Previous Article | Next Article 
Molecular and Cellular Biology, May 2000, p. 3345-3354, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
TLS-ERG Leukemia Fusion Protein Inhibits RNA
Splicing Mediated by Serine-Arginine Proteins
Liu
Yang,1,2
Lisa J.
Embree,1,2 and
Dennis D.
Hickstein1,2,3,*
Medical Research Service, VA Puget Sound
Health Care System, Seattle, Washington 98108,1
and Divisions of Oncology2 and
Molecular Medicine,3 University of
Washington School of Medicine, Seattle, Washington 98195
Received 25 October 1999/Returned for modification 1 December
1999/Accepted 16 February 2000
 |
ABSTRACT |
The translocation liposarcoma (TLS) gene is fused to
the ETS-related gene (ERG) in human myeloid leukemia,
resulting in the generation of a TLS-ERG protein. We demonstrate that
both TLS and the TLS-ERG leukemia fusion protein bind to RNA polymerase II through the TLS N-terminal domain, which is retained in the fusion
protein; however, TLS recruits members of the serine-arginine (SR)
family of splicing factors through its C-terminal domain, whereas the
TLS-ERG fusion protein lacks the ability to recruit SR proteins due to
replacement of the C-terminal domain by the fusion partner ERG. In
transient-transfection assays, the TLS-ERG fusion protein inhibits E1A
pre-mRNA splicing mediated by these TLS-associated SR proteins (TASR),
and stable expression of the TLS-ERG fusion protein in K562 cells
alters the splicing profile of CD44 mRNA. These results suggest that
TLS fusion proteins may lead to cellular abnormalities by interfering
with the splicing of important cellular regulators.
 |
INTRODUCTION |
The TLS (also called
FUS) gene was originally identified at the site of the
t(12;16) chromosomal translocation in malignant liposarcomas, where it
is fused to the CHOP (c/EBP homologous protein) gene
(12, 36). In human myeloid leukemias with the t(16;21)
chromosomal translocation, the TLS gene is fused to the ERG (ETS-related gene) gene (23). In both
instances, the resultant TLS-CHOP and TLS-ERG fusion proteins generated
by these translocations retain the N-terminal domain of TLS; however,
in both fusion proteins the C-terminal domain of TLS is replaced by the
DNA-binding domain from the corresponding transcription factor. The
oncogenic potentials of both the TLS-CHOP and the TLS-ERG fusion
proteins have been confirmed in transformation assays using mouse cell
lines (24, 51) and normal human hematopoietic cells
(32), respectively.
The role of TLS in normal cellular function and the mechanisms whereby
TLS fusion proteins lead to transformation remain unclear. TLS belongs
to a family of closely related proteins, including Ewing's sarcoma
protein, EWS (13), and TATA-binding protein-associated factor, TAFII68 (3). Both EWS and
TAFII68 interact with components of the RNA polymerase II
(Pol II) complex (3, 4, 34), thus implicating TLS in
transcriptional activation. The N-terminal domains of the TLS family of
proteins are rich in glutamine, serine, and tyrosine, which are amino
acid residues commonly found in transcriptional activation domains.
Since TLS fusion proteins acquire their C-terminal region from the
DNA-binding domains of the corresponding transcription factors, TLS
fusion proteins are thought to lead to transformation by
transcriptional activation of target genes (33). Moreover,
TLS fusion proteins have been shown to transactivate reporter genes in
transient-transfection assays (35, 51). However, mutagenesis
studies have failed to demonstrate a correlation between the ability to
transactivate and the ability to transform (26, 28).
The lack of a correlation between transactivation and transformation
with TLS fusion proteins suggested that TLS fusion proteins might
transform cells through the disruption of important cellular processes
other than transcription. In this regard, there is considerable circumstantial evidence that TLS participates in RNA processing. The
C-terminal domain of TLS contains two sequence motifs,
ribonucleoprotein consensus sequence (RNP-CS) and
arginine-glycine-glycine repeats (RGG), which are signatures of
RNA-binding proteins (6). TLS binds to RNA and shuttles
between the nucleus and the cytoplasm (52). When
overexpressed in erythroid cells, TLS induces the preferential use of
the most distal 5' splice sites during E1A pre-mRNA splicing
(19). TLS also associates with splicing factors ribonucleoprotein (RNP) A1 (51) and SF1 (49).
In this study, we demonstrate that TLS and its fusion protein TLS-ERG
interact with RNA Pol II through the N-terminal domain of TLS, the
domain preserved in the fusion protein. However, wild-type TLS recruits
members of the serine-arginine family of splicing factors through the
C-terminal domain of TLS, and the TLS-ERG fusion protein lacks this
ability due to replacement of its C-terminal domain by the fusion
partner. In the E1A pre-mRNA splicing assay, the TLS-ERG fusion protein
interferes with E1A pre-mRNA splicing mediated by TLS-associated SR
proteins in a dominant-negative manner. These results suggest that TLS
protein functions as a docking molecule in the recruitment of SR
splicing factors and that the TLS-ERG fusion protein inhibits this
function of TLS.
 |
MATERIALS AND METHODS |
Two-hybrid screen and cDNA cloning.
A yeast
two-hybrid-screen was performed as previously described
(47), using the C-terminal domain of TLS as the bait (Fig. 1). To obtain full-length mouse TASR-2
cDNA, the TASR-2 insert identified from the yeast two-hybrid screen was
used as a probe in the hybridization screening of a Uni-ZAP phage cDNA
library derived from murine EML cells with erythroid-myeloid-lymphoid potentials (42). pBluescript phagemid containing the
full-length TASR-2 cDNA was prepared after in vivo excision from the
Uni-ZAP XR vector and was used in sequencing reactions with dye
terminators (Applied Biosystems). Human TASR-2 cDNA was obtained from
K562 leukemia cells by reverse transcription-PCR (RT-PCR) using primers designed on the basis of the mouse TASR-2 sequence.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of TLS, TLS-ERG fusion protein, and TLS
deletion mutants. Wild-type TLS and ERG proteins are shown with
distinct sequence features: QSY, glutamine-, serine-, and tyrosine-rich
domain; RGG, regions with multiple Arg-Gly-Gly repeats; RNP-CS,
ribonucleoprotein consensus sequence. TLS-NTD indicates the TLS
N-terminal domain, and TLS-CTD designates the TLS C-terminal domain
(used as a bait in the yeast two-hybrid screen).
|
|
In vitro translation.
The TNT coupled
reticulocyte lysate system (Promega) was used in the in
vitro translation of TASR-2 cDNA. The DNA template was a
pBluescript phagemid containing the full-length mouse TASR-2 cDNA along
with the empty pBluescript vector as a negative control. The
[35S]methionine-labeled protein was prepared as specified
by the manufacturer and separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12%
polyacrylamide gel.
Plasmid construction.
The cDNAs for TLS, TLS-ERG, and ERG
were cloned into the EcoRI-SmaI sites of the
pSG5-FL vector for transfection and expression of these proteins with
the Flag epitope at the N-terminal end. Plasmid pSG5-FL-TLS-NTD
contains a DNA insert corresponding to amino acids 1 to 290 of the TLS
sequence, whereas pSG5-FL-TLS-CTD contains a DNA insert corresponding
to amino acids 357 to 525 of the TLS sequence. Myc-tagged expression
plasmids pCS2-MT-TASR-1 and pCS2-MT-TASR-2 were generated by in-frame
cloning of full-length TASR cDNAs into the
EcoRI-StuI sites of pCS2-MT vector. For the in
vivo splicing assay, TASR cDNAs were inserted into the pMH vector
(Boehringer Mannheim) to generate pMH-TASR-1 and pMH-TASR-2 with the
influenza virus hemagglutinin (HA) epitope tagged at the C-terminal
ends of TASR proteins. Reporter plasmid pCS3-MT-E1A was a kind gift
from F. Moreau-Gachelin (19), and reporter plasmid pCS3-MT-E1A-9S was constructed by cloning the cDNA for the 9S E1A
splicing isoform into the EcoRI-XbaI sites of
pCS3-MT vector.
Immunoprecipitation and Western blotting.
