Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2000, p. 3597-3607, Vol. 20, No. 10
Department of Biological Sciences, St.
John's University, Jamaica, New York 11439,1
and Institute of Microbiology, Academy of Sciences of the
Czech Republic, Prague, Czech Republic2
Received 9 November 1999/Returned for modification 10 January
2000/Accepted 28 February 2000
The budding yeast PLC1 gene encodes a homolog of the
The hydrolysis of
phosphatidylinositol-4,5-bisphosphate [PtdIns(4,5)P2] by
phospholipase C (PLC) is a key early event in the regulation of diverse
cell functions by many extracellular molecules. The reaction yields two
prominent eukaryotic second messengers: 1,2-diacylglycerol (DG) and
inositol 1,4,5-triphosphate [Ins(1,4,5)P3] (15, 41,
44). The hydrophilic Ins(1,4,5)P3 triggers the release of calcium from internal stores and thus modulates
Ca2+- and calmodulin-regulated pathways (3),
while the hydrophobic DG activates the phospholipid- and
Ca2+-dependent protein kinase C (50). As a
result, cytoplasmic PLC plays vital roles in the signal transduction
cascades which ultimately regulate nuclear events.
Three classes of mammalian phosphatidylinositol (PtdIns)-specific PLC
isoenzymes, designated While PLC1 is not an essential gene, its deletion results in
a number of phenotypes, including slow growth (progressively exacerbated at higher temperatures), osmosensitivity, defective utilization of carbon sources other than glucose, altered cell morphology, and inability to complete cytokinesis (23).
Flick and Thorner (24) identified two genes which, when
present in high copy number, suppress the temperature sensitivity of
cells in which the PLC1 gene has been deleted
(plc1 PLC1 was also identified in a genetic screen for mutants
with increased frequencies of chromosome missegregation
(54). The plc1-1 mutant, a temperature-sensitive
mutant isolated in this screen, displayed a 32-fold increase in
chromosome missegregation events. However, since plc1-1
cells appeared to have normal nuclei and spindle morphologies and were
not supersensitive to the microtubule (MT)-destabilizing drug benomyl,
Payne and Fitzgerald-Hayes reasoned that it was unlikely that the
chromosome missegregation phenotype results from a defect in the
components of the mitotic segregation apparatus (54).
Rather, they concluded that plc1-1 affects chromosome segregation indirectly, possibly by interfering with proper timing of
the cell cycle or by altering intracellular concentrations of calcium.
The kinetochore is a specialized organelle that mediates chromosome
attachment to spindle MTs. Kinetochores are composed of centromeric DNA
and a set of associated proteins. Whereas in animal cells the
centromeres span several megabases, have complex organizations, and
bind several MTs, in S. cerevisiae the centromere
(CEN) is 125 bp long and engages only a single MT
(67). CEN of S. cerevisiae includes
three conserved elements, termed CDEI, CDEII, and CDEIII (22,
30). CBF3, a four-protein complex that binds the CDEIII sequence,
is absolutely essential for kinetochore assembly and function in vivo
(28). The four protein subunits of CBF3 have molecular
masses of 110, 64, 58, and 23 kDa (11, 16, 40, 60). The
genes borne by p110 (NDC10, CBF2, and
CTF14) (16, 26, 33), p64 (CEP3 and
CBF3b) (39, 61), p58 (CTF13)
(16), and p23 (SKP1) (11, 60) have
been cloned and characterized.
Traditionally, the PtdIns cycle and PLC activity have been thought to
be associated with the plasma membrane. However, several reports
suggest that an independently regulated PtdIns cycle operates also
within the nucleus (4, 10, 13, 14, 45, 55). The regulation
and downstream effectors of this nuclear PtdIns cycle are unknown. In
this paper, we demonstrate that in S. cerevisiae Plc1p
associates with the kinetochore and appears to affect the binding
interaction between MTs and the kinetochore, which is essential for
proper chromosome segregation and cell cycle progression. These results
indicate a specific nuclear function for PLC in eukaryotic cells.
Strains and media.
Yeast strains used in this study (listed
in Table 1) were grown in rich medium
(YPD; 1% yeast extract, 2% Bacto Peptone, 2% glucose) or under
selection in synthetic minimal medium containing glucose (SD) and
supplemented with appropriate nutrients. Yeasts were manipulated as
described previously (8).
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Phospholipase C Is Involved in Kinetochore Function
in Saccharomyces cerevisiae

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
isoform of mammalian phosphoinositide-specific phospholipase C. Here, we present evidence that Plc1p associates with the kinetochore complex CBF3. This association is mediated through interactions with
two established kinetochore proteins, Ndc10p and Cep3p. We show by
chromatin immunoprecipitation experiments that Plc1p resides at
centromeric loci in vivo. Deletion of PLC1, as well as
plc1 mutations which abrogate the interaction of Plc1p with
the CBF3 complex, results in a higher frequency of minichromosome loss, nocodazole sensitivity, and mitotic delay. Overexpression of Ndc10p suppresses the nocodazole sensitivity of plc1 mutants,
implying that the association of Plc1p with CBF3 is important for
optimal kinetochore function. Chromatin extracts from
plc1
cells exhibit reduced microtubule binding to
minichromosomes. These results suggest that Plc1p associates with
kinetochores and regulates some aspect of kinetochore function and
demonstrate an intranuclear function of phospholipase C in eukaryotic cells.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
,
, and
, were identified via
biochemical, molecular, and immunological approaches (41). The Saccharomyces cerevisiae gene coding for PtdIns-specific
PLC (PLC1) has also been cloned, and the protein product
(Plc1p) is most closely related to mammalian
isoforms, both in
terms of sequence identity and in arrangements of conserved domains
(23, 54, 68). All isoenzymes of the three main families of
PLC, as well as the yeast Plc1p, contain a series of common modules which facilitate the enzymatic reaction. The modular structure contains
an N-terminal pleckstrin homology (PH) domain, an EF-hand calcium
binding domain, an active site containing two conserved regions termed
X and Y boxes, and a C-terminal C2 lipid binding domain (32,
35) (schematic representation of the modular structure of Plc1p
is shown in Fig. 4).
). One of these genes, PHO81, codes for
an inhibitor of a cyclin-dependent protein kinase comprised of
PHO80 and PHO85 gene products. The second suppressor is a novel gene, SPL2. In addition, Plc1p was
previously shown to interact with the PtdIns kinase homolog Tor2p
(43). Recent data implicate Plc1p in the regulation of
several processes. Plc1p is required for synthesis of inositol
hexakisphosphate, which supports efficient export of mRNA from the
nucleus (70), and for oxidative-stress-induced destruction
of cyclin Ume3p (12). In addition, Plc1p appears to be
involved in signal transduction pathways responsible for the sensing of
nutrients. Plc1p is required for glucose-induced activation of plasma
membrane H+-ATPase (9) and is also a component
of a nitrogen signaling pathway controlling the developmental switch
from yeast-like to pseudohyphal growth (1). However,
Plc1p's relationship to defined signal transduction pathways as well
as the subcellular distribution of Plc1p in yeast remains unknown.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Yeast strains used in this study
Plasmids. Plasmids pAS2-1-PLC1 and pYX232-PLC1-3HA have already been described (43). Plasmids pGBT9-PLC1 and pACT2-PLC1 were constructed by ligating a PLC1-containing BamHI fragment from pAS2-1-PLC1 into pGBT9 and pACT2, respectively. To construct plasmid pRS413-PLCP, which contains the promoter region of PLC1, a 1,100-bp fragment of the PLC1 promoter region was amplified by PCR using the oligonucleotides PLCP5 (5'-GCGCGAATTCGGGCCCACTTTTGGACGCTGGCGTCGC-3'), which hybridizes 1,107 bp upstream of the ATG start codon and introduces an ApaI site, and PLCP3 (5'-GCGCGAATTCACACTGCGTGAATGACCTTACCG-3'), which hybridizes 6 bp upstream of the ATG start codon and introduces an EcoRI site. The amplified 1.1-kb fragment was digested with EcoRI and ApaI and ligated into EcoRI- and ApaI-digested pRS413. Subsequently, an EcoRI-SacI fragment from pYX232-PLC1-3HA was ligated into EcoRI- and SacI-digested pRS413-PLCP to construct pRS413-PLC1.
