Previous Article | Next Article 
Molecular and Cellular Biology, May 2000, p. 3626-3632, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of a Novel E2F3 Product Suggests a Mechanism for
Determining Specificity of Repression by Rb Proteins
Gustavo
Leone,
Faison
Nuckolls,
Seiichi
Ishida,
Monique
Adams,
Rosalie
Sears,
Laszlo
Jakoi,
Alexander
Miron,§ and
Joseph R.
Nevins*
Department of Genetics, Howard Hughes Medical
Institute, Duke University Medical Center, Durham, North Carolina
27710
Received 29 October 1999/Returned for modification 23 November
1999/Accepted 22 February 2000
 |
ABSTRACT |
The tumor suppressor function of Rb is intimately related to its
ability to interact with E2F and repress the transcription of E2F
target genes. Here we describe a novel E2F product that specifically
interacts with Rb in quiescent cells. This novel E2F, which we term
E2F3b, is encoded by a unique mRNA transcribed from an intronic
promoter within the E2F3 locus. The E2F3b RNA differs from the
previously characterized E2F3 RNA, which we now term E2F3a, by the
utilization of a unique coding exon. In contrast to the E2F3a product
that is tightly regulated by cell growth, the E2F3b product is
expressed equivalently in quiescent and proliferating cells. But,
unlike the E2F4 and E2F5 proteins, which are also expressed in
quiescent cells and form complexes with the p130 protein, the E2F3b
protein associates with Rb and represents the predominant E2F-Rb
complex in quiescent cells. Thus, the previously described specificity
of Rb function as a transcriptional repressor in quiescent cells
coincides with the association of Rb with this novel E2F product.
 |
INTRODUCTION |
Pathways controlling the progression
of cells out of quiescence, through G1, and into S phase
have now been elucidated in considerable detail. A variety of studies
have demonstrated the role of G1 cyclin-dependent kinases
(cdk) that phosphorylate and control the activity of Rb and related
proteins, leading to the accumulation of E2F transcription factor
activity (for reviews, see references 6, 9, 17, 21, 26,
27, and 30). It is also clear that the
disruption of this pathway, either through the activation of
positive-acting components such as the G1 cyclins or the
inactivation of negative components such as p53, Rb, and the cyclin
kinase inhibitors, can lead to a loss of cell growth control that
underlies the development of various forms of human cancer (10,
30).
E2F activity is comprised of a complex array of DNA binding activities
involving various members of a family of related proteins that include
six distinct E2F members and at least two heterodimer partners, DP1 and
DP2 (4, 22). The complexity of the E2F activity suggests a
complexity of function whereby the individual family members might play
distinct roles in cellular growth control. Indeed, emerging evidence
indicates that distinct roles can be ascribed to the individual E2F
activities. For instance, it has been suggested that the E2F4 and E2F5
proteins, which specifically associate with the Rb-related p130 protein
in quiescent cells (28), function to repress transcription
of various genes encoding proteins important for cell growth. In
contrast, E2F3 has been suggested to play a positive role in
transcription control during the cell cycle and appears to be important
for efficient induction of S phase in cycling cells (18).
E2F1, on the other hand, appears to function in the induction of
apoptosis (2, 14, 23, 25, 31), accumulating at the initial
G1/S transition as cells re-enter the cell cycle
(18).
Additional insight into the role of E2F and Rb family proteins in the
control of transcription has come from the analysis of expression of
various E2F target genes in cells derived from mouse embryos deficient
in Rb family members (7, 11). These studies have provided
evidence for deregulation of various E2F target genes in cells lacking
Rb or Rb family members. Particularly striking is the specificity in
the control of E2F-regulated genes exhibited by individual Rb family
members (11). The absence of Rb function coincided with
partial derepression of cyclin E and p107 expression but normal control
of various other E2F targets. In contrast, the combined absence of the
p130 and p107 activities led to the deregulation of a number of E2F
targets but no change in cyclin E nor p107. These results thus suggest
that the individual Rb family members play distinct roles in the
control of transcription in quiescent cells.
We have now further explored the role of E2F activities in the control
of gene expression as a function of cell proliferation. Because of
recent work that highlights an apparent important role of E2F3 activity
in regulating transitions during the cell cycle (18), we
have further analyzed the control of E2F3 accumulation in quiescent and
growing cells. In so doing, we have revealed a complexity in the
organization of the E2F3 locus whereby two independent but
overlapping transcription units direct the synthesis of two distinct
mRNAs that differ with respect to the initial exon utilized. These two
RNAs encode related but distinct proteins that differ with respect to
expression. In particular, we find that an E2F3 product that is
expressed in quiescent cells specifically associates with Rb and thus
may be critical for the specificity of Rb transcription control in
quiescent cells.
 |
MATERIALS AND METHODS |
Cell culture.
REF52 cells were grown in Dulbecco modified
Eagle medium (DMEM) containing 10% serum (5% fetal bovine serum and
5% calf serum). To bring cells to quiescence, cells were plated at
approximately 3,500 cells/cm2 and incubated overnight. The
next day, the cells were washed once with DMEM, and the culture medium
was replaced with DMEM containing 0.25% serum; cells were then further
incubated for 48 h prior to replacement with culture medium
containing 10% serum.
Isolation of E2F3 genomic DNA.
A mouse BAC library (Genome
Systems) was screened with a 1.5-kb human E2F3 cDNA probe isolated by
HindIII/BamHI digestion of pcDNA3-E2F3. Two
positive clones, 305 G72 and 146 J18, were identified and isolated.
EcoRI, HindIII, and KpnI digestion
of the two clones demonstrated similar restriction patterns.
Construction of plasmids.
Mouse BAC clone 305 G72 was
digested with EcoRI and HindIII. A 532-bp
N-terminal HindIII/DraI human cDNA probe
isolated a 6.5-kb EcoRI fragment and a 3-kb
HindIII fragment. A 943-bp N-terminal HindIII/HindII human cDNA probe isolated
both a 6.5- and a 15-kb EcoRI fragment. The 3-kb
HindIII fragment and the 6.5- and 15-kb EcoRI
fragments were subcloned into pBluescript SK(+/
) creating the
constructs 3kbH3pBS, 6.5kbpBS, and 15kbpBS.
