This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Misiti, S.
Right arrow Articles by Farsetti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Misiti, S.
Right arrow Articles by Farsetti, A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2000, p. 3764-3771, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Induction of hTERT Expression and Telomerase Activity by Estrogens in Human Ovary Epithelium Cells

Silvia Misiti,1 Simona Nanni,1 Giulia Fontemaggi,1 Yu-Sheng Cong,2 Jianping Wen,2 Hal W. Hirte,3 Giulia Piaggio,1 Ada Sacchi,1 Alfredo Pontecorvi,1,4 Silvia Bacchetti,2,* and Antonella Farsetti1,5,*

Molecular Oncogenesis Laboratory, Regina Elena Cancer Institute,1 and Institute of Experimental Medicine, National Research Council,5 Rome, and Institute of Medical Pathology, Catholic University, Milan,4 Italy, and Department of Pathology and Molecular Medicine2 and Department of Medicine,3 McMaster University, Hamilton, Ontario, Canada

Received 10 November 1999/Returned for modification 21 December 1999/Accepted 2 March 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

In mammals, molecular mechanisms and factors involved in the tight regulation of telomerase expression and activity are still largely undefined. In this study, we provide evidence for a role of estrogens and their receptors in the transcriptional regulation of hTERT, the catalytic subunit of human telomerase and, consequently, in the activation of the enzyme. Through a computer analysis of the hTERT 5'-flanking sequences, we identified a putative estrogen response element (ERE) which was capable of binding in vitro human estrogen receptor alpha  (ERalpha ). In vivo DNA footprinting revealed specific modifications of the ERE region in ERalpha -positive but not ERalpha -negative cells upon treatment with 17beta -estradiol (E2), indicative of estrogen-dependent chromatin remodelling. In the presence of E2, transient expression of ERalpha but not ERbeta remarkably increased hTERT promoter activity, and mutation of the ERE significantly reduced this effect. No telomerase activity was detected in human ovary epithelial cells grown in the absence of E2, but the addition of the hormone induced the enzyme within 3 h of treatment. The expression of hTERT mRNA and protein was induced in parallel with enzymatic activity. This prompt estrogen modulation of telomerase activity substantiates estrogen-dependent transcriptional regulation of the hTERT gene. The identification of hTERT as a target of estrogens represents a novel finding which advances the understanding of telomerase regulation in hormone-dependent cells and has implications for a potential role of hormones in their senescence and malignant conversion.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Most human somatic cells do not express telomerase, the ribonucleoprotein that elongates telomeric DNA, or its catalytic protein, hTERT, which is limiting for enzyme activity (33). In humans, telomerase is regulated in a tissue-specific manner during development (42); the enzyme is present in early embryogenesis but is repressed upon cell differentiation in somatic tissues (27, 42). Loss of enzymatic activity is accompanied by loss of the full-length transcript of hTERT and/or by the appearance of alternatively spliced transcripts that are unlikely to encode functional proteins (21, 42). In the adult, telomerase persists only in germ line cells and in progenitor cells of somatic tissues with self-renewing potential, in agreement with the requirement for the enzyme for sustained cell proliferation (16). How hTERT silencing is achieved and which factors contribute to this process are presently unknown, although the regulation of hTERT expression appears to be primarily at the transcriptional level (42). An understanding of the molecular mechanisms underlying the regulation of telomerase activity might allow the modulation of telomerase expression and, consequently, of cell life span (4, 43), with important potential therapeutic applications in aging and malignancy.

Several lines of evidence suggest that sex steroid hormones may be good candidates as physiological regulators of hTERT expression. Recent findings are consistent with the hypothesis that telomerase activity is potentially under hormonal control in some estrogen-targeted tissues, such as the endometrium (25, 37, 40), and the prostate (30), and in epithelial cells with high renewing potential from estrogen-regulated tissues (3). Physiological responses to estrogen are mediated, within specific tissues, by at least two members of the nuclear hormone receptor superfamily, the estrogen receptors (ERs) ERalpha and ERbeta (2). These are ligand-dependent transcription factors belonging to a large family of structurally related proteins that are able to modulate the expression of a variety of genes involved in diverse biological functions, such as cell proliferation, morphogenesis, cellular differentiation, and programmed cell death. ERs act by direct interaction of the hormone-receptor complex with a set of specific DNA sequences, the estrogen response elements (EREs), localized in the 5'-flanking regions of hormone-regulated genes. Distinct ligand-directed conformational changes of the hormone-receptor complex may result, in turn, in transcriptional silencing or activation of target genes (2, 28). Alternative mechanisms of ER activation, involving coregulatory proteins (19, 20), transcription factors such as AP-1 or Sp1 (35, 44), and/or phosphorylation signaling pathways, have also been reported (2).

The recent cloning and characterization of the hTERT gene and its promoter region (6, 17, 40, 45) has provided essential reagents for the investigation of the molecular mechanisms involved in the regulation of telomerase in different cell backgrounds. In this study, we provide evidence for a potential role of estrogens and ERs in the transcriptional regulation of hTERT by demonstrating that a noncanonical ERE within the hTERT promoter is functional in vitro and in vivo and that the addition of estrogen to human ovary epithelium cell cultures results in the induction of hTERT expression and of telomerase activity.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Cells. Human ovarian surface epithelium (HOSE) cell strains GRO, LLO, and LEA and immortal HOSE cell line WOO were cultured in E3 medium with 3% fetal calf serum (FCS) (8). The human ovarian cancer cell line OVCA-433 (36) was grown in RPMI 1640 with 10% FCS, while cervical cancer HeLa cells, breast cancer MCF-7 and MDA-MB231 cells, and mouse NIH 3T3 fibroblasts were grown in Dulbecco modified essential medium with 10% FCS. Forty-eight hours prior to experimental use, the cells were switched to medium supplemented with hormone-deprived serum (18).

Plasmids and transfections. Plasmids P-1009 and P-330 and the pGL2-Enhancer vector have been described previously (6). P-1009Mut, with a mutated ERE, was generated using a QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.) and the following oligonucleotide sequence: 5'-CCTCCCCCTTGTGCGGGCATGATGTGATCAGATGTTGGCC-3'.

The hTERT-ERE-TK reporter was generated by inserting double-stranded oligonucleotides encompassing the hTERT promoter (-956 to -930) into the linker region of pBLCAT2 (12) upstream of the thymidine kinase (TK) promoter at bp -105. All constructs were sequenced using the dideoxynucleotide method (38). pSG5-HEO, encoding human ERalpha (13), and the human ERbeta expression vector (24) were gifts from P. Chambon (Strasbourg, France) and J. A. Gustafsson (Huddinge, Sweden), respectively. The reporter vector for the Xenopus laevis vitellogenin B1 (VIT) promoter has been previously described (12). pCMV-beta -gal was used as an internal control to monitor transfection efficiency. Cells were electroporated as described previously (12) and assayed for luciferase and beta -galactosidase activities using reagents and protocols from Promega (Madison, Wis.).