For construction of pYX242-HT-T7-NDC10 and pACT2-NDC10, the NDC10 coding sequence was generated by PCR with the oligonucleotides NDC10-5 (5'-GCGCGGATCCTGAGATCATCGATTTTGTTTCTACTAAAATTG-3') and NDC10-3 (5'-GCGCGAGCTCTTATTGGGCCCAGTTAGATAGATATACTAACAGACCATCAAATG-3'). Primer NDC10-5 introduces a BamHI site, and NDC10-3 introduces SacI and ApaI sites. The PCR-derived NDC10 fragment was digested with BamHI and SacI and ligated into BamHI and SacI sites of the pACT2 (Clontech) or pYX242-HT-T7 vector (8) to yield pACT2-NDC10 or pYX242-HT-T7-NDC10, respectively. Plasmid pYX232-NDC10-3HA was constructed by ligating a BamHI-ApaI fragment containing NDC10 from pACT2-NDC10 into BamHI- and ApaI-digested pYX232-PLC1-3HA. Plasmids pYX242-NDC10-3HA and pAS2-1-NDC10 were constructed by ligating a BamHI-XhoI fragment from pYX232-NDC10-3HA into BamHI- and XhoI-digested pYX242 or BamHI- and SalI-digested pAS2-1. For construction of the pACT2-NDC10(194-446) and pGEX-5X-1-NDC10(194-446) plasmids, the NDC10 sequence coding for amino acids 194 to 667 was generated by PCR with the primers NDC5 (5'-GCGCGGATCCCAGAAACTAACCATCTCTCTG-3') and NDC3 (5'-TCCGCGAGCTCGAATTCCCGCCTTGATGTGTTAGGCCC-3'). Sequence coding for amino acids 194 to 446 was released from this fragment by digestion with BamHI (introduced by the NDC5 primer) and EcoRI (internal site within the NDC10 sequence) and ligated into similarly digested pACT2 and pGEX-5X-1 plasmids. Plasmids pAS2-1-CTF13 and pACT2-CTF13 were built by first adding a BamHI site to the 5' end of the coding region of CTF13 and an ApaI site to the 3' end of the coding region by PCR with the oligonucleotides CTF5 (5'-GCTAGGATCCCCAGAAGTCCATGTCGC-3') and CTF3 (5'-CGCGCTGCAGGGCCCTTTCACATCGATAAATCTCTACTCG-3'). The fragment was digested with BamHI and ApaI and ligated into BamHI- and ApaI-digested pAS2-1-NDC10 and pACT2-NDC10. Plasmids pAS2-1-CEP3, pACT2-CEP3, pAS2-1-SKP1, and pACT2-SKP1 were constructed in a similar way by adding a BamHI site to the 5' end of the corresponding coding region and an ApaI site to the 3' end of the coding region by PCR. Oligonucleotides CEP5 (5'-GCGCGGATCCGTACCACTCAACTGAAATCC-3') and CEP3 (5'-CGCGCTGCAGGGCCCAGGAAAGTATGTCAGAAATGTTATATTCG-3') were used to build pAS2-1-CEP3 and pACT2-CEP3 plasmids. Oligonucleotides SKP5 (5'-GCGCGGATCCTGACTTCTAATGTTGTCCTAGTGAGTGG-3') and SKP3 (5'-CGCGCTGCAGGGCCCTACGGTCTTCAGCCCATTCATTTTC-3') were used to construct the pAS2-1-SKP1 and pACT2-SKP1 plasmids.One-hybrid assay.
The integrating reporter plasmid
pHISi-1-CEN was constructed by annealing two 5'-end-phosphorylated
oligonucleotides, CEN-5 (5'- [P]AATTCGCGCAGCTGTATTAGTGTATTTGATTTCCGAAAGTTAAAAAAGAAATAGTAAGAAATATATATTTCCC-3') and CEN-3
(5'-[P]GGGAAATATATATTTCTTACTATTTCTTTTTTAACTTTCGGAAAT CAAATACACTAATACAGCTGCGCG-3'),
and by subsequent cloning into EcoRI- and
SmaI-digested pHISi-1 (Clontech, Palo Alto, Calif.). Another reporter plasmid, pHISi-1-CEN-M53, was constructed in the same way as
described above except that the CDEIII sequence with single base
substitutions (underlined; C
A and G
T) was used. Both plasmids were linearized with XhoI and separately transformed into
the YM4271 strain to construct two reporter strains,
YM4271[pHISi-1-CEN] and YM4271[pHISi-1-CEN-M53]. Both reporter
strains were individually transformed with the pACT2-NDC10, pACT2-CEP3,
pACT2-CTF13, pACT2-SKP1, and pACT2-PLC1 plasmids, selected on plates
coated with SD-Leu-His, and subsequently streaked on plates containing
SD-Leu-His plus 50 mM 3-amino-1,2,4-triazole (3-AT).
Chromatin immunoprecipitation.
In vivo chromatin
cross-linking and immunoprecipitation were performed essentially as
described previously (5, 47) with several minor
modifications. Briefly, yeast cells were grown in 50 ml of YPD to an
A600 of 1.2 to 1.5, at which point they were fixed for 2 h by the addition of formaldehyde to a concentration of 1%. Subsequently, the cells were converted to spheroplasts with
Zymolyase (8). Spheroplasts were washed sequentially in 2.5 ml of ice-cold phosphate-buffered saline (10 mM
NaH2PO4, 150 mM NaCl at pH 7.4), 2.5 ml of
buffer I (0.25% Triton X-100, 10 mM EDTA, 0.5 mM EGTA, 10 mM HEPES at
pH 6.5), and 2.5 ml of buffer II (200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA,
10 mM HEPES at pH 6.5). Finally, the spheroplasts were resuspended in
300 µl of lysis buffer (1% sodium dodecyl sulfate, 10 mM EDTA, 50 mM
Tris-HCl at pH 8.0) supplemented with protease inhibitors at the
following concentrations: 10 µg/ml each for leupeptin, aprotinin,
pepstatin, and antipain; 1 mM for phenylmethylsulfonyl fluoride; 2 mM
for benzamidine; 0.5 mM for TLCK
(N
-p-tosyl-L-lysine chloromethyl ketone); and
100 µg/ml for TPCK (N-tosyl-L-phenylalanine
chloromethyl ketone). The suspension was then sonicated 10 times for
10 s each to fragment chromosomal DNAs to an average size of
~500 bp. The suspension was centrifuged for 10 min at
10,000 × g, and the supernatant was diluted with 2.7 ml of dilution buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM
Tris-HCl at pH 8.0) supplemented with protease inhibitors at the
above-named concentrations. The resultant solubilized chromatin
solution was divided in three aliquots (1 ml each), and each aliquot
was precleared by adding 50 µl of 50% protein A-Sepharose 4B slurry
and incubating for 10 min at 4°C with gentle rocking. Beads were then
harvested by centrifugation, and the supernatant was incubated with 4 µg of 12CA5 antibody overnight on ice. Sonicated phage
DNA (2 µg) and protein A-Sepharose 4B beads (50 µl of 50% slurry) were
added, and the incubation continued for 1 h. Beads were then
harvested and washed, and the DNA was released and extracted as
described previously (5).