For expression of
Flag- or Myc-tagged proteins, 10 µg of the pSG5-Flag-expression
construct and 10 µg of the pCS2-Myc-expression construct were
introduced into 3 × 106 COS-7 cells by
electroporation. At 48 h after electroporation, the cells were
lysed with 0.6 ml of lysis buffer A (10 mM Tris-HCl [pH 7.4], 2.5 mM
MgCl2, 100 mM NaCl, 0.5% Triton X-100). Prior to cell
lysis, 30 µl of D8 polyclonal rabbit anti-Flag antibody (Santa Cruz
Biotechnology), 3 µl of 9E10 monoclonal mouse anti-Myc antibody
(Sigma), or 10 µl of 8WG16 monoclonal mouse anti-RNA Pol II antibody
(Research Diagnostics, Inc.) was incubated with 30 µl of protein A/G
agarose (Santa Cruz Biotechnology) for 50 min at 4°C in 0.3 ml of
buffer A, and the antibody-protein A/G-agarose complex was then
incubated with 0.2 ml of fresh cell lysate for 20 min at 4°C with
gentle rocking. After the samples were washed with RIPA buffer four
times, 50 µl of SDS-PAGE sample buffer was added to the agarose
beads. The samples were heated at 100°C for 3 min, 20 µl of the
sample was separated by SDS-PAGE in a 10% polyacrylamide gel, and the
proteins were detected with M2 monoclonal mouse anti-Flag antibody
(Sigma) or the 9E10 monoclonal mouse anti-Myc antibody as described in
Results. Protein bands were visualized using the enhanced
chemiluminescence Western blotting analysis system (Amersham).
E1A pre-mRNA splicing assay.
For in vivo splicing of E1A
pre-mRNA, 2 µg of pCS3-MT-E1A and 2 µg of pMH-TASR plus 6 µg of
pSG5-Flag construct were mixed with 60 µl of
N-[1-(2,3-dioleoxy)propyl]-N,N,N-trimethylammonium (DOTAP; Boeringer Mannheim). The total amount of DNA for each 60-mm
dish was kept at 5 µg by the addition of the corresponding empty
vector. The DNA-DOTAP mixture was then added to two duplicate dishes
with 65% confluent HeLa cells in 4 ml of Dulbecco modified Eagle
medium containing 1% fetal bovine serum. After 7 h of incubation with the DNA-DOTAP mixture, the cells were replenished with Dulbecco modified Eagle medium containing 10% fetal bovine serum and further incubated for 40 h. The cells from one dish were then lysed with 0.25 ml of RIPA buffer for Western blot analysis, while the cells from
the other dish were used for RNA isolation with an RNeasy column
(Qiagen). Total RNA from transfected HeLa cells in each 60-mm dish was
eluted with 50 µl of H2O from the RNeasy column.
For RT-PCR amplification of various E1A isoforms, 10 µl of total HeLa
RNA was used for overnight hybridization to 10 pmol
of T7 primer. After
RT with SuperScript H

reverse transcriptase (GIBCO-BRL),
the RNA was degraded by RNase
H in a 40-µl reaction mixture. A
1.5-µl volume of the reaction
mixture was then used as the DNA
templates for PCR amplification
of various E1A splicing isoforms. The
forward primer was 5'GAGCTTGGGCGACCTCA3'
(RR67), and the
reverse primer was 5'AATACGACTCACTATAG3' (T7).
The reactions
were carried out in 50 µl containing 10 pmol of
each primer, 0.2 mM
each deoxynucleoside triphosphate, 1.5 mM
MgCl
2, 1×
Taq buffer, and 2.5 U of Platinum
Taq polymerase
(GIBCO-BRL).
PCR was performed by a 2-min incubation at 94°C followed
by 35
cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C,
with
a final extension for 7 min at 72°C. To eliminate mismatches
between
different E1A isoforms, 3 µl of 0.1 M EDTA (pH 8.0) was added
to each 50 µl of PCR products and the annealing was carried out
at
80°C for 10 h. The PCR products were then separated on a 1.5%
agarose gel, denatured with NaOH, transferred to a nylon membrane,
and
detected with a
32P-labeled E1A cDNA
probe.
For the RNase protection assay, 10 µl of the total RNA was hybridized
to 1.5 × 10
6 cpm of
32P-labeled RNA probe
antisense to the E1A genomic sequence (covering
bases 499 to 1316 of
the E1A gene). After overnight hybridization,
excessive RNA probe was
digested with a mixture of RNase A plus
RNase T
1 supplied
with the RNase protection assay system (PharMingen).
The protected
antisense E1A RNA fragments were isolated as specified
by the
manufacturer and were separated on a 6% QuickPoint precast
denaturing gel
(Novex).
CD44 splicing assay.
For the generation of retroviral
constructs that express Flag-tagged proteins, Flag-TLS, Flag-TLS-ERG,
and Flag-ERG cDNA cassettes were cloned into the
HpaI-BamHI sites of retroviral vector LXSN. The
retroviral particles were first packaged in PG13 cells and then
transduced into K562 cells. After selection with G418 at a
concentration of 1 mg/ml of medium, the G418-resistant cells were
collected for Western blotting analysis and RNA isolation.
For RT-PCR analysis of CD44 splicing, 10 µg of total RNA from K562
cells was hybridized overnight to 10 pmol of oligo(dT)
adapter primer
5'GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT3'. After
RT by
SuperScript H

reverse transcriptase, the total RNA was
degraded by RNase H
in a 40-µl reaction mixture. A 1.5-µl sample of
the RT mixture
was then used as the DNA templates for PCR amplification
of various
CD44 splicing isoforms with the Platinum
Taq DNA
polymerase. To
detect subtle changes of CD44 alternative splicing after
expression
of the Flag-TLS-ERG cassette in K562 cells, two pairs of
CD44
primers were used in the PCR. The first primer pair consisted
of
5'TCCCAGTATGACACATATTGC3' (P1) and
5'CAGCTGTCCCTGTTGTCGAA3'
(V6D), and the second primer pair
consisted of 5'GTACGTCTTCAAATACCATC3'
(V3U) and
5'CAAGATGATCAGCCATTCTGG3' (P2). PCR amplification was
performed by a 2-min incubation at 94°C followed by 35 cycles
of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, with a final
extension for 7 min at 72°C. To eliminate mismatches between
different
CD44 splicing isoforms, 3 µl of 0.1 M EDTA (pH 8.0) was
added
to each 50 µl of PCR products and the annealing was carried out
at 80°C for 10 h. The PCR products were then separated on a
1.5%
agarose gel, denatured with NaOH, transferred to a nylon
membrane,
and detected with a
32P-labeled CD44H cDNA probe
spanning constitutive exons 3, 4, 5,
16, 17, and 18 (see Fig.
7B).
 |
RESULTS |
TLS N-terminal domain mediates interactions with RNA Pol II.
The structural features of TLS, TLS-ERG, ERG, TLS-NTD (N-terminal
domain), and TLS-CTD (C-terminal domain) are shown in the schematic
(Fig. 1). The N-terminal domain of TLS is rich in glutamine, serine,
and tyrosine residues and has been suggested to function as a
transcriptional activation domain (25, 35, 51). In addition,
EWS and TAFII68, two proteins highly homologous to TLS, interact with components of the RNA Pol II complex (3, 4, 34). These observations suggested that TLS might physically interact with RNA Pol II.
To examine the potential interaction of TLS and RNA Pol II, COS-7 cells
were transfected with plasmids expressing Flag-tagged
TLS, TLS-ERG, and
ERG proteins (Fig.
2A, lanes 1 to 3).
Lysates
from the transfected cells were then immunoprecipitated with a
mouse monoclonal antibody recognizing the C-terminal heptapeptide
repeats on the largest subunit of RNA Pol II. Western blotting
analysis
showed that both Flag-TLS and Flag-TLS-ERG, but not Flag-ERG,
were
present in the immunocomplexes brought down by the anti-RNA
Pol II
antibody (lanes 4 to 6). Interestingly, more Flag-TLS-ERG
than Flag-TLS
was coimmunoprecipitated by the anti-RNA Pol II
antibody despite the
demonstration that Flag-TLS-ERG was less
abundant than Flag-TLS in the
total-cell lysates. These results
suggest that TLS-ERG leukemia fusion
protein may have a higher
affinity toward RNA Pol II than does
wild-type TLS or that TLS-ERG
may localize preferentially to the
nucleus.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
Association of TLS, TLS-ERG, and TLS-NTD with RNA Pol
II. (A) COS-7 cells were transfected with Flag-tagged TLS, TLS-ERG, or
ERG expression plasmid, and the cell lysates were probed with the M2
anti-Flag antibody to confirm protein expression (lanes 1 to 3). The
same lysates were immunoprecipitated with a mouse monoclonal 8WG16
antibody (Research Diagnostics, Inc.) recognizing the C-terminal
heptapeptide repeat on the largest subunit of RNA Pol II (lanes 4 to
6), and the immunoprecipitates were blotted with an M2 anti-Flag
antibody or a rabbit polyclonal anti-RNA Pol II antibody (Santa Cruz
Biotechnology). (B) COS-7 cells were transfected with Flag-tagged TLS
deletion constructs, and the lysates were probed with the M2 anti-Flag
antibody to confirm protein expression (lanes 7 to 9). The same lysates
were immunoprecipitated with the 8WG16 anti-RNA Pol II antibody and
blotted with an anti-Flag antibody or an anti-RNA Pol II antibody
(lanes 10 to 12). (C) HeLa cell lysate (lane 13) was immunoprecipitated
(IP) with the 8WG16 anti-RNA Pol II antibody (lane 14) or a mouse
immunoglobulin G (IgG) (lane 15) and then blotted with a rabbit
anti-TLS antibody and a rabbit anti-Pol II antibody.
|
|
To test our hypothesis that the interaction between TLS and RNA Pol II
is mediated through the N-terminal domain of TLS, two
additional
plasmids expressing the Flag-tagged N-terminal domain
of TLS
(Flag-TLS-NTD) or the Flag-tagged C-terminal domain of
TLS
(Flag-TLS-CTD) were constructed (Fig.