Electrophoretic mobility shift assay. A 32P-labeled double-stranded oligonucleotide containing the hTERT ERE (5'-GCATGTGTGTGCGGGCGGGATGTGACCAGATGTGATCC-3'; bp -949 to -935 upstream of the ATG) was assayed for binding to extracts from Spodoptera frugiperda Sf9 cells infected with a baculovirus expressing human ERalpha (5) or ERbeta (Alexis Biochemicals, Milan, Italy) or with a control baculovirus. As a control for ER binding, a 32P-labeled double-stranded oligonucleotide spanning the canonical X. laevis VIT ERE was used. Competition experiments were performed by adding to the binding mixture increasing amounts of unlabeled oligonucleotides containing the hTERT ERE, the human coaggulation factor XII ERE (12), or the mutant hTERT ERE 20 min prior to the addition of the 32P-labeled probe. Supershift experiments with ERbeta were carried out with anti-ERbeta antibody L-20X (Santa Cruz, Santa Cruz, Calif.). Binding reactions and native polyacrylamide gel electrophoresis were carried out as previously described (12).

Western blot analysis. For detection of ERalpha expression, cell lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (Bio-Rad, Hercules, Calif.). Immunostaining of proteins was done with antibody HC-20 according to supplier instructions (Santa Cruz), and detection was done by enhanced chemiluminescence (Amersham Corp., Arlington Heights, Ill.).

Genomic footprinting. Cells were treated with the DNA-alkylating reagent dimethyl sulfate (DMS) (0.1% for 2 min for MCF-7, MDA-MB231, and HeLa cells and 0.2% for 4 min for OVCA-433 cells), and their DNA was cleaved with piperidine. Genomic footprinting was performed by ligation-mediated (LM) PCR (9) with Vent DNA polymerase for first-strand extension and subsequent PCR amplification. To generate footprints for the endogenous hTERT gene, the following primers, specific for the region of interest, were used (coding strand): primer 1, GAATCGGCCTAGGCTGTG; primer 2, ACCGGGCGCCTCACACCAGCC; and primer 3, ACCGGGCGCCTCACACCAGCCACAACGG. Labeled PCR products were resolved on a 6% polyacrylamide-8 M urea sequencing gel. Control samples consisted of chromatin-free DNA from each cell line treated in vitro with 0.125% DMS for 2 min. Volumetric integration of signal intensities was performed with NIH Image software (version 1.58), and quantitation was done as described by Dey et al. (9). Briefly, the average value of each band from three independent experiments was normalized to the value of the corresponding band in the control guanine ladder. Methylation percentages were obtained by normalization of values for ERalpha -positive (MCF-7 and OVCA-433) cells to those for ERalpha -negative (MDA-MB231 and HeLa) cells, which showed no protection or hypersensitivity. Values of <15% were considered not significant (32).

RT-PCR analysis of hTERT mRNA. Expression of hTERT mRNA was analyzed by semiquantitative reverse transcription (RT)-PCR amplification. Total RNA was prepared from HOSE cells using RNAzol B (Biotech, Rome, Italy) according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed at 37°C for 45 min in the presence of random hexamers and Moloney murine leukemia virus reverse transcriptase (Gibco-BRL). hTERT mRNA analysis was carried out by PCR amplification of a fragment of 145 bp using primers and conditions described by Ulaner et al. (42). The housekeeping aldolase mRNA, used as an external standard, was amplified from the same cDNA reaction mixture using specific primers (31). The exponential phase of amplification was previously determined by serial dilution of RT reaction mixtures for each cDNA template used and PCR performed under these conditions. Amplified PCR products were electrophoresed on a 3% agarose gel containing ethidium bromide (0.5 µg/ml) and visualized under UV light.

Immunofluorescence. LEA and LLO cells, grown in E3 medium with hormone-deprived serum, were seeded in 35-mm plates. After 16 h, the medium was replaced with fresh medium containing 17beta -estradiol (E2) at a final concentration of 10-7 M or the equivalent volume of vehicle alone. Cells were immunostained with the telomerase-specific antibody K-370 as described by Martin-Rivera et al. (29), and nuclei were stained with Hoechst 33258. Images were captured with a Zeiss fluorescence microscope.

Telomerase assay. Extracts from GRO, LEA, LLO, and WOO cells were prepared by detergent lysis, and enzymatic activity was detected by the PCR-based telomere repeat amplification protocol (TRAP) (22).


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Ligand-dependent occupancy of the hTERT promoter in vitro and in vivo. A computer-assisted analysis of the hTERT 5'-flanking sequence (6) revealed a composite regulatory unit comprising an imperfect palindromic consensus sequence for the ERE (5'-GGCGGGATGTGACCA-3', at positions -949 to -935 relative to the ATG), partially overlapping an AP1 binding site and adjacent to an SP1 motif (Fig. 1a).


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 1.   (a) Schematic diagram and nucleotide sequence of the hTERT gene 5'-flanking sequences. The region extending to bp 1009 upstream of the hTERT ATG (+1) and the locations of the two ERE half-sites and of an additional downstream half-site (black triangles) are indicated. The hTERT promoter sequence between bp -1009 and -755 is shown below the diagram. The boxes define the composite regulatory unit comprising an imperfect palindromic ERE at positions -949 to -935, a partially overlapping AP1 binding site, an adjacent SP1 motif, and the single ERE half-site at positions -794 to -789. The asterisks indicate G residues altered in the genomic footprints shown in Fig. 2. (b) ERalpha binding to the hTERT ERE. A 32P-labeled double-stranded oligonucleotide containing the hTERT ERE sequence was incubated with extracts of Sf9 cells infected with wild-type (wt) baculovirus (lane 2) or recombinant baculovirus expressing human ERalpha (lanes 3 to 10). Lane 1, probe alone; lane 3, recombinant ERalpha alone; lanes 4 to 9, like lane 3 but with 25-, 100-, and 250-fold molar excesses of unlabeled oligonucleotides containing the hTERT (lanes 4 to 6) or FXII (lanes 7 to 9) ERE sequences; lane 10, like lane 3 but with a 250-fold molar excess of an unrelated unlabeled oligonucleotide (NS). (c) ERbeta binding to EREs. 32P-labeled double-stranded oligonucleotides containing the VIT ERE (lanes 1 to 4) or the hTERT ERE (lanes 5 to 8) were incubated with extracts of Sf9 cells infected with recombinant baculovirus expressing human ERbeta (lanes 2 to 4 and 6 to 8) in the presence of (E2) (lanes 2, 4, 6, and 8) or of TAM (lanes 3 and 7). Anti-ERbeta antibodies (lanes 4 and 8) were used for supershifting ERbeta -ERE complexes. Lane 1, VIT ERE probe alone; lane 5, hTERT ERE probe alone.