Mutagenesis of PLC1 and gap repair.
We employed
the PCR procedure for localized mutagenesis and gap repair as described
previously (49). PLC1 was first amplified by PCR
with a slightly error-prone Taq polymerase, using the
primers PLC-M5 (5'-CCTTGACATGATTTTGAAAATGG-3') and PLC-M3
(5'-TAGAGGTGTGGTCAATAAGAGCG-3') and with pGBT9-PLC1 as a
template. The PCR product (100 ng) was cotransformed with 100 ng of
EcoRI- and BamHI-digested pGBT9 into the CG1945
strain harboring the pACT2-NDC10 plasmid. About 105
transformants were selected on SD-Leu-Trp plates and subsequently replica plated onto plates containing SD-Leu-Trp-His plus 2.5 mM 3-AT.
The transformants that were unable to grow on these plates were
identified, and pGBT9-PLC1 mutant plasmids were isolated and
transformed back into the CG1945 strain containing pACT2-NDC10 to
verify the inability of the transformants to grow on plates containing
SD-Leu-Trp-His plus 2.5 mM 3-AT. Twenty pGBT9-PLC1 plasmids were
isolated in this way and transformed in plc1
cells. We
took advantage of the fact that the pGBT9-PLC1 plasmid can suppress the
temperature sensitivity, osmosensitivity, and nocodazole sensitivity of
plc1
cells. We eliminated those pGBT9-PLC1 mutant plasmids, which suppressed none of these phenotypes and were not phenotypically distinguishable from plc1
cells. These
plasmids probably encode mutated Plc1p with grossly reduced ability to function in vivo. All other transformants (plc1
cells
harboring the mutated pGBT9-PLC1 plasmid) displayed temperature
sensitivity and nocodazole sensitivity but osmoresistance (ability to
grow in YPD medium containing 0.7 M NaCl). We selected three mutant plasmids with the tightest phenotypes and subcloned the coding regions
of PLC1 as EcoRI-SalI fragments in the
pRS413-PLCP plasmid (see above) to yield pRS413-PLC1-8, pRS413-PLC1-29,
and pRS413-PLC1-39 (these plasmids express PLC1 from its
natural promoter). The resultant plasmids were transformed in
plc1
cells, and the temperature sensitivity, nocodazole
sensitivity, and osmoresistance of the transformants were confirmed.
Hereafter, these mutants are referred to as the plc1-8,
plc1-29, and plc1-39 mutants.
). About 5 × 104 transformants were selected on plates containing
synthetic complete medium (SC) lacking His at 28°C and subsequently
replica plated onto YPD plates at 37°C and YPD plates containing 0.7 M NaCl at 28°C. The transformants that were unable to grow at 37°C
but grew well at 28°C on YPD plates with 0.7 M NaCl were identified.
Mutagenized pRS413-PLC1 plasmids were isolated and retested in the
HL1-1 strain. Four plasmids were temperature sensitive but
osmoresistant on both minimal and rich medium upon retesting.
Minichromosome stability assay.
Mitotic minichromosome
stability was measured as a fraction of cells that retained the plasmid
after growth in nonselective medium (38, 46). Briefly,
wild-type or plc1
cells containing the empty pRS413
plasmid, or plc1
cells containing PLC1,
plc1-8, plc1-29, or plc1-39 in pRS413
(CEN HIS3) were transformed with the pRS414 plasmid
(CEN TRP1). For each transformant, five single colonies were
inoculated separately into medium nonselective for the pRS414 plasmid
and grown for about 24 h at 28°C. At the end of the growth, the
cultures were still in the exponential phase, as was determined by
counting the cells with a hemacytometer and by measuring
A600. For each culture, the frequency of
Trp+ cells was determined at the time of inoculation
(F0) and at the end of nonselective growth
(Fend) by plating appropriately diluted cultures on YPD
plates and subsequently replica plating them onto SC lacking
tryptophan. The rate of plasmid loss per generation was determined as
described previously (38, 46), according to the equation
Fend = F0(FD)G,
where FD is the fraction of cells in each
generation that retain the minichromosome and G is the
number of generations. The fraction of cells that lose the
minichromosome per generation is (1
FD).
The number of cell doublings was calculated by counting the total cell
numbers at the beginning and at the end of nonselective growth.
strain. Deletion of PLC1
(plc1::URA3) was introduced into the
YPH499 strain (ade2-101) as described previously
(54), and the resultant strain, PN101, was transformed with
the pUN20 and pRS413 plasmids containing a PLC1,
plc1-8, plc1-29, or plc1-39 allele.
For each transformant, five single white colonies (haploid
ade2-101 cells with a single copy of SUP11 are
white) from color plates were inoculated separately into medium nonselective for the pUN20 plasmid and grown for three generations to
eliminate the cells containing more than one copy of the pUN20 plasmid.
Subsequently, the cells were spread onto color medium plates to yield a
density of about 100 colonies per plate and incubated for 4 to 5 days
at 28°C and then overnight at 4°C. The number of half-sectored
red-white colonies (which represent missegregation events that occurred
at the first division after plating) divided by the total number of
mostly white colonies plated represents the missegregation frequency of
the pUN20 minichromosome.
Minichromosome-MT binding assay. Preparation of yeast lysates containing minichromosomes and the minichromosome-MT binding assay were done as described previously (36, 37). Briefly, yeast cultures were grown to an A600 of ~0.6 after the cells were maintained in exponential growth for several generations. In experiments with nocodazole-arrested cells, nocodazole was added to the cultures to 15 µg/ml for 6 h and nocodazole was also present during the preparation of spheroplasts (36). Cells were spheroplasted by glusulase and osmotically lysed in EBB buffer (10 mM Tris-Cl [pH 7.4], 10 mM MgCl2, 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.1 mM dithiothreitol). Minichromosomes were eluted from nuclei by adding 0.3 M NaCl. After 5 min of incubation, the extracts were diluted threefold by adding EBB buffer and subjected to two subsequent centrifugations, each at 15,000 × g for 20 min. The clear supernatant was removed, supplemented with 10 µM taxol, and used for the MT binding assay. Purified tubulin was polymerized in vitro into MTs with an average length of 2 µm as directed by the manufacturer (ICN Biochemicals, Inc.) and stabilized by addition of the MT-stabilizing drug taxol (10 µM final concentration). Different amounts of stabilized MTs were added to 500-µl aliquots of the cleared extracts to initiate the MT binding assay. After 15 min of incubation at room temperature, the reaction mixtures were centrifuged at 15,000 × g for 8 min. The supernatant and pellet fractions were separated, and the amount of minichromosomes in each fraction was determined by Southern blot using a TRP1 probe. The calibration of the band intensities was performed by loading different amounts of the TRP1 DNA fragment on the gels, and the band intensities of the scanned images were quantified using UN-SCAN-IT software (Silk Scientific).
Other methods. Two-hybrid screening, expression and purification of the glutathione S-transferase (GST)-Ndc10(194-446) fusion protein, Western blotting, and coprecipitation assays were carried out as described previously (8, 43). The DNA contents of cells were determined by flow cytometry of propidium iodide-stained cells (64).
| |
RESULTS |
|---|
|
|
|---|
Plc1p interacts with two components of the kinetochore
complex.
