating basal
subunit gene expression
appears to be within the context of other critical cis
elements within the
subunit promoter (12). The emerging model for cell-specific transcriptional regulation of the
subunit gene is that the appropriate combinatorial code of cis
elements and their cognate binding proteins is required to regulate
expression of the gene (56).
Despite advances in our understanding of cell-specific regulation of
the
subunit, our understanding of the mechanisms of endocrine-inducible regulation of
subunit expression in placental cells is less comprehensive. In placental trophoblasts, studies of cell
signaling have primarily elucidated the effects of cAMP in
increasing activation of protein kinase A (PKA) and the subsequent phosphorylation-dependent activation of CREB. Elevated
levels of cAMP increase CRE-dependent expression of the genes encoding the
and
CG peptides in a coordinated but distinct manner
(2, 5, 11, 13, 19, 52). Interestingly, combined activation of the cAMP/PKA and phorbol ester/protein kinase C (PKC) signaling pathways results in potentiated activation of the
subunit gene. However, the mechanism(s) for this transcriptional response has not
been elucidated (5, 21). The dual tandem CREs of the
subunit likely play a prominent role in inducible regulation by
multiple signaling cascades since this cis element has been shown to bind CREB and other inducible factors such as c-Jun (25, 33).
In addition to regulation by PKA and PKC, trophoblasts express
receptors for epidermal growth factor (EGF) on their cell surface as
well as EGF itself (3), suggesting the possibility for
autocrine regulation by this growth peptide. EGF receptor binding and
subsequent activation alter trophoblast differentiation (18,
55) and increase the synthesis and secretion of CG from placental
cells (8, 14, 37, 55, 64, 65). Mechanistically, the effects of EGF on CG subunit synthesis appear to be mediated primarily via
stabilization of CG subunit mRNA rather than a direct increase in the
rate of transcription in human trophoblast cells (14). Recent evidence (51) derived from a rat trophoblast cell
model (Rcho-1 cells) suggests that the human
subunit is directly
regulated by EGF signaling through CREB
phosphorylation. However, similar studies have not been
conducted in human cell lines in which the
subunit gene is
expressed endogenously. In the present study, we sought to examine the
role of EGF stimulation on induction of the glycoprotein
hormone
subunit promoter in the human choriocarcinoma cell line
JEG3. We demonstrate that unlike the case in Rcho-1 cells, acute EGF
administration alone only modestly enhances
subunit gene
activation. However, concurrent administration of EGF and activation of
the cAMP/PKA pathway resulted in synergistic activation of the
subunit gene.
 |
MATERIALS AND METHODS |
Plasmids, hormones, agonists, and reagents.
All plasmids
were prepared by two cycles through cesium chloride by standard
methods. Human
880 luciferase and the CRE(
)
subunit
luciferase reporters were a gift from Richard A. Maurer (Oregon Health
Sciences University, Portland) and contained nucleotides
846 to +42
of the 5'-flanking region of the
subunit gene. The human
-204
luciferase reporter was prepared by PCR with the
846 luciferase
reporter as a template. The
204 deletion was confirmed by nucleotide
sequence analysis and essentially contained the URE, the CREs, the JRE,
and the CCAAT box. Mutations in the individual CREs within the
subunit promoter were accomplished by oligonucleotide-directed
mutagenesis as described before (66, 67). Each individual
CRE was replaced with a NotI restriction site
(5'GCGGCCGC3'), generating h
-204-CRE1-MUT-luc and
h
-204-CRE2-MUT-luc. Mutagenesis was confirmed by nucleotide sequence
analysis. The human
CRE-Prl-luciferase reporter was constructed by
cloning annealed oligonucleotides for the dual tandem CRE from the
subunit gene into the SmaI site in the reporter
Prl-luciferase (a gift from D. Duval and C. Clay, Colorado State
University, Fort Collins). The Prl-luciferase reporter contains the
TATAA box from the prolactin gene cloned upstream of the luciferase
coding sequence in the luciferase reporter pGL3 (Promega, Madison,
Wis.). The synthesized CRE oligonucleotides were purchased from
Gibco-BRL (Gaithersburg, Md.). The nucleotide sequences for the
oligonucleotides were 5'GGGATTGACGTCATGGTAAAAATTGACGTCATG3' and 5'CATGACGTCAATTTTTACCATGACGTCAATCCC3'. The
orientation of the annealed CRE oligonucleotide in Prl-luciferase was
confirmed by restriction analysis; the proper orientation of the CRE
relative to luciferase reestablishes a SmaI restriction
site. The expression vector for Raf-CAAX was a gift from Linda VanAelst
(Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). The
expression vector for cytomegalovirus JNK-interacting protein (CMV-JIP)
was a gift from Roger Davis (University of Massachusetts, Worcester).
The expression vectors for c-Jun and c-Fos were gifts from Paul Dobner (University of Massachusetts, Worcester) and Michael Greenberg (Harvard
Medical School, Boston, Mass.). The expression vector for A-Fos and
CMV/500 were a gift from Charles Vinson (National Cancer Institute,
Bethesda, Md.).
Forskolin was purchased from Sigma (St. Louis, Mo.) and resuspended at
a stock concentration of 1 mM in dimethyl sulfoxide (DMSO). EGF was
purchased from Gibco-BRL and resuspended at a stock concentration of 1 mg/ml in Dulbecco's phosphate-buffered saline. PD98059 was purchased
from New England Biolabs (Beverly, Mass.) and resuspended at a stock
concentration of 50 mM in DMSO. SB203580 was purchased from Calbiochem
(La Jolla, Calif.) and resuspended at a stock concentration of 20 mM in
DMSO. All tissue culture media were purchased from Sigma. Fetal bovine
and horse sera were purchased from Gibco-BRL. Luciferin and the
transcription and translation reticulocyte lysate kit were purchased
from Promega.
Cell culture, transient transfection, and luciferase assay.
The human choriocarcinoma cell line JEG3 was cultured in monolayers
with Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
fetal bovine serum. The rat lactotrope cell line GH3 was cultured in
monolayers with DMEM supplemented with 15% horse serum and 2.5% fetal
bovine serum. Prior to all studies, cell cultures were split to fresh
medium and cultured to approximately 50% confluence. All
transient-transfection studies were conducted as described previously
(65, 66). In transfection studies requiring agonist
administration, cells were treated with forskolin and/or EGF at the
concentrations noted for individual experiments for 6 h prior to
collection (18 h following electroporation) except in Fig. 1. In Fig.
1, transfected cells received control solution, EGF alone, forskolin
alone, or the combination of forskolin and EGF, all administered at
time zero. Time zero was designated as the starting point of a 6-h
period of agonist administration. Some cells received a 4-h
pretreatment (administered at
4 h relative to time zero) with EGF.
This was followed by administration of control solution or forskolin at
time zero. All cells in these studies were collected 6 h later.
PD98059 (50 µM) or SB203580 (20 µM) was used in some experiments
and administered to cells 15 min prior to agonist administration.
Following cell collection, lysates were prepared by three freeze-thaw
cycles and clarified by centrifugation, and luciferase activity was
determined as described before (23, 66, 67). All
transfection studies were conducted in triplicate on at least three
separate occasions with similar results. Data shown are reported as
means (n = 3) ± standard errors of the mean and were
analyzed by analysis of variance to detect treatment interactions.
Preparation of nuclear extracts and CRE pull-down assays.
JEG3 cells were serum starved for 2 h prior to preparation of
nuclear extracts. Nuclear extracts were prepared following
administration of either control solution, EGF, forskolin, or the
combination of EGF and forskolin as described for the
transient-transfection studies. Hormones were administered for a total
of 2 h. Plates were placed on an ice bed, and cells were washed
with HEPES-buffered saline (HBS; 10 mM HEPES [pH 7.4]-150 mM NaCl).
Cells were collected by scraping into ice-cold HBS and pelleted by
centrifugation (2,000 rpm for 15 min). Cells were lysed in a Dounce
homogenizer, and nuclei were isolated using the sucrose cushion method
described previously (66, 67). Nuclei were resuspended in a
buffer containing 10 mM HEPES (pH 7.4), 2.5 mM MgCl2, 3.6 mM KCl, 150 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 5 mM
benzamadine, and 0.2 mM phenylmethylsulfonyl fluoride (PMSF). This
buffer is referred to as binding buffer. Nuclear proteins were
extracted by adding additional NaCl (in binding buffer) to a final
concentration of 450 mM and incubating the extract for 30 min at 4°C
with constant rocking. Nuclear debris was removed by centrifugation,
and protein concentration was determined by the Bradford assay. Nuclear
extracts were aliquoted and stored at
80°C until later use.
CRE oligonucleotides were synthesized as described above except that
the sense strand was biotinylated at the 5' termini during
the
synthesis reaction. Equal amounts of each oligonucleotide
were
resuspended in binding buffer, heated to 100°C for 10 min,
and
allowed to cool slowly to room temperature. Streptavidin-agarose
(SA)
beads (Sigma) were washed four times in binding buffer, resuspended
in
binding buffer containing annealed CRE oligonucleotides, and
allowed to
batch bind for 1 h with constant rocking at 4°C. Bound
CRE-SA
beads were washed four times in binding buffer and resuspended
at a
final approximate CRE concentration of 2 pmol/µl of SA beads.
CRE
binding reactions were carried out in binding buffer containing
50 pmol
of bound CRE, 10 µg of sonicated salmon sperm DNA, and
100 µg of
nuclear protein in a total volume of 500 µl. Binding
reactions were
carried out for 2 h at 4°C with constant rocking.
Bound
complexes were washed six times (1 ml each) in binding buffer
and
resuspended in 75 µl of 2× sodium dodecyl sulfate (SDS) loading
buffer (100 mM Tris [pH 6.8], 4% SDS, 5% glycerol, 0.01%
bromophenol
blue). The constituents of the binding complexes were
examined
by immunoblot analysis, described below. These experiments
were
carried out with three separate nuclear extracts prepared on
separate
occasions. Results were similar with all three nuclear
extracts.
Antibodies, immunoblot analysis, and immunoprecipitation (IP)
kinase assays.
CREB antibody was generously supplied by R. A. Maurer (Oregon Health Sciences University) and used at a titer of
1:5,000 with nonfat dry milk (5%) as a blocking agent. Antibodies for
c-Jun, c-Fos, JNK1, ERK2, p38, all secondary antibodies coupled to
horseradish peroxidase, and protein A/G plus agarose were purchased
from Santa Cruz Biotechnology (Santa Cruz, Calif.).
Phosphorylation-specific extracellular signal-regulated kinase (ERK)
and p38 antibodies were purchased from New England Biolabs and used per
the manufacturer's instructions.
For studies of the effects of agonist administration on cell signaling
components, JEG3 cells were plated at approximately
50% confluence and
serum starved for 2 h prior to agonist administration.
In some
experiments, PD98059 was administered 15 min prior to
agonist
administration. Agonists were administered for the specified
times (see
individual experiments), plates were placed on ice,
and cells were
washed with ice-cold HBS. Cells were lysed in a
radio-
immunoprecipitation assay (RIPA) buffer containing 20 mM
Tris (pH 8.0),
137 mM NaCl, 10% glycerol, 1% NP-40, 0.1% SDS,
0.5% deoxycholate, 2 mM EDTA, 5 mM sodium vanadate, 5 mM benzamadine,
and 0.2 mM PMSF.
Debris from cell lysates was cleared by centrifugation,
and lysates
were suspended in an equal volume of 2× SDS loading
buffer. All
protein samples were boiled for 5 min and chilled
briefly on ice prior
to loading on gels. For Western blotting,
proteins were resolved by
SDS-polyacrylamide gel electrophoresis
(PAGE) and transferred to
polyvinylidene difluoride membranes
by electroblotting. The membranes
were blocked, and antibodies
were applied at titers specific to each
antibody (per the manufacturer).
Proteins were visualized by
chemiluminescence with reagents purchased
from NEN-DuPont (Boston,
Mass.).
Analysis of JNK activity was accomplished by IP followed by an in vitro
kinase assay. Cell lysates were prepared in RIPA buffer
as described
above. JNK antibody (0.5 µg/200 µl of cell lysate)
was added to the
cell lysate with protein A/G-agarose and mixed
by rocking for 2 h
at 4°C. Protein A/G-agarose beads containing
JNK activity were washed
twice (1 ml each) with ice-cold RIPA
buffer. Beads were then washed
twice (1 ml each) in an ice-cold
buffer containing 20 mM Tris (pH 8.0),
137 mM NaCl, 10% glycerol,
1% NP-40, 2 mM EDTA, 5 mM sodium vanadate,
5 mM benzamadine, and
0.2 mM PMSF. The beads were finally washed in 1 ml of ice-cold
kinase buffer containing 20 mM HEPES (pH 7.4), 20 mM
MgCl
2, 25
mM