We first evaluated the ability of the hTERT promoter to bind in vitro ligand-activated human ERs. Incubation of a 32P-labeled oligonucleotide spanning the hTERT ERE with extracts from S. frugiperda (Sf9) cells infected with a baculovirus expressing ERalpha (Fig. 1b, lane 3) resulted in the formation of a specific complex that was progressively inhibited by increasing concentrations of unlabeled oligonucleotides corresponding to the hTERT ERE (Fig. 1b, lanes 4 to 6) or to the well-characterized FXII ERE (12) (Fig. 1b, lanes 7 to 9). Compared to the hTERT ERE, the FXII ERE was a less efficient competitor, likely because of sequence divergence between the two oligonucleotides within the 5' half-site. No inhibition was observed upon the addition of a 250-fold molar excess of an unrelated oligonucleotide (Fig. 1b, lane 10), and no complex was formed when the hTERT ERE was incubated with extracts from SF9 cells infected with wild-type virus (Fig. 1b, lane 2), underscoring the specificity of the interaction between ERalpha and the hTERT ERE. An oligonucleotide containing a mutated hTERT ERE competed weakly for ER binding (data not shown), in agreement with functional data showing that mutations strongly reduced the estrogen response of the element (see Fig. 3a and b). Incubation of 32P-labeled hTERT ERE with Sf9 cells infected with a baculovirus expressing ERbeta did not show any interaction, whether in the presence or absence of E2 or of the antiestrogen 4-hydroxytamoxifen (TAM). As a control for the functionality of ERbeta , the canonical X. laevis VIT ERE was used (Fig. 1c). In the presence of E2, ERbeta bound the VIT ERE and was supershifted upon the addition of anti-ERbeta antibody (Fig. 1c, lanes 2 and 4, respectively). The addition of TAM to the binding mixture inhibited the formation of the ERbeta -VIT ERE complex (Fig. 1c, lane 3).

To assess the functionality of the hTERT ERE in cells from estrogen-regulated tissues, we compared the in vivo DNA footprints over this region in ERalpha -positive (MCF-7 and OVCA-433) and ERalpha -negative (MDA-MB231 and HeLa) cells (Fig. 2a) cultured in the presence or absence of E2 (10-7 M) for various times. Cells were treated with DMS, and their DNA was analyzed by LM PCR with primers specific for the region of the hTERT promoter from positions -1025 to -917 relative to the ATG (Fig. 1a). The extent of protection or hypersensitivity of specific residues was evaluated by densitometry (Table 1) (Materials and Methods). A comparison of DNA extracted from DMS-treated cells to purified DNA treated with DMS in vitro (Fig. 2b to e) revealed a mixed pattern of protected and hyperreactive G residues in cells constitutively expressing ERalpha (e.g., MCF-7 and OVCA-433). In particular, in MCF-7 cells grown in the absence of E2, we observed protection (~70%) of the G at position -954; protection was less pronounced (~40%) in cells grown with the hormone (Fig. 2b, compare lane 2 with lanes 1 and 3). The addition of estrogen resulted in hypermethylation (30 to 55%) of two clusters of G residues, at positions -949 to -945, immediately upstream of and within the hTERT ERE 5' half-site; this result was compatible with unmasking of binding sites normally inaccessible to transcription factors, as suggested for the uteroglobin gene enhancer in hormone-treated endometrial cells (39). In OVCA-433 cells (Fig. 2d), estrogen treatment resulted in a different pattern, with consistent protection (35 to 45%) of four G residues (at positions -954, -950, -946, and -944) upstream of and within the 5' half-site of the ERE. In addition, G residues at positions -931 and -927 downstream of the ERE were protected, in comparison to the results for in vitro-treated DNA or DNA from cells grown without estrogen. Protection of all these regions may be mediated by the conformational and functional changes that the ER undergoes following transition from an inactive to an active state (2, 28). The presence of a binding site for AP1 and SP1 adjacent to or within the ERE may also contribute to this effect, since these nuclear proteins have been shown to interact with ERalpha in certain contexts involving estrogen-regulated promoters (35, 44).


View larger version (71K):
[in this window]
[in a new window]
 
FIG. 2.   (a) Expression of endogenous ERalpha by Western blot analysis. ERalpha -negative (HeLa and MDA-MB231) and ERalpha -positive (OVCA-433 and MCF-7) cells were lysed directly in protein sample buffer, and equal amounts of protein were separated on a denaturing 12% polyacrylamide gel. Immunostaining was performed with anti-ERalpha antibody HC-20. As a loading control, proteins were stained with Ponceau S (data not shown). Treatment with E2 did not affect the levels of ERalpha in the ER-positive cells (data not shown). (b to e) DMS genomic footprinting of the hTERT promoter. Cells were treated with the DNA-alkylating reagent DMS, and their DNA was cleaved with piperidine and analyzed by LM PCR with primers specific for the region of the hTERT promoter from bp -1025 to -917 relative to the ATG (Fig. 1a). (b) Breast cancer MCF-7 cells. (c) Breast cancer MDA-MB231 cells. (d) Ovarian cancer OVCA-433 cells. (e) Cervical cancer HeLa cells. Length (in hours) of treatment with E2 (lanes 2, 3, 5 to 9, and 11 to 13) is indicated. In vitro-methylated DNA from each cell line is shown in lanes 1, 4, 10, and 14. Protected guanine residues over the ERE region are indicated by open arrows, while relevant hypermethylated guanine residues are indicated by filled arrows (b and d). Corresponding G residues unmodified in ERalpha -negative cells are indicated by arrowheads (c and e). The asterisks (in panel d) indicate two protected guanine residues, of unknown significance, downstream of the ERE region.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Densitometry of genomic footprintsa

In MDA-MB231 and HeLa cells, both of which do not express ERalpha (Fig. 2a), no genomic footprint was detectable over the region comprising the ERE, regardless of hormone treatment (Fig. 2c and e); this result suggests that no factors are bound to this region, at least in these cell backgrounds. The lack of a footprint in MDA-MB231 cells, which express low levels of human ERbeta (1), further indicates that this receptor does not interact in vivo with the hTERT ERE. Overall, these results demonstrate that distinct and cell-type specific remodelling of chromatin takes place over the hTERT ERE upon hormonal induction and that the expression of ERalpha is required for this effect.

Functional characterization of the hTERT ERE. Chimeric constructs containing the luciferase reporter fused to two fragments of the hTERT promoter, P-1009 and P-330 (6), only the first of which contains the ERE, were cotransfected with an ERalpha expression vector into NIH 3T3 murine fibroblasts and immortal HOSE WOO cells in the presence or absence of E2 (10-7 M). In NIH 3T3 cells, the combination of ERalpha and estrogen resulted in about 40-fold enhancement in the activity of the P-1009 promoter. Mutation of the hTERT ERE in P-1009Mut essentially abrogated the estrogen responsiveness of this construct (Fig. 3a). No estrogen-mediated activation was observed with the ERE-negative construct P-330. Similar results were obtained with WOO cells (Fig. 3b), although in this case the hormone-dependent induction of the P-1009 promoter was substantially less pronounced (about fourfold). This reduced responsiveness could be accounted for by the higher basal level of the promoter in WOO cells and/or by the effects of other cell-specific factors that may contribute to hTERT transcriptional regulation in ovarian cells.