Because the gene encoding PtdIns-specific PLC,
PLC1, was isolated in a genetic screen of mutants that
exhibit defects in chromosome segregation (54), it seemed to
us that Plc1p might be involved in kinetochore function. To test this
hypothesis, we used the two-hybrid assay (21) to determine
whether Plc1p interacts with Ndc10p, a component of the CBF3 complex of
the kinetochore. We found that Plc1p interacts with full-length Ndc10p
(Fig. 1A). We also constructed several
truncation alleles of Ndc10p and identified amino acids 194 to 446 as
the essential domain required for interaction with Plc1p (data not
shown). To confirm the interaction between Plc1p and Ndc10p by an
independent biochemical approach, we expressed the domain of Ndc10p
encompassing amino acids 194 to 446 in Escherichia coli as a
fusion with GST, purified the fusion protein on glutathione (GSH)-Sepharose 4B, and tested its ability to interact with Plc1p. Because Plc1p is expressed at a very low level in S. cerevisiae (23), we overexpressed Plc1p from a
high-copy-number vector with a strong, constitutive triose phosphate
isomerase promoter as a C-terminal fusion with three copies of the
hemagglutinin (HA) epitope (plasmid pYX232-PLC-3HA) in a
protease-deficient strain, BJ5465 (43). Cell lysate prepared
from this strain was incubated with GST-Ndc10p(194-446)
fusion protein or with GST protein as the control. The resulting
protein complexes were isolated using GSH-Sepharose 4B beads.
GST-Ndc10p(194-446) fusion protein (but not GST protein)
was able to precipitate Plc1p-3HA from the yeast cell lysate (Fig. 1B),
confirming that Plc1p can interact with Ndc10p.
|
Plc1p associates with the assembled CBF3 complex of the kinetochore. The interaction of Plc1p with Ndc10p and Cep3p can be interpreted in two ways: (i) Plc1p interacts with Ndc10p and Cep3p prior to assembly into the kinetochore or (ii) Plc1p contacts the assembled kinetochore via Ndc10p and Cep3p. Additionally, it is also conceivable that the domains of Ndc10p and Cep3p responsible for the interaction with Plc1p are hidden within the CBF3 complex after assembly of the kinetochore and are not available for interaction with Plc1p. To resolve these issues, we determined whether the assembled CBF3 complex interacts with Plc1p. To this end, we used a modified one-hybrid assay. The one-hybrid system is an in vivo assay used to test binding of a protein to short target DNA sequences. When a DNA binding protein is fused to the Gal4 AD and expressed in yeast, it can bind to its specific recognition sequence inserted in the promoter region of a reporter gene (such as HIS3) and activate its transcription. We used a one-hybrid assay to test the binding of CBF3 proteins to the CDEIII sequence. The rationale was that reporter gene transcription would be activated only if the CBF3 complex was assembled on the CDEIII sequence. Conversely, cis-acting mutations in CDEIII would prevent proper assembly of the CBF3 complex (56), resulting in a failure to activate the transcription of the reporter gene. A similar one-hybrid assay was used previously by Ortiz et al. (51) in a screen which resulted in the identification of Ctf19p, Mcm21p, and Okp1p as components of the kinetochore.
We constructed two new derivatives of the YM4271 reporter strain by inserting either the wild-type CDEIII sequence (strain JC107) or the CDEIII sequence with a point mutation in the conserved CCG motif (strain JC108) upstream in the promoter of the HIS3 reporter gene. JC107 and JC108 cells were then transformed with plasmids for expression of Gal4 AD fusions with Ndc10p, Cep3p, Ctf13p, and Skp1p, and the transformants were streaked on plates containing 50 mM 3-AT. JC107 cells expressing Gal4 AD fusions of Ndc10p and Cep3p were able to grow on plates containing SD-Leu-His plus 50 mM 3-AT. JC108 cells expressing the same fusions, but with the point mutation in the CDEIII sequence, were not able to grow on the same medium (Fig. 1D). JC107 cells expressing the Gal4 AD fusion with Ctf13p grew very weakly, and cells expressing the Skp1p fusion were unable to grow on plates containing SD-Leu-His plus 50 mM 3-AT (data not shown). Interestingly, the JC107 cells expressing the Gal4 AD-Ndc10p fusion were able to grow even at 90 mM 3-AT. Thus, in the JC107 strain, the CBF3 complex can assemble on the CDEIII sequence, and this results in the activation of transcription of the reporter HIS3 gene. A point mutation in the conserved CCG motif of the CDEIII sequence in strain JC108 disrupts assembly of the CBF3 complex and prevents the transcriptional activation of HIS3. When strains JC107 and JC108 were transformed with pACT2-PLC1, Gal4 AD-Plc1p fusion protein was able to activate transcription of HIS3 in the JC107 strain but not in the JC108 strain (Fig. 1D). All four subunits of CBF3 are needed for assembly of CBF3 on CDEIII, and mutations in any one of the four CBF3 subunits abolish the CDEIII binding activity of CBF3 (19, 34, 58). The above results indicate an interaction between Plc1p and the assembled CBF3 complex. However, we cannot exclude the possibility that Plc1p also interacts with the individual Cep3p and Ndc10p components prior to their assembly in CBF3.Plc1p localizes to CEN DNA in vivo.
To test
whether the interaction between Plc1p and the CBF3 complex occurs in
vivo at the CEN locus, we used in vivo cross-linking followed by chromatin immunoprecipitation. Cells expressing Plc1p-3HA were first treated with formaldehyde to cross-link the cellular structures and then lysed and sonicated to shear the chromatin. Subsequently, Plc1p-3HA was immunoprecipitated using anti-HA (12CA5) antibody and protein A-Sepharose. As a positive control, we also used a
strain expressing an epitope-tagged allele of CSE4,
CSE4-HA. Cse4p, a histone H3 variant, is a structural
component of the yeast kinetochore (48). To exclude the
possibility that CEN chromatin is preferentially
precipitated with anti-HA antibody or protein A-Sepharose, we also
performed the chromatin immunoprecipitation with extracts that
contained no HA-tagged proteins. The immunoprecipitated DNA was
analyzed by PCR for the presence of the CEN3 fragment and
two noncentromeric control fragments. The CEN3 DNA fragment specifically coimmunoprecipitated with Plc1p-3HA and Cse4-HAp (Fig.
2). Immunoprecipitates from mock-treated
extracts and from extracts of an untagged strain did not contain
detectable amounts of the CEN3 fragment. In addition,
noncentromeric loci were not also detectable in any immunoprecipitate.
Thus, Plc1p localizes to the centromere in vivo, presumably by
interactions with the CBF3 components Cep3p and Ndc10p.
|
plc1
cells are hypersensitive to nocodazole and
display an increased rate of minichromosome loss.
Nocodazole is an
MT-depolymerizing drug that arrests cells at mitosis (52).
Recent studies suggest that low concentrations of nocodazole alter MT
dynamics and cause unstable attachment of the kinetochore to spindle
MTs (63, 66). Since mutations in kinetochore-associated
proteins can result in nocodazole hypersensitivity (25), we
determined the resistance of plc1
cells to nocodazole. Disruption of PLC1 resulted in nocodazole hypersensitivity
(Fig. 3A). When considered together with
the previous report that mutation in PLC1 causes a
chromosome segregation defect (54), our results suggest that
Plc1p may affect the fidelity of chromosome segregation. Therefore, we
tested the stability of minichromosomes in plc1
cells.