-glycerol phosphate, 100 µM sodium
vanadate, 20 µM ATP, and
2 mM dithiothreitol. The beads were then
resuspended in kinase
buffer (50 µl) containing 5 µCi of
[

-
32P]ATP and approximately 1 µg of bacterially
expressed and partially
purified glutathione-
S-transferase
(GST)-ATF2 as a substrate.
Incubation of the kinase reaction mixture
was carried out for
30 min at 30°C with frequent mixing. The kinase
reaction was terminated
by the addition of 50 µl of 2× SDS loading
buffer. Samples were
boiled, resolved by SDS-PAGE, and visualized by
autoradiography.
All of the studies were repeated on at least three
separate occasions
with similar
results.
Preparation of AP-1 in reticulocyte lysates and EMSA.
Expression vectors for c-Fos and c-Jun were used in a coupled
transcription and translation synthesis reaction in reticulocyte lysates. Individual preparations were mixed and incubated at 37°C for
60 min to allow heterodimer formation. Electrophoretic mobility shift
assays (EMSAs) were conducted essentially as described before (67). Briefly, activator protein 1 (AP-1) binding activity
from reticulocyte lysates was mixed with binding buffer, 1 µg
of poly(dI-dC), and specific antisera (c-Fos, c-Jun, and Ets
antibodies; Santa Cruz Biotechnology) and maintained at room
temperature for 45 min. CRE oligonucleotides were
radiolabeled with polynucleotide kinase and [
-32P]ATP.
Labeled CRE probe (approximately 0.06 pmol) was then added and
incubated further for 30 min at room temperature. The binding reactions
were resolved on native polyacrylamide gels. The gels were dried, and
DNA-protein complexes were visualized by autoradiography.
 |
RESULTS |
Combined actions of EGF and forskolin induce synergistic
activation of the glycoprotein hormone
subunit
gene in JEG3 cells.
We initially conducted dose-response
studies with EGF and forskolin to determine the conditions for maximum
biological response to agonists, using activation of a
glycoprotein hormone
subunit-luciferase reporter as an
endpoint in JEG3 cell transfection studies. Transfections were carried
out by electroporation. The transfected cells were administered
increasing doses of EGF (0, 10, 25, 50, and 100 ng/ml) or forskolin (0, 0.1, 1, and 10 µM), and cell lysates were examined for luciferase
activity. At the dose of EGF that resulted in maximal response (50 ng/ml),
subunit reporter expression was induced 1.53 (±0.25)-fold.
At the dose of forskolin that resulted in maximal response (1 µM),
subunit reporter expression was induced 5.34 (±1.1)-fold. All
remaining studies were conducted with these doses of agonists. We
examined the effects of each agonist alone and in combination on
subunit reporter gene activity (Fig. 1).
The response to EGF and forskolin administration was consistent
with the preliminary dose-response studies, in which EGF alone induced an approximately 1.5-fold increase in
subunit promoter activity, while forskolin induced reporter gene activity approximately fivefold (Fig. 1). When both agonists were administered concurrently, the combined effects of EGF and forskolin induced
subunit reporter gene
activation approximately 8.5-fold. Analysis of variance of these data
revealed a statistically significant (P = 0.0018)
interaction between the main effects of EGF and forskolin. The combined
effects of EGF and forskolin were more than additive, representing
synergistic activation. We then examined whether concurrent
administration of both agonists was required to induce synergistic
activation of the
subunit gene. Administration of forskolin 4 h after EGF application did not result in synergistic activation of the
reporter (Fig. 1). These studies support the conclusion that
synergistic activation of the
subunit reporter requires concurrent
activation of both the EGF- and forskolin-inducible signaling cascades.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
EGF and forskolin synergistically activate the
glycoprotein hormone subunit gene. JEG3 cells were
transfected by electroporation with 500 ng of a reporter gene
containing nucleotides 846 to +42 of 5'-flanking sequences from the
human glycoprotein hormone subunit gene fused upstream
of a luciferase reporter. Approximately 18 h following
transfection, cells received control solution, EGF (50 ng/ml),
forskolin (1 µM), or the combination of EGF and forskolin (time
zero). Six hours later, cells were scraped, and lysates were prepared
by three freeze-thaw cycles and assayed for luciferase activity. Some
transfected cells received EGF 14 h following transfection
(EGF @ 4h). These cells received either control solution or
forskolin at time zero (EGF @ 4h + Forskolin). Cells were
collected 6 h following time zero. Luciferase activity is reported
as relative activity ± standard error of the mean from a single
representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
To determine the DNA sequences required for EGF-forskolin-induced
expression of the

subunit, deletion mutagenesis experiments
were
performed. We compared the effects of EGF and forskolin on
reporters
containing either nucleotides

846 to +42 or

204 to
+42 of the
5'-flanking region of the

subunit gene (Fig.
2).
The results from
transient-transfection studies revealed that
sequences upstream of

204 within the 5'-flanking region of the

subunit gene were not
required for synergistic activation by
EGF and forskolin (Fig.
2A).
Since the effect(s) of EGF appeared
to augment the effect(s) of
forskolin, likely through activation
of PKA and subsequent CREB
activation, we examined the activity
of an

subunit reporter
construct in which the CREs had been
deleted within the context of the

204 to +42 promoter region.
The results of these studies reveal that
in the absence of the
dual tandem CREs,

subunit promoter activity
was reduced by approximately
95% and the reporter was no longer
responsive to the actions of
forskolin or EGF and forskolin
(h

-204

cre luc; Fig.
2B). We examined
the possibility that the
dual tandem CREs alone were sufficient
to mediate synergistic
transcriptional activity. A single copy
of the dual tandem CREs was
cloned immediately upstream of the
prolactin minimal promoter
fused to the luciferase gene (h

CRE-Prl-Luc;
Fig.
2C). The dual
tandem CRE-luciferase reporter was clearly
sufficient to mediate
synergistic transcriptional activation consistent
with the

846 and

204

subunit promoter fragments. In the absence
of the CRE, the
prolactin minimal promoter coupled to luciferase
was essentially silent
and was not affected by the administration
of EGF and forskolin (data
not shown). The results of these studies
support the conclusion that
the