SacI/HaeII digestion of 3kbH3pBS excised the 2-kb
promoter fragment of E2F3a, which was directionally subcloned into
SacI/HindIII-digested pGL2Basic (Promega).
The primers GAGAGAGATCTTCCGAAAGCAGCCTGG and
GAGAGAGATCTAATACCCTCCTCAGCG containing BglII
sites were used to generate a 1.1-kb E2F3b promoter fragment via PCR.
The PCR product was digested with BglII, subcloned into
BglII-digested pGL2Basic, and sequenced.
RACE (rapid amplification of cDNA ends) analysis.
A cDNA
library was generated from quiescent mouse embryo fibroblasts (MEF)
using the protocol described in the Marathon cDNA Amplification Kit
(Clontech). In accordance with the kit, the first gene specific primer
(GSP1), which anneals in exon 5, used to amplify 5'E2F3b sequence was
ACTTCAAGTCTCGTTTCTGGAAGGGCTTTCACAAC. The product of the
first round of amplification was used as the template for a second
round of amplification. A more upstream primer (GSP2) that anneals in
exon 4 and contains a nested NotI site was used in the
second amplification: GAGAGAGCGGCCGCAATCCTCGGTTAACAGTTTGAGGTCCAG. The amplified product was digested with NotI, ligated
into NotI-digested pBS, and sequenced.
Primer extension analysis.
The transcription start sites for
the murine E2F3a and E2F3b transcripts were determined by primer
extension analysis as described previously (5). Poly(A)
containing RNA was prepared from MEF that were synchronized at
G1/S by hydroxyurea arrest, and 5 µg was used for primer
extension. The primer for E2F3a derived from 5' untranslated region
(UTR) sequence within exon 1a (5'-CTCGTCCTCGCTCTCTACTCTTTCCCC-3'); the primer for E2F3b derived from exon 1b sequence
(5'-CGGTAGTCATGGAGAGTCTACC-3'). The products of primer
extension were analyzed in an 8% polyacrylamide gel containing 7 M
urea along with products of DNA sequencing reactions generated with an
exon 1a primer (5'-CCTCCGCTCTTCCTCTCTGAACC-3').
Viruses.
The construction of Ad-Con and Ad-Myc have been
previously described (2).
Northern analysis.
Poly(A)+ RNA was isolated
from an equal amount of total RNA and processed for Northern analysis
as described previously (1).
E2F DNA binding assays.
E2F assays were performed as
previously described (12). Supershift analysis was carried
out as previously described (12) using antibodies specific
for E2F1 (SC-251x), E2F3 C terminus (SC-878), or E2F3 N terminus
(SC-879). The E2F3 C-terminal antibody was generated against an
18-amino-acid peptide from the C terminus of E2F3
(DLFDAYDLEKLPLVEDFMCS), which is common to both the
E2F3a and the E2F3b proteins. The E2F3 N-terminal antibody was raised against a 20-amino-acid peptide from the N terminus of the E2F3a sequence (MRKGIQPALEQYLVTAGGGE). Immunoglobulin G (IgG) was used as a
control (Santa Cruz). Immunoprecipitation followed by release with
deoxycholate (DOC) were performed as described previously (12).
Promoter transfection assays.
REF52 cells were transfected
with either E2F3a-Luc or E2F3b-Luc reporter vectors and cytomegalovirus
(CMV)-
-galactosidase as an internal control as described previously
(24). After transfection, cells were brought to quiescence
by serum starvation and then stimulated to grow by the addition of
fresh medium with serum. Cells were harvested at various times after
stimulation and luciferase, and
-galactosidase assays were performed
as described earlier (24).
 |
RESULTS |
Expression of the E2F3 locus following stimulation of
cell growth.
Previous studies have detailed the distinct pattern
of expression of the various E2F family genes (4, 22); an
example of this, as measured by Northern blot assays, is shown in Fig. 1A. Particularly striking is the distinct
pattern of expression of the E2F1 and E2F2 genes compared to that of
E2F4 and E2F5. Whereas the expression of the latter two genes is
relatively constant as cells progress out of quiescence and into a cell
cycle, the accumulation of the E2F1 and E2F2 RNAs is tightly regulated
with little or no RNA evident in quiescent cells and then a large
induction as cells pass through G1. Previous work has shown
that this is largely a function of negative autoregulatory control of
these genes in quiescent cells (8, 13, 20, 24). That is, the presence of E2F binding elements within the E2F1 and E2F2 promoters allows repression of transcription in quiescent cells, presumably mediated by an E2F-Rb family member complex.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of E2F family members following stimulation
of cell growth. (A) Expression of E2F family RNAs following stimulation
of REF52 cell growth. Cells were brought to quiescence by serum
starvation and then stimulated to grow by the addition of fresh media
with serum. Samples were taken at the indicated times, and RNA was
prepared and analyzed by Northern blotting as described in Materials
and Methods. The transition from G1 to S phase, as
indicated at the bottom of the figure, was determined by flow
cytometry. (B) Genomic organization of the E2F3 locus. The exon-intron
structure that includes the initial five exons of the E2F3 locus is
shown in relation to restriction maps. (C) Northern analysis with E2F3
exon-specific probes. REF52 cells were brought to quiescence and then
stimulated by the addition of serum. Aliquots were taken at the
indicated times, and RNA was analyzed as described in Fig. 1. E2F3 RNA
was detected with either a full-length cDNA probe (E2F3) or an exon
1-specific probe (E2F3 exon 1a [see Fig. 2]). For comparison, the
same blots were probed for expression of the cyclin E gene as well as
GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as a loading
control.
|
|
The expression of E2F3 is more complex and, in fact, appears to combine
the patterns for the other E2F species. In particular,
two E2F3 RNAs
are detected in these assays; the faster-migrating
RNA remains constant
through the growth stimulation, similar to
the pattern of E2F4 and E2F5
expression, whereas the slower-migrating
RNA accumulates with kinetics
similar to those of E2F1 and E2F2.
