Previous Article | Next Article 
Molecular and Cellular Biology, May 2000, p. 3434-3441, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
SINE Retroposons Can Be Used In Vivo as Nucleation
Centers for De Novo Methylation
Philippe
Arnaud,
Chantal
Goubely,
Thierry
Pélissier, and
Jean-Marc
Deragon*
Biomove, UMR6547 CNRS, Université
Blaise Pascal Clermont-Ferrand II, 63177 Aubière Cedex, France
Received 22 September 1999/Returned for modification 31 October
1999/Accepted 28 February 2000
 |
ABSTRACT |
SINEs (short interspersed elements) are an abundant class of
transposable elements found in a wide variety of eukaryotes. Using the
genomic sequencing technique, we observed that plant S1 SINE
retroposons mainly integrate in hypomethylated DNA regions and are
targeted by methylases. Methylation can then spread from the SINE into
flanking genomic sequences, creating distal epigenetic modifications.
This methylation spreading is vectorially directed upstream or
downstream of the S1 element, suggesting that it could be facilitated
when a potentially good methylatable sequence is single stranded during
DNA replication, particularly when located on the lagging strand.
Replication of a short methylated DNA region could thus lead to the de
novo methylation of upstream or downstream adjacent sequences.
 |
INTRODUCTION |
Most eukaryotic interspersed repeats
are the result of an amplification process that depends upon the
reverse transcription of an RNA intermediate. These repeats are either
short or long interspersed elements (SINEs or LINEs, respectively) or
retrovirus-like elements (retrotransposons and endogenous retroviruses)
(18). The fraction of the genome occupied by these elements
varies from 35% in humans (45) to probably more than 60%
in certain plant species, such as maize (39). This level of
amplification is a serious threat to the host genome, since integration
to new sites can result in deleterious mutations. To limit these
effects, the hosts have combined several strategies based on the direct repression of one or more steps of the mobility process or on the
targeting of mobile elements away from genes (39, 51).
Transcription of retroelements is usually strongly repressed and
limited either to a very small number of elements, to certain tissues,
or to particular physiological conditions (25, 26, 44),
suggesting that transcription represents an important control point of
the mobilization process. For SINEs, despite the presence of a
potentially active internal polymerase III (Pol III) promoter in a
large number of elements, their specific (Pol III-dependent) transcription was shown to be weak and limited to a very small subset
of elements (9, 26). In mammals and plants, transcriptional control of SINEs could be related to their high level of methylation directly blocking the initiation of transcription or contributing to
the formation of transcriptionally inactive chromatin domain (10,
11, 19, 27). Thus, methylation may be part of a genome defense
system which inactivates the transcription of parasitic mobile elements
(54). The few transcriptionally active elements could escape
methylation and/or be fortuitously associated with a transcriptional
enhancer (5).
The mechanism by which a large number of SINE retroposons are
methylated is for the moment unknown. Since methylation is often determined by sequence context (2), methylation of SINEs is generally thought to depend on the methylation status of their integration sites. SINEs would thus be highly methylated, because they
integrate mainly in methylated regions of the genome, while the few
hypomethylated (and transcriptionally active) elements would reside
in hypomethylated DNA regions (7, 26, 42). Recently, the
methylation status of SINEs from the sea squirt (Ciona
intestinalis) genome was shown to conform to the methylation status of the surrounding DNA sequences, supporting this hypothesis (43). Alternatively, SINEs could be direct targets for DNA
methylation. This targeting could be related to the repetitive nature
of SINEs. Methylation of DNA repeats has been described in fungi as
part of RIP and MIP phenomena (37, 41), in relation to
paramutation and gene silencing in plants (29), and in the
programmed methylation of the maize Mu (mutator), Ac (activator), and
Spm (suppressor-mutator) DNA transposons (1, 3, 40). In
these cases, methylation of repeats probably depends on homologous
DNA-DNA or RNA-DNA interactions (reviewed in reference
29).
SINEs are also suspected to play a role in inducing de novo
methylation. In several cases, genomic fragments containing SINEs were
found to be capable of inducing de novo methylation of adjacent genomic
sequences. In one case, two DNA fragments from the rat
-fetoprotein
control region containing rodent SINEs were shown to promote the de
novo methylation of an adjacent reporter gene (14). A second
example is the methylation of the mouse aprt (adenine phosphoribosyl
transferase) promoter after disruption of Sp1 elements, which may have
originated from a methylation center comprising SINEs (31, 32,
53). Finally, human Alu elements were proposed as potential de
novo methylation centers implicated in tumor supressor gene silencing
in neoplasia (13) and in the methylation of an exon of the
TP53 gene (28). Based on these reports, it has been
speculated that SINEs could be good elicitors of methylation spreading
(50).
The S1 element is a small (180-bp) plant SINE that was first described
and studied in Brassica napus and is widely distributed among Cruciferae (8, 22). Transcription of S1 elements in B. napus is severely repressed and controled in a
tissue-specific manner (9). S1 elements were recently shown
to be highly methylated at symmetrical and asymmetrical positions
(11). We show here that S1 elements generally insert in
hypomethylated DNA regions and are de novo methylated,
suggesting that they do not simply adopt the methylation status of
surrounding regions, but are directly targeted by methylases. We also
show that the integration of S1 element can induce directional de novo
methylation of genomic flanking regions.
 |
MATERIALS AND METHODS |
Plant materials and seed germination.