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3.   Effects of E2 and ERs on hTERT promoter activity. (a and b) NIH 3T3 or WOO cells, grown in the presence or absence of 10-7 M E2, were cotransfected with 5 µg of the hTERT promoter-luciferase reporter plasmids (P-1009, P-1009Mut, and P-330) or the control vector pGL2-Enhancer (pGL2), 5 µg of the ERalpha expression vector, and 250 ng of pCMV-beta gal. Cells were assayed for luciferase and beta -galactosidase activities after 48 to 72 h. Data are expressed as light units/beta -galactosidase units in the presence (+) or absence (-) of hormone. Results represent the average (± standard error [SE]) of a minimum of three independent experiments, each performed in duplicate. (c) NIH 3T3 cells were transfected with P-1009, alone (- ER) or in combination with expression vectors for ERalpha (+ ERalpha ) or ERbeta (+ ERbeta ), in the presence of E2 or TAM. The VIT promoter (nucleotides -596 to +8), containing a perfect ERE, was used as a control reporter (VIT). Results represent the average (± SE) of three independent experiments, each performed in duplicate, and values are expressed as fold induction (ratio with and without ligand). (d) NIH 3T3 cells were cotransfected with (+ ERalpha ) or without (- ERalpha ) the expression vector for ERalpha and the hTERT-ERE-TK and TK reporters as indicated and cultured in the absence or presence of E2. Results of a representative experiment out of two, each performed in triplicate, are expressed as fold induction as described for panel c.

The oncogene c-myc has been shown to activate telomerase through a variety of sites (45), and estrogens have been shown to activate c-myc (10). The two c-myc binding sites within the first 250 nucleotides upstream of the ATG are present in both the P-1009 and the P-330 constructs; therefore, the observed differences in the activation of these two reporters cannot be explained by the presence of these sites. Moreover, the lack of activation with P-1009Mut demonstrates specific dependence on the hTERT ERE. Thus, our data rule out an indirect effect of estrogens mediated by the activation of c-myc.

To expand on the results of the electrophorectic mobility shift assays and DNA footprinting experiments, the potential role of ERbeta in hTERT promoter function was evaluated directly by cotransfection of the ERbeta expression vector and the P-1009 reporter in NIH 3T3 cells (Fig. 3c). Unlike the results obtained with ERalpha and in agreement with the results of the band shift assays, no induction of promoter activity by ERbeta over basal levels was observed in the presence of E2. Moreover, treatment with TAM, which is reported to activate ERbeta via an AP1 binding site (34), did not elicit a promoter response. As expected, the addition of TAM virtually abrogated ERalpha transactivation. These results demonstrate that the ERE contained within the proximal 1 kb of the hTERT promoter is functional and is necessary for transcriptional regulation by ligand-activated ERalpha . In contrast, ERbeta does not appear to mediate E2 induction of the hTERT promoter.

The ability of hTERT ERE to respond to E2 on its own was assessed by cloning a single copy of this element upstream of the TK promoter (hTERT-ERE-TK construct). With the control vector (TK), in which the reporter is under the control of the TK promoter (positions -105 to +51), there was no change in chloramphenicol acetyltransferase activity upon cotransfection with ERalpha and treatment with E2 (Fig. 3d). In contrast, the hTERT ERE was able to confer E2 inducibility (threefold) to the heterologous TK promoter, demonstrating the regulatory properties of this element.

Estrogen induction of telomerase activity and hTERT expression. To further investigate the potential role of sex steroid hormones in the regulation of hTERT expression and of telomerase activity, we made use of normal HOSE cells, derived from estrogen-responsive tissue from which over 90% of ovarian tumors arise (23). HOSE cells express substantial levels of ERs (11, 15; data not shown), and specific transcripts for both ERalpha and ERbeta as well as androgen and progesterone receptors are detectable in these cells in postmenopausal women (15). These properties, together with the lack of telomerase activity, make HOSE cells a suitable model to study the role of steroid hormones in telomerase regulation.

To assess whether transcriptional induction of hTERT promoter activity by E2 was paralleled by the induction of hTERT mRNA expression in estrogen-sensitive tissues, hTERT mRNA levels were measured in HOSE cells by semiquantitative RT-PCR. In the absence of hormone, no expression of hTERT mRNA was detected, whereas treatment with E2 for 6 h resulted in the appearance of a product corresponding to the amplified hTERT cDNA fragment (Fig. 4). The prompt estrogen induction of hTERT mRNA is in agreement with a regulatory mechanism acting at the transcriptional level. In addition to the mRNA, expression of the hTERT protein in the same set of primary ovarian cells was monitored by indirect immunofluorescence. Figure 5 shows the results obtained with LEA (Fig. 5a, b, e, and f) and LLO (Fig. 5c, d, g, and h) cells stained with antibody K-370 to the telomerase protein (Fig. 5a, c, e, and g). As a control, telomerase-positive, ERalpha -negative HeLa cells were included in each assay (data not shown). In the absence of hormone, no fluorescent signal was detected (Fig. 5a and c), in agreement with the lack of hTERT transcripts. The addition of E2 (Fig. 5e and g) for 6 h resulted in specific staining in over 70% of the cells. The staining pattern was predominantly nuclear and punctuated, as described for hTERT (14, 29). However, in the majority of LEA cells, staining extended to the cytoplasm (Fig. 5e); the reason for this dual pattern in not clear, but the morphology of cells with nuclear and cytoplasmic staining suggested that they might be approaching senescence.


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4.   Expression of hTERT mRNA in HOSE cells upon estrogen treatment. Total RNA was extracted from LEA (lanes 1 and 2) and LLO (lanes 3 and 4) cells grown in the presence (+) or absence (-) of 10-7 M E2 for 6 h. RT-PCR analysis was performed using primers specific for the hTERT and housekeeping aldolase genes and the conditions described in Materials and Methods. Lane 5, HeLa cell RNA as a control; lane 6, no cDNA template. Positions of molecular size markers are indicated.


View larger version (55K):
[in this window]
[in a new window]
 
FIG. 5.   Induction of hTERT expression by E2. LEA (a, b, e, and f) and LLO (c, d, g, and h) cells were grown in the absence (a to d) or presence (e to h) of E2 and stained with anti-hTERT antibody K-370 (a, c, e, and g) or with Hoechst 33258 (b, d, f, and h). Uninduced cells (a and c) did not express hTERT, while treatment with the hormone for 6 h resulted in abundant nuclear accumulation of the protein (e and g). Magnification, ×85.