1A). After transfection,
both
Flag-TLS-NTD and Flag-TLS-CTD were expressed in COS-7 cells
and
migrated faster than Flag-TLS on SDS-PAGE (Fig.
2B, lanes
7 to 9).
Along with Flag-TLS, Flag-TLS-NTD was detectable in the
anti-RNA Pol II
immunocomplex (lanes 10 and 11) whereas Flag-TLS-CTD
was absent from
the immunocomplex (lane 12). These results suggested
that the
N-terminal domain of wild-type TLS protein interacts
with RNA Pol II
and that this ability is retained by the TLS-ERG
fusion
protein.
To confirm that endogenous TLS associates with endogenous RNA Pol II,
we carried out coimmunoprecipitation experiments with
the same anti-RNA
Pol II antibody using human cell lysates. In
these experiments, we used
a rabbit anti-TLS antibody (a kind
gift from F. Moreau-Gachelin) that
recognizes the TLS N-terminal
region to detect endogenous TLS. We found
that TLS is abundantly
expressed in a variety of human cell lines
including HeLa (Fig.
2C, lane 13). Endogenous TLS was also present in
the anti-Pol
II immunocomplex (lane 14) but not in the immunocomplex
with the
mouse IgG (lane 15), indicating that endogenous TLS associates
with RNA Pol
II.
TASR-2 is a serine-arginine splicing factor.
We recently
demonstrated through yeast two-hybrid screening that TLS interacts with
a well-known SR protein SC35 and a novel SR protein termed TASR-1
(47). To obtain a more complete picture of the proteins
interacting with TLS, we carried out a second yeast two-hybrid screen
of a mouse hematopoietic cDNA library using the C-terminal domain of
TLS as the bait (Fig. 1A). We isolated a cDNA encoding a second novel
TLS-associated SR protein termed TASR-2. Mouse TASR-2 cDNA (GenBank
accession number AF060490) is 2.7 kb long and encodes a protein of 262 amino acids with a calculated molecular mass of 31 kDa (Fig.
3A). The cDNA encoding human TASR-2
(GenBank accession number AF067730) was isolated from K562 cells by
RT-PCR. Mouse and human TASR-2 are identical at the amino acid level,
suggesting that TASR-2 is evolutionarily conserved. Similar to SC35 and
TASR-1, TASR-2 also has typical RNP2 and RPN1 motifs in its
N-terminal region and multiple serine-arginine repeats in its
C-terminal region (Fig. 3B) that are characteristic of prototype SR
proteins. Even though the calculated molecular mass of TASR-2 is 31 kDa, in vitro-translated TASR-2 protein migrated as a band of 37 kDa
(Fig. 3C, lane 1) when analyzed by SDS-PAGE. This discrepancy between
the calculated molecular size and that determined by SDS-PAGE is
typical of SR proteins such as SC35 and SF2/ASF (16) and
results from phosphorylation of the serine residues and perhaps regions
of alternating charge.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Amino acid sequence and characterization of TASR-2. (A)
The predicted amino acid sequence of TASR-2 protein is shown. Mouse
TASR-2 (GenBank accession number AF060490) and human TASR-2 (GenBank
accession number AF067730) are identical at the amino acid level. RNP2
and RNP1 consensus sequences are underlined. Arg-Ser or Ser-Arg
dipeptide repeats are shown in bold type. (B) Schematic comparison of
SC35, TASR-1, and TASR-2. The RNP consensus sequences are shown in gray
boxes. The RS domains are in hatched boxes. (C) In vitro translation
reaction products with pBluescript-TASR-2 as the template (lane 1) are
separated by SDS-PAGE on a 12% polyacrylamide gel along with protein
molecular markers (lane 2) and control reaction products with the
pBluescript empty vector (lane 3). The position of the TASR-2 protein
is indicated by an arrow. (D) A 2.5-µg sample of pCS3-MT-E1A reporter
plasmid was cotransfected with 2.5 µg of pCR3 empty vector (lanes 4 and 5) or with 2.5 µg of pCR3-TASR-1 (lane 6) and 2.5 µg of
pCS3-TASR-2 (lane 7) expression plasmid into HeLa cells. RT-PCR was
carried out as described in Materials and Methods, and the E1A splicing
products were confirmed by hybridization to a 32P-labeled
E1A DNA probe. Lane 4 contains control RT-PCR products from a reaction
carried out in the absence of reverse transcriptase to show the
presence of residual pCS3-MT-E1A template DNA in the total RNA.
|
|
To confirm that TASR-2 functions as a splicing factor, its effect on
the alternative splicing of an E1A reporter gene was
tested. The
alternative splicing of E1A pre-mRNA leads to the
generation of five
different splicing isoforms designated 13S,
12S, 11S, 10S, and 9S mRNA
(see Fig.
5A). For these studies of
E1A pre-mRNA splicing, HeLa cells
were transfected with the pCS3-MT-E1A
reporter containing the E1A
genomic sequence, and the alternative
splicing of the E1A pre-mRNA was
examined by RT-PCR. In HeLa cells
the dominant splicing products of E1A
pre-mRNA are 13S and 12S
isoforms (Fig.
3D, lane 5). TASR-1 promotes
multiple splice site
selections leading to 11S, 10S, and 9S isoforms
(lane 6) whereas
coexpression of TASR-2 promotes 5' splice site
selection, leading
primarily to the 9S isoform (lane 7). Due to the
presence of residual
plasmid DNA in the total RNA, the E1A genomic
sequence could be
amplified by PCR (lane
4).
The TLS C-terminal domain mediates interaction with SR
proteins.
We have previously shown through coimmunoprecipitation
that TLS interacts with SC35 and TASR-1 (47). Since the
C-terminal domain of TLS is replaced by the DNA-binding domain of ERG
in the TLS-ERG leukemia fusion protein, we investigated the interaction between TLS and TLS-ERG and the TASR-1 and TASR-2 proteins. Plasmids expressing Flag-tagged TLS, TLS-ERG, or ERG were cotransfected into
COS-7 cells with plasmids expressing Myc-tagged TASR-1 or TASR-2, and
lysates from the cotransfected cells were used for immunoprecipitation.
In immunoprecipitates brought down using an anti-Flag antibody,
Myc-TASR-1 and Myc-TASR-2 were found to associate with the wild-type
Flag-TLS (Fig. 4A,
lanes 1 and 4) but not with the Flag-TLS-ERG leukemia fusion protein or
wild-type Flag-ERG (lanes 2, 3, 5, and 6). In the reciprocal
immunoprecipitation, only Flag-TLS was coimmunoprecipitated with
Myc-TASR-1 and Myc-TASR-2 using an anti-Myc antibody (Fig. 4B,
lanes 7 and 10) whereas Flag-TLS-ERG and Flag-ERG were not
immunoprecipitated (lanes 8, 9, 11, and 12). Since Flag-TLS and
Flag-TLS-ERG differ only in their C-terminal domains, these results
suggested that the TLS C-terminal domain was responsible for
interaction with TLS-associated SR proteins. In further experiments,
the Flag-tagged TLS C-terminal domain alone was shown to
coimmunoprecipitate with both Myc-TASR-1 and Myc-TASR-2 (Fig. 4C, lanes
15 and 18) whereas the Flag-tagged TLS N-terminal domain did not
interact with either TASR protein (lanes 14 and 17).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Association of TLS-CTD with TASR proteins in COS-7
cells. (A) Plasmids expressing Myc-tagged TASR-1 (lanes 1 to 3) and
TASR-2 (lanes 4 to 6) were cotransfected into COS-7 cells with plasmids
expressing Flag-tagged TLS, TLS/ERG, or ERG. The cell lysates were
immunoprecipitated (IP) with a rabbit polyclonal D8 anti-Flag antibody
(Santa Cruz Biotechnology). The immunoprecipitates were blotted with a
mouse monoclonal M2 anti-Flag antibody (Sigma) or a mouse monoclonal
9E10 anti-Myc antibody (Sigma). (B) The reciprocal immunoprecipitation
described for panel A was carried out with the 9E10 anti-Myc antibody
using the same lysates from cells coexpressing Myc-TASR-1 (lanes 7 to
9) or Myc-TASR-2 (lanes 10 to 12), along with Flag-tagged TLS, TLS-ERG,
or ERG. (C) Plasmids expressing Myc-tagged TASR-1 (lanes 13 to 15) and TASR-2 (lanes 16 to 19) were cotransfected into
COS-7 cells with plasmids expressing Flag-tagged TLS, TLS-NTD, or
TLS-CTD. The cell lysates were immunoprecipitated with the 9E10
anti-Myc antibody, and the immunoprecipitates were separated by
SDS-PAGE on a 12% polyacrylamide gel and blotted with the anti-Flag
antibody.
|
|
The TLS-ERG leukemia fusion protein inhibits E1A pre-mRNA
splicing.