B. napus seeds
from the Westar cultivar and for 18 different breeding lines were
obtained as a gift from DNA Landmark, Inc. Seeds were grown on solid MS
media (Sigma) containing 8 g of agar per liter supplemented with
Gamborg's vitamins (thiamine-HCl, 1 mg/liter; pyridoxine-HCl, 0.5 mg/liter; nicotinic acid, 0.5 mg/liter; and myoinositol, 100 mg/liter),
D(+)-saccharose (30 g/liter), and MES
(morpholineethanesulfonic acid [0.5 g/liter]) adjusted to pH 5.7. Plants were grown for 10 to 15 days at 23°C. Leaf material was
collected, frozen in liquid nitrogen, and stored at
80°C until DNA extraction.
DNA extractions.
B. napus DNA was isolated from leaves
has described previously (11) with the addition of a CsCl
purification step or by using the DNeasy Plant isolation system (Qiagen).
Genomic sequencing method.
The genomic sequencing method was
based on that described by Clark et al. (6). Briefly,
digested DNA (1 to 5 µg) was denatured for 20 min at 37°C in 70 µl of 0.3 M NaOH. Denatured DNA was mixed with 400 µl of freshly
prepared 2 M sodium metabisulfite-0.6 mM hydroquinone (pH 5) (Merck)
(1.7 M-0.5 mM final concentration). The reaction mixture was incubated
in a Hot Top thermal cycler (Appligene) for 18 h at 55°C with a
30-s denaturation step at 94°C every 3 h. DNA was then purified
by a desalting column step (Promega Wizard DNA Clean-Up System), and
eluted DNA was incubated in 0.3 M NaOH for 15 min at 37°C. After
neutralization with ammonium acetate (at a 3 M final concentration),
the DNA was precipitated in ethanol and resuspended in 100 µl of water.
PCRs were performed with 100 ng of treated DNA in a Crocodile III
apparatus (Appligene) by using Taq Bead Hot Start polymerase (Promega).
The reactions were carried out in 50 µl containing 50 pmol of each
primer (the sequences of primers used to amplified bisulfite-treated
DNA are available on request), 0.2 mM each deoxynucleoside triphosphate
(dNTP), and 1.25 U (1 bead) of Taq Bead Hot Start polymerase in the
recommended buffer. Samples were processed as follows: 1 cycle at
94°C for 5 min; followed by 1 min at proper annealing temperature
(corresponding to the lowest melting temperature of the primers used);
40 cycles at 72°C for 45 s, 94°C for 30 s, and the proper
annealing temperature for 30 s; and 1 cycle at 72°C for 5 min.
PCR products were cloned by using the pGEM-T Easy vector (Promega) and
transfected into Escherichia coli DH5
by heat shock at
42°C (38). Nucleotide sequences were determined with the
T7 sequencing kit (Amersham Pharmacia Biotech).
The bisulfite reaction converts nonmethylated cytosines in DNA to
uracils, while leaving 5-methylcytosines unaltered (
6).
To
demonstrate the efficiency of the bisulfite treatment on CpG-rich
S1
elements, the na16 locus (S1 with flanking regions; 750 bp
total) was
cloned in a pGEM-T vector, and 10 ng of this linearized
plasmid was
mixed with 5 µg of digested genomic DNA before bisulfite
treatment.
To control the treatment, we amplified this control
locus by using pGEM
primers designed for bisulfite-treated DNA
(pG1B,
GGGTGAATTGGGTTTGATGT; and pG2B, CTCCCATATAATCAACCTAC).
Eighteen recombinant na16 controls were analyzed, and all clones
showed a 100% conversion efficiency. All cytosines present in
the S1
element or in its flanking regions were converted to uracil
(139 per
clone) except for methylated cytosines (4 per clone)
resulting from
plasmid multiplication in bacteria expressing the
dcm
methylation pathway. Therefore, S1 elements are not resistant
to the
bisulfite reaction and are treated with the same efficiency
as their
genomic flanking
sequences.
Restriction enzyme analysis.
For the genomic blotting
experiments, aliquots of 5 to 10 µg of genomic DNA from heterozygous
plants (for the na32 locus) were digested with different combinations
of restriction enzymes (DraI, TTTAAA;
DraI-AvaI, CYCGRG; AsnI, ATTAAT;
AsnI-AvaI), separated by electrophoresis on
1% agarose gel, transferred to nylon membranes under alkaline
conditions (38), and hybridized with
32P-labelled probe P1 (see Fig. 3).
 |
RESULTS |
S1 integrates in hypomethylated target sites.
The methylation
status of eight S1-containing loci (S1 plus ~200 bp of upstream and
downstream flanking sequences) was analyzed by the genomic sequencing
method (see reference 6 and Materials and Methods).
These loci were chosen randomly from our collection of lambda clones.
All sequences flanking S1 at these loci were searched against
databases, and no significant homology was detected. The results of
this analysis are summarized in Fig. 1,
and two examples (na16 and na32) are presented in detail in Fig.