This is not a species-specific event
since analysis of both MEF
and human diploid fibroblasts yielded
essentially the same result
(data not
shown).
Analysis of the E2F3 genomic locus reveals two distinct
transcription units.
To explore the mechanistic basis for the
generation of two E2F3 RNAs that differ in their expression, we have
analyzed the genomic organization of the E2F3 locus. E2F3
mouse genomic clones were isolated by screening a mouse BAC genomic
library with a radiolabeled probe derived from the full-length, 1.5-kb
human E2F3 cDNA. Two positive clones were identified and isolated as described in Materials and Methods. Analysis of the clones by restriction mapping and Southern blot analysis revealed that they were
overlapping clones, each containing the E2F3 gene locus. Three fragments, a 3-kb HindIII fragment, a 6.5-kb
EcoRI fragment, and a 15-kb EcoRI fragment from
the initial BAC clone were determined by Southern blot analysis to
contain a portion of the E2F3 gene. The fragments were
isolated and subcloned into pBluescript SK(+/
). Exon-intron
boundaries for the first five exons were identified by sequencing using
primers derived from human cDNA. Lack of homology to the human cDNA as
well as the presence of consensus splice sites resolved exon-intron
borders (Fig. 1B). Intron length was determined by both PCR analysis,
using primers complementary to the adjacent exons, and by direct sequencing.
To further analyze the expression of the E2F3 locus, we repeated the
Northern analysis using either the complete cDNA probe
or a probe
specific to the exon 1 sequences. As shown in Fig.
1C, the cDNA probe
again detected both E2F3 transcripts. In contrast,
the exon 1 probe
only detected the larger, slower-migrating E2F3
transcript that was
regulated by growth. It would thus appear
that the smaller,
constitutively expressed E2F3 RNA is lacking
sequences derived from
exon
1.
Since only the smaller transcript, lacking exon 1, is present in
quiescent cells, we created a cDNA library using RNA from
quiescent MEF
cells in order to clone and characterize this smaller
E2F3 gene
product. Using primers from exons 4 and 5, we amplified
5' RACE
products from the library, subcloned these into pBS, and
then sequenced
the inserts. Two of nine clones contained sequence
representing exons
2, 3, and 4, as well as an additional six codons
upstream of exon 2 beginning with an ATG (Fig.
2A). The
sequence
unique to the shorter transcript was aligned to the E2F3
genomic
sequence and found to lie within intron 1, 1.1 kb downstream of
the known exon 1. We have now referred to the original first exon
as
exon 1a, and we have designated the unique sequence as exon
1b (Fig.
2A).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
Alternate 5' exons encode E2F3 RNAs. (A) Genomic
structure and organization of the E2F3 locus. The deduced
position of the exon 1b, as identified by RACE analysis and sequence
comparison, is indicated in relation to the initial E2F3 exon, now
termed exon 1a, and in relation to exon 2. The DNA sequence of the
longest RACE product is presented. (B) Comparison of the amino acid
sequence encoded by E2F3 exon 1a and exon 1b. The sequences homologous
to the previously defined cyclin A binding domain of E2F1 are indicated
as well as the sequence corresponding to the nuclear localization
signal.
|
|
A comparison of the amino acid sequence encoded by exon 1a and exon 1b
is shown in Fig.
2B. Most notably, the E2F3b protein
lacks the
N-terminal extension found in the E2F1, E2F2, and E2F3a
proteins.
Otherwise, the two E2F3 proteins are identical in sequence,
which
includes the DNA binding domain, a domain involved in dimerization
with
the DP1 partner protein, and the transcription activation-Rb
binding
domain. In addition, both proteins share the nuclear localization
sequence that is encoded at the beginning of exon 2. Thus, the
two
proteins would be predicted to bind to identical DNA sequences
and
partner with DP1 equivalently, as well as to interact with
Rb.
Moreover, both proteins would have the intrinsic ability to
localize to
the nucleus. The proteins differ in the N terminus
in that E2F3a
includes the potential cyclin A binding domain characterized
in E2F1
(
3,
15,
16), whereas a portion of the putative
domain would
be lost in E2F3b. Moreover, the ubiquitin targeting
domain described in
E2F1 (
19) would also be conserved in E2F3a
but not in
E2F3b.
Distinct promoters control the expression of E2F3a and E2F3b.
Using RACE as well as primer extension analysis, the sequence
corresponding to the 5' end of E2F3a and E2F3b mRNAs was identified (Fig. 3A and B). An examination of the
DNA sequence flanking the E2F3a transcription start site as well as the
E2F3b transcription start site revealed the presence of a number of
potential binding sites for a variety of transcription factors. Most
notably, the putative E2F3a promoter sequence contained multiple
potential E2F binding elements in the 5'-flanking region of the E2F3a
gene. There are three E2F recognition sites found in the upstream
promoter and one site found in the 5' UTR. Like many other
E2F-regulated genes, there is an Sp1 recognition sequence very close to
the E2F binding sites. In addition, we noted the presence of E-box elements that represent potential Myc binding sites. In contrast, although an analysis of the E2F3b promoter sequence revealed the presence of potential binding sites for several transcription factors,
there were no sites for E2F nor Myc.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Cell cycle regulation of the E2F3a and E2F3b promoters.
(A) Mapping of E2F3a and E2F3b transcription initiation sites by primer
extension analysis. Primers specific for the E2F3a and the E2F3b
transcripts (see Materials and Methods) were used with RNA from MEF
arrested at G1/S. The major E2F3a extension product (lane
2) and the E2F3b extension products (lane 4) are indicated by arrows.