It is now increasingly recognized that gene
transcription by RNA Pol II can be coupled to RNA processing (5,
14, 15, 22, 29, 30, 38, 43, 45, 50). As transcriptional elongation by RNA Pol II is taking place, the nascent pre-mRNA is
processed by the splicing machinery associated with RNA Pol II. Because
TLS interacts with both RNA Pol II and SR splicing factors and because
TLS-ERG lacks the ability to recruit SR proteins due to the replacement
of the C-terminal domain by the fusion partner, the fusion protein
might cause alterations in RNA splicing mediated by the SR proteins.
The adenovirus E1A gene was used as a reporter gene to analyze
splicing, since the alternative splicing of E1A pre-mRNA by
SR proteins
has been well characterized (
7,
44). The five
different E1A
splicing isoforms designated 13S, 12S, 11S, 10S,
and 9S mRNA are
illustrated (Fig.
5A). The effect of TLS
or the
TLS-ERG leukemia fusion protein on TASR-mediated alternative
splicing
of adenovirus E1A pre-mRNA was tested in HeLa cells and
analyzed
by RT-PCR. In the absence of exogenous SR protein expression,
the major splicing products of E1A pre-mRNA were 13S and 12S isoforms
(Fig.
5B, lanes 1 to 3). TASR-1 overexpression resulted in an
increase
in the 11S, 10S, and 9S isoforms (lane 4), whereas TASR-2
overexpression predominantly increased the 9S isoform (lane 7).
Although coexpression of wild-type TLS did not significantly alter
TASR-mediated E1A pre-mRNA splicing (lanes 5 and 8), most probably
due
to the high levels of endogenous TLS, coexpression of TLS-ERG
resulted
in nearly complete inhibition of E1A pre-mRNA splicing
mediated by both
TASR proteins (lanes 6 and 9).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
TLS-ERG inhibition of TASR-mediated E1A pre-mRNA
splicing. (A) Diagram of individual E1A pre-mRNA splicing isoforms.
Numbers indicate individual exons, and dashed lines represent spliced
sequences. (B) Alternative splicing of exogenous E1A pre-mRNA was
analyzed by RT-PCR using RNA from HeLa cells transfected with the
pCS3-MT-E1A reporter construct plus various expression plasmids. DNA
combinations for all samples are indicated on the top. (C) In vivo
alternative splicing of E1A pre-mRNA in HeLa cells was analyzed by an
RNase protection assay. DNA combinations for all samples are indicated
at the top, positions of RNA markers are labeled at the left, protected
E1A RNA fragments are shown on the right with exons designated by
numerals in boxes, and levels of protein expression are shown at the
bottom. Since HA-tagged TASR proteins (which promote identical E1A
pre-mRNA splicing to the untagged TASR proteins) were not detectable
from total-cell lysates, they were concentrated by immunoprecipitation
(IP) with a rabbit anti-HA antibody prior to Western blotting.
|
|
To confirm that these results reflected changes in E1A pre-mRNA
splicing patterns and were not due to selective amplification
by PCR,
we used an RNase protection assay to measure the steady-state
levels of the various E1A splicing isoforms. After hybridization
to a
32P-labeled antisense E1A RNA probe followed by RNase
digestion
and gel electrophoresis, each E1A splicing product could be
identified
according to the distinct sizes of the protected RNA
fragments.
In the absence of exogenous SR protein expression,
alternative
splicing of E1A pre-mRNA in HeLa cells normally generated
13S,
12S, and 9S isoforms (Fig.
5C, lanes a to d). TASR-1
overexpression
resulted in an increase in the levels of 11S, 10S, and
9S isoforms
(lane e), whereas TASR-2 overexpression favored 5' splice
site
selection, leading primarily to the 9S isoform (lane i). Although
coexpression of Flag-TLS and Flag-ERG did not significantly alter
TASR-mediated E1A pre-mRNA splicing (lanes f, h, j, and l),
coexpression
of Flag-TLS-ERG led to a decrease in the levels of 13S and
12S
isoforms and an almost complete inhibition of the 11S, 10S, and
9S
isoforms mediated by both TASR proteins (lanes g and k). By
Western
blotting, the levels of Flag-tagged TLS, TLS-ERG, ERG
and HA-tagged
TASR proteins were shown to remain consistent in
all samples,
demonstrating that the observed inhibition of E1A
splicing was not due
to variation in transfection or decrease
in TASR expression caused by
the TLS-ERG fusion protein. Unspliced
E1A pre-mRNA was not detected by
RNase protection, consistent
with previous reports (
7,
44)
indicating that unprocessed
E1A pre-mRNA is labile under the in vivo
experimental conditions.
The SR splicing factor SC35 was not assessed
in this study, because
endogenous SC35 is abundant in HeLa cells and
overexpression of
SC35 has minimal effect on E1A pre-mRNA splicing
(
44,
47).
To rule out the possibility that the observed TLS-ERG inhibition of
TASR-mediated E1A pre-mRNA splicing was due to repression
of
transcription from the pCS3-MT-E1A reporter or preferential
destabilization of the 11S, 10S, and 9S E1A splicing isoforms,
we
constructed an additional reporter plasmid, pCS3-MT-E1A-9S,
which was
generated from the same vector as pCS3-MT-E1A but contains
a cDNA
insert corresponding to the 9S E1A splicing isoform. When
this
construct was analyzed under the same conditions, the resultant
9S E1A
mRNA levels were not decreased by coexpression of TLS-ERG
or altered by
TASR-1 or TASR-2 (data not shown). These results
indicated that TLS-ERG
did not suppress transcription from the
pCS3-MT-E1A vector or
selectively destabilize the 9S E1A splicing
isoform.
TLS deletion mutants are unable to inhibit E1A pre-mRNA
splicing.
Since the TLS N-terminal domain mediates the interaction
with RNA Pol II and the C-terminal domain binds and recruits SR
splicing factors, TLS appears to have two functionally distinct
domains. To investigate whether the TLS N-terminal or C-terminal domain alone inhibited TASR-mediated E1A pre-mRNA splicing, TLS deletion plasmids and TASR expression plasmids were cotransfected into HeLa
cells along with the pCS3-MT-E1A reporter construct and the alternative
splicing of E1A pre-mRNA was analyzed by the RNase protection assay.
The Flag-TLS-ERG leukemia fusion protein again inhibited TASR-mediated
E1A pre-mRNA splicing (Fig. 6,
lanes n and r). However, neither the Flag-tagged TLS N-terminal domain nor the C-terminal domain alone affected TASR-mediated E1A pre-mRNA splicing (lanes o, p, s, and t). These results indicated that neither TLS deletion mutant was sufficient to disrupt E1A pre-mRNA splicing mediated by TLS-associated SR proteins and that both the TLS
N-terminal domain (RNA Pol II-interaction domain) and the ERG
C-terminal domain (DNA-binding domain) were required for the TLS-ERG
leukemia fusion protein to inhibit E1A pre-mRNA splicing.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of TLS deletion mutants on TASR-mediated E1A
pre-mRNA splicing. The TLS deletion mutant containing the N-terminal or
C-terminal domain was transfected into HeLa cells, and its effect on
TASR-mediated E1A pre-mRNA splicing was examined by an RNase protection
assay. Bottom panels represent Western blots of TLS and TLS deletion
mutants as well as immunoprecipitation (IP) followed by Western
blotting to demonstrate the presence of TASR-1 and TASR-2. Labeling is
as in Fig. 5C.
|
|
Stable expression of the TLS-ERG fusion protein affects CD44
alternative splicing.