2. In four cases (na6, na10, na16, and
na27), methylated cytosine was not found in DNA sequences flanking the
S1 element, suggesting that these SINEs integrated in hypomethylated
target sites. Since several S1 insertions are not fixed in
Brassica populations (48), we searched for
heterozygous plants containing an "empty" allele (i.e., the site
before S1 integration) as well as the S1-containing allele. To confirm
the hypomethylated nature of S1 target sites, we analyzed the
methylation status of empty alleles. Genome duplication is a common
phenomenon in Brassica and was viewed as a potential problem
in this approach. Genome duplication leads to the presence of several
homeologous sites in the same genome. Despite the use of stringent PCR
conditions that target orthologous (allelic) sites, we were concerned
about the possibility of amplifying empty homeologous sites as well. We
have tested this possibility by amplifying the eight genomic S1 loci by
using DNA extracted from single plants (not shown; see reference
48 for examples). Empty sites were not detected for
all plants (as expected if we were also targeting empty homeologous
sites), and a typical allelic pattern was observed in all cases. Also,
the sequencing of several PCR products for each sites did not reveal
sequence divergence, as expected if duplicated sequences were also
amplified. We therefore conclude that our PCR amplifications only
target allelic (orthologous) sites and that the duplicate nature of the
Brassica genome does not interfere with our approach.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Summary of the methylation status obtained by genomic
sequencing of eight S1-containing loci (A) and three corresponding
empty loci obtained from an heterozygous plant (B). For each locus
(name of the locus indicated below), the height of bars is proportional
to the number of cytosines analyzed (indicated above). The proportion
of methylated cytosines found in S1 sequences or in upstream or
downstream flanking sequences is symbolized by dark portions, and the
corresponding percentages (when not 0) are indicated. The arrows for
the empty loci indicate the position of insertion of the S1 element in
the corresponding S1-containing site.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Two detailed examples of genomic sequencing results. (A)
Plus and minus strands of the na16 locus. (B) Plus and minus strands of
the na32 locus (only the plus strand for the downstream region).
Cytosine methylation is indicated by solid circles, while nonmethylated
sites are represented by open circles. The S1 sequence is printed in
boldface.
|
|
The methylation status of the na10 and na27 empty allele was
determined, and it confirmed that these S1 target sites were
hypomethylated before S1 integration and remained hypomethylated
following the integration event (Fig.
1). In four other S1 loci,
we
found a significant amount of methylated cytosine only upstream
(na30
and na32) or downstream (na7 and na17) of the S1 element.
These results
suggest that, either these S1 elements integrated
at a precise
transition between methylated and hypomethylated
DNA regions, or they
integrated in a hypomethylated DNA region
which was subsequently
methylated as a consequence of the S1 integration
event. As for na10
and na27, we cloned the na32 empty allele and
determine its methylation
status. The na32 empty allele was found
to be hypomethylated (Fig.
1B),
suggesting that the upstream methylation
we have observed for the
S1-containing alleles (33% in Fig.
1A
and
2) is a direct consequence
of the S1 integration event. The
downstream regions of na32 empty and
S1-containing alleles are
both hypomethylated (2.4 and 0.7%,
respectively). In this case,
a single CpG site is concerned, and this
preexisting methylation
is not affected by the integration event.
Therefore, the very
low levels of methylation observed in the 5'
flanking region of
na7 (0.3%) and the 3' flanking region of na30
(0.9%) probably
also preexist in the empty site and do not result from
the S1
integration event. We conclude that, for the eight sites
analyzed,
S1 integration events took place at hypomethylated target
sites
and that flanking sequences could be methylated after S1
integration.
S1 elements are preferential targets for de novo methylation.
The eight S1 elements studied were found to be highly methylated (Fig.
1 and 2). The precise sequence context of S1 methylation is presented
in Table 1 and is similar to the
situation presented in a previous report (11). The levels of
5-methylcytosine in the eight different S1 elements range from 26% to
58%. Cytosines from the S1 element in CpG and CpNpG are preferred
targets for methylation and are methylated at levels of 92 and 55%,
respectively. Asymmetrical positions were also found methylated in S1
sequences with confirmation of Cp(A/T)pA as a preferred asymmetrical
target site (Table 1) (11). These results suggest that S1
elements can be specific targets for methylation during or after
integration in hypomethylated genomic target sites.
Spreading of DNA methylation from S1 elements.
As discussed
above, four of the eight S1 loci analyzed have a significant level of
methylation in 5' or 3' S1 flanking sequences (Fig. 1 and 2). Since all
"empty" integration sites studied were shown to be hypomethylated,
this methylation of flanking sequences is probably a direct consequence
of the SINE integration. We suggest that following the integration and
methylation of the S1 element, methylation has spread in a directional
manner from the S1 element to upstream or downstream flanking genomic
regions. The methylation observed in flanking regions mainly concerns
CpG sites with a reduction of 5-methylcytosine in CpNpG and
asymmetrical sites compared to S1 methylation (Table 1).
The extent of the methylation spreading was tested for locus na32. DNA
samples from individual heterozygous plants (i.e.,
presenting the empty
and the S1-containing alleles at the na32
locus) were used. Using two
PCR products (positions +80 to

410
and

250 to

750 with an
overlapping region of 160 bp), the methylation
status of the upstream
regions of both alleles (on the upper strand)
up to position

750 was
analyzed by genomic sequencing (Fig.
3A).
For the S1 allele, we observed up to position

750 a high level
of
methylation with the same proportion of 5-methylcytosine in
different
contexts, as presented in Table
1 (S1-5'FL; i.e., mainly
concentrated
on CpG). For the empty allele, the region is completely
unmethylated up
to position

417. From this position, one of the
nine empty clones
analyzed showed a methylation pattern similar
to that of the S1 allele,
while the eight other clones still maintained
an unmethylated pattern
up to position

720. At this position,
another clone adopted an S1
(methylated) profile, while the seven
others still maintained their
unmethylated status up to position

750. Therefore, the transition
from a methylated to an unmethylated
DNA region on the empty allele is
not a linear process but appears
to be a stepwise process, possibly
implicating frontier elements.
These results suggest that, following
the S1 integration event,
methylation spread from the SINE to the 5'
flanking region of
the na32 locus over at least 750 bp until it reached
an already
methylated DNA region.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Evaluation of the upstream methylation spreading for the
na32 locus. (A) The methylation status of the empty and S1 allele
upstream regions was analyzed by genomic sequencing (upper strand).
