Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 3807-3816, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Three Yeast Proteins Related to the Human Candidate
Tumor Suppressor p33ING1 Are Associated with Histone
Acetyltransferase Activities
Robbie
Loewith,1
Maria
Meijer,1
Susan P.
Lees-Miller,2
Karl
Riabowol,1 and
Dallan
Young1,*
Departments of Biochemistry and Molecular
Biology and Oncology, University of Calgary Health Sciences
Centre,1 and Department of Biological
Sciences, University of Calgary,2 Calgary,
Alberta T2N 4N1, Canada
Received 26 August 1999/Returned for modification 26 October
1999/Accepted 13 March 2000
 |
ABSTRACT |
Three Saccharomyces cerevisiae proteins (Yng1/YOR064c,
Yng2/YHR090c, and Pho23) and two Schizosaccharomyces pombe
proteins (Png1/CAA15917 and Png2/CAA21250) share significant sequence
identity with the human candidate tumor suppressor p33ING1
in their C-terminal regions. The homologous regions contain PHD finger
domains which have been implicated in chromatin-mediated transcriptional regulation. We show that GFP-Yng2, like human Ing1, is
localized in the nucleus. Deletion of YNG2 results in several phenotypes, including an abnormal multibudded morphology, an
inability to utilize nonfermentable carbon sources, heat shock sensitivity, slow growth, temperature sensitivity, and sensitivity to
caffeine. These phenotypes are suppressed by expression of either human
Ing1 or S. pombe Png1, suggesting that the yeast and human
proteins are functionally conserved. Yng1- and Pho23-deficient cells
also share some of these phenotypes. We demonstrated by yeast
two-hybrid and coimmunoprecipitation tests that Yng2 interacts with
Tra1, a component of histone acetyltransferase (HAT) complexes. We
further demonstrated by coimmunoprecipitation that HA-Yng1, HA-Yng2,
HA-Pho23, and HA-Ing1 are associated with HAT activities in yeast.
Genetic and biochemical evidence indicate that the Yng2-associated HAT
is Esa1, suggesting that Yng2 is a component of the NuA4 HAT complex.
These studies suggest that the yeast Ing1-related proteins are involved
in chromatin remodeling. They further suggest that these functions may
be conserved in mammals and provide a possible mechanism for the human
Ing1 candidate tumor suppressor.
 |
INTRODUCTION |
Several observations suggest that
mammalian p33ING1 is involved in the regulation of cell
proliferation and apoptosis (18, 21, 28). NIH 3T3 cells
transformed by infection with a retrovirus containing a region of the
Ing1 cDNA in the antisense orientation exhibit anchorage-independent
growth in soft agar, and they form tumors in nude mice. Furthermore,
microinjection of constructs that express Ing1 in the sense orientation
results in inhibition of DNA synthesis and cell cycle progression in
human diploid fibroblasts. Ing1 levels are also increased upon the
induction of apoptosis in P19 cells by serum deprivation, and
overexpression of Ing1 in P19 and rodent fibroblasts enhances
Myc-dependent apoptosis (28). Evidence indicates that
expression of Ing1 is repressed in a majority of breast and lymphoid
cancer cell lines and glioblastomas and is mutated in some
neuroblastoma cell lines, breast cancers, and brain tumors (21,
52, 74). Together, these observations suggest that Ing1 acts as a
tumor suppressor and that it is involved in regulating apoptosis. This
is further supported by reports that Ing1 and the p53 tumor suppressor
form a complex and functionally cooperate to control cell growth
(20, 83).
The carboxyl-terminal 70 amino acid residues of Ing1 contain the
Cys4-His-Cys3 sequence of a PHD finger domain.