subunit CREs were required and
sufficient to mediate the
combined effects of EGF and forskolin.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Dual tandem CREs within the subunit promoter are
minimally required for synergistic transcriptional activation by EGF
and forskolin. JEG3 cells were transfected by electroporation with 500 ng of an subunit reporter containing (A) nucleotides 846 to +42
(h -880 luc) or 204 to +42 (h -204 luc) of 5'-flanking sequence
coupled to a luciferase reporter; (B) h -204luc with dual tandem CREs
deleted (h -204 cre luc); or (C) the dual tandem CREs fused
upstream of a minimal promoter from the prolactin gene coupled to a
luciferase reporter (h -CRE-Prl luc). Agonists were administered for
a 6-h period as described in the legend to Fig. 1, and luciferase
activity was assayed. Luciferase activity is reported as relative
activity ± standard error of the mean from a single
representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
Synergistic activation of the
subunit by EGF and forskolin is
cell specific.
The data presented support the conclusion that EGF-
and forskolin-induced cell signaling together are required for
synergistic activation of the
subunit gene in the JEG3 placental
cell line. We examined the possibility that the
subunit or the
CRE-Prl-luciferase reporters would be induced in a similar manner in a
heterologous cell type, since the components of EGF- and
forskolin-induced cell signaling cascades are likely ubiquitous. The
rat pituitary lactotrope cell line GH3 was an ideal heterologous cell
model, since GH3 cells are EGF responsive (76, 85) and
numerous studies of CREB activity have been carried out with this cell
model (77-79). GH3 cells were transfected with the
subunit or the CRE-Prl-luciferase reporter, and luciferase activity
was examined following administration of control solution, EGF,
forskolin, or the combination of EGF and forskolin. In GH3 cells,
neither reporter was EGF responsive. Both reporters were clearly
induced by forskolin administration to a similar magnitude as observed
in JEG3 cells (four- to sixfold) (Fig.
3). Interestingly, in GH3 cells, the
combined effect(s) of EGF and forskolin on these reporters was not
different from that of forskolin treatment alone. The GH3 cells used
for these studies were EGF responsive, based upon studies examining
changes in tyrosine phosphorylation of intracellular
proteins by immunoblot analysis (data not shown). Similar results were
observed with HeLa cells (data not shown). These studies support the
conclusion that the ability of EGF and forskolin to induce synergistic
activation of the
subunit is cell type specific.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Activation of the subunit by EGF and
forskolin is cell type specific. GH3 cells were transfected by
electroporation with 500 ng of an subunit reporter (h -880-luc;
500 ng) or the dual tandem CREs fused upstream of a minimal promoter
from the prolactin gene coupled to a luciferase reporter
(h -CRE-Prl-luc). Transfected cells were cultured for 18 h.
Agonists were administered for a 6-h period as described in the legend
to Fig. 1, and luciferase activity was assayed. Luciferase activity is
reported as relative activity ± standard error of the mean from a
single representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
EGF and forskolin administration results in potentiated ERK
activation in JEG3 cells.
One of the principal signaling pathways
induced by EGF receptor activation is the ERK cascade (45).
The magnitude and duration of EGF-induced ERK activation can vary with
cell type. In an effort to gain insight into the signaling mechanisms
involved in the synergistic induction of the
subunit gene, an
extended time course for EGF-induced ERK activation was examined (Fig.
4A). ERK activity was measured by
immunoblot analysis with a phosphorylation-specific antibody that recognizes the dual phosphorylated forms of p42 and p44
ERK. As expected, EGF induced robust ERK activation that peaked at 30 min and remained measurable for up to 4 h following treatment.
Forskolin administration did not induce any apparent activation of
the ERK pathway. Interestingly, the combined actions of EGF and
forskolin resulted in potentiated activation of the ERK cascade. The
levels of ERKs (regardless of phosphorylation) were
similar in each lane (Fig. 4A). Potentiation of ERK activation by EGF
and forskolin was also observed in an in vivo ERK activation assay in
which a Gal4-Elk1 fusion protein was expressed in combination with a
Gal4-dependent luciferase reporter (Fig. 4B) (66). These studies revealed that the level of Elk1 transcriptional activity was
increased by EGF treatment but not by forskolin administration. Consistent with biochemical studies of ERK
phosphorylation, the combined actions of EGF and
forskolin resulted in a synergistic activation of the Gal4-Elk1 fusion
protein.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Influence of EGF and forskolin on induction of
the ERK pathway in JEG3 cells. (A) JEG3 cells were plated at
approximately 60% confluence and serum starved for 2 h. Cells
were administered control solution, EGF, forskolin, or EGF plus
forskolin for 0, 0.5, 1, 2, or 4 h. Whole-cell lysates were
prepared and resolved by SDS-PAGE. Western blot analysis was conducted
with a phosphorylation-specific ERK
(p-p42ERK and p-p44ERK) antibody. The blot was
then stripped and reprobed with an ERK antibody to determine equivalent
loading of each lane (p42ERK and p44ERK). (B)
JEG3 cells were cotransfected by electroporation with a luciferase
reporter (1 µg) containing five Gal4 binding sites coupled to the E1B
minimal promoter and the luciferase coding sequence and an expression
vector for Gal4-Elk1 transactivation domain fusion (Gal4-Elk1, 1 µg).
Eighteen hours later, cells were administered control solution, EGF,
forskolin, or the combination of EGF plus forskolin. Luciferase
activity was determined 6 h later. Luciferase activity is reported
as relative activity ± standard error of the mean from a single
representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
Activation of the ERK pathway required but not sufficient for
synergistic activation of the
subunit.
Thus far, our studies
have implicated EGF-induced activation of the ERK pathway in
potentially contributing to the activation of the
subunit gene. We
sought to disrupt EGF signaling to the ERK cascade to examine the
requirement for the ERK pathway for synergistic activation of the
subunit reporter. Initial studies confirmed that pretreatment of JEG3
cells with PD98059 reduced the magnitude and duration of EGF-induced
ERK activation (Fig. 5A). In parallel
experiments, administration of PD98059 was sufficient to block the
synergistic activation of the
subunit reporter induced by
concurrent administration of EGF and forskolin (Fig. 5B).
Administration of PD98059 did not influence forskolin-induced
subunit reporter activity, suggesting that the pharmacological actions
of this MEK-1 inhibitor were specific. These studies confirm that
EGF-induced ERK activation was required for synergistic activation of
the
subunit promoter.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Blockade of the ERK cascade abolishes synergistic
activation of the subunit by EGF and forskolin. (A) JEG3 cells were
plated at approximately 60% confluence and serum starved for 2 h.
Cells were administered EGF plus forskolin (E + F) for 0, 0.5, 1, 2, or 4 h in the absence (control) or presence of PD98059 (50 µM). Whole-cell lysates were prepared and resolved by SDS-PAGE.
Western blot analysis was conducted with a
phosphorylation-specific ERK (p-p42ERK and
p-p44ERK) antibody. The blot was then stripped and reprobed
with an ERK antibody to determine equivalent loading of each lane
(p42ERK and p44ERK). (B) JEG3 cells were
transfected by electroporation with h -880-luc as described in the
legend to Fig. 1. Fifteen minutes prior to administration of agonists,
some cells received PD98059 (50 µM). Luciferase activity was
determined 6 h following agonist administration. Luciferase
activity is reported as relative activity ± standard error of the
mean from a single representative experiment (n = 3
independent electroporations per treatment). All transfection studies
were conducted on at least three separate occasions (in triplicate)
with similar results.
|
|
We next examined the possibility that activation of the ERK pathway by
overexpression of a constitutively active form of Raf
kinase (Raf-CAAX)
was sufficient (in combination with forskolin)
to mediate synergistic
activation of the

subunit. JEG3 cells
were cotransfected with the

subunit reporter and a control plasmid
or the Raf-CAAX expression
vector. The transfected cells were
cultured overnight and then
stimulated with control solution or
forskolin for a 6-h period.
Luciferase activity was then determined.
The addition of expression
vector for Raf-CAAX did not potentiate
the effects of forskolin on the

subunit reporter (Fig.
6A).
In a
control study, the same dose of Raf-CAAX expression vector
cotransfected with the Gal4-Elk1 expression vector and the
Gal4-dependent
luciferase reporter was sufficient to induce robust
activation
of the Elk1 fusion protein, demonstrating the efficacy of
the
Raf-CAAX expression vector (Fig.
6B). These studies provide
evidence
that ERK activation alone is not sufficient to mediate
synergistic
activation of the

subunit.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
ERK activation by overexpression of Raf-CAAX is not
sufficient to mediate synergistic activation of the subunit. (A)
JEG3 cells were cotransfected by electroporation with an subunit
reporter (h -880-luc; 500 ng) and 2.5 µg of control plasmid
(pcDNA3) or expression vector for Raf-CAAX, a constitutively active
form of Raf kinase. Eighteen hours later, control solution (open bars)
or forskolin (solid bars) was administered for a 6-h period as
described in the legend to Fig. 1, and luciferase activity was
determined. (B) JEG3 cells were cotransfected by electroporation with a
luciferase reporter (1 µg) containing five Gal4 binding sites coupled
to the E1B minimal promoter and the luciferase coding sequence with an
expression vector (1 µg) encoding a Gal4 DNA-binding domain-Elk1
transactivation domain fusion. Some cells were also transfected with
control plasmid (pcDNA3; 2.5 µg) or Raf-CAAX (2.5 µg). Twenty-four
hours later, cells were lysed, and luciferase activity was determined.
Luciferase activity is reported as relative activity ± standard
error of the mean from a single representative experiment (n = 3 independent electroporations per treatment). All transfection
studies were conducted on at least three separate occasions (in
triplicate) with similar results.
|
|
EGF induces the p38 MAPK and JNK pathways in JEG3 cells.
For
many tyrosine kinase and serpentine receptors, ligand-mediated
activation of multiple mitogen-activated protein kinase (MAPK) cascades
appears to be the rule rather than the exception (16, 29, 30,
69). We investigated the possibility that EGF receptor activation
resulted in activation of multiple MAPK pathways in placental cells.
EGF administration resulted in transient activation of the p38 MAPK
(Fig. 7A) and JNK (Fig.
8A) pathways. The activity of both
enzymes peaked at 30 min and was reduced greatly by 1 h following
hormone administration. The combined effects of EGF and forskolin did
not appear to potentiate activation of either the p38 MAPK or JNK
signaling pathway (Fig. 7A and 8A). Specific disruption of the p38 MAPK
cascade is possible with the pyridinyl imidazole SB203580
(17). We have recently demonstrated that administration of
SB203580 at the doses used in the present experiment was sufficient to
attenuate gonadotropin-releasing hormone/p38 MAPK-induced
c-fos reporter activity in
T3-1 cells (68). In
JEG3 cells, pretreatment with 20 µM SB203580 did not alter the
effects of EGF, forskolin, or the combined action of EGF and forskolin
on the
subunit reporter (Fig. 7B). Thus, despite the fact that EGF
receptor activation results in a marked increase in p38 MAPK activity
in JEG3 cells, these studies do not provide any evidence that p38 MAPK
is required for synergistic activation of the
subunit by EGF and
forskolin.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 7.
Influence of EGF and forskolin on activation of the p38
MAPK cascade. (A) JEG3 cells were plated at approximately 60%
confluence and serum starved for 2 h. Cells were administered
control solution, EGF, forskolin, or EGF and forskolin for 0, 0.25, 0.5, or 1 h. Whole-cell lysates were prepared and resolved by
SDS-PAGE. Western blot analysis was conducted with a
phosphorylation-specific p38 antibody
(p-p38MAPK). The blot was then stripped and reprobed with a
p38 antibody (p38MAPK) to determine equivalent loading in
each lane. (B) In separate studies, JEG3 cells were transfected by
electroporation with an subunit reporter (h -880-luc; 500 ng) and
cultured for 18 h. Fifteen minutes prior to agonist
administration, some cells received control solution (DMSO) or SB203580
(20 µM). Agonists were administered for a 6-h period as described in
the legend to Fig. 1, and luciferase activity was assayed. Luciferase
activity is reported as relative activity ± standard error of the
mean from a single representative experiment (n = 3
independent electroporations per treatment). All transfection studies
were conducted on at least three separate occasions (in triplicate)
with similar results.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
JNK cascade required for synergistic activation of the
subunit. (A) JEG3 cells were plated at approximately 60%
confluence and serum starved for 2 h. Cells were administered
control solution, EGF, forskolin, or EGF and forskolin for 0, 0.5, 1, 2, or 4 h. Whole-cell lysates were prepared, and equal amounts of
lysate were subjected to IP with a JNK antibody and protein A-agarose.
JNK activity was determined by an in vitro kinase assay with GST-ATF2
as a substrate. The kinase reaction products were resolved by SDS-PAGE
and visualized by autoradiography. (B) JEG3 cells were cotransfected by
electroporation with an subunit reporter (h -880-luc; 500 ng) and
10 µg of control plasmid (pcDNA3) or expression vector for JIP
(CMV-JIP). Eighteen hours later, agonists were administered for a 6-h
period as described in the legend to Fig. 1, and luciferase activity
was assayed. (C) JEG3 cells were cotransfected by electroporation with
a luciferase reporter (1 µg) containing five Gal4 binding sites
coupled to the E1B minimal promoter and the luciferase coding sequence
with an expression vector (1 µg) encoding a Gal4 DNA-binding
domain-Elk1 transactivation domain fusion. Some cells were also
transfected with control plasmid (pcDNA3; 12.5 µg), a constitutively
active form of Raf kinase (Raf-CAAX; 2.5 µg) plus pcDNA3 (10 µg) or
the combination of Raf-CAAX (2.5 µg) and an expression vector for
JIP-1 (CMV-JIP; 10 µg). Twenty-four hours later, cells were lysed,
and luciferase activity was determined. Luciferase activity is reported
as relative activity ± standard error of the mean from a single
representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
Specific pharmacological inhibition of the JNK signaling cascade is
problematic due to the lack of reagents that specifically
inhibit this
enzyme. Recently, JIP-1, a cytoplasmic inhibitor
of the JNK pathway,
was cloned and characterized (
24,
43).
We used
overexpression of this putative dominant negative expression
vector to
disrupt JNK signaling to determine a potential role
for this signaling
cascade in the synergistic activation of the

subunit reporter.
Transfection of the JIP-1 expression plasmid
in JEG3 cells resulted in
an 85% increase in basal