Finally, telomerase activity in extracts of HOSE cell strains (GRO, LEA, and LLO) and in immortal HOSE cells (WOO) grown in the absence or presence of estrogens was assayed by TRAP (Fig. 6). As reported previously (8), extracts from mortal cells were telomerase negative in the uninduced state (Fig. 6, lanes 3, 7, and 11). Upon the addition of E2 (10-7 M) to the culture medium, telomerase activity was induced within 3 h of treatment and increased marginally by 6 h. By 24 h, enzymatic activity was reduced, likely because of E2 intracellular catabolism (46). No hormonal induction of telomerase activity was observed in human embryonic kidney cells, which are telomerase negative and non-estrogen responsive (data not shown). Extracts from immortal WOO cells were telomerase positive, even in the absence of E2 (8); estrogen treatment did not induce significant changes in telomerase activity (Fig. 6, lanes 15 to 18), suggesting that once telomerase reactivation has taken place (here through cell immortalization), no estrogen-dependent modulation of enzymatic activity is detectable.


View larger version (76K):
[in this window]
[in a new window]
 
FIG. 6.   Telomerase activity in response to E2 treatment. Telomerase activity was assayed by TRAP in extracts from GRO (lanes 3 and 4), LEA (lanes 7 to 10), LLO (lanes 11 to 14), and WOO (lanes 15 to 18) cells. Assays shown were performed with 5 µg of protein, except in the case of WOO cells (10 µg of protein; similar results were obtained with 1 µg of protein). Cells were grown in the presence of E2 at 10-7 M for the indicated times. As positive and negative controls, 0.1 µg of protein from telomerase-positive HeLa cells was assayed before and after heat inactivation (no E2) (lanes 2 and 1, respectively).

Taken together, the above results indicate that estrogen treatment induces de novo hTERT expression and telomerase activity in telomerase-negative primary ovary epithelial cells with rapid kinetics strongly indicative of hormone-dependent transcriptional regulation of the hTERT gene. Our results differ from those of Tanaka et al. (41), who failed to detect changes in telomerase activity upon estrogen treatment of human endometrial cells. However, as the authors themselves suggested, this lack of response may have been related to the cells used, telomerase-positive endometrial cells that were unable to proliferate in vitro. Moreover, it has been shown that estrogen effects on the endometrium are mediated indirectly by ER-positive stromal cells (7).

In conclusion, the finding that hormone treatment of telomerase-negative ovary epithelium cells activates hTERT expression and telomerase provides, to our knowledge, the first direct evidence that a "physiological" stimulus may reverse telomerase silencing in normal cells. In addition, the identification of the hTERT gene as a target of hormones greatly advances the understanding of telomerase regulation in normal and malignant hormone-dependent cells and provides a suitable model for investigating the effects of steroid hormones in cell senescence and oncogenesis.

After submission of this paper, Kyo et al. (26) reported the activation of hTERT expression and of telomerase by E2 in MCF-7 breast cancer cells. Together with our results, these findings indicate that estrogens play a role in the regulation of telomerase expression in estrogen-targeted tissues under different physiological and pathological conditions.


    ACKNOWLEDGMENTS

We are grateful to Jan-Ake Gustafsson for the ERbeta expression vector and to Maria Blasco for antibody K-370. We also thank the anonymous reviewer for very helpful suggestions on the role of c-myc in the response of telomerase to estrogens.

This work was supported by grants from Associazione Italiana per la Ricerca sul Cancro (AIRC), Ministero della Sanità, Ministero dell'Università e della Ricerca Scientifica e Tecnologica (MURST), and the National Cancer Institute of Canada (NCIC) to S.B.

S.M. and S.N. contributed equally to this work.