The stability of the pRS413 minichromosome was measured as a fraction
of cells that retained the minichromosome after growth in nonselective
medium (38). The stability of the pUN20 minichromosome
(17) was measured using the half-sectored colony color assay
(29). The results of both methods were in good agreement and
showed that the minichromosome loss rate in plc1
cells
was about fivefold higher than in the wild-type cells (Table
2). Nocodazole (2 µg/ml) increased the
minichromosome loss rate twofold in the wild-type strain but almost
fivefold in plc1
cells (Table 2). This indicates that the
deletion of PLC1 acts synergistically with nocodazole in
destabilizing minichromosomes. It should be noted, however, that this
high rate of loss (32%; Table 2) for plc1
cells in the
presence of nocodazole is at the high limit of the plasmid loss rate
measurable by this assay and corresponds to the loss rate of an
acentric minichromosome or YRp plasmid (36, 38). For the
same reason, we were unable to determine the plasmid loss rate of
plc1
cells in the presence of nocodazole by the
half-sectored colony assay. In this case, frequent sectoring made
identification of half-sectored colonies impossible.
|
|
Disruption of the interaction between Plc1p and Ndc10p results in temperature sensitivity, nocodazole sensitivity, and an increased rate of minichromosome loss. What is the biological significance of the interaction between Plc1p and the kinetochore? To answer this question, we generated three plc1 mutants (the plc1-8, plc1-29, and plc1-39 mutants) that do not interact with Ndc10p (see Materials and Methods). In addition, none of these mutants interacted in the two-hybrid assay with Cep3p or with the assembled kinetochore in the one-hybrid assay described above. All three plc1 mutants displayed slower growth at the permissive temperature (28°C), temperature sensitivity (inability to grow at temperatures higher than 36°C), nocodazole sensitivity (inability to grow in YPD medium containing more than 4 µg of nocodazole per ml), and a slightly higher rate of minichromosome loss (Table 2). All three mutants displayed the osmoresistant phenotype (ability to grow in YPD medium containing 0.7 M NaCl), indicating that a subset of Plc1p functions is not altered in these mutants. To determine if Ndc10p overexpression can suppress the temperature sensitivity and/or nocodazole sensitivity in these mutants, Ndc10p was overexpressed either as an N-terminal fusion with the His tag and T7 epitope (HT-T7) or as a C-terminal fusion with three HA tags. Overexpression of both fusion proteins suppressed the nocodazole sensitivity of the plc1-29 and plc1-39 mutants (Fig. 3B) and weakly suppressed the temperature sensitivity of the plc1-39 mutant (data not shown). These results provide genetic evidence for an interaction between Plc1p and Ndc10p.
To determine whether the enzymatic activities [the hydrolysis of PtdIns(4,5)P2] of the three mutants were likely to be affected, we sequenced the plc1-29, plc1-39, and plc1-8 alleles (Fig. 4). Since the mutations in all three plc1 alleles map to conserved regions which are presumably important for PtdIns(4,5)P2 hydrolysis (7, 18, 20), it is very likely that the enzymatic activities of the plc1 alleles are severely diminished or perhaps completely absent. Therefore, the resulting phenotypes of the three plc1 alleles (temperature sensitivity, nocodazole sensitivity, and minichromosome missegregation) are due to either the kinetochore binding defect, the diminished ability to hydrolyze PtdIns(4,5)P2, or both.
|
plc1
cells exhibit mitotic delay.
In addition
to the kinetochore-MT interactions, the fidelity of chromosome
transmission is also controlled by the action of at least one of the
kinetochore-based mitotic checkpoint control systems (27, 31, 42,
56). Mutations that weaken a single centromere or mutations in
genes that encode centromere DNA binding proteins can delay the cell
cycle in the G2/M stage, suggesting a role for the
kinetochore in checkpoint control systems in yeast cells (16, 53,
59, 64, 65). Despite the good potential for being the
signal-transducing molecule of the kinetochore, Plc1p did not appear to
be involved in mitotic checkpoint control. After treatment with
nocodazole (15 µg/ml), the plc1
cells properly arrested
as large-budded cells and maintained viability for at least 6 h
(data not shown). However, if Plc1p is involved in attachment of an MT
to the kinetochore, then plc1
cells would be expected to
linger in the G2/M stage of the cell cycle, as was observed for ctf13, cep3, and skp1 mutants
(2, 11, 16, 61). We examined the cell and nuclear
morphologies of wild-type and plc1
cells during
exponential growth at 28°C (Table 3).
The frequencies of large-budded cells (with the diameter of the bud
being at least 75% of the diameter of the mother cell) with a single
nucleus positioned within 50% of the mother cell proximal to the neck (53, 59) were 12% for the wild-type strain and 26% for the plc1
strain. Exponentially growing plc1
cells also displayed a larger amount of cells with a 2N DNA content
than the wild-type strain (Fig. 5). Taken
together, these results demonstrate that plc1
cells
exhibit a relatively mild delay at the G2/M stage of the
cell cycle. About 8% of plc1
cells also displayed a
two-budded cell phenotype (Table 3). Depending on the size of the
second bud, it is either with or without a nucleus. The appearance of cells with two buds in the plc1
population suggests an
additional partial defect or delay in cytokinesis. This observation is
supported by the previous work of Flick and Thorner (23),
who described the appearance of multibudded plc1
cells
after 10 h of incubation at 37°C (restrictive temperature for
the plc1
mutant). Perhaps in addition to its role in
G2/M transition, Plc1p has an additional role in
cytokinesis, which is more pronounced during suboptimal growth
conditions, such as high temperature.
|
|
Minichromosomes in plc1
extract exhibit reduced MT
binding.
Previous work suggested that kinetochore function can be
perturbed by a failure either to form the core CEN
DNA-protein complex or to assemble components that interact with the
MTs to ensure faithful chromosome segregation (36). We used
an assay developed by Kingsbury and Koshland (36, 37) to
measure the ability of minichromosomes formed in vivo to bind MTs in
vitro. The wild-type and plc1
mutant strains were
transformed with the centromeric plasmid (minichromosome) pRS414, which
was then assayed in clarified extracts of these cultures for binding to
taxol-stabilized MTs. In the control lysate without MTs, about 2 to 3%
of the plasmid pelleted when it was subjected to centrifugation.
However, in the presence of a saturating concentration of MTs, about
24% of the plasmid pelleted with MTs in the wild-type extract and
about 13% pelleted in the plc1
extract (Table
4). When the same experiment was
performed with the pRS424 plasmid, which does not contain the
CEN sequence and which is segregated by a
kinetochore-independent mechanism, the amounts of plasmid precipitated
from the wild-type and plc1
lysates were nearly identical
and increased from only 2% (control experiment without MTs) to about
4% (saturating concentration of MTs). To improve the sensitivity of
the assay and to exclude the possibility that the observed difference
in MT binding activities between the two strains was merely the result
of different cell cycle profiles, the assay was also performed with
lysates prepared from nocodazole-arrested cells (Table 4). The
G2/M transition is the phase when the kinetochore is
required for progression of the cell cycle through mitosis. It is also
when the kinetochore is in its most active state. Kinetochores of cells
arrested with nocodazole at the G2/M transition exhibit the
highest MT binding activity (36). Our data for the wild-type
strain correspond to these previous results. The saturating
concentration of MTs pelleted about 48% of the plasmid in the
wild-type strain but only 28% in the plc1
strain (Table
4). The amount of 2µm plasmid (pRS424) precipitated from
nocodazole-arrested wild-type and plc1
cells did not
significantly differ from the amounts precipitated from asynchronous
cultures and ranged from 2% in experiments without MTs to about 4% in
experiments with a saturating concentration of MTs (data not shown).
Although the difference in MT binding between the wild-type and
plc1
strains is relatively small, it is reproducible in
both asynchronous and mitotic extracts and suggests that in
plc1
cells the kinetochore function is indeed partially
impaired.
|
| |
DISCUSSION |
|---|
|
|
|---|
It is generally accepted that PtdIns signaling pathways are present in nuclei (4, 14), and enzymes responsible for PtdIns turnover and signaling, such as PLC and protein kinase C, have been identified in the nuclear interior, associated with nonmembrane nuclear structures (10, 13, 45, 55). The nuclear PtdIns cycle is regulated independently of the PtdIns cycle at the plasma membrane (14). Nuclear PtdIns(4,5)P2, for instance, decreases as cells progress through the S phase of the cell cycle (69), and nuclear PLC activity and DG levels increase at the G2/M transition (62). However, the processes regulated by the nuclear PtdIns cycle have not been identified and the biological function of the nuclear PtdIns cycle remains unknown. Our data demonstrate that in S. cerevisiae Plc1p associates with kinetochores and appears to affect the binding of kinetochores to MTs.