subunit reporter
activity with a minimal
effect on induction of the reporter by
forskolin (forskolin induced a
5.4-fold versus 4.7-fold induction
for control versus JIP,
respectively) (Fig.
8B). Furthermore,
overexpression of the JIP-1
expression vector attenuated the synergistic
effects of EGF and
forskolin on the

subunit reporter (EGF combined
with forskolin
induced an 8.1-fold increase for controls versus
5.0-fold induction for
JIP-overexpressing cells) (Fig.
8B). Statistical
analysis of these data
revealed no significant treatment interaction.
Similar results were
observed at lower doses of JIP expression
vector (data not shown),
suggesting that the dose used induced
maximal inhibition. The effects
of the JIP-1 expression vector
were specific, since this putative
dominant negative expression
vector did not interfere with Raf
kinase-induced activation of
the Gal4-Elk1 fusion protein (Fig.
9C). Additional studies
confirmed
that JIP overexpression did not interfere with EGF-mediated
induction
of ERK activation examined by immunoblot analysis with the
phosphorylation-specific
ERK antibody (data not shown).
These data implicate a potential
role for EGF-induced JNK activation in
the synergistic activation
of the

subunit.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 9.
EGF treatment recruits AP-1 to the CRE binding complex.
JEG3 cells were plated at approximately 60% confluence and cultured
overnight. The cells were then serum starved for 2 h and received
control solution (0.1% DMSO; lane C), EGF (50 ng/ml; lane E),
forskolin (1 µM; lane F), or the combination of agonists (lane E+F)
for a 2-h treatment period. Some cells received PD98059 (50 µM) for
15 min prior to administration of agonists. Nuclei were isolated, and
nuclear extracts were prepared. Nuclear extract (200 µg) was mixed in
a binding reaction with biotinylated CRE oligonucleotides coupled to SA
beads in a CRE pull-down experiment (see Materials and Methods). CRE
binding complexes were washed, subjected to SDS-PAGE, and probed by
Western blot analysis. (A) Control studies initially conducted for
analysis of CREB within the CRE binding complex. In some binding
reactions, SA beads were used in the absence of biotinylated CRE (lane
Mock). Some binding reactions were conducted in the absence (lane
control) or presence of a 50-fold molar excess of nonbiotinylated CRE
oligonucleotide added to the reaction mixture as a competitor (lane
Competitor). (B) Western analysis was initially conducted with CREB
antiserum followed by c-Jun and then c-Fos antiserum; the blot
was stripped between antibodies. (C) Whole-cell lysates from
JEG3 cells treated with various agonists over the time course denoted
were examined for expression of Jun and Fos oncoproteins by Western
blot analysis. (D) JEG3 cells were treated with control solution (DMSO)
or PD98059 (50 µM) for 15 min prior to administration of agonists.
Whole-cell lysates were then subjected to Western blot analysis for
c-Jun and c-Fos. All of these studies were repeated at least three
times with independently prepared nuclear extracts or whole-cell
lysates with essentially identical results.
|
|
Binding complex associated with the
subunit dual CREs is
altered by EGF and forskolin administration.
We examined the
hypothesis that the CRE binding complex contained factors that were
induced by or would facilitate the response to signaling pathways
induced by EGF. We sought to examine the components of the CRE binding
complex using a biotinylated CRE "pull-down" method followed by
immunoblot analysis (Fig. 9). Biotinylated dual tandem CRE
oligonucleotides were bound to SA beads and mixed with nuclear extracts
derived from JEG3 cells following a 2-h administration of control
solution, EGF, forskolin, or the combination of EGF and forskolin. The
CRE binding complexes were resolved by SDS-PAGE and subjected to
Western blot analysis. Initial control studies revealed that CREB was
present in a JEG3 cell nuclear extract regardless of agonist treatment
(Fig. 9A). Furthermore, nuclear extract from cells treated with EGF and
forskolin and subjected to the pull-down assay in the absence of a
biotinylated CRE failed to pull down CREB in the binding complex (Fig.
9A, Mock). Binding reactions conducted in the presence of a 50-fold molar excess of unbiotinylated CRE as a competitor showed that CRE was
effective in competing for CREB binding, suggesting that the binding
activity was specific (Fig. 9A). In the absence of agonists and after
treatment with forskolin alone, the dual tandem CRE binding complex was
predominantly composed of CREB (Fig. 9B). EGF stimulation of JEG3 cells
resulted in the recruitment of c-Jun to the CRE binding complex. The
presence of c-Jun in the CRE binding complex has been found in previous
studies (33). Surprisingly, c-Fos was also recruited to the
CRE binding complex, and the combined effects of EGF and
forskolin-stimulated signaling resulted in an approximately twofold
increase in c-Fos present in the CRE complex. In addition to c-Jun and
c-Fos, we also examined whether other members of the Jun/Fos family of
transcription factors were present in the CRE complex following EGF
and/or forskolin stimulation. Western blotting analysis in the
pull-down assay for FosB, JunB, or JunD revealed that none of these
basic leucine zipper proteins were present in the
subunit CRE
binding complex (data not shown). Additional competition studies
revealed that a 50-fold molar excess of unbiotinylated CRE was
effective at competing for c-Jun and c-Fos binding (data not shown).
These studies provide support for the specificity of the CRE pull-down
studies and clear evidence that the composition of the CRE binding
complex was altered during agonist stimulation of JEG3 cells.
In the presence of EGF and/or EGF and forskolin stimulation, the CRE
binding complex consisted minimally of CREB and AP-1
heterodimers. To determine whether EGF-induced ERK activation
was
required for the recruitment of AP-1 to the CRE binding complex,
identical nuclear extracts were prepared following treatment with
PD98059. Blockade of the ERK pathway with PD98059 resulted in
a failure
to recruit AP-1 to the CRE binding complex as accessed
by the CRE
pull-down assay (Fig.
9B). We then examined a more
extensive time
course for c-Jun and c-Fos activation following
treatment with EGF,
forskolin, and the combination of agonists
(Fig.
9C). EGF
administration was clearly the primary stimulus
for c-Jun and c-Fos
oncoprotein accumulation in JEG3 cells. Consistent
with the CRE
pull-down studies, the combined effects of EGF and
forskolin induced
elevated levels of c-Fos but not c-Jun. Pretreating
the cells with
PD98059 greatly reduced the induction of both oncoproteins
by the
combined actions of EGF and forskolin (Fig.
9D). These
studies support
the conclusion that AP-1 is recruited to the CRE
binding complex and
that EGF induction of the ERK pathway is required
for upregulation of
c-Jun and c-Fos
oncoproteins.
Dual tandem CREs are capable of binding AP-1, and AP-1 binding is
required for synergistic activation of the
subunit promoter.
The CRE pull-down studies could not specifically resolve the
possibility that the AP-1 present in the CRE binding complex was a
result of direct binding of AP-1 to the dual CREs or that AP-1 in the
CRE binding complex resulted from interaction of AP-1 with
potential coactivators independent of DNA binding. To resolve this
issue, c-Fos and c-Jun were prepared using a coupled
transcription and translation reaction in reticulocyte lysates.
c-Fos and c-Jun were mixed and incubated at 37°C to allow heterodimer
formation. AP-1 binding activity was used in an EMSA with radiolabeled
dual tandem CREs as a probe. Specific DNA-protein interactions
were visualized by autoradiography (Fig.
10A). Use of extracts from the
reticulocyte lysate alone (expressing a control luciferase plasmid) in
the EMSA reactions resulted in the formation of a nonspecific complex.
Addition of AP-1 binding activity to the EMSA resulted in the formation
of a specific DNA-protein complex (AP-1 complex). AP-1 binding to the
dual CREs was enhanced by the addition of normal rabbit serum. In
contrast, the AP-1-CRE binding complex was attenuated with the
addition of an antibody to c-Fos. Furthermore, addition of a c-Jun
antibody resulted in a pronounced "supershift" of the CRE complex.
Addition of an antibody for the DNA-binding domain of Ets1 and -2 did
not interfere with the AP-1-CRE complex, providing evidence for the
specificity of the antibodies. Addition of an unlabeled, consensus AP-1
oligonucleotide (at 50-fold molar excess) greatly reduced CRE binding
to AP-1 (competition
AP-1). Taken together, these DNA-binding studies support the hypothesis that c-Jun-c-Fos heterodimers can interact directly with the dual tandem CREs of the
subunit promoter.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 10.
Dual tandem CREs are capable of binding AP-1,
and AP-1 binding is required for synergistic activation of the subunit promoter. The oncoproteins c-Fos and c-Jun were synthesized in
a coupled transcription and translation reaction with reticulocyte
lysates. AP-1 binding activity was then used in EMSAs. (A) The dual CRE
probe was radiolabeled with polynucleotide kinase (free probe). An
apparent nonspecific binding activity was present in reticulocyte
lysates expressing a control luciferase plasmid and is indicated by an
arrow. In some binding reactions, 2 µg of normal rabbit serum (NRS),
c-Fos, c-Jun, or Ets antiserum was added to perturb potential
DNA-protein complexes. This is indicated in part by an arrow labeled
Supershift. Unlabeled consensus AP-1 oligonucleotides (3 pmol) were
added to some binding reaction mixtures at an approximately 50-fold
molar excess (competition AP-1) to disrupt CRE-AP-1 interactions. ,
binding reaction without reticulocyte lysate. (B) JEG3 cells were
cotransfected by electroporation with an subunit reporter
(h -880-luc; 500 ng) and 10 µg of control plasmid (CMV/500) or 5 or
10 µg of expression vector for A-Fos. Eighteen hours later, agonists
were administered for a 6-h period as described in the legend to Fig.
1, and luciferase activity was assayed. Luciferase activity is reported
as relative activity ± standard error of the mean from a single
representative experiment (n = 3 independent
electroporations per treatment). All transfection studies were
conducted on at least three separate occasions (in triplicate) with
similar results.
|
|
To assess the role of elevated c-Fos and c-Jun-c-Fos heterodimers on
synergistic activation of the

subunit gene, we overexpressed
a
putative dominant negative inhibitor to c-Fos (A-Fos) developed
by
David Ginty and Charles Vinson (
1). A-Fos is a fusion of
an
acidic amphipathic peptide extension onto the amino terminus
of the
basic leucine zipper region of c-Fos that disrupts c-Jun-c-Fos
DNA
binding with remarkable specificity (
1). In those studies,
A-Fos did not alter the DNA binding of CREB homodimers. The aim
of our
studies was to putatively "knock down" c-Jun-c-Fos heterodimer
binding to the

subunit CREs by overexpression of A-Fos. We
cotransfected
increasing doses of expression vector for A-Fos with the

subunit
reporter and treated transfected cells with control
solution,
EGF, forskolin, or the combination of EGF and forskolin.
Transfected
cells overexpressing the parental vector (control) and
treated
with EGF and forskolin demonstrated synergistic activation of
the

subunit reporter (Fig.
10B). Overexpression of the A-Fos
expression vector resulted in a decrease (25 to 35%) in basal
levels
of

subunit expression and a dose-dependent decrease in
synergistic
activation of the

reporter. At the highest dose
of A-Fos used, the
effects of EGF and forskolin on the

subunit
reporter were similar
to those with forskolin administered alone.
Overexpression of the A-Fos
expression vector did not disrupt
the effects of forskolin, suggesting
that the effects of A-Fos
overexpression were specific. Similar results
were obtained with
the h