Control reactions lacking MEF RNA are shown in lanes 1 and 3. The size
of the primer extension products was compared to a set of DNA
sequencing reactions as shown on the left. (B) Genomic organization of
the E2F3a and E2F3b promoters. The genomic region including exons 1a
and 1b is shown together with DNA sequence immediately upstream of each
exon. The positions of transcription start sites, as inferred from the
primer extension mapping, are indicated by arrows. In each case, the +1
site represents the longest primer extension product. The site of
fusion of each promoter fragment to the luciferase reporter is shown as
well as the E2F recognition sites in the E2F3a upstream sequence. (C)
Analysis of E2F3a ( ) and E2F3b ( ) promoter activity following the
stimulation of cell growth. REF52 cells were transfected with 4 µg of
E2F3a-luciferase or E2F3b-luciferase, together with 2 µg of the
CMV- -galactosidase vector as an internal control. Transfected cells
were brought to quiescence by serum starvation for 48 h and then
stimulated by the addition of fresh medium with serum. Samples were
taken at the indicated times and assayed for luciferase and
-galactosidase activity. Luciferase activity was normalized to
-galactosidase activity.
|
|
To analyze the functional capacity of the sequences flanking exons 1a
and 1b, the DNA fragments were placed in an expression
vector utilizing
the luciferase gene as a reporter. Each was then
transfected into
growing REF52 cells; the cells were then growth
arrested by serum
starvation and stimulated to reenter the cell
cycle by the addition of
serum, and then extracts were prepared
every 4 h after serum
addition and assayed for luciferase activity,
which was normalized to a

-galactosidase internal control. As
shown by the data in Fig.
3C,
the two promoter constructs displayed
very different properties. E2F3a
promoter activity was low in
quiescent and early-G
1 cells
and then increased in activity following
serum stimulation; the
activity in late G
1 cells was approximately
15-fold higher
than that in quiescent cells. This pattern of promoter
activity closely
parallels the accumulation of the E2F3a RNA as
seen in the Northern
blot analysis of RNA from serum stimulated
cells (Fig.
1).
In contrast to the pattern of activity of the E2F3a promoter, the E2F3b
promoter was active in quiescent cells and the activity
of the promoter
remained constant throughout the cell cycle (Fig.
3C), again directly
reflecting the pattern of accumulation of
the E2F3b RNA as seen in the
Northern analysis (Fig.
1).
E2F3b DNA binding activity does not fluctuate following stimulation
of cell growth.
In addition to the distinct transcription control
for the two E2F3 products, the lack of N-terminal sequences in the
E2F3b protein, which at least for E2F1 are important for controlling the accumulation of the protein and DNA binding activity during the
cell cycle, would predict that the two E2F3 proteins might exhibit
distinct patterns of accumulation. Indeed, direct assays for E2F
activity in extracts of quiescent cells and cells stimulated to
proliferate revealed a distinct pattern for the two activities. Similar
to observations of previous experiments, E2F activity can be seen to
fluctuate in response to stimulation of cell growth (Fig.
4A). This includes the loss of the p130
complex, the appearance of a p107 complex, and the accumulation of
various E2F activities. Treatment of the extracts with deoxycholate
eliminated the p130 complex, as well as the p107 complex, and allowed a
better analysis of the total E2F activity. In addition to the E2F4
activity, it was also clear that DOC treatment led to the release of
substantial E2F3b activity, particularly from the quiescent cells
sample (Fig. 4A). The identity of the E2F bands was confirmed by
antibody supershift assays using an extract from G1/S
cells and antibodies specific for either the N terminus or the C
terminus of E2F3 (Fig. 4B). Thus, the pattern of E2F activities
that can be observed independent of association with Rb family proteins
includes constant amounts of E2F4 and E2F3b as well as the regulated
accumulation of E2F3a and E2F1.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Control of E2F3 DNA binding activity following
stimulation of cell growth. (A) E2F DNA binding activity following
stimulation of cell growth. REF52 cells were brought to quiescence and
then stimulated by the addition of medium containing 10% serum. Cells
were harvested at the indicated times following the stimulation of
growth, nuclear extracts were prepared, and E2F DNA binding activity
was measured using electrophoretic mobility shift assays as previously
described. A sample of each nuclear extract was also treated with DOC
and then analyzed for E2F DNA binding activity. (B) Identification of
distinct E2F3 activities. A nuclear extract sample from the 18-h time
point presented in the left panel (G1/S sample) was
incubated without antibody (lane 1), an E2F3 antibody specific for the
N terminus of E2F3a (lane 2), and E2F3 C-terminus-specific antibody
that recognizes both E2F3a and E2F3b (lane 3), control IgG (lane 4), or
an E2F1-specific antibody prior to being subjected to gel shift
analysis. The E2F4- and E2F5-specific bands indicated on the DNA gel
shift have been identified using specific antibodies against the
respective proteins (data not shown).
|
|
The E2F3b protein is a specific partner for Rb in quiescent
cells.
Given the distinct pattern of expression of the two forms
of E2F3, together with the structural differences in the two proteins, we have looked for properties of the two proteins that might suggest functional differences. Clearly, one distinction is the pattern of
expression; the E2F3b transcript is produced in quiescent cells, whereas the E2F3a transcript is only produced in proliferating cells.
Previous work has detailed the cell-cycle-regulated accumulation of
E2F3 DNA binding activity that reflects that of the E2F3a protein (18). We have now examined the state of the E2F3b protein in quiescent cells as an approach to understanding its function.
To determine the nature of the interactions of the E2F3b protein with
respect to Rb family members, we used immunoprecipitation
assays as
shown in Fig.
5. Samples of a quiescent
cell extract
were immunoprecipitated under nondenaturing conditions
with antibodies
specific to Rb, p107, or p130, and then E2F activity
was released
by treatment with DOC. DNA binding assays of the
DOC-released
material revealed an association of Rb with the E2F3b
protein
as well as small amounts of E2F4 (lane 3). The fact that there
was little or no E2F-Rb complex evident in the direct gel shift
assay,
in spite of the evidence for an association of E2F3b with
Rb by
immunoprecipitation and DOC release, likely reflects a reduced
DNA
binding affinity of the E2F-Rb relative to the free E2F protein.