    FOOTNOTES

* Corresponding author. Mailing address for Silvia Bacchetti: Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario L8N 3Z5, Canada. Phone: (905) 525-9140, ext. 22296. Fax: (905) 546-9940. E-mail: bacchett{at}fhs.mcmaster.ca. Mailing address for Antonella Farsetti: Molecular Oncogenesis Laboratory, Regina Elena Cancer Institute, Via delle Messi d'Oro 156, 00158 Rome, Italy. Phone: (39-06) 4985-2531. Fax: (39-06) 4180-526. E-mail: farsetti{at}crs.ifo.it.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Aldous, W. K., A. J. Marean, M. J. DeHart, L. A. Matej, and K. H. Moore. 1999. Effects of tamoxifen on telomerase activity in breast carcinoma cell lines. Cancer 85:1523-1529[CrossRef][Medline].
2. Beato, M., and A. Sanchez-Pacheco. 1996. Interaction of steroid hormone receptors with the transcription initiation complex. Endocrinol. Rev. 17:587-609[Abstract/Free Full Text].
3. Bednarek, A. K., Y. Chu, and C. M. Aldaz. 1998. Constitutive telomerase activity in cells with tissue-renewing potential from estrogen-regulated rat tissues. Oncogene 16:381-385[CrossRef][Medline].
4. Bodnar, A. G., M. Ouellette, M. Frolkis, S. E. Holt, C. P. Chiu, G. B. Morin, C. B. Harley, J. W. Shay, S. Lichtsteiner, and W. E. Wright. 1998. Extension of life-span by introduction of telomerase into normal human cells. Science 279:349-352[Abstract/Free Full Text].
5. Brown, M., and P. A. Sharp. 1990. Human estrogen receptor forms multiple protein-DNA complexes. J. Biol. Chem. 265:11238-11243[Abstract/Free Full Text].
6. Cong, Y. S., J. Wen, and S. Bacchetti. 1999. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum. Mol. Genet. 8:137-142[Abstract/Free Full Text].
7. Cooke, P. S., D. L. Buchanan, P. Young, T. Seawan, J. Brody, K. S. Korach, J. Taylor, D. B. Lubhan, and G. R. Cunha. 1997. Stromal estrogen receptors mediate mitogenic effects of estradiol on uterine epithelium. Proc. Natl. Acad. Sci. USA 94:6535-6540[Abstract/Free Full Text].
8. Counter, C. M., H. W. Hirte, S. Bacchetti, and C. B. Harley. 1994. Telomerase activity in human ovarian carcinoma. Proc. Natl. Acad. Sci. USA 91:2900-2904[Abstract/Free Full Text].
9. Dey, A., A. M. Thornton, M. Lonergan, S. M. Weissman, J. W. Chamberlain, and K. Ozato. 1992. Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse tissues. Mol. Cell. Biol. 12:3590-3599[Abstract/Free Full Text].
10. Dubik, D., and R. P. C. Shiu. 1992. Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7:1587-1594[Medline].
11. Enmark, E., M. Pelto-Huikko, K. Grandien, S. Lagercrantz, J. Lagercrantz, C. Nordenskjold, and J. A. Gustafsson. 1997. Human estrogen receptor beta-gene structure, chromosomal localization and expression pattern. J. Clin. Endocrinol. Metab. 82:4258-4265[Abstract/Free Full Text].
12. Farsetti, A., S. Misiti, F. Citarella, A. Felici, M. Andreoli, A. Fantoni, A. Sacchi, and A. Pontecorvi. 1995. Molecular basis of estrogen regulation of Hageman factor XII gene expression. Endocrinology 136:5076-5083[Abstract].
13. Green, S., I. Issemann, and E. Sheer. 1998. A versatile in vivo and in vitro eucaryotic expression vector for protein engineering. Nucleic Acids Res. 16:369[Free Full Text].
14. Harrington, L., W. Zhou, T. McPhail, R. Oulton, D. S. K. Yeung, V. Mar, M. B. Bass, and M. O. Robinson. 1997. Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev. 11:3109-3115[Abstract/Free Full Text].
15. Hillier, S. G., R. A. Anderson, A. R. Williams, and M. Tetsuka. 1998. Expression of oestrogen receptor alpha and beta in cultured human ovarian surface epithelial cells. Mol. Hum. Reprod. 4:811-815[Abstract/Free Full Text].
16. Holt, S. E., and J. W. Shay. 1999. Role of telomerase in cellular proliferation and cancer. J. Cell. Physiol. 180:10-18[CrossRef][Medline].
17. Horikawa, I., P. L. Cable, C. Afshari, and J. C. Barrett. 1999. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res. 59:826-830[Abstract/Free Full Text].
18. Horwitz, K. B., and W. L. McGuire. 1987. Estrogen control of progesterone receptor in human breast cancer. J. Biol. Chem. 266:1008-1013[Abstract/Free Full Text].
19. Horwitz, K. B., T. A. Jackson, D. L. Bain, J. K. Richer, G. S. Takimoto, and L. Tung. 1996. Nuclear receptor coactivators and corepressors. Mol. Endocrinol. 10:1167-1177[Abstract/Free Full Text].
20. Katzenellenbogen, J. A., B. W. O'Malley, and B. S. Katzenellenbogen. 1996. Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol. Endocrinol. 10:119-131[Free Full Text].
21. Kilian, A., D. D. L. Bowtell, H. E. Abud, G. R. Hime, D. J. Venter, P. K. Keese, E. L. Duncan, R. R. Reddel, and R. A. Jefferson. 1997. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum. Mol. Genet. 6:2011-2019[Abstract/Free Full Text].
22. Kim, N. W., and F. Wu. 1997. Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res. 25:2595-2597[Abstract/Free Full Text].
23. Kommos, F. 1996. Gynaecological cancer, p. 541-572. In J. R. Pasqualini, and B. S. Katzenellenbogen (ed.), Hormone-dependent cancer. Marcel Dekker, Inc., New York, N.Y.
24. Kuiper, G. G., J. G. Lemmen, B. Carlsson, J. C. Corton, S. H. Safe, P. T. van der Saag, B. van der Burg, and J. A. Gustafsson. 1998. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 139:4252-4263[Abstract/Free Full Text].
25. Kyo, S., M. Takakura, T. Kohama, and M. Inoue. 1997. Telomerase activity in human endometrium. Cancer Res. 57:610-614[Abstract/Free Full Text].
26. Kyo, S., M. Takakura, T. Kanaya, W. Zhuo, K. Fujimoto, Y. Nishio, A. Orimo, and M. Inoue. 1999. Estrogen activates telomerase. Cancer Res. 59:5917-5921[Abstract/Free Full Text].
27. Lau, K. M., S. C. Mok, and S. M. Ho. 1999. Expression of mouse telomerase catalytic subunit in embryos and adult tissues. Proc. Natl. Acad. Sci. USA 96:5722-5727[Abstract/Free Full Text].
28. Lazennec, G., T. R. Ediger, L. N. Petz, A. M. Nardulli, and B. S. Katzenellenbogen. 1997. Mechanistic aspects of estrogen receptor activation probed with constitutively active estrogen receptors: correlations with DNA and coregulator interactions and receptor conformational changes. Mol. Endocrinol. 11:1375-1386[Abstract/Free Full Text].
29. Martin-Rivera, L., E. Herrera, J. P. Albar, and M. A. Blasco. 1998. Expression of mouse telomerase catalytic subunit in embryos and adult tissues. Proc. Natl. Acad. Sci. USA 95:10471-10476[Abstract/Free Full Text].
30. Meeker, A. K., H. J. Sommerfeld, and D. S. Coffey. 1996. Telomerase is activated in the prostate and seminal vesicles of castrated rats. Endocrinology 137:5743-5746[Abstract].
31. Moretti, F., A. Farsetti, S. Soddu, S. Misiti, M. Crescenzi, S. Filetti, M. Andreoli, A. Sacchi, and A. Pontecorvi. 1997. P53 re-expression inhibits proliferation and restores differentiation of human thyroid anaplastic carcinoma cells. Oncogene 14:729-740[CrossRef][Medline].
32. Mueller, P. R., S. J. Salser, and B. Wold. 1988. Constitutive and metal-inducible protein: DNA interactions at the mouse metallothionein I promoter examined by in vivo and in vitro footprinting. Genes Dev. 2:412-427[Abstract/Free Full Text].
33. Nugent, C. I., and V. Lundblad. 1998. The telomerase reverse transcriptase: components and regulation. Genes Dev. 12:1073-1085[Free Full Text].
34. Paech, K., P. Webb, G. G. J. M. Kuiper, S. Nilsson, J.-A. Gustafsson, P. J. Kushner, and T. S. Scanlan. 1997. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP-1 site. Science. 277:1508-1510[Abstract/Free Full Text].
35. Porter, W., B. Saville, D. Hoivik, and S. Safe. 1997. Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol. Endocrinol. 11:1569-1580[Abstract/Free Full Text].
36. Rodriguez, G. C., A. Berchuck, R. S. Whitaker, D. Schlossman, D. L. Clarke-Pearson, and R. C. Bast, Jr. 1991. Epidermal growth factor expression in normal ovarian epithelium and ovarian cancer. Am. J. Obstet. Gynecol. 164:745-750[Medline].
37. Saito, T., A. Schneider, N. Martel, H. Mizumoto, M. Bulgay-Moerschel, R. Kudo, and H. Nakazawa. 1997. Proliferation-associated regulation of telomerase activity in human endometrium and its potential implication in early cancer diagnosis. Biochem. Biophys. Res. Commun. 231:610-614[CrossRef][Medline].
38. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
39. Scholz, A., M. Truss, and M. Beato. 1999. Hormone-dependent recruitment of NF-Y to the uteroglobin gene enhancer associated with chromatin remodeling in rabbit endometrial epithelium. J. Biol. Chem. 274:4017-4026[Abstract/Free Full Text].
40. Takakura, M., S. Kyo, T. Kanaya, H. Hirano, J. Takeda, M. Yutsudo, and M. Inoue. 1999. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res. 59:551-557[Abstract/Free Full Text].
41. Tanaka, M., M. Takakura, T. Kanaya, T. Sagawa, K. Yamashita, Y. Okada, E. Hiyama, and M. Inoue. 1998. Expression of telomerase activity in human endometrium is localized to epithelial glandular cells and regulated in a menstrual phase-dependent manner correlated with cell proliferation. Am. J. Pathol. 153:1985-1991[Abstract/Free Full Text].
42. Ulaner, G. A., J. F. Hu, T. H. Vu, L. C. Giudice, and R. Hoffman. 1998. Telomerase activity in human development is regulated by human telomerase reverse transcriptase transcription and by alternative splicing of hTERT transcripts. Cancer Res. 58:4168-4172[Abstract/Free Full Text].
43. Vaziri, H., and S. Benchimol. 1998. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr. Biol. 8:279-282[CrossRef][Medline].
44. Webb, P., G. N. Lopez, R. M. Uht, and P. J. Kushner. 1995. Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol. Endocrinol. 9:443-456[Abstract/Free Full Text].
45. Wu, K.-J., C. Grandori, M. Amacker, N. Simon-Vermot, A. Polack, J. Lingner, and R. Dalla-Favera. 1999. Direct activation of TERT transcription by c-Myc. Nat. Genet. 21:220-224[CrossRef][Medline].
46. Zimmermann, H., R. Koytchev, O. Mayer, A. Borner, U. Mellinger, and H. Breitbarth. 1998. Pharmacokinetics of orally administered estradiol-valerate. Results of a single-dose cross-over bioequivalence study in postmenopausal women. Arzneimittelforschung 48:941-947[Medline].