Plc1p exhibits all three characteristics expected of a kinetochore
protein (61). First, Plc1p associates with centromeric DNA
through interaction with the CBF3 complex. Second, plc1
cells delay in the G2/M stage of the cell cycle, are
hypersensitive to nocodazole, and display a greater instability of
minichromosomes. In addition, minichromosomes isolated from
plc1
cells have a reduced ability to bind MTs. Third, in
comparison with the wild-type cells, plc1-1 mutant cells
display a 32-fold-higher frequency of missegregation of a chromosome
fragment (cen3X69) carrying a destabilizing mutation in the
CDEIII region of the centromere (54).
The CBF3 complex is essential for binding of kinetochores to MTs in vitro. However, CBF3 does not mediate efficient MT attachment on its own (57). Attachment requires the presence of additional cellular factors. It was proposed that CBF3 forms a DNA-binding scaffold onto which additional kinetochore components assemble, including proteins that directly bind to MTs (57). However, the identities of these proteins remain unknown. Our data suggest that Plc1p may be one of these accessory proteins of the kinetochore involved in binding MTs.
Since Plc1p is not essential for cell viability and does not contain a recognizable MT binding motif, it is more likely that Plc1p has a regulatory rather than a structural role in the MT-kinetochore interaction. An alternative explanation may be that CBF3 subunits bind MTs directly but that Plc1p is required to achieve an active MT binding conformation of the CBF3 subunits. Using in vivo cross-linking and immunoprecipitation, Meluh and Koshland (47) demonstrated the existence of centromeric subcomplexes which probably correspond to kinetochore assembly intermediates. In their model, kinetochore assembly initiates with recruitment of the CBF3 complex, and possibly Mif2p, to CDEIII. The resultant subcomplex then serves as the nucleation site around which a fully functional kinetochore is assembled if CDEI and CDEII are adjacent. Conceivably, Plc1p may function in this folding process, which may affect the ability of kinetochores to bind MTs.
The MT binding activity of kinetochore complexes is high in mitotic extracts and low in interphase extracts. However, the DNA binding activity of CBF3 is high in both stages (57). These results suggest that CBF3 is assembled on the centromeric DNA throughout the cell cycle but that the MT attachment is controlled by a cell cycle-dependent interaction of additional factors with a constitutively bound CBF3 scaffold. At present we do not know whether Plc1p remains stably localized at the CEN locus throughout the cell cycle or whether it localizes to the CEN locus only during a particular stage(s) of the cell cycle.
Currently, it is difficult to determine whether only the ability of
Plc1p to bind kinetochores or this binding ability and Plc1p's
enzymatic activity are required for the apparent mitotic functions of
Plc1p. The sequencing of the plc1-29, plc1-39,
plc1-8, and plc1-113 alleles revealed that they
all acquired mutations which likely affect the enzymatic activity.
Since all of these mutants failed to interact with Ndc10p and Cep3p in
a two-hybrid assay and with the CBF3 complex in a one-hybrid assay, we
believe that they do not interact with kinetochores. Therefore, the
corresponding phenotypes can be attributed to either a loss of binding
to kinetochores, a decrease (or loss) of enzymatic activity, or both.
Since plc1
cells display only a mild mitotic delay and
only a sixfold-increased rate of minichromosome loss, it seems likely
that Plc1p is not a direct structural component of the kinetochore but
rather a regulatory factor affecting some aspects of the kinetochore activity.
Since kinetochores are unlikely to contain any PtdIns(4,5)P2 component which could be used as a substrate for Plc1p, it seems unlikely that Plc1p would hydrolyze PtdIns(4,5)P2 at the kinetochore. It is possible that the interaction of Plc1p with the kinetochore is spatially and perhaps also temporally separated from its enzymatic activity. It remains to be determined which of these two events [binding to kinetochore and hydrolysis of PtdIns(4,5)P2] is relevant for the observed mitotic functions of Plc1p. However, since nuclei of mammalian cells contain a pool of PtdIns(4,5)P2 which is not associated with nuclear envelope (4, 6, 71), the possibility that the kinetochore-bound Plc1p hydrolyzes PtdIns(4,5)P2 cannot be completely discarded. It will be important to determine whether Plc1p remains localized to the CEN locus throughout the cell cycle or whether it localizes to the CEN locus only during a particular stage(s) of the cycle and whether this localization and interaction with the CBF3 complex regulates the Plc1p-dependent hydrolysis of PtdIns(4,5)P2. The possibility that PLC is regulated in a cell cycle-specific manner is supported by the observation that in mammalian cells nuclear PLC activity and DG levels are increased at the G2/M transition (62). In this context, it will be important to explore further the role of PLC during mitosis in both yeast and mammalian cells.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the National Institutes of Health (1R15 GM/OD55937-01) and the American Cancer Society (BE-239) to A.V.
We are grateful to D. Burke, M. Fitzgerald-Hayes, M. Hall, P. Hieter, D. Koshland, M. Smith, F. Spencer, and J. Thorner for providing plasmids and strains and to P. Paine and I. Vancurova for critical readings of the manuscript and helpful comments. We thank the staff of the Flow Cytometry Laboratory of the State University of New York at Stony Brook for performing the FACS analysis and the DNA sequencing facility of the Michigan State University for sequencing the plc1 mutants.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biological Sciences, St. John's University, 8000 Utopia Parkway, Jamaica, NY 11439. Phone: (718) 990-6287. Fax: (718) 990-5958. E-mail: vancuraa{at}stjohns.edu.
Present address: Department of Medicine and Pathology, Washington
University School of Medicine, St. Louis, MO 63110.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ansari, K.,
S. Martin,
M. Farkasovsky,
I. M. Ehbrecht, and H. Kuntzel.
1999.
Phospholipase C binds to the receptor-like GPR1 protein and controls pseudohyphal differentiation in Saccharomyces cerevisiae.
J. Biol. Chem.
274:30052-30058 |
| 2. | Bai, C., P. Sen, K. Hofmann, L. Ma, M. Goebl, J. W. Harper, and S. J. Elledge. 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86:263-274[CrossRef][Medline]. |
| 3. | Berridge, M. J. 1993. Inositol triphosphate and calcium signaling. Nature 361:315-325[CrossRef][Medline]. |
| 4. |
Boronenkov, I. V.,
J. C. Loijens,
M. Umeda, and R. A. Anderson.
1998.
Phosphoinositide signaling pathways in nuclei are associated with nuclear speckles containing pre-mRNA processing factors.
Mol. Biol. Cell
9:3547-3560 |
| 5. |
Braunstein, M.,
A. B. Rose,
S. G. Holmes,
C. D. Allis, and J. R. Broach.
1993.
Transcriptional silencing in yeast is associated with reduced nucleosome acetylation.
Genes Dev.
7:592-604 |
| 6. | Caramelli, E., A. Matteucci, N. Zini, C. Carini, L. Guidotti, D. Ricci, N. M. Maraldi, and S. Capitani. 1996. Nuclear phosphoinositide-specific phospholipase C, phosphatidylinositol 4,5-bisphosphate and protein kinase C during rat spermatogenesis. Eur. J. Cell Biol. 71:154-164[Medline]. |
| 7. |
Cheng, H.-F.,
M.-J. Jiang,
C.-L. Chen,
S.-M. Liu,
L.-P. Wong,
J. W. Lomasney, and K. King.
1995.