-CRE-Prl-luciferase reporter (not shown).
Consistent with
the observations of others (
1), our results
suggest that A-Fos
overexpression attenuated synergistic activation of
the

subunit
reporter, presumably by disrupting AP-1 binding of
c-Jun-A-Fos
rather than c-Jun-c-Fos complexes. These studies support
the conclusion
that direct participation of AP-1 in the CRE binding
complex is
essential for synergistic activation of the

subunit
reporter
by EGF and
forskolin.
Two functional CREs are required for synergistic activation of the
subunit by EGF and forskolin.
One potential hypothesis
explaining the synergistic activation of the
subunit by EGF and
forskolin is that CREB dimers bind to one CRE while AP-1 binds to the
other CRE. This hypothesis suggests a requirement for two functional
CREs within the
subunit promoter to facilitate responses to EGF and
forskolin. In order to examine this possibility, we tested whether two
functional CREs were required for synergistic activation of the
subunit promoter. Individual CREs were replaced with NotI
restriction sites by site-directed mutagenesis. Mutant
subunit
promoter fragments (in the context of the human
luciferase
204 to
+42 promoter fragment) were cloned into a luciferase reporter and transfected into JEG3 cells (Fig. 11).
Transfected cells were administered EGF, forskolin, and the combination
of EGF and forskolin. The results of these studies provide evidence
that two functional CREs were required for synergistic activation of
the
subunit by EGF and forskolin. A significant treatment
interaction (P = 0.0038) of the main effects of EGF and
forskolin treatment was observed for the wild-type
subunit
promoter. This statistical interaction was not detected with either of
the CRE mutations. Basal expression of individual CRE mutant reporters
and response to forskolin (fold induction) were reduced 45 to 58% and
28 to 38%, respectively, compared with the results with the wild-type
subunit. The results of these studies provide evidence that two
functional CREs within the
subunit promoter were required for
maintenance of basal levels of expression, response to forskolin, and
synergistic activation by EGF and forskolin.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 11.
Two functional CREs are required for synergistic
activation of the subunit by EGF and forskolin. JEG3 cells were
transfected by electroporation with 500 ng of an subunit reporter
containing h -204 luc, h -204 luc with the 5' CRE mutated (h -204
CRE1-MUT-luc), or h -204 luc with the 3' CRE mutated (h -204
CRE2-MUT-luc). Agonists were administered for a 6-h period as described
in the legend to Fig. 1, and luciferase activity was assayed.
Luciferase activity is reported as relative activity ± standard
error of the mean from a single representative experiment (n = 3 independent electroporations per treatment). All transfection
studies were conducted on at least three separate occasions (in
triplicate) with similar results.
|
|
 |
DISCUSSION |
Studies of corpus luteum function during early pregnancy in women
reveal that one important determinant of adequate progesterone production is the rate and/or timing of the increase in CG secretion from cells of the trophoblast lineage (6, 7, 27, 42, 47).
Thus, mechanisms that contribute to maximal synthesis of CG subunits
are important determinants in the establishment of luteotropic support
and maintenance of early pregnancy. In the present studies, we describe
the novel synergistic activation of the glycoprotein
hormone
subunit gene by interaction between two key intracellular
signaling pathways, the MAPK and PKA cascades. We have used a
choriocarcinoma cell model to examine the role of EGF and the adenylate
cyclase activator forskolin in the regulation of the
subunit gene.
Cells of the trophoblast lineage express the EGF receptor, and EGF is a
critical growth peptide involved in the differentiation of trophoblasts
and the regulation of CG subunit mRNA stability and CG secretion
(8, 14, 18, 37, 55, 65). In the present studies,
subunit
reporter gene activity was only modestly increased by EGF receptor
activation. This is consistent with studies by Rao and others
(14), demonstrating that EGF receptor activation increases
the stability of
subunit mRNA in placental cells rather than
altering the rate of transcription. In contrast, EGF receptor
activation in rat placental cells (Rcho cells) results in two- to
threefold induction of an
subunit reporter gene in a
PKC/CRE/CREB-dependent mechanism (51). The differences
between studies may reflect variation in the individual cell models. In
JEG3 cells, EGF appears to play a more prominent role in
subunit
gene activation when administered concurrently with forskolin, when the
combined actions of the agonists induce synergistic activation of the
subunit gene. The effect(s) of EGF and forskolin on expression of
the
subunit gene is closely coordinated with CG secretion, since
cAMP-induced CG secretion is markedly potentiated by the addition of
EGF (63-65).
As seen in the studies of others (31, 44, 45, 60), EGF
receptor activation in JEG3 cells results in activation of all three
MAPK pathways. Of the three MAPK pathways, the combined actions of EGF
and forskolin potentiated the activation of the ERK cascade (increased
magnitude of enzyme activity for a longer duration). Potentiated ERK
activation was demonstrated by examining ERK
phosphorylation (Fig. 4A), induction of a Gal4-Elk1
fusion protein (Fig. 4B), and the c-fos proto-oncogene (Fig.
9C), which requires Elk1 in the formation of a ternary complex at the
c-fos serum response element (34, 49, 61, 73, 81,
82). Potentiated ERK activation induced by EGF and forskolin in
JEG3 cells is reminiscent of the situation in some prostate cancer cell
lines, in which the combined actions of EGF and inducers of cAMP such
as forskolin result in similar ERK potentiation (15, 62).
However, this is not the case in all cell types. Administration of
forskolin or cAMP attenuates EGF-induced ERK signaling in hepatocytes
(83), Rat-1 fibroblasts (84), and adenocarcinoma
cell lines (46). Inhibition of EGF-induced ERK signaling by
cAMP appears to occur upstream of ERK in the signaling pathway,
likely through phosphorylation of the regulatory domain
of Raf1, which reduces its affinity for Ras binding (84).
The cellular mechanism(s) leading to potentiated ERK activation
following combined stimulation with EGF and forskolin in JEG3 and other
cell types is not presently clear.
In our studies, blockade of EGF-forskolin-induced ERK activation with a
selective inhibitor (PD98059) reduced the magnitude and duration of ERK
activity and was sufficient to block synergistic transcriptional
activation of the
subunit gene. These studies provide clear
evidence that ERK activation is absolutely required for synergistic
transcriptional activation of the
subunit gene. It is reasonable to
suggest that potentiated ERK activation induced by the combined actions
of EGF and forskolin is required for regulation of the
subunit in
trophoblast cells. Prolonged or potentiated ERK activation in some cell
types leads to expression of a differentiated phenotype, such as in
neurite outgrowth in PC12 cells (50, 80). Furthermore,
prolonged ERK phosphorylation results in increased nuclear retention of activated ERK (41, 70). Thus, it is
plausible that potentiated activation of the ERK cascade in JEG3 cells
leads to prolonged nuclear retention of activated ERK, which leads to maximal expression of the
subunit gene, one marker of trophoblast differentiation.
EGF induced both the JNK and p38 MAPK cascades in JEG3 cells.
Activation of additional signaling pathways is likely critical to
synergistic activation of the
subunit, since direct activation of
the ERK cascade by Raf-CAAX overexpression was not sufficient (in
combination with forskolin) to induce transcriptional synergy. A role
for the JNK cascade was demonstrated by JIP-1 overexpression. JIP is a
putative intracellular anchoring protein that, when overexpressed, specifically retains JNK in the cytoplasmic compartment, thus restricting JNK-dependent gene activation (24). These
studies support the conclusion that the EGF-induced JNK cascade leading to c-Jun activation is presumably required for synergistic activation of the
subunit. JNK is the only known kinase that is capable of
c-Jun association, phosphorylation, and transcriptional
activation (20, 39, 53, 54). A caveat to interpreting these
studies with putative dominant negative signaling molecules is that
overexpression likely influences or shifts the stoichiometry of the
endogenous pathways, possibly leading to altered function of other
potential effector molecules. In defense of these studies,
overexpression of JIP-1 did not interfere with Raf kinase-induced
Gal4-Elk1 transcriptional activation, which, within the context of our
control studies, was ERK dependent. Furthermore, JIP-1
overexpression did not interfere with EGF-induced ERK
phosphorylation or forskolin-induced signaling to the
subunit, providing additional evidence for the specific action of
the JIP-1 expression vector. In contrast to the JNK cascade,
pharmacological blockade of the p38 MAPK pathway by administration of
SB203580 at a maximal dose (17, 68) did not alter
subunit gene activation. Thus, EGF-induced p38 MAPK likely is not
required, while the JNK cascade appears to contribute to synergistic
activation of the
subunit gene in placental cells. It is reasonable
to hypothesize that both combinatorial MAPK activation (ERK and JNK activation) and relative changes in the magnitude and duration of ERK
signaling contribute to
subunit gene expression in placental cells.
The CRE from the
subunit has been shown previously to bind CREB and
c-Jun by EMSA (25, 33, 57). Our studies extend these
findings in several ways. First, our studies confirm the presence of
CREB and c-Jun in the CRE binding complex in an immunoblot analysis to
provide evidence for the specificity of antibodies, which is not
possible in an EMSA. Second, our studies identify c-Fos as a component
of the
subunit CRE binding complex. c-Fos was not detected in CRE