Only the CpG sites are indicated (by stars). The position of the
R1-AvaI site is indicated. The proportion of CpG methylation
is represented by bars of different lengths. Nine and seven clones were
sequenced, respectively, for the empty and S1 alleles. (B) Restriction
map of both alleles. Positions of the probe (P1) and of the two
AvaI restriction sites (R1 and R2) are indicated.
DraI and AsnI are not sensible for DNA
methylation, while AvaI is inhibited by methylation. (C)
Southern analysis of the methylation status of the na32 locus. DNA from
heterozygous plants were digested with DraI (lane 1),
DraI-AvaI (lane 2), AsnI (lane 3), or
AsnI-AvaI (lane 4) and probed with the P1
fragment. The sizes of the hybridized fragments (in base pairs) are
shown. The size difference between the two fragments revealed after the
AsnI digestion (lane 3) can be explained by the presence or
absence of the S1 element and confirms the heterozygous state of the
plant studied. The R1 site is methylated for the S1 allele but
unmethylated for the empty allele. The R2 sites appear to be methylated
for the S1 allele.
|
|
To confirm these results and to validate the difference in methylation
observed in the genomic sequencing experiment, DNA
from individual
heterozygous plants was digested with a restriction
enzyme sensible to
DNA methylation (
AvaI) followed by DNA hybridization
(Fig.
3B and C). We choose to analyze the methylation status of
a restriction
site (R1-
AvaI, Fig.
3) located at position

385
on both
alleles that presents a clear difference in methylation
pattern in the
genomic sequencing analysis (Fig.
3A). Using the
P1 probe and a
DraI-AvaI digest, we found two bands of similar
intensities
(Fig.
3C, lane 2). The first band of 525 bp is expected
if the
R1-
AvaI site is methylated and not cleaved by the
AvaI
restriction enzyme. The band at 330 bp is expected if
the R1-
AvaI
site is unmethylated and cleaved by the
restriction enzyme. These
results suggest that the two restriction
fragments observed were
generated from the two alleles (S1 and empty)
that differ in their
R1-
AvaI site methylation status (Fig.
3A). We confirmed these
results by using probe P1 and an
AsnI-
AvaI digest. The band near
2,000 bp has a
size predicted for the S1 allele if both (R1 and
R2)
AvaI
sites are methylated and not cleaved by the restriction
enzyme, while
the band at 550 bp is expected from the empty allele
if the first
AvaI site (R1) is unmethylated and cleaved (Fig.
3C, lane
4). These results confirm the difference in methylation
status observed
in the genomic sequencing between the na32 empty
and S1-containing
alleles at the R1-
AvaI
site.
 |
DISCUSSION |
S1 integrates in hypomethylated target sites.
We have shown in
this study that S1 elements insert in hypomethylated regions of the
B. napus genome. B. napus, like most higher
plants, has a relatively high level of 5-methylcytosine. We estimated
previously that almost 15% of cytosine is transformed to
5-methylcytosine in the nuclear DNA of this species (11) (compared to 2 to 7% for animal DNA [36]). It is
therefore unlikely that the systematic association of S1 elements with
hypomethylated portions of the B. napus genome happened by
chance. We have shown recently that S1 integration (like mammalian SINE
integration) occurs at nonrandom staggered breaks, probably resulting
from the action of a LINE-encoded endonuclease (47). The
general A/T richness of a given DNA region and the presence of short
runs of pyrimidines followed by short runs of purines were shown to be
a favorable context for S1 integration (47). We show here that the methylation status of the integration site is also a factor,
and we suggest that the endonuclease implicated in S1 integration could
be inhibited by DNA methylation (or by a chromatin structure induced by
DNA methylation), thereby selecting hypomethylated DNA regions. It
remains to be shown whether the methylation status also influences the
target site selection of mammalian retroposons, but the similarity of
target sites between plant and mammalian retroposons (47)
and the observation that Alu integration sites are strongly depleted in
methylatable CpG sites (15) suggest that this might be the case.
Possible mechanisms for the de novo methylation induced by S1
integration.
Our results indicate that S1 does not simply adopt
the methylation level of its integration site, but is directly targeted by methylases. Recently, Pélissier et al. suggested that heavy de
novo methylation at symmetrical and asymmetrical sites, like that we
observed on the S1 element, is a hallmark of RNA-directed DNA
methylation (34). The transposition cycle of SINEs includes the formation of an RNA-DNA intermediate following first-strand DNA
synthesis (16). This RNA-DNA transposition intermediate may
be recognized by methylases leading to specific de novo methylation of
the element. The production of aberrant (sense and antisense [9]) S1 RNA resulting from cotranscriptional events
where an S1 element is transcribed due to its presence in a Pol II
transcriptional unit, could also activate a RNA-directed DNA
methylation system (30). Finally, methylation of S1 elements
could also happen by DNA-DNA interactions, but since S1 elements are
very short repeats (less than 200 bp) they may be unable to generate a
direct ectopic homologous DNA-DNA interaction (12, 37).
Following SINE integration, we report a de novo methylation of either
its upstream or downstream flanking genomic region.
We suggest that
this methylation results from a vectorial spreading
from the SINE into
the flanking region. The restriction in the
orientation of the
methylation spreading is probably related to
the mechanism used and
deserves attention. According to in vitro
studies, the recognition of a
methylated cytosine in single- or
double-strand oligonucleotides is
sufficient to initiate methylation
spreading (
4,
24,
46,
49). However, methylation spreading
is greatly enhanced on
hemimethylated duplexes, when the methylatable
cytosines are
present on single-stranded DNA and when a high concentration
of
methylatable cytosines is available (
4,
24,
46,
49).