Molecular and Cellular Biology, June 2000, p. 3764-3771, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Calado, R. T., Yewdell, W. T., Wilkerson, K. L., Regal, J. A., Kajigaya, S., Stratakis, C. A., Young, N. S. (2009). Sex hormones, acting on the TERT gene, increase telomerase activity in human primary hematopoietic cells. Blood 114: 2236-2243 [Abstract] [Full Text]  
  • Hrdlickova, R., Nehyba, J., Bose, H. R. Jr. (2009). Regulation of Telomerase Activity by Interferon Regulatory Factors 4 and 8 in Immune Cells. Mol. Cell. Biol. 29: 929-941 [Abstract] [Full Text]  
  • Rotinen, M., Celay, J., Alonso, M. M, Arrazola, A., Encio, I., Villar, J. (2009). Estradiol induces type 8 17{beta}-hydroxysteroid dehydrogenase expression: crosstalk between estrogen receptor {alpha} and C/EBP{beta}. J Endocrinol 200: 85-92 [Abstract] [Full Text]  
  • Farsetti, A., Grasselli, A., Bacchetti, S., Gaetano, C., Capogrossi, M. C. (2009). The telomerase tale in vascular aging: regulation by estrogens and nitric oxide signaling. J. Appl. Physiol. 106: 333-337 [Abstract] [Full Text]  
  • Xu, M., Luo, W., Elzi, D. J., Grandori, C., Galloway, D. A. (2008). NFX1 Interacts with mSin3A/Histone Deacetylase To Repress hTERT Transcription in Keratinocytes. Mol. Cell. Biol. 28: 4819-4828 [Abstract] [Full Text]  
  • Grasselli, A., Nanni, S., Colussi, C., Aiello, A., Benvenuti, V., Ragone, G., Moretti, F., Sacchi, A., Bacchetti, S., Gaetano, C., Capogrossi, M. C., Pontecorvi, A., Farsetti, A. (2008). Estrogen Receptor-{alpha} and Endothelial Nitric Oxide Synthase Nuclear Complex Regulates Transcription of Human Telomerase. Circ. Res. 103: 34-42 [Abstract] [Full Text]  
  • Moehren, U., Papaioannou, M., Reeb, C. A., Grasselli, A., Nanni, S., Asim, M., Roell, D., Prade, I., Farsetti, A., Baniahmad, A. (2008). Wild-type but not mutant androgen receptor inhibits expression of the hTERT telomerase subunit: a novel role of AR mutation for prostate cancer development. FASEB J. 22: 1258-1267 [Abstract] [Full Text]  
  • Minamino, T., Komuro, I. (2007). Vascular Cell Senescence: Contribution to Atherosclerosis. Circ. Res. 100: 15-26 [Abstract] [Full Text]  
  • Russo, V., Berardinelli, P., Martelli, A., Di Giacinto, O., Nardinocchi, D., Fantasia, D., Barboni, B. (2006). Expression of Telomerase Reverse Transcriptase Subunit (TERT) and Telomere Sizing in Pig Ovarian Follicles. J. Histochem. Cytochem. 54: 443-455 [Abstract] [Full Text]  
  • Kirschenbaum, A., Liu, X.-H., Yao, S., Narla, G., Friedman, S. L., Martignetti, J. A., Levine, A. C. (2006). Sex steroids have differential effects on growth and gene expression in primary human prostatic epithelial cell cultures derived from the peripheral versus transition zones. Carcinogenesis 27: 216-224 [Abstract] [Full Text]  
  • Tarry-Adkins, J. L., Ozanne, S. E., Norden, A., Cherif, H., Hales, C. N. (2006). Lower antioxidant capacity and elevated p53 and p21 may be a link between gender disparity in renal telomere shortening, albuminuria, and longevity. Am. J. Physiol. Renal Physiol. 290: F509-F516 [Abstract] [Full Text]  
  • Hrdlickova, R., Nehyba, J., Liss, A. S., Bose, H. R. Jr. (2006). Mechanism of Telomerase Activation by v-Rel and Its Contribution to Transformation. J. Virol. 80: 281-295 [Abstract] [Full Text]  
  • Li, Y., Idamakanti, N., Arroyo, T., Thorne, S., Reid, T., Nichols, S., VanRoey, M., Colbern, G., Nguyen, N., Tam, O., Working, P., Yu, D.-C. (2005). Dual Promoter-Controlled Oncolytic Adenovirus CG5757 Has Strong Tumor Selectivity and Significant Antitumor Efficacy in Preclinical Models. Clin. Cancer Res. 11: 8845-8855 [Abstract] [Full Text]  
  • Renaud, S., Loukinov, D., Bosman, F. T., Lobanenkov, V., Benhattar, J. (2005). CTCF binds the proximal exonic region of hTERT and inhibits its transcription. Nucleic Acids Res 33: 6850-6860 [Abstract] [Full Text]  
  • Gomez-Garcia, L, Sanchez, F M, Vallejo-Cremades, M T, de Segura, I A G., De Miguel del Campo, E (2005). Direct activation of telomerase by GH via phosphatidylinositol 3'-kinase. J Endocrinol 185: 421-428 [Abstract] [Full Text]  
  • Zaccagnini, G., Gaetano, C., Della Pietra, L., Nanni, S., Grasselli, A., Mangoni, A., Benvenuto, R., Fabrizi, M., Truffa, S., Germani, A., Moretti, F., Pontecorvi, A., Sacchi, A., Bacchetti, S., Capogrossi, M. C., Farsetti, A. (2005). Telomerase Mediates Vascular Endothelial Growth Factor-dependent Responsiveness in a Rat Model of Hind Limb Ischemia. J. Biol. Chem. 280: 14790-14798 [Abstract] [Full Text]  
  • Benvenuti, S., Luciani, P., Vannelli, G. B., Gelmini, S., Franceschi, E., Serio, M., Peri, A. (2005). Estrogen and Selective Estrogen Receptor Modulators Exert Neuroprotective Effects and Stimulate the Expression of Selective Alzheimer's Disease Indicator-1, a Recently Discovered Antiapoptotic Gene, in Human Neuroblast Long-Term Cell Cultures. J. Clin. Endocrinol. Metab. 90: 1775-1782 [Abstract] [Full Text]  