binding complexes when assayed by EMSA (33), probably
because of blocked epitopes within the CRE complex. Furthermore, AP-1
binding activity prepared in vitro was capable of forming a complex
with the
subunit CREs independent of other potential binding
partners (Fig. 10A). Mutagenesis studies revealed that two functional
CREs were required for basal, forskolin-, and EGF- and
forskolin-induced activation of the
subunit gene. These studies
suggest the possibility that concurrent CREB and AP-1 dimer binding to
the
subunit promoter via dual CREs may be required for synergistic
activation of the
subunit gene. Based upon our understanding of the
growing complexity of the CRE binding complex, additional studies will
be necessary to clearly resolve this compelling issue.
The importance of c-Jun-c-Fos within the CRE binding complex is
supported by A-Fos overexpression studies. Putative knockdown of AP-1
binding by overexpression of A-Fos was effective at blocking synergistic activation of the
subunit (Fig. 11). This dominant interfering mutant has been shown previously to disrupt c-Jun-c-Fos heterodimer binding to DNA in a remarkably specific manner
(1). Our interpretation of these collective studies is that
the recruitment of AP-1 to the
subunit CREs requires ERK and JNK
catalytic activity and is essential for synergistic activation of the
subunit by EGF and forskolin. Since CREB and c-Jun can both
physically interact with CREB binding protein (CBP) (for a review, see
reference 28), it is reasonable to predict that
recruitment of CBP to the CRE binding complex may also be critical to
ERK-JNK-dependent synergistic activation of the
subunit. Recent
evidence suggests that transcriptional activation by subdomains of CBP
can be regulated by nerve growth factor in an ERK-dependent manner
(48), providing one potential mechanism for the actions of
EGF-ERK and forskolin on the
subunit.
It is interesting to note that the effect(s) of EGF- and
forskolin-induced signaling on the
subunit promoter was cell type specific. Since the PKA and MAPK cascades are likely ubiquitously expressed, we speculated that the combined effect of EGF and forskolin would induce synergistic activation of the
subunit in a
heterologous cell type. However, this was not the case. In several cell
types, including GH3 and HeLa cells, activation of the
subunit by
the combined agonists was not different from that by forskolin alone. This putative cell specificity may reflect several possibilities. From
the cell-specific effects of EGF and cAMP on the ERK pathway described
earlier, it may not be a surprise that the combined effects of these
two agonists were not sufficient to induce synergistic activation of
the
subunit in heterologous cell types. However, inhibition of
EGF-induced ERK activation by cAMP was not necessarily a causal factor
in these studies. Comparative analysis of signaling pathways downstream
of the EGF receptor revealed marked cell-specific variation in MAPK
signaling. For example, in GH3 and HeLa cells, EGF-induced ERK
activation was markedly shorter in duration than that observed in JEG3
cells. In both heterologous cell lines, EGF-induced activation of the
ERK pathway peaked at 15 min following hormone application and returned
to baseline by 1 h (M. S. Roberson, unpublished
observations). Furthermore, EGF-induced JNK activity was greatly
reduced in GH3 cells compared with EGF action on the JNK cascade in
JEG3 cells (not shown). This cell-specific response to EGF alone
(independent of forskolin treatment) may account for the
differences observed between JEG3 cells and other EGF-responsive cell
types. These studies also cannot discount the possibility that other
tissue-specific factors may be playing an important role in
placenta-specific regulation of the
subunit gene by EGF and
forskolin in JEG3 cells. Additional mutagenesis studies will be
required to identify other sequences within the promoter that are
required for synergistic regulation of the
subunit.
The present studies identify a novel mechanism for synergistic
activation of the glycoprotein
subunit gene in
placental cells. The dual tandem CREs appear to be sufficient to
mediate the effects of concurrent EGF- and forskolin-induced cell
signaling. The ERK and JNK cascades are required for this activation
via an AP-1-dependent mechanism. While EGF receptor stimulation
resulted in p38 MAPK activation, this pathway does not appear to
contribute to synergistic activation of the
subunit gene in JEG3
cells. Based upon extensive contributions from John Nilson and his
colleagues and other laboratories, there is clear evidence for the
hypothesis that discrete combinations of transcriptional regulators are
required for placenta-specific
subunit gene activation. Our studies
add further complexity to cell-specific
subunit regulation by
suggesting that combinatorial signal transduction pathways contribute
to induction of the
subunit gene in cells of the trophoblast
lineage. Furthermore, it may not be sufficient to merely identify the
signaling molecules necessary within specific signaling cascades; it
may also be necessary to examine issues of magnitude and duration of
enzyme activation that may contribute to the specificity of a given
response. The combined effects of the PKA and MAPK signaling cascades
facilitate maximal levels of
subunit gene activation through
integration of a higher-order, multifactor CRE binding complex that
reflects a changing endocrine milieu.
 |
ACKNOWLEDGMENTS |
We thank Richard A. Maurer (Oregon Health Sciences University,
Portland), Colin Clay (Colorado State University, Fort Collins), Roger
Davis (University of Massachusetts, Worcester), Linda VanAelst (Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), David Ginty (Johns
Hopkins University, Baltimore, Md.), Paul Dobner (University of
Massachusetts, Worcester), Michael Greenberg (Harvard Medical School,
Boston, Mass.), and Charles Vinson (National Cancer Institute,
Bethesda, Md.) for generously sharing valuable reagents. Special thanks
go to Jane Reusch (University of Colorado, Denver) for helpful
discussions during the course of these studies. We thank Joanne Fortune
(Cornell University, Ithaca, N.Y.) and Colin Clay (Colorado State
University, Fort Collins) for helpful criticisms during the preparation
of the manuscript.
This work was supported by a Consolidated Research Grant from the
College of Veterinary Medicine, Cornell University.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biomedical Sciences T6-008a VRT, Cornell University, Ithaca, NY 14853. Phone: (607) 253-3469. Fax: (607) 253-3851. E-mail:
msr14{at}cornell.edu.
 |
REFERENCES |
| 1.
|
Ahn, S.,
M. Olive,
S. Aggarwal,
D. Krylov,
D. D. Ginty, and C. Vinson.
1998.
A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcriptional of c-fos.
Mol. Cell. Biol.
18:967-977[Abstract/Free Full Text].
|
| 2.
|
Albanese, C.,
T. W. Kay,
N. M. Troccoli, and J. L. Jameson.
1991.
Novel cyclic adenosine 3', 5'-monophosphate response element in the human chorionic gonadotropin beta-subunit gene.
Mol. Endocrinol.
5:693-702[Abstract/Free Full Text].
|
| 3.
|
Amemiya, K.,
H. Kurachi,
H. Adachi,
K. I. Morishige,
K. Adachi,
T. Imai, and A. Miyake.
1994.
Involvement of epidermal growth factor (EGF)/EGF receptor autocrine and paracrine mechanism in human trophoblast cells: functional differentiation in vitro.
J. Endocrinol.
143:291-301[Abstract/Free Full Text].
|
| 4.
|
Andersen, B.,
G. C. Kennedy, and J. H. Nilson.
1990.
A cis-acting element located between the cAMP response elements and CCAAT box augments cell-specific expression of the glycoprotein hormone alpha subunit gene.
J. Biol. Chem.
265:21874-21880[Abstract/Free Full Text].
|
| 5.
|
Andersen, B.,
A. Milsted,
G. Kennedy, and J. H. Nilson.
1988.
Cyclic AMP and phorbol esters interact synergistically to regulate expression of the chorionic gonadotropin genes.
J. Biol. Chem.
263:15578-15583[Abstract/Free Full Text].
|
| 6.
|
Baird, D. D.,
C. R. Weinberg,
A. J. Wilcox,
D. R. McConnaughey,
P. I. Musey, and D. C. Collins.
1991.
Hormonal profiles of natural conception cycles ending in early, unrecognized pregnancy loss.
J. Clin. Endocrinol. Metab.
72:793-800[Abstract/Free Full Text].
|
| 7.
|
Baird, D. D.,
A. J. Wilcox,
C. R. Weinberg,
F. Kamel,
D. R. McConnaughey,
P. I. Musey, and D. C. Collins.
1997.
Preimplantation hormonal differences between the conception and nonconception menstrual cycles of 32 normal women.
Hum. Reprod.
12:2607-2613[Abstract/Free Full Text].
|
| 8.
|
Barnea, E. R.,
D. Feldman,
M. Kaplan, and D. W. Morrish.
1990.
The dual effect of epidermal growth factor upon human chorionic gonadotropin secretion by the first trimester placenta in vitro.
J. Clin. Endocrinol. Metab.
71:923-928[Abstract/Free Full Text].
|
| 9.
|
Barnhart, K. M., and P. L. Mellon.
1994.
The orphan nuclear receptor, steroidogenic factor-1, regulates the glycoprotein hormone alpha-subunit gene in pituitary gonadotropes.
Mol. Endocrinol.
8:878-885[Abstract/Free Full Text].
|
| 10.
|
Bokar, J. A.,
R. A. Keri,
T. A. Farmerie,
R. A. Fenstermaker,
B. Andersen,
D. L. Hamernik,
J. Yun,
T. Wagner, and J. H. Nilson.
1989.
Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression.
Mol. Cell. Biol.
9:5113-5122[Abstract/Free Full Text].
|
| 11.
|
Bokar, J. A.,
W. J. Roesler,
G. R. Vandenbark,
D. M. Kaetzel,
R. W. Hanson, and J. H. Nilson.
1988.
Characterization of the cAMP responsive elements from the genes for the alpha-subunit of glycoprotein hormones and phosphoenolpyruvate carboxykinase (GTP). Conserved features of nuclear protein binding between tissues and species.
J. Biol. Chem.
263:19740-19747[Abstract/Free Full Text].
|
| 12.
|
Budworth, P. R.,
P. G. Quinn, and J. H. Nilson.
1997.
Multiple characteristics of a pentameric regulatory array endow the human -subunit glycoprotein hormone promoter with trophoblast specificity and maximal activity.
Mol. Endocrinol.
11:1669-1680[Abstract/Free Full Text].
|
| 13.
|
Burrin, J. M., and J. L. Jameson.
1989.
Regulation of transfected glycoprotein hormone alpha-gene expression in primary pituitary cell cultures.
Mol. Endocrinol.