In
vivo, DNA replication of a short methylated region will lead
to the
formation of hemimethylated DNA adjacent to single-stranded
DNA only on
the lagging strand and not on the leading strand (Fig.
4) (
24). DNA replication could
thus stimulate an oriented methylation
spreading (from the
hemimethylated region to the single-stranded
region of the lagging
strand) like the one observed in this work
(Fig.
4). Methylation
spreading would depend on the presence on
the lagging strand of a
potentially good methylatable region and
the position of the
replication origin in relation to the methylated
locus (the SINE S1 in
our case) would determine which strand (plus
or minus) is the lagging
strand (Fig.
4) and thus which of the
flanking regions (upstream or
downstream) would be de novo methylated.
Although the spreading would
at first only concern a small DNA
region on the lagging strand,
methylation can further spread after
each round of replication and can
expand for at least several
hundred bases as observed. The oriented
methylation spreading
we observed in this work could thus reflect the
general property
of DNA replication to promote de novo methylation
spreading from
short methylated DNA regions.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Possible involvement of DNA replication in de novo
methylation spreading. Following integration, S1 elements would be
targeted for de novo methylation by an unknown mechanism (see text).
After replicating the methylated SINE (black boxes), two hemimethylated
regions will be formed (black and white boxes), one on the leading
strand and one on the lagging strand. DNA methyltransferase (hatched
oval) associated with the replication apparatus (grey circle) can
recognize these hemimethylated regions and can methylate the
corresponding neosynthesized strands (23) (the organization
of the replication fork is presented as by Kornberg and Baker
[20]). In the 3' part of the SINE on the lagging
strand, the methyltransferase is adjacent to single-stranded DNA.
Methylation spreading from the SINE to flanking sequences would depend
on the presence on the lagging strand of a potentially good
methylatable region, and the polarity of the methylation spreading
would depend on the position of replication origin and the direction of
the replication fork (A or B). The initial methylation spreading
(thicker line) can only concern the immediate S1 flanking region, but
since de novo methylation is possible at each round of DNA replication,
methylation can potentially spread by this mechanism to sequences
thousand of base pairs from the SINEs. Also, we should expect that the
methylated version of the locus will rapidly take over the unmethylated
one following successive rounds of DNA replication.
|
|
Alternatively, we cannot exclude that methylation has spread, not from
the SINE, but from a methylated region located several
hundred base
pairs upstream or downstream of the integration site.
In that case,
importation of new methylation sites by the insertion
(and methylation)
of the SINE would provide a magnet for de novo
methylation, the SINE
acting as a barrier to this spreading. However,
it seems unlikely that
a small methylated island like a SINE could
trigger methylation at
distance (~400 bp for na32). Also, in one
case in which mammalian
SINEs were suspected to generate de novo
methylation (
32),
CpG methylation was less important when located
at distance from the
methylation center, suggesting that methylation
was originating from
this center and was not spreading from external
methylated
sequences.
It is also interesting to note that the methylation profile of flanking
sequences is different from the methylation profile
of S1 sequences
(Table
1). A strong reduction in the 5-methylcytosine
content of CpNpG
and asymmetrical sites was observed while CpG
sites were equally
methylated. This observation suggests that
methylation of flanking
regions implies a change of methylase
specificity or the action of a
different methylase compare to
S1 elements. Interestingly, similar
results were observed in tobacco
plants with chromosomal inserts that
were subjected to RNA-directed
DNA methylation (
34,
52). In
these plants, viroid RNA-DNA
interactions trigger specific and dense de
novo methylation of
viroid transgene sequences. Methylation occurred
potentially at
all C positions in symmetrical and nonsymmetrical sites
and was
essentially restricted to the viroid sequences (
34).
However,
for one of the loci analyzed, methylation was found to spread
up to 500 bp downstream from the viroid-specific sequences. (T.
Pélissier and M. Wassenegger, unpublished results). In contrast
to the heavy methylation pattern detected within the viroid sequences,
the distribution of methylated cytosines within this area was
significantly biased in favor of symmetrical sites, a pattern
reminiscent of that we observed in our
study.
Possible consequences of the modification of methylation patterns
upon SINE integration.
In a few well-characterized cases, the
insertion of a SINE in or near a gene has been shown to result in a
genetic defect. In these cases, the deleterious effects result from the
disruption of an open reading frame, the modification of splicing
patterns causing exon skipping, or the creation of genomic instability leading to deletions and gene rearrangements (21). We show
here that SINE insertion can also lead to epigenetic modifications. DNA
methylation can affect chromatin organization and has been implicated
in a number of important epigenetic modifications, including
transcriptional regulation and gene silencing, genomic imprinting, and
X-chromosome inactivation (35). The methylation spreading
that we observed after S1 insertion could therefore affect gene
expression. This seems likely for two reasons. First, promoters of
active genes are generally undermethylated (33), and since
S1 elements are targeted to hypomethylated regions, we expect the S1
element to be enriched in gene-containing regions. Second, we have
shown that the de novo methylation spreading can directly affect
genomic DNA at least several hundred base pairs from the insertion
sites. Since inactive chromatin structure can spread from methylated
region several kilobase pairs into unmethylated flanking regions
(17), we estimate that a gene remote from the integration
site could still be affected by an S1 integration event. Based on these
observations, the local spreading of methylation observed following S1
integration could influence genes at remote genomic sites.
 |
ACKNOWLEDGMENTS |
We thank Christophe Tatout, Charles White, Zoya Auramova, and
Damian Labuda for critical review of the manuscript. We also thank
Benoit Landry for providing us with B. napus seeds and Alain Lenoir for technical help.