We have shown that coexpression of TLS-ERG
inhibits TASR-mediated E1A pre-mRNA splicing in transient-transfection
experiments. Since these results were obtained through overexpression
of both TLS-ERG and the E1A reporter gene, overexpression of the
TLS-ERG fusion protein might displace binding to RNA Pol II by other
splicing factors, resulting in a generic decrease in RNA splicing.
To investigate the effect of exogenous TLS-ERG on endogenous RNA
splicing when TLS-ERG is expressed at a level comparable
to the
endogenous protein, we subcloned the Flag-TLS, Flag-TLS-ERG,
and
Flag-ERG cDNA cassettes into the retroviral vector LXSN. Through
retroviral transduction, K562 cells harboring Flag-TLS, TLS-ERG,
and
ERG retroviral constructs were obtained using G418 selection.
From
these transduced K562 cells, Flag-tagged proteins were readily
detectable by Western blotting with an anti-Flag antibody (Fig.
7A, lanes 1 to 4). The protein level and
the relative ratio between
the exogenous Flag-TLS and Flag-TLS-ERG in
retrovirus-transduced
K562 cells were comparable to those between the
endogenous TLS
and TLS-ERG in YNH-1 cells (compare lanes 2 and 3 to
lane 5).
YNH-1 is a cell line from a myeloid leukemia patient with the
t(16;21) translocation that expresses the TLS-ERG fusion protein
(
46).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of TLS-ERG stable expression on CD44 splicing in
K562 cells. (A) Western blot analyses of lysates from K562 cells
harboring the empty retroviral vector LXSN (lane 1) or K562 cells
harboring the retroviral construct with Flag-TLS (lane 2), Flag-TLS-ERG
(lane 3), or Flag-ERG (lane 4) were carried out with a mouse anti-Flag
antibody. Lysate from the human YNH-1 myeloid leukemia cells (which
express endogenous TLS-ERG fusion protein) was blotted with a rabbit
anti-TLS antibody that recognizes the N-terminal region of TLS (lane
5). (B) Genomic structure of the CD44 gene. Regions of constitutive
exons and variable exons are indicated. The sizes of the exons are not
drawn to scale. Arrows designate primers used for RT-PCR amplification.
(C) Southern blot analysis of RT-PCR products for CD44 splicing
isoforms. Lanes 1 to 4 represent CD44 RT-PCR products using primer P1
and V6D. Lanes 5 to 8 represent CD44 RT-PCR products using primer 3VU
and P2. All RT-PCR products were separated on a 1.5% agarose gel and
probed with a 32P-labeled CD44 DNA probe. Arrows indicate
positions of CD44 splicing isoforms that are affected by exogenous
Flag-TLS-ERG in K562 cells.
|
|
To examine whether stable expression of the exogenous Flag-TLS-ERG
fusion protein affects the splicing of an important endogenous
RNA, we
investigated the alternative splicing profiles of CD44
mRNA in K562
cells harboring different LXSN retroviral constructs.
The
CD44 gene encodes a cell adhesion molecule consisting of 10
constitutive exons and 10 variable exons (Fig.
7B). Different
combinations of the variable exons lead to a variety of CD44 splicing
isoforms that differ in their extracellular domains. Abnormal
splicing of CD44 mRNA has been found both in solid tumors and
in
leukemia (
10), and recently it has been suggested that
stage-specific
changes in SR proteins may be linked to changes in CD44
splicing
during different stages of mammary cancer (
41).
The predominant CD44 mRNA in K562 cells is the CD44H isoform which
lacks any of the variable exons (data not shown). To detect
subtle
changes in variable-exon-containing CD44 splicing isoforms,
we used
RT-PCR and primers P1 and V6D to amplify CD44 isoforms
that contain the
variable V6 exon and primers V3U and P2 to amplify
CD44 isoforms that
contain the variable V3 exon. The amplified
CD44 products were then
separated by gel electrophoresis and probed
with a
32P-labeled CD44 DNA probe. As shown in Fig.
7C, expression
of the
Flag-TLS or Flag-ERG protein in K562 cells did not alter the
profile
of CD44 isoforms containing the V6 exon (compare lane 1 with
lanes
2 and 4) or the profile of CD44 isoforms containing the V3 exon
(compare lane 5 with lanes 6 and 8). However, expression of the
Flag-TLS-ERG fusion protein in K562 cells changed the profile
of
endogenous CD44 isoforms containing the V6 exon (compare lane
1 with
lane 3) and the V3 exon (compare lane 5 with lane
7).
 |
DISCUSSION |
These studies indicate that TLS interacts with RNA Pol II through
the N-terminal domain of TLS and interacts with members of the SR
family of splicing factors through the C-terminal domain of TLS. In
contrast, the TLS-ERG fusion protein binds RNA Pol II but is unable to
bind SR proteins, due to replacement of its C-terminal domain by the
fusion partner. The TLS-ERG fusion protein not only lacks the ability
to bridge the binding of RNA Pol II to SR proteins but also inhibits
E1A pre-mRNA splicing mediated by these SR proteins in transfected HeLa
cells. When Flag-TLS-ERG was introduced through retroviral transduction
into K562 cells and expressed at a level comparable to the endogenous
protein, it changed the splicing profile of the endogenous CD44, a cell adhesion molecule whose abnormal splicing is associated with cellular transformation and tumor metastasis (10).
RNA splicing, a critical step in gene expression, is increasingly
recognized as a cotranscriptional event (reviewed in references 31 and 40). Experimental evidence
now indicates that transcription, capping, and polyadenylation are also
intimately linked by RNA Pol II through its association with
RNA-processing factors (9, 21). Among different components
of the transcriptional machinery, the C-terminal domain of the largest
subunit of RNA Pol II complex is thought to be especially critical for
recruitment of RNA-processing factors (29, 30). Even though
a novel set of C-terminal domain associated SR-like proteins directly
interact via their C-terminal domain-interacting domains with RNA Pol
II (11, 48), prototypical SR proteins including SC35 and
ASF/SF2 lack such C-terminal domain-interacting domains. At present,
the way in which these SR proteins associate with RNA Pol II remains
unclear. Recently, a novel transcription coactivator, p52, was found to
interact specifically with ASF/SF2 and was suggested to act as an
adapter to coordinate transcription and splicing (17). Based
on our observation that TLS interacts with both RNA Pol II and SR
proteins, we propose that TLS functions as a docking molecule by
recruiting SR splicing factors to RNA Pol II, thus coupling gene
transcription with RNA splicing.
The TLS gene is ubiquitously expressed, suggesting that TLS
may be essential for cell function (1). In myeloid leukemia cells with the t(16;21) translocation and in liposarcoma cells with the
t(12;16) translocation, only one TLS allele is interrupted by
chromosomal translocation while the remaining TLS allele is intact
(12, 36, 46). This indicates that the TLS fusion protein
functions in a dominant-negative manner.
The TLS-ERG fusion protein not only inhibits TASR-mediated E1A pre-mRNA
splicing, leading to 11S, 10S, and 9S isoforms, but also decreases the
expression of the 13S and 12S E1A splicing isoforms. The generation of
13S and 12S isoforms may be mediated by additional splicing factors
present in HeLa cells, which in turn implies that the splicing pathway
via TLS potentially includes other splicing factors. Based on the
observation that expression of the TLS-ERG leukemia fusion protein,
despite the presence of endogenous TLS protein, is sufficient to
inhibit E1A pre-mRNA splicing in HeLa cells and to alter CD44 splicing
in K562 cells, the TLS-ERG fusion protein appears to function in a
dominant-negative manner to interfere with RNA splicing. Our finding
that neither the N-terminal nor the C-terminal deletion mutant of TLS
was sufficient to block TASR-mediated E1A splicing suggests that
inclusion of the ERG DNA-binding domain is required for the
dominant-negative function of the TLS-ERG leukemia fusion protein,
possibly by conferring a higher affinity of the fusion protein for RNA
Pol II and/or by localizing the fusion protein to the nucleus.
One can envisage at least two potential mechanisms whereby the TLS-ERG
fusion protein alters CD44 splicing. In the first scenario, if splicing
into a specific CD44 isoform requires docking by TLS, the TLS-ERG
fusion protein might block this pathway, leading to degradation of the
unfinished CD44 pre-mRNA. In the second scenario, if one CD44 splicing
pathway is blocked and alternative splicing pathways exist, the
inhibition of the first pathway by the TLS-ERG fusion protein might
push the splicing of CD44 pre-mRNA through alternative routes, thus
increasing the chance of aberrant splicing.