3:1643-1651[Abstract/Free Full Text].
|
| 14.
|
Cao, H.,
Z. M. Lei, and C. V. Rao.
1994.
Transcriptional and posttranscriptional mechanisms in epidermal growth factor regulation of human chorionic gonadotropin (hCG) subunits and hCG receptor gene expression in human choriocarcinoma cells.
Endocrinology
135:962-970[Abstract].
|
| 15.
|
Chen, T.,
R. W. Cho,
P. J. Stork, and M. J. Weber.
1999.
Elevation of cyclic adenosine 3',5'-monophosphate potentiates activation of mitogen-activated protein kinase by growth factors in LNCaP prostate cancer cells.
Cancer Res.
59:213-218[Abstract/Free Full Text].
|
| 16.
|
Cobb, M. H.
1999.
MAP kinase pathways.
Prog. Biophys. Mol. Biol.
71:479-500[CrossRef][Medline].
|
| 17.
|
Cuenda, A.,
J. Rouse,
Y. N. Doza,
R. Meier,
P. Cohen,
T. F. Gallagher,
P. R. Young, and J. C. Lee.
1995.
SB203580 is a specific inhibitor of the MAP kinase homologue which is stimulated by cellular stress and interleukin-1.
FEBS Lett.
362:229-233[CrossRef][Medline].
|
| 18.
|
Dakour, J.,
H. Li,
H. Chen, and D. W. Morrish.
1999.
EGF promotes development of a differentiated trophoblast phenotype having c-myc and junB proto-oncogene activation.
Placenta
20:119-126[Medline].
|
| 19.
|
Delegeane, A. M.,
L. H. Ferland, and P. L. Mellon.
1987.
Tissue-specific enhancer of the human glycoprotein hormone alpha-subunit gene: dependence on cyclic AMP-inducible elements.
Mol. Cell. Biol.
7:3994-4002[Abstract/Free Full Text].
|
| 20.
|
Derijard, B.,
M. Hibi,
I. H. Wu,
T. Barrett,
B. Su,
T. Deng,
M. Karin, and R. J. Davis.
1994.
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:1025-1037[CrossRef][Medline].
|
| 21.
|
Deutsch, P. J.,
J. P. Hoeffler,
J. L. Jameson, and J. F. Habener.
1988.
Cyclic AMP and phorbol ester-stimulated transcription mediated by similar DNA elements that bind distinct proteins.
Proc. Natl. Acad. Sci. USA
85:7922-7926[Abstract/Free Full Text].
|
| 22.
|
Deutsch, P. J.,
J. L. Jameson, and J. F. Habener.
1987.
Cyclic AMP responsiveness of human gonadotropin-alpha gene transcription is directed by a repeated 18-base pair enhancer. Alpha-promoter receptivity to the enhancer confers cell-preferential expression.
J. Biol. Chem.
262:12169-12174[Abstract/Free Full Text].
|
| 23.
|
deWet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737[Abstract/Free Full Text].
|
| 24.
|
Dickens, M.,
J. S. Rogers,
J. Cavanagh,
A. Raitano,
Z. Xia,
J. R. Halpern,
M. E. Greenberg,
C. L. Sawyers, and R. J. Davis.
1997.
A cytoplasmic inhibitor of the JNK signal transduction pathway.
Science
277:693-696[Abstract/Free Full Text].
|
| 25.
|
Drust, D. S.,
N. M. Troccoli, and J. L. Jameson.
1991.
Binding specificity of cyclic adenosine 3',5'-monophosphate-responsive element (CRE)-binding proteins and activating transcription factors to naturally occurring CRE sequence variants.
Mol. Endocrinol.
5:1541-1551[Abstract/Free Full Text].
|
| 26.
|
Fenstermaker, R. A.,
T. A. Farmerie,
C. M. Clay,
D. L. Hamernik, and J. H. Nilson.
1990.
Different combinations of regulatory elements may account for expression of the glycoprotein hormone alpha-subunit gene in primate and horse placenta.
Mol. Endocrinol.
4:1480-1487[Abstract/Free Full Text].
|
| 27.
|
France, J. T.,
J. Keelan,
L. Song,
H. Liddell,
A. Zanderigo, and B. Knox.
1996.
Serum concentrations of human chorionic gonadotrophin and immunoreactive inhibin in early pregnancy and recurrent miscarriage: a longitudinal study.
Aust. N.Z. J. Obstet. Gynaecol.
36:325-330[Medline].
|
| 28.
|
Goldman, P. S.,
V. K. Tran, and R. H. Goodman.
1997.
The multifunctional role of the co-activator CBP in transcriptional regulation.
Recent Prog. Horm. Res.
52:103-119.
|
| 29.
|
Gutkind, J. S.
1998.
Cell growth control by G protein-coupled receptors: from signal transduction to signal integration.
Oncogene
17:1331-1342[CrossRef][Medline].
|
| 30.
|
Gutkind, J. S.
1998.
The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase cascades.
J. Biol. Chem.
273:1839-1842[Free Full Text].
|
| 31.
|
Hashimoto, A.,
M. Kurosaki,
N. Gotoh,
M. Shibuyi, and T. Kurosaki.
1999.
Shc regulates epidermal growth factor-induced activation of the JNK signaling pathway.
J. Biol. Chem.
274:20139-20143[Abstract/Free Full Text].
|
| 32.
|
Heckert, L. L.,
K. Schultz, and J. H. Nilson.
1995.
Different composite regulatory elements direct expression of the human subunit gene to pituitary and placenta.
J. Biol. Chem.
270:26497-26504[Abstract/Free Full Text].
|
| 33.
|
Heckert, L. L.,
K. Schultz, and J. H. Nilson.
1996.
The cAMP response elements of the subunit gene bind similar proteins in trophoblasts and gonadotropes but have distinct functional sequence requirements.
J. Biol. Chem.
271:31650-31656[Abstract/Free Full Text].
|
| 34.
|
Hill, C. S., and R. Treisman.
1995.
Transcriptional regulation by extracellular signals: mechanisms and specificity.
Cell
80:199-211[CrossRef][Medline].
|
| 35.
|
Hoeffler, J. P.,
T. E. Meyer,
Y. Yun,
J. L. Jameson, and J. F. Habener.
1988.
Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA.
Science
242:1430-1433[Abstract/Free Full Text].
|
| 36.
|
Horn, F.,
J. J. Windle,
K. M. Barnhart, and P. L. Mellon.
1992.
Tissue-specific gene expression in the pituitary: the glycoprotein hormone alpha-subunit gene is regulated by a gonadotrope-specific protein.
Mol. Cell. Biol.
12:2143-2153[Abstract/Free Full Text].
|
| 37.
|
Ilekis, J., and R. Benveniste.
1985.
Effects of epidermal growth factor, phorbol myristate acetate, and arachidonic acid on choriogonadotropin secretion by cultured human choriocarcinoma cells.
Endocrinology
116:2400-2409[Abstract/Free Full Text].
|
| 38.
|
Jameson, J. L.,
C. Albanese, and J. F. Habener.
1989.
Distinct adjacent protein-binding domains in the glycoprotein hormone alpha gene interact independently with a cAMP-responsive enhancer.
J. Biol. Chem.
264:16190-16196[Abstract/Free Full Text].
|
| 39.
|
Karin, M.
1995.
The regulation of AP-1 activity by mitogen-activated protein kinases.
J. Biol. Chem.
270:16483-16486[Free Full Text].
|
| 40.
|
Kennedy, G. C.,
B. Andersen, and J. H. Nilson.
1990.
The human alpha subunit glycoprotein hormone gene utilizes a unique CCAAT binding factor.
J. Biol. Chem.
265:6279-6285[Abstract/Free Full Text].
|
| 41.
|
Khokhlatchev, A. V.,
B. Canagarajah,
J. Wilsbacher,
M. Robinson,
M. Atkinson,
E. Goldsmith, and M. H. Cobb.
1998.
Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation.
Cell
93:605-615[CrossRef][Medline].
|
| 42.
|
Kratzer, P. G., and R. N. Taylor.
1990.
Corpus luteum function in early pregnancies is primarily determined by the rate of change of human chorionic gonadotropin levels.
Am. J. Obstet. Gynecol.
163:1497-1502[Medline].
|
| 43.
|
Kumahara, E.,
T. Ebihara, and D. Steffen.
1999.
Nerve growth factor induces zif268 gene expression via MAPK-dependent and independent pathways in PC12D cells.
J. Biochem. (Tokyo)
125:541-553[Abstract/Free Full Text].
|
| 44.
|
Lange, C. A.,
J. K. Richer, and K. B. Horwitz.
1999.
Hypothesis: progesterone primes breast cancer cells for cross-talk with proliferative and antiproliferative signals.
Mol. Endocrinol.
13:829-836[Free Full Text].
|
| 45.
|
Lange, C. A.,
J. K. Richer,
T. Shen, and K. B. Horwitz.
1998.
Convergence of progesterone and epidermal growth factor signaling in breast cancer.
J. Biol. Chem.
273:31308-31316[Abstract/Free Full Text].
|
| 46.
|
Leiberman, M. D.,
P. Paty,
X. K. Li,
H. Naama,
D. Evoy, and J. M. Daly.
1996.
Elevation of intracellular cyclic adenosine monophosphate inhibits the epidermal growth factor signal transduction pathway and cellular growth in pancreatic adenocarcinoma cell lines.
Surgery
120:354-359[CrossRef][Medline].
|
| 47.
|
Liu, H. C.,
E. Pyrgiotis,
O. Davis, and Z. Rosenwaks.
1995.
Active corpus luteum function at pre-, peri- and postimplantation is essential for a viable pregnancy.
Early Pregnancy
1:281-287.
|
| 48.
|
Liu, Y.,
J. C. Chrivia, and D. S. Latchman.
1998.
Nerve growth factor up-regulates the transcriptional activity of CBP through activation of the p42/p44MAPK cascade.
J. Biol. Chem.
273:32400-32407[Abstract/Free Full Text].
|
| 49.
|
Marais, R.,
J. Wynne, and R. Treisman.
1993.
The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain.
Cell
73:381-393[CrossRef][Medline].
|
| 50.
|
Marshall, C. J.
1995.
Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation.
Cell
80:179-185[CrossRef][Medline].
|
| 51.
|
Matsumoto, K.,
T. Yamamoto,
H. Kurachi,
Y. Nishio,
T. Takeda,
H. Homma,
K. I. Morishige,
A. Miyake, and Y. Murata.
1998.
Human chorionic gonadotropin- gene is transcriptionally activated by epidermal growth factor through cAMP response element in trophoblast cells.
J. Biol. Chem.
273:7800-7806[Abstract/Free Full Text].
|
| 52.
|
Milsted, A.,
R. P. Cox, and J. H. Nilson.
1987.
Cyclic AMP regulates transcription of the genes encoding human chorionic gonadotropin with different kinetics.
DNA
6:213-219[Medline].
|
| 53.
|
Minden, A.,
A. Lin,
F. X. Claret,
A. Abo, and M. Karin.
1995.
Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs.
Cell
81:1147-1157[CrossRef][Medline].
|
| 54.
|
Minden, A.,
A. Lin,
T. Smeal,
B. Derijard,
M. Cobb,
R. Davis, and M. Karin.
1994.
c-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated protein kinases.
Mol. Cell. Biol.
14:6683-6688[Abstract/Free Full Text].
|
| 55.
|
Morrish, D. W.,
D. Bhardwaj,
L. K. Dabbagh,
H. Marusyk, and O. Siy.
1987.
Epidermal growth factor induces differentiation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta.
J. Clin. Endocrinol. Metab.
65:1282-1290[Abstract/Free Full Text].
|
| 56.
|
Nilson, J. H.,
J. A. Bokar,
C. M. Clay,
T. A. Farmerie,
R. A. Fenstermaker,
D. L. Hamernik, and R. A. Keri.
1991.
Different combinations of regulatory elements may explain why placenta-specific expression of the glycoprotein hormone alpha-subunit gene occurs only in primates and horses.
Biol. Reprod.
44:231-237[Abstract].
|
| 57.
|
Pestell, R. G.,
A. N. Hollenberg,
C. Albanese, and J. L. Jameson.
1994.
c-jun represses transcription of the human chorionic gonadotropin and genes through distinct types of CREs.
J. Biol. Chem.
269:31090-31096[Abstract/Free Full Text].
|
| 58.
|
Pierce, J. G., and T. F. Parsons.
1981.