This work was supported by the CNRS (UMR 6547), by the Université
Blaise Pascal, and by a European Community grant (FPIV, Molecular Tools
for Biodiversity) from the BIOTECH program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Biomove, UMR6547
CNRS, Université Blaise Pascal Clermont-Ferrand II, 24 Ave des
Landais, 63177 Aubière Cedex, France. Phone: 33 473407752. Fax:
33 473407777. E-mail:
J-Marc.Deragon{at}geem.univ-bpclermont.fr.
 |
REFERENCES |
| 1.
|
Bennetzen, J. L.
1996.
The mutator transposable element system of maize.
Curr. Top. Microbiol. Immunol.
24:195-229.
|
| 2.
|
Bird, A.
1992.
The essential of DNA methylation.
Cell
70:5-8[CrossRef][Medline].
|
| 3.
|
Brutnell, T. P., and S. L. Dellaporta.
1994.
Somatic inactivation and reactivation of AC associated with changes in cytosine methylation and transposase expression.
Genetics
138:213-225[Abstract].
|
| 4.
|
Carotti, D.,
S. Funiciello,
F. Palitti, and R. Strom.
1998.
Influence of pre-existing methylation on the de novo activity of eukaryotic DNA methyltransferase.
Biochemistry
37:1101-1108[CrossRef][Medline].
|
| 5.
|
Chesnokov, I., and C. W. Schmid.
1996.
Flanking sequences of an Alu source stimulate transcription in vitro by interacting with sequence-specific transcription factors.
J. Mol. Evol.
42:30-36[CrossRef][Medline].
|
| 6.
|
Clark, S. J.,
J. Harrison,
C. L. Paul, and M. Frommer.
1994.
High sensitivity mapping of methylated cytosines.
Nucleic Acids Res.
22:2990-2997[Abstract/Free Full Text].
|
| 7.
|
Deininger, P. L.,
M. A. Batzer,
C. A. Hutchison III, and M. H. Edgell.
1992.
Master genes in mammalian repetitive DNA amplification.
Trends Genet.
8:307-311[Medline].
|
| 8.
|
Deragon, J. M.,
B. S. Landry,
T. Pélissier,
S. Tutois,
S. Tourmente, and G. Picard.
1994.
An analysis of retroposition in plants based on a family of SINEs from Brassica napus.
J. Mol. Evol.
39:378-386[CrossRef][Medline].
|
| 9.
|
Deragon, J. M.,
N. Gilbert,
L. Rouquet,
A. Lenoir,
P. Arnaud, and G. Picard.
1996.
A transcriptional analysis of the S1Bn (Brassica napus) family of SINE retroposons.
Plant Mol. Biol.
32:869-878[CrossRef][Medline].
|
| 10.
|
Englander, E. W.,
A. P. Wolffe, and B. H. Howard.
1993.
Nucleosome interactions with a human Alu element. Transcription repression and effects on template methylation.
J. Biol. Chem.
268:19565-19573[Abstract/Free Full Text].
|
| 11.
|
Goubely, C.,
P. Arnaud,
C. Tatout,
J. S. Heslop-Harrison, and J. M. Deragon.
1999.
S1 SINE retroposons are methylated at symmetrical and non-symmetrical position in Brassica napus: identification of a new methylation site in plants.
Plant Mol. Biol.
39:243-255[CrossRef][Medline].
|
| 12.
|
Goyon, C.,
J. L. Rossignol, and G. Faugeron.
1996.
Native DNA repeats and methylation in Ascobolus.
Nucleic Acids Res.
24:3348-3356[Abstract/Free Full Text].
|
| 13.
|
Graff, J. R.,
J. G. Herman,
S. Myohanen,
S. B. Baylin, and P. M. Vertino.
1997.
Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation.
J. Biol. Chem.
272:22322-22329[Abstract/Free Full Text].
|
| 14.
|
Hass, A., and W. Schulz.
1994.
Enhancement of reporter gene de novo methylation by DNA fragments from the -fetoprotein control region.
J. Biol. Chem.
269:1821-1826[Abstract/Free Full Text].
|
| 15.
|
Jurka, J.,
P. Klonowski, and E. N. Trifonov.
1998.
Mammalian retroposons integrate at kinkable DNA sites.
J. Biomol. Struct. Dyn.
15:717-721[Medline].
|
| 16.
|
Jurka, J.
1997.
Sequence patterns indicate an enzymatic involvement in integration of mammalian retroposons.
Proc. Natl. Acad. Sci. USA
94:1872-1877[Abstract/Free Full Text].
|
| 17.
|
Kass, S. U.,
J. P. Goddard, and R. L. P. Adams.
1993.
Inactive chromatin spreads from a focus of methylation.
Mol. Cell. Biol.
13:7372-7379[Abstract/Free Full Text].
|
| 18.
|
Kazazian, H. H.
1998.
Mobile elements and disease.
Curr. Opin. Genet. Dev.
8:343-350[CrossRef][Medline].
|
| 19.
|
Kochanek, S.,
D. Renz, and W. Doerfler.
1993.
DNA methylation in the Alu sequences of diploid and haploid primary human cells.
EMBO J.
12:1141-1151[Medline].
|
| 20.
|
Kornberg, A., and T. A. Baker.
1991.
DNA replication, 2nd ed.