SR proteins appear to possess the capacity to alter gene expression by
influencing RNA splicing. The important regulatory roles of SR proteins
in cellular processes have been demonstrated by their functions in
Drosophila development and sex determination (2, 20,
37), their involvement in T-cell activation (39), and
their close association with cell cycle control (27). Even though transcriptional deregulation by oncogenic fusion proteins has
attracted much of the attention, aberrant RNA splicing is also
frequently detected in cancer cells and is associated with cellular
transformation (8, 18) and tumor metastasis (10). The mechanism underlying aberrant splicing has yet to be elucidated. This study links a specific chromosomal translocation, and the resultant leukemia fusion protein, to disruption of RNA splicing. Although our observation is made from cells expressing exogenous Flag-TLS-ERG fusion protein and further experiments with cancer cells
harboring TLS translocations are needed, these results suggest that TLS
fusion proteins may lead to abnormal splicing of genes critical for
cell growth and differentiation.
Ewing's sarcoma protein EWS and TATA-binding protein-associated factor
TAFII68 share sequence homology with TLS, and it is likely
that both EWS and TAFII68 also interact with SR splicing factors. The potential disruption of coupling between transcription and
RNA splicing by EWS fusion proteins especially deserves further investigation. In addition to fusion with the Fli-1 protein in 90% of
cases of Ewing's sarcoma, EWS is involved in chromosomal translocations with a variety of transcription factors including ERG,
ETV1, E1A-F, FEV, ATF-1, WT1, and TEC1 (4). In all of these
fusions involving EWS, the N-terminal domain of EWS is retained. EWS
fusion proteins may thus function in a manner analogous to the TLS
fusion proteins by interfering with the recruitment of RNA-processing
factors such as the SR proteins.
 |
ACKNOWLEDGMENTS |
We thank R. S. Morrison, M. B. Roth, and Y.-C. Yang for
helpful discussions; T. R. Bauer, Jr., S. Collins, and B. Kwiatkowski for critical reading of the manuscript; and S. L. Danner and S. M. Stray for DNA sequencing.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine/Oncology, University of Washington School of Medicine, 1660 S. Columbian Way, GMR 151, Seattle, WA 98108. Phone: (206) 764-2705. Fax:
(206) 764-2827. E-mail: dennishi{at}u.washington.edu.
 |
REFERENCES |
| 1.
|
Aman, P.,
I. Panagopoulos,
C. Lassen,
T. Fioretos,
M. Mencinger,
H. Toresson,
M. Hoglund,
A. Forster,
T. H. Rabbits,
D. Ron,
N. Mandahl, and F. Mitelman.
1996.
Expression patterns of the human sarcoma-associated genes FUS and EWS and genomic structure of FUS.
Genomics
37:1-8[CrossRef][Medline].
|
| 2.
|
Amrein, H.,
M. L. Hedley, and T. Maniatis.
1994.
The role of specific protein-RNA and protein-protein interactions in positive and negative control of pre-mRNA splicing by Transformer-2.
Cell
76:735-746[CrossRef][Medline].
|
| 3.
|
Bertolotti, A.,
Y. Lutz,
D. J. Heard,
P. Chambon, and L. Tora.
1996.
hTAFII68, a novel RNA/ss DNA-binding protein with homology to the pro-oncoprotein TLS/FUS and EWS is associated with both TFIID and RNA polymerase II.
EMBO J.
15:5022-5031[Medline].
|
| 4.
|
Bertolotti, A.,
T. Melot,
J. Acker,
M. Vigneron,
O. Delattre, and L. Tora.
1998.
EWS, but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the TET family, EWS and hTAFII68, and subunits of TFIID and RNA polymerase II complexes.
Mol. Cell. Biol.
18:1489-1497[Abstract/Free Full Text].
|
| 5.
|
Beyer, A. L., and Y. N. Osheim.
1988.
Splice site selection, rate of splicing, and alternative splicing on nascent transcripts.
Genes Dev.
2:754-765[Abstract/Free Full Text].
|
| 6.
|
Burd, C. G., and G. Dreyfuss.
1994.
Conserved structures and diversity of functions of RNA-binding proteins.
Science
265:615-621[Abstract/Free Full Text].
|
| 7.
|
Caceres, J. F.,
S. Stamm,
D. M. Helfman, and A. R. Krainer.
1994.
Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors.
Science
265:1706-1709[Abstract/Free Full Text].
|
| 8.
|
Carstens, R. P.,
J. V. Eaton,
H. R. Krigman,
P. J. Walther, and M. A. Garcia-Blanco.
1997.
Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer.
Oncogene
15:3059-3065[CrossRef][Medline].
|
| 9.
|
Cho, E. J.,
T. Takagi,
C. R. Moore, and S. Buratowski.
1997.
mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain.
Genes Dev.
11:3319-3326[Abstract/Free Full Text].
|
| 10.
|
Cooper, D. L., and G. J. Dougherty.
1995.
To metastasize or not? Selection of CD44 splice sites.
Nat. Med.
1:635-637[CrossRef][Medline].
|
| 11.
|
Corden, J. L., and M. Patturajan.
1997.
A CTD function linking transcription to splicing.
Trends Biochem. Sci.
22:413-416[CrossRef][Medline].
|
| 12.
|
Crozat, A.,
P. Aman,
N. Mandahl, and D. Ron.
1993.
Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma.
Nature
363:640-644[CrossRef][Medline].
|
| 13.
|
Delattre, O.,
J. Zucman,
B. Plougastel,
C. Desmaze,
T. Melot,
M. Peter,
H. Kovar,
I. Houbert,
P. DeJong,
G. Rouleau,
A. Aurias, and G. Thomas.
1992.
Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumors.
Nature
359:162-165[CrossRef][Medline].
|
| 14.
|
Du, L., and S. L. Warren.
1997.
A functional interaction between the carboxy-terminal domain of RNA polymerase II and pre-mRNA splicing.
J. Cell Biol.
136:5-18[Abstract/Free Full Text].
|
| 15.
|
Fakan, S.,
G. Leser, and T. E. Martin.
1986.
Immunoelectron microscope visualization of nuclear ribonucleoprotein antigens within spread transcription complexes.
J. Cell Biol.
103:1153-1157[Abstract/Free Full Text].
|
| 16.
|
Fu, X. D., and T. Maniatis.
1992.
Isolation of a complementary DNA that encodes the mammalian splicing factor SC35.
Science
256:535-538[Abstract/Free Full Text].
|
| 17.
|
Ge, H.,
Y. Si, and A. P. Wolffe.
1998.
A novel transcriptional coactivator, p52, functionally interacts with the essential splicing factor ASF/SF2.
Mol. Cell
2:751-759[CrossRef][Medline].
|
| 18.
|
Ge, K.,
J. DuHadaway,
W. Du,
M. Herlyn,
U. Rodeck, and G. C. Prendergast.
1999.
Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma.
Proc. Natl. Acad. Sci. USA
96:9689-9694[Abstract/Free Full Text].
|
| 19.
|
Hallier, M.,
A. Lerga,
S. Barnache,
A. Tavitian, and F. Moreau-Gachelin.
1998.
The transcription factor Spi-1/PU.1 interacts with the potential splicing factor TLS.
J. Biol. Chem.
273:4838-4842[Abstract/Free Full Text].
|
| 20.
|
Heinrichs, V., and B. S. Baker.
1997.
In vivo analysis of the functional domains of the Drosophila splicing regulator RBP1.
Proc. Natl. Acad. Sci. USA
94:115-120[Abstract/Free Full Text].
|
| 21.
|
Hirose, Y., and J. L. Manley.
1998.
RNA polymerase II is an essential mRNA polyadenylation factor.
Nature
395:93-96[CrossRef][Medline].
|
| 22.
|
Huang, S., and D. L. Spector.
1996.
Intron-dependent recruitment of pre-mRNA splicing factors to sites of transcription.
J. Cell Biol.
133:719-732[Abstract/Free Full Text].
|
| 23.
|
Ichikawa, H.,
K. Shimizu,
R. Katsu, and M. Ohki.
1994.
An RNA-binding protein gene, TLS/FUS, is fused to ERG in human myeloid leukemia with t(16;21) chromosomal translocation.
Cancer Res.
54:2865-2868[Abstract/Free Full Text].
|
| 24.
|
Ichikawa, H.,
K. Shimizu,
R. Katsu, and M. Ohki.
1999.
Dual transforming activities of the FUS (TLS)-ERG leukemia fusion protein conferred by two N-terminal domains of FUS (TLS).
Mol. Cell. Biol.
19:7639-7650[Abstract/Free Full Text].
|
| 25.
|
Immanuel, D.,
H. Zinszner, and D. Ron.
1995.