  • Ritz, J. M., Kuhle, O., Riethdorf, S., Sipos, B., Deppert, W., Englert, C., Gunes, C. (2005). A Novel Transgenic Mouse Model Reveals Humanlike Regulation of an 8-kbp Human TERT Gene Promoter Fragment in Normal and Tumor Tissues. Cancer Res. 65: 1187-1196 [Abstract] [Full Text]  
  • Wang, S., Zhu, J. (2004). The hTERT Gene Is Embedded in a Nuclease-resistant Chromatin Domain. J. Biol. Chem. 279: 55401-55410 [Abstract] [Full Text]  
  • Sinha-Datta, U., Horikawa, I., Michishita, E., Datta, A., Sigler-Nicot, J. C., Brown, M., Kazanji, M., Barrett, J. C., Nicot, C. (2004). Transcriptional activation of hTERT through the NF-{kappa}B pathway in HTLV-I-transformed cells. Blood 104: 2523-2531 [Abstract] [Full Text]  
  • Biroccio, A., Leonetti, C. (2004). Telomerase as a new target for the treatment of hormone-refractory prostate cancer. Endocr Relat Cancer 11: 407-421 [Abstract] [Full Text]  
  • Bardin, A, Boulle, N, Lazennec, G, Vignon, F, Pujol, P (2004). Loss of ER{beta} expression as a common step in estrogen-dependent tumor progression. Endocr Relat Cancer 11: 537-551 [Abstract] [Full Text]  
  • Takeda, T., Inaba, H., Yamazaki, M., Kyo, S., Miyamoto, T., Suzuki, S., Ehara, T., Kakizawa, T., Hara, M., DeGroot, L. J., Hashizume, K. (2003). Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter. J. Clin. Endocrinol. Metab. 88: 3531-3538 [Abstract] [Full Text]  
  • Horikawa, I., Barrett, J. C. (2003). Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms. Carcinogenesis 24: 1167-1176 [Abstract] [Full Text]  
  • Wang, S., Zhu, J. (2003). Evidence for a Relief of Repression Mechanism for Activation of the Human Telomerase Reverse Transcriptase Promoter. J. Biol. Chem. 278: 18842-18850 [Abstract] [Full Text]  
  • Cherif, H., Tarry, J. L., Ozanne, S. E., Hales, C. N. (2003). Ageing and telomeres: a study into organ- and gender-specific telomere shortening. Nucleic Acids Res 31: 1576-1583 [Abstract] [Full Text]  
  • Szutorisz, H., Lingner, J., Cuthbert, A. P., Trott, D. A., Newbold, R. F., Nabholz, M. (2003). A Chromosome 3-encoded Repressor of the Human Telomerase Reverse Transcriptase (hTERT) Gene Controls the State of hTERT Chromatin. Cancer Res. 63: 689-695 [Abstract] [Full Text]  
  • Fu, W., Lu, C., Mattson, M. P. (2002). Telomerase Mediates the Cell Survival-Promoting Actions of Brain-Derived Neurotrophic Factor and Secreted Amyloid Precursor Protein in Developing Hippocampal Neurons. J. Neurosci. 22: 10710-10719 [Abstract] [Full Text]  
  • Stewart, S. A. (2002). Multiple Levels of Telomerase Regulation. Mol. Interv. 2: 481-483 [Abstract] [Full Text]  
  • Cong, Y.-S., Wright, W. E., Shay, J. W. (2002). Human Telomerase and Its Regulation. Microbiol. Mol. Biol. Rev. 66: 407-425 [Abstract] [Full Text]  
  • Horikawa, I., Cable, P. L., Mazur, S. J., Appella, E., Afshari, C. A., Barrett, J. C. (2002). Downstream E-Box-mediated Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene Transcription: Evidence for an Endogenous Mechanism of Transcriptional Repression. Mol. Biol. Cell 13: 2585-2597 [Abstract] [Full Text]  
  • Mauro, L. J., Foster, D. N. (2002). Regulators of Telomerase Activity. Am. J. Respir. Cell Mol. Bio. 26: 521-524 [Full Text]  
  • Liu, T., Nozaki, Y., Phan, S. H. (2002). Regulation of Telomerase Activity in Rat Lung Fibroblasts. Am. J. Respir. Cell Mol. Bio. 26: 534-540 [Abstract] [Full Text]  
  • Mergny, J.-L., Riou, J.-F., Mailliet, P., Teulade-Fichou, M.-P., Gilson, E. (2002). Natural and pharmacological regulation of telomerase. Nucleic Acids Res 30: 839-865 [Abstract] [Full Text]  
  • Ducrest, A.-L., Amacker, M., Mathieu, Y. D., Cuthbert, A. P., Trott, D. A., Newbold, R. F., Nabholz, M., Lingner, J. (2001). Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity. Cancer Res. 61: 7594-7602 [Abstract] [Full Text]  
  • Lazennec, G., Bresson, D., Lucas, A., Chauveau, C., Vignon, F. (2001). ER{beta} Inhibits Proliferation and Invasion of Breast Cancer Cells. Endocrinology 142: 4120-4130 [Abstract] [Full Text]  
  • Elenitoba-Johnson, K. S. J. (2001). Complex Regulation of Telomerase Activity : Implications for Cancer Therapy. Am. J. Pathol. 159: 405-410 [Full Text]  
  • Pendino, F., Flexor, M., Delhommeau, F., Buet, D., Lanotte, M., Ségal-Bendirdjian, E. (2001). Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation. Proc. Natl. Acad. Sci. USA 10.1073/pnas.111464998v1 [Abstract] [Full Text]  
  • Cong, Y.-S., Bacchetti, S. (2000). Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells. J. Biol. Chem. 275: 35665-35668 [Abstract] [Full Text]  
  • Pendino, F., Flexor, M., Delhommeau, F., Buet, D., Lanotte, M., Segal-Bendirdjian, E. (2001). Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation. Proc. Natl. Acad. Sci. USA 98: 6662-6667 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Misiti, S.
Right arrow Articles by Farsetti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Misiti, S.
Right arrow Articles by Farsetti, A.