This evolutionarily conserved domain is predicted to chelate two
Zn2+ ions and is similar to, but distinct from, other zinc
binding motifs such as the RING finger
(Cys3-His-Cys4) and LIM domain (Cys2-His-Cys5). PHD finger domains have been
found in many different proteins, including transcription factors and
other proteins implicated in chromatin-mediated transcriptional
regulation (1). In particular, PHD fingers are found in the
Drosophilia melanogaster polycomb (Pc-G) and trithorax
(trx-G) group proteins, which are thought to reside in large
multiprotein complexes. Pc-G and trx-G are required for the expression
of homeotic genes, and evidence suggests that they exert their effects
through chromatin modification or interaction. Thus, it has been
proposed that PHD finger domains may be involved in complex formation
or recognition of nuclear targets related to chromatin structure and
chromatin regulation (1).
In eukaryotes, DNA metabolism is strongly influenced by the packaging
of DNA into higher-order chromatin. In general, chromatin structure is
repressive to transcription (53, 54), and gene activation or
silencing often requires remodeling of nucleosomes in promoter regions
(38, 56). Covalent modifications, including acetylation, of
core histones have been known for some time to be correlated with the
activity of genetic loci (9, 75). Lysines in the
amino-terminal extensions of histones are the targets of histone
acetyltransferases (HATs) and histone deacetylases (HDACs). It has been
hypothesized that neutralization of the positively charged histone
N-terminal tails by acetylation lower their affinity for DNA, alter
chromatin structure, and/or increase the interaction of histones with
transcription factors (8, 31, 41, 44, 79).
Several previously identified transcriptional coactivators or
corepressors have been shown to possess the ability to acetylate or
deacetylate histones (38, 56, 72). In Saccharomyces
cerevisiae, proteins that possess HAT activity include Hat1
(36), Gcn5 (11), and Esa1 (68). Hat1
is localized in both the cytosol and nucleus and acetylates primarily
newly synthesized histone H4 prior to its assembly into nucleosomes
(36, 55, 60, 78). Gcn5 is a nuclear HAT that preferentially
acetylates H3, and to a lesser extent it acetylates H2B and H4
(25). Gcn5 is not essential, but it is required for
transcriptional regulation of some genes (22), and mutations
that impair Gcn5 HAT activity correlate with decreased transcriptional
activity (39, 81). Esa1 is an essential gene that was
recently shown to possess HAT activity with a preference for H2A and H4
(13). Several mammalian transcription regulators have also
been shown to possess HAT activity, including Gcn5 and Esa1 homologs
(8), p300 and CREB-binding protein (5, 51), pCAF
(82), ACTR (12), Src-1 (69), and
TAFII250 (48).
HATs function as components of large, evolutionarily conserved
macromolecular assemblies, five of which have been identified in
S. cerevisiae (16, 24, 25, 63). These include the
1.8-MDa SAGA (Spt-Ada-Gcn5-acetyltransferase), 0.8-MDa ADA, NuA3,
1.3-MDa NuA4 (nucleosomal H2A.H4), and the novel SLIK (SAGA-like)
complexes. Esa1 was recently shown to be the HAT subunit of NuA4
(3), whereas Gcn5 is the catalytic HAT in the SAGA and ADA
complexes (25). The HAT of the NuA3 complex has not been
characterized aside from its substrate preference for histone H3
(25).
Purified SAGA promotes acetyl coenzyme A (acetyl-CoA)-dependent
transcription from nucleosomal promoter templates, but not free DNA, in
vitro (70). This observation is consistent with the
requirement for Gcn5 HAT activity for both promoter-directed histone
acetylation and Gcn5-mediated transcriptional activation in vivo
(39, 81). Furthermore, acidic activators such as Gcn4 and
the VP16 activation domain can physically interact with purified native
SAGA complex, and GAL4-VP16 targets acetylation and transcriptional stimulation by SAGA (76). Like SAGA, NuA4 is recruited to
promoters by acidic activator proteins to promote histone acetylation
and transcriptional stimulation (3, 13, 76). Unlike SAGA,
which preferentially acetylates the N termini of histones H3 and H2B, NuA4 targets mainly the N termini of histone H4 and to a lesser extent
H2A (3, 13).