Association of SARFH (sarcoma-associated RNA-binding fly homolog) with regions of chromatin transcribed by RNA polymerase II.
Mol. Cell. Biol.
15:4562-4571[Abstract].
|
| 26.
|
Jaishankar, S.,
J. Zhang,
M. F. Roussel, and S. J. Baker.
1999.
Transforming activity of EWS/Fli is not strictly dependent upon DNA-binding activity.
Oncogene
18:5592-5597[CrossRef][Medline].
|
| 27.
|
Jumaa, H.,
J. L. Guenet, and P. J. Nielsen.
1997.
Regulated expression and RNA processing of transcripts from the Srp20 splicing factor gene during the cell cycle.
Mol. Cell. Biol.
17:3116-3124[Abstract].
|
| 28.
|
Lessnick, S. L.,
B. S. Braun,
C. T. Denny, and W. A. May.
1995.
Multiple domains mediate transformation by the Ewing's sarcoma EWS/FLI-1 fusion gene.
Oncogene
10:423-431[Medline].
|
| 29.
|
McCracken, S.,
N. Fong,
K. Yankulov,
S. Ballantyne,
G. Pan,
J. Greenblatt,
S. D. Patterson,
M. Wickens, and D. Bentley.
1997.
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[CrossRef][Medline].
|
| 30.
|
Mortillaro, M. J.,
B. J. Blencowe,
X. Wei,
H. Nakayasu,
L. Du,
S. L. Warren,
P. A. Sharp, and R. Berezney.
1996.
A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix.
Proc. Natl. Acad. Sci. USA
93:8253-8257[Abstract/Free Full Text].
|
| 31.
|
Neugebauer, K. M., and M. B. Roth.
1997.
Transcription units as RNA processing units.
Genes Dev.
11:3279-3285[Free Full Text].
|
| 32.
|
Pereira, D. S.,
C. Dorrell,
C. Y. Ito,
O. I. Gan,
B. Murdoch,
V. N. Rao,
J. P. Zou,
E. S. Reddy, and J. E. Dick.
1998.
Retroviral transduction of TLS-ERG initiates a leukemogenic program in normal human hematopoietic cells.
Proc. Natl. Acad. Sci. USA
95:8239-8244[Abstract/Free Full Text].
|
| 33.
|
Perrotti, D.,
S. Bonatti,
R. Trotta,
R. Martinez,
T. Skorski,
P. Salomoni,
E. Grassilli,
R. V. Lozzo,
D. R. Cooper, and B. Calabretta.
1998.
TLS/FUS, a pro-oncogene involved in multiple chromosomal translocations, is a novel regulator of BCR/ABL-mediated leukemogenesis.
EMBO J.
17:4442-4455[CrossRef][Medline].
|
| 34.
|
Petermann, R.,
B. M. Mossier,
D. NT. Aryee,
V. Khazak,
E. A. Golemis, and H. Kovar.
1998.
Oncogenic EWS-Fli1 interacts with hsRPB7, a subunit of human RNA polymerase II.
Oncogene
17:603-610[CrossRef][Medline].
|
| 35.
|
Prasad, D. D.,
M. Ouchida,
L. Lee,
V. N. Rao, and E. S. Reddy.
1994.
TLS/FUS fusion domain of TLS/FUS-erg chimeric protein resulting from the t(16;21) chromosomal translocation in human myeloid leukemia functions as a transcriptional activation domain.
Oncogene
9:3717-3729[Medline].
|
| 36.
|
Rabbitts, T. H.,
A. Forster,
R. Larson, and P. Nathan.
1993.
Fusion of the dominant negative transcription regulator CHOP with a novel gene FUS by translocation t(12;16) in malignant liposarcoma.
Nat. Genet.
4:175-180[CrossRef][Medline].
|
| 37.
|
Ring, H. Z., and J. T. Lis.
1994.
The SR protein B52/SRp55 is essential for Drosophila development.
Mol. Cell. Biol.
14:7499-7506[Abstract/Free Full Text].
|
| 38.
|
Sass, H., and T. Pederson.
1984.
Transcription-dependent localization of U1 and U2 small nuclear ribonucleoproteins at major sites of gene activity in polytene chromosomes.
J. Mol. Biol.
180:911-926[CrossRef][Medline].
|
| 39.
|
Screaton, G. R.,
J. F. Caceres,
A. Mayeda,
M. V. Bell,
M. Plebanski,
D. G. Jackson,
J. I. Bell, and A. R. Krainer.
1995.
Identification and characterization of three members of the human SR family of pre-mRNA splicing factors.
EMBO J.
14:4336-4349[Medline].
|
| 40.
|
Steinmetz, E. J.
1997.
Pre-mRNA processing and the CTD of RNA polymerase II: the tail that wags the dog?
Cell
89:491-494[CrossRef][Medline].
|
| 41.
|
Stickeler, E.,
F. Kittrell,
D. Medina, and S. M. Berget.
1999.
Stage-specific changes in SR splicing factors and alternative splicing in mammary tumorigenesis.
Oncogene
18:3574-3582[CrossRef][Medline].
|
| 42.
|
Tsai, S.,
S. Bartelmez,
E. Sitnicka, and S. Collins.
1994.
Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid development.
Genes Dev.
8:2831-2841[Abstract/Free Full Text].
|
| 43.
|
Vincent, M.,
P. Lauriault,
M.-F. Dubois,
S. Lavoie,
O. Bensaude, and B. Chabot.
1996.
The nuclear matrix protein p255 is a highly phosphorylated form of RNA polymerase II largest subunit which associates with spliceosomes.
Nucleic Acids Res.
24:4649-4652[Abstract/Free Full Text].
|
| 44.
|
Wang, J., and J. L. Manley.
1995.
Overexpression of the SR proteins ASF/SF2 and SC35 influences alternative splicing in vivo in diverse ways.
RNA
1:335-346[Abstract].
|
| 45.
|
Xing, Y.,
C. V. Johnson,
P. R. Dobner, and J. B. Lawrence.
1993.
Higher level organization of individual gene transcription and RNA splicing.
Science
259:1326-1330[Abstract/Free Full Text].
|
| 46.
|
Yamamoto, K.,
H. Hamaguchi,
K. Nagata,
M. Kobayashi,
F. Tanimoto, and M. Taniwaki.
1997.
Establishment of a novel human acute myeloblastic leukemia cell line (YNH-1) with t(16;21), t(1;16) and 12q13 translocations.
Leukemia
11:599-608[CrossRef][Medline].
|
| 47.
|
Yang, L.,
L. J. Embree,
S. Tsai, and D. D. Hickstein.
1998.
Oncoprotein TLS interacts with serine-arginine proteins involved in RNA splicing.
J. Biol. Chem.
273:27761-27764[Abstract/Free Full Text].
|
| 48.
|
Yuryev, A.,
M. Patturajan,
Y. Litingtung,
R. V. Joshi,
C. Gentile,
M. Gebara, and J. L. Corden.
1996.
The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins.
Proc. Natl. Acad. Sci. USA
93:6975-6980[Abstract/Free Full Text].
|
| 49.
|
Zhang, D.,
A. J. Paley, and G. Childs.
1998.
The transcriptional repressor ZFM1 interacts with and modulates the ability of EWS to activate transcription.
J. Biol. Chem.
273:18086-18091[Abstract/Free Full Text].
|
| 50.
|
Zhang, G.,
K. L. Taneja,
R. H. Singer, and M. R. Green.
1994.
Localization of pre-mRNA splicing in mammalian nuclei.
Nature
372:809-812[Medline].
|
| 51.
|
Zinszner, H.,
R. Albalat, and D. Ron.
1994.
A novel effector domain from the RNA-binding protein TLS or EWS is required for oncogenic transformation by CHOP.
Genes Dev.
8:2513-2526[Abstract/Free Full Text].
|
| 52.
|
Zinszner, H.,
J. Sok,
D. Immanuel,
Y. Yin, and D. Ron.
1997.
TLS (FUS) binds RNA in vivo and engages in nucleo-cytoplasmic shuttling.
J. Cell Sci.
110:1741-1750[Abstract].
|
Molecular and Cellular Biology, May 2000, p. 3345-3354, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tan, A. Y., Manley, J. L.
(2009). The TET Family of Proteins: Functions and Roles in Disease. J Mol Cell Biol
0: mjp025v1-mjp025
[Abstract]
[Full Text]
-
Fushimi, K., Ray, P., Kar, A., Wang, L., Sutherland, L. C., Wu, J. Y.