Cloning and identification of amino acid residues of human phospholipase C 1 essential for catalysis.
J. Biol. Chem.
270:5495-5505 |
| 8. |
Choi, J. H.,
W. Lou, and A. Vancura.
1998.
A novel membrane-bound glutathione S-transferase functions in the stationary phase of the yeast Saccharomyces cerevisiae.
J. Biol. Chem.
273:29915-29922 |
| 9. | Coccetti, P., R. Tisi, E. Martegani, L. S. Teixeira, R. L. Brandao, I. M. Castro, and J. M. Thevelein. 1998. The PLC1 encoded phospholipase C in the yeast Saccharomyces cerevisiae is essential for glucose-induced phosphatidylinositol turnover and activation of plasma membrane H+-ATPase. Biochim. Biophys. Acta 1405:147-154[Medline]. |
| 10. | Cocco, L., R. S. Gilmour, A. Ognibene, A. J. Letcher, F. A. Manzoli, and R. F. Irvine. 1987. Synthesis of polyphosphoinositides in nuclei of Friend cells. Evidence for polyphosphoinositide metabolism inside the nucleus which changes with cell differentiation. Biochem. J. 248:765-770[Medline]. |
| 11. | Connelly, C., and P. Hieter. 1996. Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression. Cell 86:275-285[CrossRef][Medline]. |
| 12. |
Cooper, K. F.,
M. J. Mallory, and R. Strich.
1999.
Oxidative stress-induced destruction of the yeast C-type cyclin Ume3p requires phosphatidylinositol-specific phospholipase C and the 26S proteasome.
Mol. Cell. Biol.
19:3338-3348 |
| 13. | Divecha, N., H. Banfic, and R. F. Irvine. 1991. The polyphosphoinositide cycle exists in the nuclei of Swiss 3T3 cells under the control of a receptor (for IGF-I) in the plasma membrane, and stimulation of the cycle increases nuclear diacylglycerol and apparently induces translocation of protein kinase C to the nucleus. EMBO J. 10:3207-3214[Medline]. |
| 14. | Divecha, N., H. Banfic, and R. F. Irvine. 1993. Inositides and the nucleus and inositides in the nucleus. Cell 74:405-407[CrossRef][Medline]. |
| 15. | Divecha, N., and R. F. Irvine. 1995. Phospholipid signaling. Cell 80:269-278[CrossRef][Medline]. |
| 16. | Doheny, K. F., P. K. Sorger, A. A. Hyman, S. Tugendreich, F. Spencer, and P. Hieter. 1993. Identification of essential components of the Saccharomyces cerevisiae kinetochore. Cell 73:761-774[CrossRef][Medline]. |
| 17. | Elledge, S. J., and R. W. Davis. 1988. A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cerevisiae. Gene 70:303-312[CrossRef][Medline]. |
| 18. |
Ellis, M. V.,
S. R. James,
O. Perisic,
C. P. Downes,
R. L. Williams, and M. Katan.
1998.
Catalytic domain of phosphoinositide-specific phospholipase C (PLC). Mutational analysis of residues within the active site and hydrophobic ridge of PLC 1.
J. Biol. Chem.
273:11650-11659 |
| 19. |
Espelin, C. W.,
K. B. Kaplan, and P. K. Sorger.
1997.
Probing the architecture of a simple kinetochore using DNA-protein crossing.
J. Cell Biol.
139:1383-1396 |
| 20. | Essen, L.-O., O. Perisic, M. Katan, Y. Wu, M. F. Roberts, and R. L. Williams. 1997. Structural mapping of the catalytic mechanism for a mammalian phosphoinositide-specific phospholipase C. Biochemistry 36:1704-1718[CrossRef][Medline]. |
| 21. | Fields, S., and O. K. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245-246[CrossRef][Medline]. |
| 22. | Fitzgerald-Hayes, M., L. Clarke, and J. Carbon. 1982. Nucleotide sequence comparisons and functional analysis of yeast centromere DNAs. Cell 29:235-244[CrossRef][Medline]. |
| 23. |
Flick, J., and J. Thorner.
1993.
Genetic and biochemical characterization of a phosphatidylinositol-specific phospholipase C in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:5861-5876 |
| 24. |
Flick, J., and J. Thorner.
1998.
An essential function of a phosphoinositide-specific phospholipase C is relieved by inhibition of a cyclin-dependent protein kinase in the yeast Saccharomyces cerevisiae.
Genetics
148:33-47 |
| 25. | Foreman, P. K., and R. W. Davis. 1996. CDP1, a novel Saccharomyces cerevisiae gene required for proper nuclear division and chromosome segregation. Genetics 144:1387-1397[Abstract]. |
| 26. |
Goh, P. Y., and J. V. Kilmartin.
1993.
NDC10: a gene involved in chromosome segregation in Saccharomyces cerevisiae.
J. Cell Biol.
121:503-512 |
| 27. | Gorbsky, G. J. 1997. Cell cycle checkpoints: arresting progress in mitosis. Bioessays 19:193-197[CrossRef][Medline]. |
| 28. |
Hegemann, J. H.,
J. H. Shero,
G. Cottarel,
P. Philippsen, and P. Hieter.
1988.
Mutational analysis of centromere DNA from chromosome VI of Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:2523-2535 |
| 29. | Hieter, P., C. Mann, M. Snyder, and R. W. Davis. 1985. Mitotic stability of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40:381-392[CrossRef][Medline]. |
| 30. | Hieter, P., D. Pridmore, J. H. Hegemann, M. Thomas, R. W. Davis, and P. Philippsen. 1985. Functional selection and analysis of yeast centromeric DNA. Cell 42:913-921[CrossRef][Medline]. |
| 31. | Hoyt, M. A., L. Totis, and B. T. S. Roberts. 1991. S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell 66:507-517[CrossRef][Medline]. |
| 32. | James, S. 1998. The structure of phospholipase C isoforms and the regulation of phosphoinositide hydrolysis. Biochem. Soc. Trans. 26:354-359[Medline]. |
| 33. |
Jiang, W.,
J. Lechner, and J. Carbon.
1993.
Isolation and characterization of a gene (CBF2) specifying a protein component of the budding yeast kinetochore.