In
contrast to the association of Rb with E2F3b, p130 was exclusively
associated with E2F4 and E2F5 (lane 7) with no evidence for an
interaction with E2F3b. The small amount of p107 found in quiescent
cells was also associated with E2F4 and E2F5 but not with E2F3b
(lane
5). The evident specificity of these interactions was further
strengthened by the observations that the E2F3b protein remained
in the
supernatants of the p107 or p130 immunoprecipitates (lanes
10 and 11)
and that essentially no E2F3b protein remained in the
supernatant of
the Rb immunoprecipitate (lanes 9 to 11). Based
on these results, we
conclude that the E2F3b protein is the predominant
partner for Rb in
quiescent cells, whereas E2F4 and E2F5 are the
specific partners for
p130 as well as the small amounts of p107
found in quiescent cells.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
E2F3b is specifically associated with Rb in quiescent
cells. Nuclear (N) and cytoplasmic (C) extracts prepared from quiescent
cells were immunoprecipitated with antibodies specific for the
indicated Rb family member protein. The immunoprecipitates (IP) were
treated with DOC to release the associated E2F activities as described
in Materials and Methods. The released material was assayed for E2F DNA
binding activity by gel mobility shift (lanes 3 to 8). In addition, the
supernatants (Sup) from the immunoprecipitations were also assayed for
E2F activity (lanes 9 to 11). Finally, a sample of the nuclear extract
was directly treated with DOC and then assayed for E2F binding
activity (lanes 1 and 2).
|
|
 |
DISCUSSION |
The study of cell proliferation control has demonstrated the
critical role for E2F transcriptional activity in the regulation of
various genes that encode proteins essential for DNA replication and
cell cycle regulation. These studies have also detailed the complexity
of E2F and Rb activity, defining six distinct members of the E2F family
of proteins and three members of the Rb family; further work has begun
to define functional specificity of this complexity, with unique roles
played by different E2F family members (4, 22). The results
we describe here now provide evidence for further complexity whereby
the E2F3 locus is seen to generate two distinct products
through the utilization of distinct promoters. This transcriptional
control of E2F3 expression results in the production of related
proteins that are expressed with very different kinetics during the
course of cell proliferation. Most importantly, the association of the
E2F3b protein with Rb in quiescent cells suggests a basis for
specificity in the repression of transcription that is evident from the
analysis of cells deficient in each of the Rb family members
(11).
The E2F3 locus provides further complexity to the E2F
family.
The identification of the E2F3b protein as an alternative
product of the E2F3 locus provides further insight into the
evolution of the structural and functional complexity of the E2F family (Fig. 6). Like E2F1, E2F2, and E2F3a,
E2F3b does not interact with either p130 or p107; rather, E2F3b
interacts specifically with Rb. Unlike E2F1, E2F2, and E2F3a, the
E2F3b product is constitutively expressed, accumulating in both
quiescent and proliferating cells. Thus, in this regard, E2F3b shares
properties in common with the E2F4 and E2F5 products. In addition, the
E2F3b protein lacks the N-terminal extension that is found in the E2F1,
E2F2, and E2F3a proteins. Although an understanding of the precise role
of these N-terminal amino acids in the function of these proteins is
still developing, several observations are pertinent. First, the
ability of cyclin A-cdk2 to control the DNA binding activity of the
E2F1 protein is dependent on the interaction of the kinase with a motif found in these N-terminal sequences (3, 15, 16). Second, the
ubiquitin-mediated degradation of E2F1 is dependent on sequences found
in the N terminus of E2F1 (19). Taken together, these observations suggest that because of the absence of these regulatory elements found in E2F1, E2F2, and E2F3a, the accumulation of E2F3b is
regulated quite differently from these three E2F proteins, whose
accumulation is tightly governed by cell proliferation control.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Relationship of E2F3b to the E2F family. Schematic
representation of the entire E2F family with conserved domains
indicated.
|
|
A unique role for E2F3 activity in cell growth control.
Several observations seem particularly relevant when considering the
functional role of the E2F3b product. Of perhaps most significance are
the observations of Dyson and colleagues that define a specificity in
transcriptional repression in quiescent cells mediated by Rb family
proteins (11). Whereas cyclin E and p107 transcription was
derepressed in cells lacking Rb, there was no effect on the expression
of various other E2F targets. In contrast, the combined loss of p107
and p130 led to derepression of transcription of several other E2F
target genes but not of cyclin E or p107. As such, these results
provide evidence for specificity in the action of Rb and p130 in
transcription repression. Since the specificity of promoter selection
in Rb-mediated repression most likely must reside in the DNA binding
component of the Rb family member complex, namely, the associated E2F
protein, our observation that Rb and p130 exhibit distinct E2F binding
specificity in quiescent cells now provides a mechanism by which to
consider the specificity of repression.
Previous work has suggested that individual E2F proteins may exhibit
DNA binding specificity (
29); thus, the specificity
of
Rb-mediated versus p130-mediated repression could indeed reflect
the
ability of distinct E2F proteins, in this case E2F3b versus
E2F4, to
select promoter sequences. In this regard, it is interesting
to note
that the cyclin E gene has been suggested to be a target
for positive
control by E2F3a in cycling cells (
18), an observation
of
interest considering the fact that E2F3a and E2F3b share the
identical
DNA binding domain. Given the fact that E2F3b is the
predominant
partner for Rb in quiescent cells, together with the
fact that it is
the E2F protein that imparts DNA sequence specificity
to the Rb
repression, we suggest that E2F3b is likely involved
in the process of
controlling the expression of cyclin E, and
other targets specifically
repressed by Rb, in the quiescent
cell.
 |
ACKNOWLEDGMENTS |
We thank Kaye Culler for assistance in the preparation of the manuscript.
G.L. was supported by a fellowship from the Medical Research Council of
Canada, S.I. and R.S. were supported by the Howard Hughes Medical
Institute, and M.A. was supported by a Merck/UNCF fellowship. This work
was supported by the Howard Hughes Medical Institute and by a V
Foundation grant to G.L.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, Howard Hughes Medical Institute, Duke University Medical
Center, Durham, NC 27710. Phone: (919) 684-2746. Fax: (919) 681-8973. E-mail: J.Nevins{at}duke.edu.