The SAGA complex contains at least four protein modules, including the
Ada and Spt subgroups of transcription regulators, the histone-fold
subgroup of TATA-binding protein-associated factors, and the essential
433-kDa Tra1 protein (24, 25). Tra1 has also been shown to
be a component of the SLIK and NuA4 HAT complexes, and it also coelutes
in a high-molecular-weight region distinct from the nucleosomal HAT
complexes, indicating that it is present in uncharacterized protein
complexes (24). Tra1 has been highly conserved among
eukaryotes (47), and the mammalian homolog, TRRAP, is
associated with the PCAF HAT complex (77). TRRAP was identified as a cofactor that interacts with c-Myc and E2F-1 and is
required for transformation by c-Myc and E1A (47). The
identification of TRRAP as an essential cofactor for these oncogenic
transcription factors suggests that it regulates gene expression.
Tra1 and TRRAP belong to the phosphatidyl inositol-3 (PI3) kinase
family of serine/threonine protein kinases that includes mammalian
DNA-PK, ATM, FRAP, Schizosaccharomyces pombe Rad3, and S. cerevisiae Vps34, Pik1, Stt4, Tor1, Tor2, Tel1, and Mec1
(63; reviewed in reference 8).
These proteins appear to be involved in processes including cell cycle
control, DNA repair, and transcription (35, 42). Although
Tra1 and TRRAP are closely related to the PI3 kinases, they do not
contain the DXXXXN and DFG motifs conserved in the catalytic site of
PI3 kinases (47). The association of Tra1 and TRRAP with HAT
complexes suggests that they regulate transcriptional activation
through the recruitment of HAT activity to activator-bound promoters
(24, 76). Although a scaffolding role of Tra1 has been
suggested (8, 24), the molecular function of Tra1 and TRRAP
are not known.
Three proteins, Yng1, Yng2, and Pho23, in the budding yeast S. cerevisiae share significant sequence identity in their PHD finger
domains with mammalian Ing1. We show that Yng2 is associated with Tra1,
and we further demonstrate that Yng1, Yng2, and Pho23 are associated
with HAT activities. We also provide strong evidence that the
Yng2-associated HAT is Esa1, suggesting that Yng2 is a component of the
NuA4 complex. Our results suggest that Yng1, Yng2, and Pho23 are
involved in chromatin remodeling and possibly transcriptional
regulation. We also report genetic and biochemical evidence suggesting
that human and yeast Ing1 homologs have been functionally conserved.
 |
MATERIALS AND METHODS |
Yeast strains and genetic analysis.
The S. cerevisiae strain L40 (MATa his3 trp1 leu2 ade2
LYS2::lexA-HIS3 URA3::lexA-lacZ) has been
previously described (30, 80). The genotypes of other yeast
strains used in this study are listed in Table
1. S. cerevisiae culture,
transformation, mating, tetrad analysis, and other genetic
manipulations were performed as previously described (2,
17).
DNA manipulation and analysis.
Procedures used for DNA
manipulation and analysis (purification, cloning, electrophoresis,
transformation, etc.) have been previously described (64).
PCR was performed as described (46).
Plasmids.