J. Cell Biol.
121:513-519 |
| 34. | Kaplan, K. B., A. A. Hyman, and P. K. Sorger. 1997. Regulating the yeast kinetochore by ubiquitin-dependent degradation and Skp1p-mediated phosphorylation. Cell 91:491-500[CrossRef][Medline]. |
| 35. | Katan, M. 1998. Families of phosphoinositide-specific phospholipase C: structure and function. Biochim. Biophys. Acta 1436:5-17[Medline]. |
| 36. | Kingsbury, J., and D. Koshland. 1991. Centromere-dependent binding of yeast minichromosomes to microtubules in vitro. Cell 66:483-495[CrossRef][Medline]. |
| 37. | Kingsbury, J., and D. Koshland. 1993. Centromere function on minichromosomes isolated from budding yeast. Mol. Biol. Cell 4:859-870[Abstract]. |
| 38. | Koshland, D., L. Rutledge, M. Fitzgerald-Hayes, and L. H. Hartwell. 1987. A genetic analysis of dicentric minichromosomes in Saccharomyces cerevisiae. Cell 48:801-812[CrossRef][Medline]. |
| 39. | Lechner, J. 1994. A zinc finger protein, essential for chromosome segregation, constitutes a putative DNA binding subunit of the Saccharomyces cerevisiae kinetochore complex, Cbf3. EMBO J. 13:5203-5211[Medline]. |
| 40. | Lechner, J., and J. Carbon. 1991. A 240 kd multisubunit protein complex, CBF3, is a major component of the budding yeast centromere. Cell 64:717-725[CrossRef][Medline]. |
| 41. | Lee, S. B., and S. G. Rhee. 1995. Significance of PIP2 hydrolysis and regulation of phospholipase C isozymes. Curr. Opin. Cell Biol. 7:183-189[CrossRef][Medline]. |
| 42. | Li, R., and A. W. Murray. 1991. Feedback control of mitosis in budding yeast. Cell 66:519-531[CrossRef][Medline]. |
| 43. | Lin, H., J. H. Choi, and A. Vancura. 1998. Phosphoinositide-specific phospholipase C interacts with phosphatidylinositol kinase homolog TOR2. Biochem. Biophys. Res. Commun. 252:285-289[CrossRef][Medline]. |
| 44. | Majerus, P. W. 1992. Inositol phosphate biochemistry. Annu. Rev. Biochem. 61:225-250[CrossRef][Medline]. |
| 45. | Martelli, A. M., R. S. Gilmour, V. Bertagnolo, L. M. Neri, L. Manzoli, and L. Cocco. 1992. Nuclear localization and signalling activity of phosphoinositidase C beta in Swiss 3T3 cells. Nature 358:242-245[CrossRef][Medline]. |
| 46. | Meluh, P. B., and D. Koshland. 1995. Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol. Biol. Cell 6:793-807[Abstract]. |
| 47. |
Meluh, P. B., and D. Koshland.
1997.
Budding yeast centromere composition and assembly as revealed by in vivo cross-linking.
Genes Dev.
11:3401-3412 |
| 48. | Meluh, P. B., P. Yang, L. Glowczewski, D. Koshland, and M. M. Smith. 1998. Cse4p is a component of the core centromere of Saccharomyces cerevisiae. Cell 94:607-613[CrossRef][Medline]. |
| 49. | Muhlrad, D., R. Hunter, and R. A. Parker. 1992. A rapid method for localized mutagenesis of yeast genes. Yeast 8:79-82[CrossRef][Medline]. |
| 50. |
Nishizuka, Y.
1992.
Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C.
Science
258:607-614 |
| 51. |
Ortiz, J.,
O. Stemman,
S. Rank, and J. Lechner.
1999.
A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore.
Genes Dev.
13:1140-1155 |
| 52. |
Owellen, R. J.,
C. A. Hartke,
R. M. Dickerson, and F. O. Hains.
1976.
Inhibition of tubulin-microtubule polymerization by drugs of the vinca alkaloid class.
Cancer Res.
36:1499-1502 |
| 53. | Pangilinan, F., and F. Spencer. 1996. Abnormal kinetochore structure activates the spindle assembly checkpoint in budding yeast. Mol. Biol. Cell 7:1195-1208[Abstract]. |
| 54. |
Payne, W. E., and M. Fitzgerald-Hayes.
1993.
A mutation in PLC1, a candidate phosphainositide-specific phospholipase C gene from Saccharomyces cerevisiae, causes aberrant mitotic chromosome segregation.
Mol. Cell. Biol.
13:4351-4364 |
| 55. |
Payrastre, B.,
M. Nievers,
J. Boonstra,
M. Breton,
A. J. Verkleij, and P. M. Van Bergen en Henegouwen.
1992.
A differential location of phosphoinositide kinases, diacylglycerol kinase, and phospholipase C in the nuclear matrix.
J. Biol. Chem.
267:5078-5084 |
| 56. | Rudner, A. D., and A. W. Murray. 1996. The spindle assembly checkpoint. Curr. Opin. Cell Biol. 8:773-780[CrossRef][Medline]. |
| 57. |
Sorger, P. K.,
F. F. Severin, and A. A. Hyman.
1994.
Factors required for the binding of reassembled yeast kinetochores to microtubules in vitro.
J. Cell Biol.
127:995-1008 |
| 58. |
Sorger, P. K.,
K. F. Doheny,
P. Hieter,
K. M. Kopski,
T. C. Huffaker, and A. A. Hyman.
1995.
Two genes required for the binding of an essential Saccharomyces cerevisiae kinetochore complex to DNA.
Proc. Natl. Acad. Sci. USA
92:12026-12030 |
| 59. |
Spencer, F., and P. Hieter.
1992.
Centromere DNA mutations induce a mitotic delay in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
89:8908-8912 |
| 60. | Stemmann, O., and J. Lechner. 1996. The Saccharomyces cerevisiae kinetochore contains a cyclin-CDK complexing homologue, as identified by in vitro reconstitution. EMBO J. 15:3611-3620[Medline]. |
| 61. |
Strunnikov, A. V.,
J. Kingsbury, and D. Koshland.
1995.
CEP3 encodes a centromere protein of Saccharomyces cerevisiae.
J. Cell Biol.
128:749-760 |
| 62. |
Sun, B.,
N. R. Murray, and A. P. Fields.
1997.
A role for nuclear phosphatidylinositol-specific phospholipase C in the G2/M phase transition.
J. Biol. Chem.
272:26313-26317 |
| 63. | Vasquez, R. J., B. Howell, A. M. C. Yvon, P. Wadsworth, and L. Cassimeris. 1997. Nanomolar concentrations of nocodazole alter microtubule dynamic instability in vivo and in vitro. Mol. Biol. Cell 8:973-985[Abstract]. |
| 64. | Wang, Y., and D. J. Burke. 1995. Checkpoint genes required to delay cell division in response to nocodazole respond to impaired kinetochore function in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 15:6838-6844[Abstract]. |
| 65. |
Wells, W. A. E., and A. W. Murray.
1996.
Aberrantly segregating centromeres activate the spindle assembly checkpoint in budding yeast.
J. Cell Biol.
133:75-84 |
| 66. | Wendell, K. L., L. Wilson, and M. A. Jordan. 1993. Mitotic block in HeLa cells by vinblastine: ultrastructural changes in kinetochore-microtubule attachment and centrosomes. J. Cell Sci. 104:261-274[Abstract]. |
| 67. |
Winey, M.,
C. L. Mamay,
E. T. O'Toole,
D. N. Mastronarde,
T. H. Giddings, Jr.,
K. L. McDonald, and J. R. McIntosh.
1995.
Three-dimensional ultrastructural analysis of the Saccharomyces cerevisiae mitotic spindle.
J. Cell Biol.
129:1601-1615 |
| 68. |
Yoko-o, T.,
Y. Matsui,
H. Yagisawa,
H. Nojima,
I. Uno, and A. Toh-e.
1993.
The putative phosphoinositide-specific phospholipase C gene, PLC1, of the yeast Saccharomyces cerevisiae is important for cell growth.
Proc. Natl. Acad. Sci. USA
90:1804-1808 |
| 69. |
York, J. D., and P. W. Majerus.
1994.
Nuclear phosphatidylinositols decrease during S-phase of the cell cycle in HeLa cells.
J. Biol. Chem.
269:7847-7850 |
| 70. |
York, J. D.,
A. R. Odom,
R. Murphy,
E. B. Ives, and S. R. Wente.
1999.
A phospholipase C-dependent inositol polyphosphate kinase pathway required for efficient messenger RNA export.
Science
285:96-100 |
| 71. |
Zini, N.,
L. M. Neri,
A. Ognibene,
K. Scotlandi,
N. Baldini, and N. M. Maraldi.
1997.
Increase of nuclear phosphatidylinositol 4,5-bisphosphate and phospholipase C 1 is not associated to variations of protein kinase C in multidrug-resistant saos-2 cells.
Microsc. Res. Tech.
36:172-178[CrossRef][Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»