Present address: Division of Human Cancer Genetics, Ohio State
University, Columbus, OH 43210.
Present address: Abbott Laboratories, Abbott Park, IL 60064.
§
Present address: Department of Cancer Biology, Dana Farber Cancer
Institute, Boston, MA 02115.
 |
REFERENCES |
| 1.
|
DeGregori, J.,
T. Kowalik, and J. R. Nevins.
1995.
Cellular targets for activation by the E2F1 transcription factor include DNA synthesis and G1/S regulatory genes.
Mol. Cell. Biol.
15:4215-4224[Abstract].
|
| 2.
|
DeGregori, J.,
G. Leone,
A. Miron,
L. Jakoi, and J. R. Nevins.
1997.
Distinct roles for E2F proteins in cell growth control and apoptosis.
Proc. Natl. Acad. Sci. USA
94:7245-7250[Abstract/Free Full Text].
|
| 3.
|
Dynlacht, B. D.,
K. Moberg,
J. A. Lees,
E. Harlow, and L. Zhu.
1997.
Specific regulation of E2F family members by cyclin-dependent kinases.
Mol. Cell. Biol.
17:3867-3875[Abstract].
|
| 4.
|
Dyson, N.
1998.
The regulation of E2f by pRB-family proteins.
Genes Dev.
12:2245-2262[Free Full Text].
|
| 5.
|
George, C. P., and J. T. Kadonaga.
1996.
Primer extension analysis of RNA, p. 133-139.
In
P. A. Krieg (ed.), A laboratory guide to RNA isolation, analysis, and synthesis. Wiley-Liss, Inc., New York, N.Y.
|
| 6.
|
Helin, K., and E. Harlow.
1993.
The retinoblastoma protein as a transcriptional repressor.
Trends Cell Biol.
3:43-46.
|
| 7.
|
Herrera, R. E.,
V. P. Sah,
B. O. Williams,
T. P. Makela,
R. A. Weinberg, and T. Jacks.
1996.
Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts.
Mol. Cell. Biol.
16:2402-2407[Abstract].
|
| 8.
|
Hsiao, K.-M.,
S. L. McMahon, and P. J. Farnham.
1994.
Multiple DNA elements are required for the growth regulation of the mouse E2F1 promoter.
Genes Dev.
8:1526-1537[Abstract/Free Full Text].
|
| 9.
|
Hunter, T.
1993.
Braking the cycle.
Cell
75:839-841[CrossRef][Medline].
|
| 10.
|
Hunter, T., and J. Pines.
1994.
Cyclins and cancer II: cyclin D and CDK inhibitors come of age.
Cell
79:573-582[CrossRef][Medline].
|
| 11.
|
Hurford, R. K.,
D. Cobrinik,
M.-H. Lee, and N. Dyson.
1997.
pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes.
Genes Dev.
11:1447-1463[Abstract/Free Full Text].
|
| 12.
|
Ikeda, M.-A.,
L. Jakoi, and J. R. Nevins.
1996.
A unique role for the Rb protein in controlling E2F accumulation during cell growth and differentiation.
Proc. Natl. Acad. Sci. USA
93:3215-3220[Abstract/Free Full Text].
|
| 13.
|
Johnson, D. G.,
K. Ohtani, and J. R. Nevins.
1994.
Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression.
Genes Dev.
8:1514-1525[Abstract/Free Full Text].
|
| 14.
|
Kowalik, T. F.,
J. DeGregori,
J. K. Schwarz, and J. R. Nevins.
1995.
E2F1 overexpression in quiescent fibroblasts leads to induction of cellular DNA synthesis and apoptosis.
J. Virol.
69:2491-2500[Abstract].
|
| 15.
|
Krek, W.,
M. E. Ewen,
S. Shirodkar,
Z. Arany,
W. G. Kaelin, and D. M. Livingston.
1994.
Negative regulation of the growth-promoting transcription factor E2F-1 by a stably bound cyclin A-dependent protein kinase.
Cell
78:161-172[CrossRef][Medline].
|
| 16.
|
Krek, W.,
G. Xu, and D. M. Livingston.
1995.
Cyclin A-kinase regulation of E2F-1 DNA binding function underlies suppression of an S phase checkpoint.
Cell
83:1149-1158[CrossRef][Medline].
|
| 17.
|
La Thangue, N. B.
1994.
DRTF1/E2F: an expanding family of heterodimeric transcription factors implicated in cell-cycle control.
Trends Biochem. Sci.
19:108-114[CrossRef][Medline].
|
| 18.
|
Leone, G.,
J. DeGregori,
Z. Yan,
L. Jakoi,
S. Ishida,
R. S. Williams, and J. R. Nevins.
1998.
E2F3 activity is regulated during the cell cycle and is required for the induction of S phase.
Genes Dev.
12:2120-2130[Abstract/Free Full Text].
|
| 19.
|
Marti, A.,
C. Wirbelauer,
M. Scheffner, and W. Krek.
1999.
Interaction between SCFSKP2 ubiquitin protein ligase and E2F-1 underlies regulation of E2F-1 degradation.
Nat. Cell Biol.
1:14-19[CrossRef][Medline].
|
| 20.
|
Neuman, E.,
E. K. Flemington,
W. R. Sellers, and W. G. Kaelin, Jr.
1994.
Transcription of the E2F-1 gene is rendered cell cycle dependent by E2F DNA-binding sites within its promoter.
Mol. Cell. Biol.
14:6607-6615[Abstract/Free Full Text].
|
| 21.
|
Nevins, J. R.
1992.
E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.
Science
258:424-429[Abstract/Free Full Text].
|
| 22.
|
Nevins, J. R.
1998.
Toward an understanding of the functional complexity of the E2F and retinoblastoma families.
Cell Growth Differ.
9:585-593[Medline].
|
| 23.
|
Qin, X.-Q.,
D. M. Livingston,
W. G. Kaelin, and P. D. Adams.
1994.
Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53-mediated apoptosis.
Proc. Natl. Acad. Sci. USA
91:10918-10922[Abstract/Free Full Text].
|
| 24.
|
Sears, R.,
K. Ohtani, and J. R. Nevins.
1997.
Identification of positively and negatively acting elements regulating expression of the E2F2 gene in response to cell growth signals.
Mol. Cell. Biol.
17:5227-5235[Abstract].
|
| 25.
|
Shan, B., and W.-H. Lee.
1994.
Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis.
Mol. Cell. Biol.
14:8166-8173[Abstract/Free Full Text].
|
| 26.
|
Sherr, C. J.
1993.
Mammalian G1 cyclins.
Cell
73:1059-1065[Medline].
|
| 27.
|
Sherr, C. J., and J. M. Roberts.
1995.
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
9:1149-1163[Free Full Text].
|
| 28.
|
Smith, E. J.,
G. Leone,
J. DeGregori,
L. Jakoi, and J. R. Nevins.
1996.
The accumulation of an E2F-p130 transcriptional repressor distinguishes a G0 from a G1 cell state.
Mol. Cell. Biol.
16:6965-6976[Abstract].
|
| 29.
|
Tao, Y.,
R. F. Kassatly,
W. D. Cress, and J. M. Horowitz.
1997.
Subunit composition determines E2F DNA-binding site specificity.
Mol. Cell. Biol.
17:6994-7007[Abstract].
|
| 30.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[CrossRef][Medline].
|
| 31.
|
Wu, X., and A. J. Levine.
1994.
p53 and E2F-1 cooperate to mediate apoptosis.
Proc. Natl. Acad. Sci. USA
91:3602-3606[Abstract/Free Full Text].
|
Molecular and Cellular Biology, May 2000, p. 3626-3632, Vol. 20, No. 10
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
McClellan, K. A., Vanderluit, J. L., Julian, L. M., Andrusiak, M. G., Dugal-Tessier, D., Park, D. S., Slack, R. S.
(2009). The p107/E2F Pathway Regulates Fibroblast Growth Factor 2 Responsiveness in Neural Precursor Cells. Mol. Cell. Biol.
29: 4701-4713
[Abstract]
[Full Text]
-
Chong, J.-L., Tsai, S.-Y., Sharma, N., Opavsky, R., Price, R., Wu, L., Fernandez, S. A., Leone, G.
(2009). E2f3a and E2f3b Contribute to the Control of Cell Proliferation and Mouse Development. Mol. Cell. Biol.
29: 414-424
[Abstract]
[Full Text]
-
Asp, P., Acosta-Alvear, D., Tsikitis, M., van Oevelen, C., Dynlacht, B. D.
(2009). E2f3b plays an essential role in myogenic differentiation through isoform-specific gene regulation. Genes Dev.
23: 37-53
[Abstract]
[Full Text]
-
He, L., Yang, H., Ma, Y., Pledger, W. J., Cress, W. D., Cheng, J. Q.
(2008). Identification of Aurora-A as a Direct Target of E2F3 during G2/M Cell Cycle Progression. J. Biol. Chem.
283: 31012-31020
[Abstract]
[Full Text]
-
Genovese, N. J., Banerjee, N. S., Broker, T. R., Chow, L. T.
(2008). Casein Kinase II Motif-Dependent Phosphorylation of Human Papillomavirus E7 Protein Promotes p130 Degradation and S-Phase Induction in Differentiated Human Keratinocytes. J. Virol.
82: 4862-4873
[Abstract]
[Full Text]
-
Freeman, S. N., Ma, Y., Cress, W. D.
(2008). RhoBTB2 (DBC2) Is a Mitotic E2F1 Target Gene with a Novel Role in Apoptosis. J. Biol. Chem.
283: 2353-2362
[Abstract]
[Full Text]
-
Eiring, A. M., Neviani, P., Santhanam, R., Oaks, J. J., Chang, J. S., Notari, M., Willis, W., Gambacorti-Passerini, C., Volinia, S., Marcucci, G., Caligiuri, M. A., Leone, G. W., Perrotti, D.
(2008). Identification of novel posttranscriptional targets of the BCR/ABL oncoprotein by ribonomics: requirement of E2F3 for BCR/ABL leukemogenesis. Blood
111: 816-828
[Abstract]
[Full Text]
-
Garneau, H., Alvarez, L., Paquin, M.-C., Lussier, C., Rancourt, C., Tremblay, E., Beaulieu, J.-F., Rivard, N.
(2007). Nuclear expression of E2F4 induces cell death via multiple pathways in normal human intestinal epithelial crypt cells but not in colon cancer cells. Am. J. Physiol. Gastrointest. Liver Physiol.
293: G758-G772
[Abstract]
[Full Text]
-
McClellan, K. A., Ruzhynsky, V. A., Douda, D. N., Vanderluit, J. L., Ferguson, K. L., Chen, D., Bremner, R., Park, D. S., Leone, G., Slack, R. S.
(2007). Unique Requirement for Rb/E2F3 in Neuronal Migration: Evidence for Cell Cycle-Independent Functions. Mol. Cell. Biol.
27: 4825-4843
[Abstract]
[Full Text]
-
Parisi, T., Yuan, T. L., Faust, A. M., Caron, A. M., Bronson, R., Lees, J. A.
(2007). Selective Requirements for E2f3 in the Development and Tumorigenicity of Rb-Deficient Chimeric Tissues. Mol. Cell. Biol.
27: 2283-2293
[Abstract]
[Full Text]
-
Sharma, N., Timmers, C., Trikha, P., Saavedra, H. I., Obery, A., Leone, G.
(2006). Control of the p53-p21CIP1 Axis by E2f1, E2f2, and E2f3 Is Essential for G1/S Progression and Cellular Transformation. J. Biol. Chem.
281: 36124-36131
[Abstract]
[Full Text]
-
Black, E. P., Hallstrom, T., Dressman, H. K., West, M., Nevins, J. R.