W. H. Freeman & Co., New York, N.Y.
|
| 21.
|
Labuda, D.,
E. Zietkiewick, and G. A. Mitchell.
1995.
Alu elements as a source of genomic variation: deleterious effects and evolutionary novelties, p. 1-24.
In
R. J. Maraia (ed.), The impact of short interspersed elements (SINEs) on the host genome. R. G. Landes Co., Springer, Austin, Tex.
|
| 22.
|
Lenoir, A.,
B. Cournoyer,
S. I. Warwick,
G. Picard, and J. M. Deragon.
1997.
Evolution of SINE S1 retroposons in Cruciferae plant species.
Mol. Biol. Evol.
14:934-941[Abstract].
|
| 23.
|
Leonhardt, H.,
A. W. Page,
H. U. Weier, and T. A. Bestor.
1992.
Targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei.
Cell
71:865-873[CrossRef][Medline].
|
| 24.
|
Lindsay, H., and R. L. P. Adams.
1996.
Spreading of methylation along DNA.
Biochem. J.
320:473-478.
|
| 25.
|
Liu, W.-M.,
W.-M. Chu,
P. V. Choudary, and C. W. Schmid.
1995.
Cell stress and translational inhibitors transiently increase the abundance of mammalian SINE transcripts.
Nucleic Acids Res.
23:1758-1765[Abstract/Free Full Text].
|
| 26.
|
Liu, W.-M.,
R. J. Maraia,
C. M. Rubin, and C. W. Schmid.
1994.
Alu transcripts: cytoplasmic localisation and regulation by DNA methylation.
Nucleic Acids Res.
22:1087-1095[Abstract/Free Full Text].
|
| 27.
|
Liu, W.-M., and C. W. Schmid.
1993.
Proposed roles for DNA methylation in Alu transcriptional repression and mutation inactivation.
Nucleic Acids Res.
21:1351-1359[Abstract/Free Full Text].
|
| 28.
|
Magewu, A. N., and P. A. Jones.
1994.
Ubiquitous and tenacious methylation of the CpG site in codon 248 of the p53 gene may explain its frequent appearance as a mutational hot spot in human cancer.
Mol. Cell. Biol.
14:4225-4232[Abstract/Free Full Text].
|
| 29.
|
Matzke, M. A.,
A. J. M. Matzke, and W. B. Eggleston.
1996.
Paramutation and transgene silencing: a common response to invasive DNA.
Trends Plant Sci.
1:382-388[CrossRef].
|
| 30.
|
Mette, M. N.,
J. van der Winden,
M. A. Matzke, and A. J. M. Matzke.
1999.
Production of aberrant promoter transcripts contributes to methylation and silencing of unliked homologous promoters in trans.
EMBO J.
18:241-248[CrossRef][Medline].
|
| 31.
|
Mummaneni, P.,
P. L. Bishop, and M. S. Turker.
1993.
A cis-acting element accounts for a conserved methylation pattern upstream of the mouse adenine phosphoribosyltransferase gene.
J. Biol. Chem.
268:552-558[Abstract/Free Full Text].
|
| 32.
|
Mummaneni, P.,
K. A. Walker,
P. L. Bishop, and M. S. Turker.
1995.
Epigenetic gene inactivation induced by a cis-acting methylation center.
J. Biol. Chem.
270:788-792[Abstract/Free Full Text].
|
| 33.
|
Naveh-Many, T., and H. Cedar.
1981.
Active gene sequences are undermethylated.
Proc. Natl. Acad. Sci. USA
78:4246-4250[Abstract/Free Full Text].
|
| 34.
|
Pélissier, T.,
S. Thalmeir,
D. Kempe,
H. L. Sanger, and M. Wassenegger.
1999.
Heavy de novo methylation at symmetrical and non-symmetrical sites is a hallmark of RNA-directed DNA methylation.
Nucleic Acids Res.
27:1625-1634[Abstract/Free Full Text].
|
| 35.
|
Razin, A.
1998.
CpG methylation, chromatin structure and gene silencing a three-way connection.
EMBO J.
17:4905-4908[CrossRef][Medline].
|
| 36.
|
Razin, A., and A. Riggs.
1980.
DNA methylation and gene function.
Science
210:604-610.
|
| 37.
|
Rossignol, J.-L., and G. Faugeron.
1994.
Gene inactivation triggered by recognition between DNA repeats.
Experientia
50:307-317[CrossRef][Medline].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
SanMiguel, P.,
A. Tikonov,
Y.-K. Jin,
N. Motchoulskaia,
D. Zakharov,
A. Melake-Berhan,
P. S. Springler,
K. J. Edwards,
M. Lee,
Z. Avramova, and J. L. Bennetzen.
1996.
Nested retrotransposons in the intergenic regions of the maize genome.
Science
274:765-768[Abstract/Free Full Text].
|
| 40.
|
Schlappi, M.,
R. Raina, and N. Fedoroff.
1994.
Epigenetic regulation of the maize Spm transposable element: novel activation of a methylated promoter by TnpA.
Cell
77:427-437[CrossRef][Medline].
|
| 41.
|
Selker, E. U.
1990.
Premeiotic instability of repeated sequences in Neurospora crassa.
Annu. Rev. Genet.
24:579-613[CrossRef][Medline].
|
| 42.
|
Shen, M. R.,
M. A. Batzer, and P. L. Deininger.
1991.
Evolution of the master Alu gene(s).
J. Mol. Evol.
33:311-320[CrossRef][Medline].
|
| 43.
|
Simmen, M. W.,
S. Leitgeb,
J. Charlton,
S. J. M. Jones,
B. R. Harris,
V. H. Clark, and A. Bird.
1999.