Glycoprotein hormones: structure and function.
Annu. Rev. Biochem.
50:465-495[CrossRef][Medline].
|
| 59.
|
Pittman, R. H.,
C. M. Clay,
T. A. Farmerie, and J. H. Nilson.
1994.
Functional analysis of the placenta-specific enhancer of the human glycoprotein hormone alpha subunit gene. Emergence of a new element.
J. Biol. Chem.
269:19360-19368[Abstract/Free Full Text].
|
| 60.
|
Pomerance, M.,
M. C. Multon,
F. Parker,
C. Venot,
J. P. Blondeau,
B. Tocque, and F. Schweighoffer.
1998.
Grb2 interaction with MEK-kinase 1 is involved in regulation of jun-kinase activities in response to epidermal growth factor.
J. Biol. Chem.
273:24301-24304[Abstract/Free Full Text].
|
| 61.
|
Price, M. A.,
A. E. Rogers, and R. Treisman.
1995.
Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET).
EMBO J.
14:2589-2601[Medline].
|
| 62.
|
Putz, T.,
Z. Culig,
I. E. Eder,
C. Nessler-Menardi,
G. Bartsch,
H. Grunicke,
F. Uberall, and H. Klocker.
1999.
Epidermal growth factor (EGF) receptor blockade inhibits the action of EGF, insulin-like growth factor I, and a protein kinase A activator on the mitogen-activated protein kinase pathway in prostate cancer cell lines.
Cancer Res.
59:227-233[Abstract/Free Full Text].
|
| 63.
|
Ritvos, O.,
R. Butzow,
J. Jalkanen,
U. H. Stenman,
I. Huhtaniemi, and T. Ranta.
1988.
Differential regulation of hCG and progesterone secretion by cholera toxin and phorbol ester in human cytotrophoblasts.
Mol. Cell. Endocrinol.
56:165-169[CrossRef][Medline].
|
| 64.
|
Ritvos, O.,
J. Jalkanen,
I. Huhtaniemi,
U. H. Stenman,
H. Alfthan, and T. Ranta.
1987.
12-O-Tetradecanoyl phorbol-13-acetate potentiates adenosine 3',5'-monophosphate-mediated chorionic gonadotropin secretion by culture human choriocarcinoma cells.
Endocrinology
120:1521-1526[Abstract/Free Full Text].
|
| 65.
|
Ritvos, O.,
J. Jalkanen,
F. Pekonen,
U. H. Stenman, and T. Ranta.
1988.
Epidermal growth factor but not insulin-like growth factor-I potentiates adenosine 3',5'-monophosphate-mediated chorionic gonadotropin secretion by cultured human choriocarcinoma cells.
Endocrinology
123:859-865[Abstract/Free Full Text].
|
| 66.
|
Roberson, M. S.,
A. Misra-Press,
M. E. Laurance,
P. J. Stork, and R. A. Maurer.
1995.
A role for mitogen-activated protein kinase in mediating activation of the glycoprotein hormone alpha-subunit promoter by gonadotropin-releasing hormone.
Mol. Cell. Biol.
15:3531-3539[Abstract].
|
| 67.
|
Roberson, M. S.,
W. E. Schoderbek,
G. Tremml, and R. A. Maurer.
1994.
Activation of the glycoprotein hormone alpha-subunit promoter by a LIM-homeodomain transcription factor.
Mol. Cell. Biol.
14:2985-2993[Abstract/Free Full Text].
|
| 68.
|
Roberson, M. S.,
T. Zhang,
H. L. Li, and J. M. Mulvaney.
1999.
Activation of p38 mitogen-activated protein kinase pathway by gonadotropin-releasing hormone.
Endocrinology
140:1310-1318[Abstract/Free Full Text].
|
| 69.
|
Robinson, M. J., and M. H. Cobb.
1997.
Mitogen-activated protein kinase pathways.
Curr. Opin. Cell Biol.
9:180-186[CrossRef][Medline].
|
| 70.
|
Robinson, M. J.,
S. A. Stippec,
E. Goldsmith,
M. A. White, and M. H. Cobb.
1998.
A constitutively active and nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell transformation.
Curr. Biol.
8:1141-1150[CrossRef][Medline].
|
| 71.
|
Schoderbek, W. E.,
K. E. Kim,
E. C. Ridgway,
P. L. Mellon, and R. A. Maurer.
1992.
Analysis of DNA sequences required for pituitary-specific expression of the glycoprotein hormone alpha-subunit gene.
Mol. Endocrinol.
6:893-903[Abstract/Free Full Text].
|
| 72.
|
Schoderbek, W. E.,
M. S. Roberson, and R. A. Maurer.
1993.
Two different DNA elements mediate gonadotropin releasing hormone effects on expression of the glycoprotein hormone alpha-subunit gene.
J. Biol. Chem.
268:3903-3910[Abstract/Free Full Text].
|
| 73.
|
Seternes, O. M.,
R. Sorensen,
B. Johansen,
T. Loennechen,
J. Aarbakke, and U. Moens.
1998.
Synergistic increase in c-fos expression by simultaneous activation of the ras/raf/map kinase- and protein kinase A signaling is mediated by the c-fos AP-1 and SRE sites.
Biochim. Biophys. Acta
1395:345-360[Medline].
|
| 74.
|
Silver, B. J.,
J. A. Bokar,
J. B. Virgin,
E. A. Vallen,
A. Milsted, and J. H. Nilson.
1987.
Cyclic AMP regulation of the human glycoprotein hormone alpha-subunit gene is mediated by an 18-base-pair element.
Proc. Natl. Acad. Sci. USA
84:2198-2202[Abstract/Free Full Text].
|
| 75.
|
Steger, D. J.,
J. H. Hecht, and P. L. Mellon.
1994.
GATA-binding proteins regulate the human gonadotropin alpha-subunit gene in the placenta and pituitary gland.
Mol. Cell. Biol.
14:5592-5602[Abstract/Free Full Text].
|
| 76.
|
Stepan, V. M.,
C. J. Dickinson,
J. del Valle,
M. Matsushima, and A. Todisco.
1999.
Cell-type specific requirement of the MAPK pathway for growth factor action of gastrin.
Am. J. Physiol.
276:G1363-G1372[Abstract/Free Full Text].
|
| 77.
|
Sun, P.,
H. Enslen,
P. S. Myung, and R. A. Maurer.
1994.
Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity.
Genes Dev.
8:2527-2539[Abstract/Free Full Text].
|
| 78.
|
Sun, P., and R. A. Maurer.
1995.
An inactivating point mutation demonstrates that interaction of cAMP response element binding protein (CREB) with the CREB binding protein is not sufficient for transcriptional activation.
J. Biol. Chem.
270:7041-7044[Abstract/Free Full Text].
|
| 79.
|
Sun, P.,
W. E. Schoderbek, and R. A. Maurer.
1992.
Phosphorylation of cyclic adenosine 3',5'-monophosphate (cAMP) response element-binding protein isoforms by the cAMP-dependent protein kinase.
Mol. Endocrinol.
6:1858-1866[Abstract/Free Full Text].
|
| 80.
|
Traverse, S.,
N. Gomez,
H. Paterson,
C. Marshall, and P. Cohen.
1992.
Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells. Comparison of the effects of nerve growth factor and epidermal growth factor.
Biochem. J.
288:351-355.
|
| 81.
|
Treisman, R.
1992.
The serum response element.
Trends Biochem. Sci.
17:423-426[CrossRef][Medline].
|
| 82.
|
Treisman, R.
1994.
Ternary complex factors: growth factor regulated transcriptional activators.
Curr. Opin. Genet. Dev.
4:96-101[CrossRef][Medline].
|
| 83.
|
Ulrich, R. G.,
C. T. Cramer,
L. A. Adams, and R. F. Kletzein.
1998.
Activation and glucagon regulation of mitogen-activated protein kinases (MAPK) by insulin and epidermal growth factor in cultured rat and human hepatocytes.
Cell. Biochem. Funct.
16:77-85[CrossRef][Medline].
|
| 84.
|
Wu, J.,
P. Dent,
T. Jelinek,
A. Wolfman,
M. J. Weber, and T. W. Sturgill.
1993.
Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'-monophosphate.
Science
262:1065-1069[Abstract/Free Full Text].
|
| 85.
|
Yoshinaga, N.,
T. Murayama, and Y. Nomura.
1998.
Death by a dopaminergic neurotoxin, 1-methyl-4-phenylpyridinium ion (MPP+) and protection by EGF in GH3 cells.
Brain Res.
794:137-142[CrossRef][Medline].
|
Molecular and Cellular Biology, May 2000, p. 3331-3344, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Xie, J., Roberson, M. S.
(2008). 3', 5'-Cyclic Adenosine 5'-Monophosphate Response Element-Dependent Transcriptional Regulation of the Secretogranin II Gene Promoter Depends on Gonadotropin-Releasing Hormone-Induced Mitogen-Activated Protein Kinase Activation and the Transactivator Activating Transcription Factor 3. Endocrinology
149: 783-792
[Abstract]
[Full Text]
-
Canettieri, G., Franchi, A., Guardia, M. D., Morantte, I., Santaguida, M. G., Harney, J. W., Larsen, P. R., Centanni, M.
(2008). Activation of Thyroid Hormone Is Transcriptionally Regulated by Epidermal Growth Factor in Human Placenta-Derived JEG3 Cells. Endocrinology
149: 695-702
[Abstract]
[Full Text]
-
Haisenleder, D. J., Burger, L. L., Walsh, H. E., Stevens, J., Aylor, K. W., Shupnik, M. A., Marshall, J. C.
(2008). Pulsatile Gonadotropin-Releasing Hormone Stimulation of Gonadotropin Subunit Transcription in Rat Pituitaries: Evidence for the Involvement of Jun N-Terminal Kinase But Not p38. Endocrinology
149: 139-145
[Abstract]
[Full Text]
-
Berghorn, K. A., Clark-Campbell, P. A., Han, L., McGrattan, M., Weiss, R. S., Roberson, M. S.
(2006). Smad6 Represses Dlx3 Transcriptional Activity through Inhibition of DNA Binding. J. Biol. Chem.
281: 20357-20367
[Abstract]
[Full Text]
-
Ediger, T.L., Schulte, N.A., Murphy, T.J., Toews, M.L.
(2003). Transcription factor activation and mitogenic synergism in airway smooth muscle cells. Eur Respir J
21: 759-769
[Abstract]
[Full Text]
-
Ghosh, D., Ezashi, T., Ostrowski, M. C., Roberts, R. M.
(2003). A Central Role for Ets-2 in the Transcriptional Regulation and Cyclic Adenosine 5'-Monophosphate Responsiveness of the Human Chorionic Gonadotropin-{beta} Subunit Gene. Mol. Endocrinol.
17: 11-26
[Abstract]
[Full Text]
-
Lorita, J., Escalona, N., Faraudo, S., Soley, M., Ramirez, I.
(2002). Effects of epidermal growth factor on epinephrine-stimulated heart function in rodents. Am. J. Physiol. Heart Circ. Physiol.
283: H1887-H1895
[Abstract]
[Full Text]
-
Thway, T. M., Wolfe, M. W.
(2002). An Activator Protein-1 Complex Mediates Epidermal Growth Factor Regulation of Equine Glycoprotein {alpha} Subunit Expression in Trophoblast Cells. Biol. Reprod.
67: 972-980
[Abstract]
[Full Text]
-
Zhang, T., Wolfe, M. W., Roberson, M. S.
(2001). An Early Growth Response Protein (Egr) 1 cis-Element Is Required for Gonadotropin-releasing Hormone-induced Mitogen-activated Protein Kinase Phosphatase 2 Gene Expression. J. Biol. Chem.
276: 45604-45613
[Abstract]
[Full Text]
-
Tarrade, A., Schoonjans, K., Guibourdenche, J., Bidart, J. M., Vidaud, M., Auwerx, J., Rochette-Egly, C., Evain-Brion, D.
(2001). PPAR{gamma}/RXR{alpha} Heterodimers Are Involved in Human CG{beta} Synthesis and Human Trophoblast Differentiation. Endocrinology
142: 4504-4514
[Abstract]
[Full Text]
-
Garcia, A., Alvarez, C. V., Smith, R. G., Dieguez, C.
(2001). Regulation of PIT-1 Expression By Ghrelin and GHRP-6 Through the GH Secretagogue Receptor. Mol. Endocrinol.
15: 1484-1495
[Abstract]
[Full Text]
-
Roberson, M. S., Meermann, S., Morasso, M. I., Mulvaney-Musa, J. M., Zhang, T.
(2001). A Role for the Homeobox Protein Distal-less 3 in the Activation of the Glycoprotein Hormone alpha Subunit Gene in Choriocarcinoma Cells. J. Biol. Chem.
276: 10016-10024
[Abstract]
[Full Text]