(2005). Distinctions in the specificity of E2F function revealed by gene expression signatures. Proc. Natl. Acad. Sci. USA
102: 15948-15953
[Abstract]
[Full Text]
-
Ishida, H., Masuhiro, Y., Fukushima, A., Argueta, J. G. M., Yamaguchi, N., Shiota, S., Hanazawa, S.
(2005). Identification and Characterization of Novel Isoforms of Human DP-1: DP-1{alpha} REGULATES THE TRANSCRIPTIONAL ACTIVITY OF E2F1 AS WELL AS CELL CYCLE PROGRESSION IN A DOMINANT-NEGATIVE MANNER. J. Biol. Chem.
280: 24642-24648
[Abstract]
[Full Text]
-
Douglas, R. M., Farahani, R., Morcillo, P., Kanaan, A., Xu, T., Haddad, G. G.
(2005). Hypoxia induces major effects on cell cycle kinetics and protein expression in Drosophila melanogaster embryos. Am. J. Physiol. Regul. Integr. Comp. Physiol.
288: R511-R521
[Abstract]
[Full Text]
-
IAQUINTA, P.J., ASLANIAN, A., LEES, J.A.
(2005). Regulation of the Arf/p53 Tumor Surveillance Network by E2F. Cold Spring Harb Symp Quant Biol
70: 309-316
[Abstract]
-
Giangrande, P. H., Zhu, W., Schlisio, S., Sun, X., Mori, S., Gaubatz, S., Nevins, J. R.
(2004). A role for E2F6 in distinguishing G1/S- and G2/M-specific transcription. Genes Dev.
18: 2941-2951
[Abstract]
[Full Text]
-
Aslanian, A., Iaquinta, P. J., Verona, R., Lees, J. A.
(2004). Repression of the Arf tumor suppressor by E2F3 is required for normal cell cycle kinetics. Genes Dev.
18: 1413-1422
[Abstract]
[Full Text]
-
Savell, J., Ma, Y., Morrow, K. S., Jove, R., Olashaw, N., Moseley, P. L., Cress, W. D., Wharton, W.
(2004). AG490 inhibits G1-S traverse in BALB/c-3T3 cells following either mitogenic stimulation or exogenous expression of E2F-1. Molecular Cancer Therapeutics
3: 205-213
[Abstract]
[Full Text]
-
de Bruin, A., Maiti, B., Jakoi, L., Timmers, C., Buerki, R., Leone, G.
(2003). Identification and Characterization of E2F7, a Novel Mammalian E2F Family Member Capable of Blocking Cellular Proliferation. J. Biol. Chem.
278: 42041-42049
[Abstract]
[Full Text]
-
Ma, Y., Yuan, J., Huang, M., Jove, R., Cress, W. D.
(2003). Regulation of the Cyclin D3 Promoter by E2F1. J. Biol. Chem.
278: 16770-16776
[Abstract]
[Full Text]
-
Landsberg, R. L., Sero, J. E., Danielian, P. S., Yuan, T. L., Lee, E. Y., Lees, J. A.
(2003). The role of E2F4 in adipogenesis is independent of its cell cycle regulatory activity. Proc. Natl. Acad. Sci. USA
100: 2456-2461
[Abstract]
[Full Text]
-
Ryo, A., Liou, Y.-C., Lu, K. P., Wulf, G.
(2003). Prolyl isomerase Pin1: a catalyst for oncogenesis and a potential therapeutic target in cancer. J. Cell Sci.
116: 773-783
[Abstract]
[Full Text]
-
He, Y., Cress, W. D.
(2002). E2F-3B Is a Physiological Target of Cyclin A. J. Biol. Chem.
277: 23493-23499
[Abstract]
[Full Text]
-
Hyde, R. K., Griep, A. E.
(2002). Unique Roles for E2F1 in the Mouse Lens in the Absence of Functional pRB Proteins. IOVS
43: 1509-1516
[Abstract]
[Full Text]
-
Saavedra, H. I., Wu, L., de Bruin, A., Timmers, C., Rosol, T. J., Weinstein, M., Robinson, M. L., Leone, G.
(2002). Specificity of E2F1, E2F2, and E2F3 in Mediating Phenotypes Induced by Loss of Rb. Cell Growth Differ.
13: 215-225
[Abstract]
[Full Text]
-
Cloud, J. E., Rogers, C., Reza, T. L., Ziebold, U., Stone, J. R., Picard, M. H., Caron, A. M., Bronson, R. T., Lees, J. A.
(2002). Mutant Mouse Models Reveal the Relative Roles of E2F1 and E2F3 In Vivo. Mol. Cell. Biol.
22: 2663-2672
[Abstract]
[Full Text]
-
Frolov, M. V., Huen, D. S., Stevaux, O., Dimova, D., Balczarek-Strang, K., Elsdon, M., Dyson, N. J.
(2001). Functional antagonism between E2F family members. Genes Dev.
15: 2146-2160
[Abstract]
[Full Text]
-
Ishida, S., Huang, E., Zuzan, H., Spang, R., Leone, G., West, M., Nevins, J. R.
(2001). Role for E2F in Control of Both DNA Replication and Mitotic Functions as Revealed from DNA Microarray Analysis. Mol. Cell. Biol.
21: 4684-4699
[Abstract]
[Full Text]
-
Lin, W.-C., Lin, F.-T., Nevins, J. R.
(2001). Selective induction of E2F1 in response to DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev.
15: 1833-1844
[Abstract]
[Full Text]
-
Adams, M. R., Sears, R., Nuckolls, F., Leone, G., Nevins, J. R.
(2000). Complex Transcriptional Regulatory Mechanisms Control Expression of the E2F3 Locus. Mol. Cell. Biol.
20: 3633-3639
[Abstract]
[Full Text]
-
D'Souza, S. J. A., Pajak, A., Balazsi, K., Dagnino, L.
(2001). Ca2+ and BMP-6 Signaling Regulate E2F during Epidermal Keratinocyte Differentiation. J. Biol. Chem.
276: 23531-23538
[Abstract]
[Full Text]