The yeast two-hybrid vector pBTM116 contains the
DNA-binding LexA coding sequence under the control of the
ADH1 promoter, the 2µm origin of replication, and the
TRP1 gene (6). pLexA-Lamin has been described
previously (6). pLexA-Yng2 was generated by inserting the
coding sequence of YNG2 into the polylinker of pBTM116
located 3' to the LexA coding sequence. pLexA-
PHD and pLEXA-PHD were
generated by inserting codons 1 to 222 and 222 to 282, respectively, of
YNG2 into pBTM116. pADHA-Yng2, pADHA-Png1, and pADHA-Ing1
were generated by cloning the PCR-derived open reading frame (ORF) of
YNG2, S. pombe PNG1, or human p33ING1
respectively, into pAD4.H, which contains the 2µm origin of
replication and ADH1 promoter (32). YEpPDE2
contains S. cerevisiae PDE2 in YEp13, as previously
described (65). pADGFPHA was derived by cloning the sequence
of the enhanced green fluorescent protein (eGFP; Clonetech) into the
HindIII site of pAD4.H (32) using the primers
5'GTCAGCAAGCTTATGGTGAGCAAGGGCGAG and
3'GATCTCAAGCTTCTTGTACAGCTCGTCCAT. pADGFPHA-Yng2,
-Gcn5, and -Esa1 were made by cloning the PCR-derived ORF of
YNG2, GCN5, or ESA1, respectively,
into pADGFPHA. Codons 1 to 222 of the YNG2 ORF were PCR
amplified and cloned into pADGFPHA to make pADGFPHA-Yng2
PHD. Codons
222 to 282 of the YNG2 ORF were PCR amplified and cloned
into pADGFPHA to make pADGFPHA-Yng2PHD. pADGFPHA-Yng2/1 was constructed
as follows. A primer,
5'TTCTCGAGAGAATTCAAAAACAGTAGAAATGGTAAAGGCCAAAACGGTTCCCCTGAAAACGAGGAAGAGGACAAAACGGAGGTTTATTGTTTCTGTAGGAAT, was used to amplify the C-terminal 64 codons of the
YNG1 ORF. This PCR product was cloned into pADGFPHA-Yng2 as
an EcoRI/SacI fragment to replace the C-terminal
PHD finger of Yng2 with that of Yng1. pADmyc-Yng2 was generated by
cloning the PCR-derived ORF of YNG2 in pUAD6
(32). pADmyc-Tra1 was derived by shuttling the
TRA1 ORF as a NotI(filled-in)/SacI
fragment from p1259 (a kind gift from C. Brandl) into the
SmaI/SacI sites of a modified pUAD6
(SalI digested, filled in, and religated). pPho23 was
generated by inserting a PCR-amplified PHO23 sequence (
480
to +490 with respect to the ORF) into the
XhoI/BamHI sites of pBluescript II SK.
pPho23target was generated by replacing the 0.75-kb
EcoRI/EcoRV fragment of pPho23 with the 0.85-kb
TRP1 gene. pYng1 was generated by inserting a PCR-amplified
YNG1 sequence (
340 to +350 with respect to the ORF) into
the EcoRV site of pBluescript II SK. pYng1Ltarget was
generated by replacing the 0.5-kb EcoRV/StuI fragment with the 2.2-kb LEU2 gene. pYng1Htarget was
generated by replacing the 0.5-kb EcoRV/StuI
fragment with the 1.7-kb HIS3 gene. pYng2 was generated by
inserting a PCR-amplified YNG2 sequence (SalI to
BglII) into the SalI and BamHI sites
of pBluescript II SK. pYng2target was generated by replacing the 0.6-kb
BamHI/EcoRI fragment of pYng2 with the 1.2-kb
URA3 gene.
Yeast two-hybrid screen.
An S. cerevisiae
two-hybrid genomic library (kindly provided by I. Sadowski) was
transformed into the S. cerevisiae strain L40 containing
pLexA-Yng2 using a high-efficiency transformation method (29, 66,
80). These transformants were grown in synthetic medium
(YC-Trp-Ura-Leu-Lys) for 16 h at 30°C to obtain efficient expression of the HIS3 reporter gene. The transformants were
then plated on synthetic plates (YC-Trp-His-Ura-Leu-Lys) to select for
cells that express His3. Approximately 2 × 103
His+ transformants were obtained from 2 × 106 primary transformants. A subset of these
His+ transformants were further analyzed, yielding 15 library clones that transactivated His3 and LacZ expression in
pLex-Yng2 harboring strains but not strains containing pLexA-lamin.
Gene disruptions.
PHO23 (YNL097c), YNG1
(YOR064c), and YNG2 (YHR090c) were disrupted in both 1788 diploid and JC1 and JC2 haploid strains by the gene replacement method
(59, 61). PHO23 was disrupted in JC1, JC2, and
1788 by transformation of a 1.7-kb BspDI/MluI fragment of pPho23target in which the PHO23 coding sequence
had been replaced with TRP1. YNG1 was disrupted in JC1 and
JC2 by transformation of a 2.5-kb fragment derived by PCR from
pYng1Htarget in which the YNG1 coding sequence had been
replaced with HIS3. YNG1 was disrupted in 1788 by
transformation of a 3.0-kb fragment derived by PCR from pYng1Ltarget in
which the YNG1 coding sequence had been replaced with
LEU2. YNG2 was disrupted by transformation of a 2.2-kb
AatII/XbaI fragment from pYng2target in which the YNG2 coding sequence had been replaced with URA3.