(2008). Up-regulation of the proapoptotic caspase 2 splicing isoform by a candidate tumor suppressor, RBM5. Proc. Natl. Acad. Sci. USA
105: 15708-15713
[Abstract]
[Full Text]
-
Goulet, I., Boisvenue, S., Mokas, S., Mazroui, R., Cote, J.
(2008). TDRD3, a novel Tudor domain-containing protein, localizes to cytoplasmic stress granules. Hum Mol Genet
17: 3055-3074
[Abstract]
[Full Text]
-
Pan, J., Zou, J., Wu, D. Y., Roberson, R. S., Hennings, L. J., Ma, X., Yared, M., Blackburn, M. L., Chansky, H. A., Yang, L.
(2008). TLS-ERG Leukemia Fusion Protein Deregulates Cyclin-Dependent Kinase 1 and Blocks Terminal Differentiation of Myeloid Progenitor Cells. Mol Cancer Res
6: 862-872
[Abstract]
[Full Text]
-
Law, W. J., Cann, K. L., Hicks, G. G.
(2006). TLS, EWS and TAF15: a model for transcriptional integration of gene expression. Brief Funct Genomic Proteomic
5: 8-14
[Abstract]
[Full Text]
-
Radic, M. Z., Shah, K., Zhang, W., Lu, Q., Lemke, G., Hilliard, G. M.
(2006). Heterogeneous Nuclear Ribonucleoprotein P2 Is an Autoantibody Target in Mice Deficient for Mer, Axl, and Tyro3 Receptor Tyrosine Kinases. J. Immunol.
176: 68-74
[Abstract]
[Full Text]
-
Shin, C., Kleiman, F. E., Manley, J. L.
(2005). Multiple Properties of the Splicing Repressor SRp38 Distinguish It from Typical SR Proteins. Mol. Cell. Biol.
25: 8334-8343
[Abstract]
[Full Text]
-
Zou, J., Ichikawa, H., Blackburn, M. L., Hu, H.-M., Zielinska-Kwiatkowska, A., Mei, Q., Roth, G. J., Chansky, H. A., Yang, L.
(2005). The Oncogenic TLS-ERG Fusion Protein Exerts Different Effects in Hematopoietic Cells and Fibroblasts. Mol. Cell. Biol.
25: 6235-6246
[Abstract]
[Full Text]
-
Fushimi, K., Osumi, N., Tsukahara, T.
(2005). NSSRs/TASRs/SRp38s function as splicing modulators via binding to pre-mRNAs. GENES CELLS
10: 531-541
[Abstract]
[Full Text]
-
Liu, K. J., Harland, R. M.
(2005). Inhibition of neurogenesis by SRp38, a neuroD-regulated RNA-binding protein. Development
132: 1511-1523
[Abstract]
[Full Text]
-
Kavanagh, S. J., Schulz, T. C., Davey, P., Claudianos, C., Russell, C., Rathjen, P. D.
(2005). A family of RS domain proteins with novel subcellular localization and trafficking. Nucleic Acids Res
33: 1309-1322
[Abstract]
[Full Text]
-
Iko, Y., Kodama, T. S., Kasai, N., Oyama, T., Morita, E. H., Muto, T., Okumura, M., Fujii, R., Takumi, T., Tate, S.-i., Morikawa, K.
(2004). Domain Architectures and Characterization of an RNA-binding Protein, TLS. J. Biol. Chem.
279: 44834-44840
[Abstract]
[Full Text]
-
Pio, R., Zudaire, I., Pino, I., Castano, Z., Zabalegui, N., Vicent, S., Garcia-Amigot, F., Odero, M. D., Lozano, M. D., Garcia-Foncillas, J., Calasanz, M. J., Montuenga, L. M.
(2004). {alpha}CP-4, Encoded by a Putative Tumor Suppressor Gene at 3p21, But Not Its Alternative Splice Variant {alpha}CP-4a, Is Underexpressed in Lung Cancer. Cancer Res.
64: 4171-4179
[Abstract]
[Full Text]
-
Sakashita, E., Tatsumi, S., Werner, D., Endo, H., Mayeda, A.
(2004). Human RNPS1 and Its Associated Factors: a Versatile Alternative Pre-mRNA Splicing Regulator In Vivo. Mol. Cell. Biol.
24: 1174-1187
[Abstract]
[Full Text]
-
Matsui, Y., Chansky, H. A., Barahmand-Pour, F., Zielinska-Kwiatkowska, A., Tsumaki, N., Myoui, A., Yoshikawa, H., Yang, L., Eyre, D. R.
(2003). COL11A2 Collagen Gene Transcription Is Differentially Regulated by EWS/ERG Sarcoma Fusion Protein and Wild-type ERG. J. Biol. Chem.
278: 11369-11375
[Abstract]
[Full Text]
-
Burchill, S A
(2003). Ewing's sarcoma: diagnostic, prognostic, and therapeutic implications of molecular abnormalities. J. Clin. Pathol.
56: 96-102
[Abstract]
[Full Text]
-
Martini, A., La Starza, R., Janssen, H., Bilhou-Nabera, C., Corveleyn, A., Somers, R., Aventin, A., Foa, R., Hagemeijer, A., Mecucci, C., Marynen, P.
(2002). Recurrent Rearrangement of the Ewing's Sarcoma Gene, EWSR1, or Its Homologue, TAF15, with the Transcription Factor CIZ/NMP4 in Acute Leukemia. Cancer Res.
62: 5408-5412
[Abstract]
[Full Text]
-
Veuger, M. J. T., Heemskerk, M. H. M., Honders, M. W., Willemze, R., Barge, R. M. Y.
(2002). Functional role of alternatively spliced deoxycytidine kinase in sensitivity to cytarabine of acute myeloid leukemic cells. Blood
99: 1373-1380
[Abstract]
[Full Text]
-
Welford, S. M., Hebert, S. P., Deneen, B., Arvand, A., Denny, C. T.
(2001). DNA Binding Domain-independent Pathways Are Involved in EWS/FLI1-mediated Oncogenesis. J. Biol. Chem.
276: 41977-41984
[Abstract]
[Full Text]
-
Wagner, K., Kafert-Kasting, S., Heil, G., Ganser, A., Eder, M.
(2001). Inhibition of granulocyte-macrophage colony-stimulating factor receptor function by a splice variant of the common beta -receptor subunit. Blood
98: 2689-2696
[Abstract]
[Full Text]
-
Chansky, H. A., Hu, M., Hickstein, D. D., Yang, L.
(2001). Oncogenic TLS/ERG and EWS/Fli-1 Fusion Proteins Inhibit RNA Splicing Mediated by YB-1 Protein. Cancer Res.
61: 3586-3590
[Abstract]
[Full Text]
-
Yang, L., Chansky, H. A., Hickstein, D. D.
(2000). EWS{middle dot}Fli-1 Fusion Protein Interacts with Hyperphosphorylated RNA Polymerase II and Interferes with Serine-Arginine Protein-mediated RNA Splicing. J. Biol. Chem.
275: 37612-37618
[Abstract]
[Full Text]
-
Lerga, A., Hallier, M., Delva, L., Orvain, C., Gallais, I., Marie, J., Moreau-Gachelin, F.
(2001). Identification of an RNA Binding Specificity for the Potential Splicing Factor TLS. J. Biol. Chem.
276: 6807-6816
[Abstract]
[Full Text]
-
Knoop, L. L., Baker, S. J.
(2001). EWS/FLI Alters 5'-Splice Site Selection. J. Biol. Chem.
276: 22317-22322
[Abstract]
[Full Text]
-
Uranishi, H., Tetsuka, T., Yamashita, M., Asamitsu, K., Shimizu, M., Itoh, M., Okamoto, T.
(2001). Involvement of the Pro-oncoprotein TLS (Translocated in Liposarcoma) in Nuclear Factor-kappa B p65-mediated Transcription as a Coactivator. J. Biol. Chem.
276: 13395-13401
[Abstract]
[Full Text]
-
Cowper, A. E., Caceres, J. F., Mayeda, A., Screaton, G. R.
(2001). Serine-Arginine (SR) Protein-like Factors That Antagonize Authentic SR Proteins and Regulate Alternative Splicing. J. Biol. Chem.
276: 48908-48914
[Abstract]
[Full Text]
-
Saunders, L. R., Perkins, D. J., Balachandran, S., Michaels, R., Ford, R., Mayeda, A., Barber, G. N.
(2001). Characterization of Two Evolutionarily Conserved, Alternatively Spliced Nuclear Phosphoproteins, NFAR-1 and -2, That Function in mRNA Processing and Interact with the Double-stranded RNA-dependent Protein Kinase, PKR. J. Biol. Chem.
276: 32300-32312
[Abstract]
[Full Text]