Nonmethylated transposable elements and methylated genes in a chordate genome.
Science
283:1164-1167[Abstract/Free Full Text].
|
| 44.
|
Skowronski, J., and M. F. Singer.
1985.
Expression of a cytoplasmic LINE-1 transcript is regulated in a human teratocarcinoma cell line.
Proc. Natl. Acad. Sci. USA
82:6050-6054[Abstract/Free Full Text].
|
| 45.
|
Smit, A. F. A.
1996.
The origin of interspersed repeats in the human genome.
Curr. Opin. Genet. Dev.
6:743-748[CrossRef][Medline].
|
| 46.
|
Smith, S. S.
1998.
Stalling of DNA methyltransferase in chromosome stability and chromosome remodelling (review).
Int. J. Mol. Med.
1:147-156[Medline].
|
| 47.
|
Tatout, C.,
L. Lavie, and J. M. Deragon.
1998.
Similar target site selection occurs in integration of plant and mammalian retroposons.
J. Mol. Evol.
47:463-470[CrossRef][Medline].
|
| 48.
|
Tatout, C.,
S. Warwick,
A. Lenoir, and J. M. Deragon.
1999.
SINE insertion as clade markers for wild crucifer species.
Mol. Biol. Evol.
16:1614-1621.
|
| 49.
|
Tollefsbol, T. O., and C. A. Hutchison, III.
1997.
Control of methylation spreading in synthetic DNA sequences by the murine DNA methyltransferase.
J. Mol. Biol.
269:494-504[CrossRef][Medline].
|
| 50.
|
Turker, M. S., and T. H. Bestor.
1997.
Formation of methylation patterns in the mammalian genome.
Mutat. Res.
386:119-130[CrossRef][Medline].
|
| 51.
|
Voytas, D. F.
1996.
Retroelements in genome organization.
Science
274:737-738[Free Full Text].
|
| 52.
|
Wassenegger, M.,
S. Heimes,
L. Riedel, and H. L. Sanger.
1994.
RNA-directed de novo methylation of genomic sequences in plants.
Cell
76:567-576[CrossRef][Medline].
|
| 53.
|
Yates, P. A.,
R. W. Burman,
P. Mummaneni,
S. Krussell, and M. S. Turker.
1999.
Tandem B1 element located in a mouse methylation center provides a target for de novo DNA methylation.
J. Biol. Chem.
274:36357-36361[Abstract/Free Full Text].
|
| 54.
|
Yoder, J. A.,
C. P. Walsh, and T. H. Bestor.
1997.
Cytosine methylation and the ecology of intragenomic parasites.
Trends Genet.
13:335-340[CrossRef][Medline].
|
Molecular and Cellular Biology, May 2000, p. 3434-3441, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hollister, J. D., Gaut, B. S.
(2009). Epigenetic silencing of transposable elements: A trade-off between reduced transposition and deleterious effects on neighboring gene expression. Genome Res
19: 1419-1428
[Abstract]
[Full Text]
-
Reiss, D., Zhang, Y., Mager, D. L.
(2007). Widely variable endogenous retroviral methylation levels in human placenta. Nucleic Acids Res
35: 4743-4754
[Abstract]
[Full Text]
-
Simons, C., Pheasant, M., Makunin, I. V., Mattick, J. S.
(2006). Transposon-free regions in mammalian genomes. Genome Res
16: 164-172
[Abstract]
[Full Text]
-
Pelissier, T., Bousquet-Antonelli, C., Lavie, L., Deragon, J.-M.
(2004). Synthesis and processing of tRNA-related SINE transcripts in Arabidopsis thaliana. Nucleic Acids Res
32: 3957-3966
[Abstract]
[Full Text]
-
Fojtova, M., Van Houdt, H., Depicker, A., Kovarik, A.
(2003). Epigenetic Switch from Posttranscriptional to Transcriptional Silencing Is Correlated with Promoter Hypermethylation. Plant Physiol.
133: 1240-1250
[Abstract]
[Full Text]
-
Oakes, C. C., Smiraglia, D. J., Plass, C., Trasler, J. M., Robaire, B.
(2003). Aging results in hypermethylation of ribosomal DNA in sperm and liver of male rats. Proc. Natl. Acad. Sci. USA
100: 1775-1780
[Abstract]
[Full Text]
-
Santourlidis, S., Trompeter, H.-I., Weinhold, S., Eisermann, B., Meyer, K. L., Wernet, P., Uhrberg, M.
(2002). Crucial Role of DNA Methylation in Determination of Clonally Distributed Killer Cell Ig-like Receptor Expression Patterns in NK Cells. J. Immunol.
169: 4253-4261
[Abstract]
[Full Text]
-
Greally, J. M.
(2001). Short interspersed transposable elements (SINEs) are excluded from imprinted regions in the human genome. Proc. Natl. Acad. Sci. USA
10.1073/pnas.012539199v1
[Abstract]
[Full Text]
-
Lenoir, A., Lavie, L., Prieto, J.-L., Goubely, C., Cote, J.-C., Pelissier, T., Deragon, J.-M.
(2001). The Evolutionary Origin and Genomic Organization of SINEs in Arabidopsis thaliana. Mol Biol Evol
18: 2315-2322
[Abstract]
[Full Text]
-
Greally, J. M.
(2002). Short interspersed transposable elements (SINEs) are excluded from imprinted regions in the human genome. Proc. Natl. Acad. Sci. USA
99: 327-332
[Abstract]
[Full Text]