Gene disruptions were confirmed by Southern blot analysis. In almost
all cases, asci derived from sporulated diploid heterozygotes
segregated the auxotrophic marker 2:2. Haploid strains of opposite
mating types were crossed, and the resulting diploids were
sporulated using standard methods (2) to derive double
(yng1
yng2
and pho23
yng2
) and triple
(yng1
yng2
pho23
) deletion mutants.
Protein biochemistry.
Proteins were isolated from yeast
cultures grown in synthetic medium to an optical density at 600 nm of
approximately 1.0. For temperature shift experiments, cells were grown
to an optical density at 600 nm of approximately 0.3; half of the
culture was allowed to continue to grow at 30°C for 4 h, while
the other half was collected by centrifugation and resuspended in
prewarmed medium and grown for 4 h at 37°C. Briefly, cells from
250 ml of culture were collected by centrifugation, washed once with
lysis buffer (20 mM Tris [pH 7.4], 150 mM NaCl, 2 mM EDTA, 0.2%
Triton X-100) and resuspended in 4 ml of lysis buffer with protease
inhibitors (1 µg of pepstatin A per ml, 200 µM phenylmethylsulfonyl
fluoride, 500 µM benzamidine HCl, 10 µg of aprotinin per ml, 1 µg
of leupeptin per ml). Cell suspensions were aliquoted into four 2-ml
tubes with 1.5 g of glass beads (diameter, 425 to 600 nm; Sigma)
and shaken for 5 min in a Mini-BeadBeater (Biospec Products) at 4°C. Cell debris was removed by a 2-min centrifugation at 450 × g, and lysates were further clarified by centrifugation for
5 min at 10,600 × g. Protein concentrations (typically 10 to 15 mg/ml) were determined at this point using a Bio-Rad Protein
assay. Ten milligrams of protein was used in 1- to 2-ml
immunoprecipitation reactions (IPs) in lysis buffer with protease
inhibitors at 4°C with gentle rotation. IPs were precleared with 40 µl of protein A-Sepharose beads for 20 min. After removal of the
beads, 5 µl of 12CA5 (antihemagglutinin [anti-HA]) ascites fluid
was added and the reaction mixtures were incubated overnight. Immune
complexes were collected by addition of 50 µl of protein A-Sepharose
followed by a 2-h incubation. Beads were collected by a 1-min
centrifugation at 2,200 rpm and washed five or six times with lysis
buffer. Half of the beads were removed at this point for HAT assays.
For coimmunoprecipitation analyses, 20 µl of protein sample buffer
was added and the beads were boiled and aliquoted prior to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis
(half for the 12CA5 blot, half for the 9E10 [anti-myc] blot). Sixty
micrograms of lysate was separated by SDS-PAGE (8% acrylamide-0.075%
bisacrylamide) to observe the expression of myc-Tra1. Thirty micrograms
of lysate was analyzed to observe expression of myc-Yng2. After
SDS-PAGE, proteins were electroblotted onto nitrocellulose membranes
(1.5 h; 100 V), blocked for 1 h or overnight in 5% milk in
Tris-buffered saline, and incubated 1 h with primary antibody
(1:2,000 12CA5; 1:30 9E10) in Tris-buffered saline-0.05% Tween 20. After washing, tagged proteins were detected with horseradish
peroxidase-conjugated anti-mouse secondary antibodies and enhanced
chemiluminescence reagents (Amersham).
HAT assays.
HAT assays were performed as previously
described (49). Immunoprecipitates were incubated at 30°C
for 30 min with 2 µg of calf thymus total histones (type IIA; Sigma)
and 0.3 µCi of [3H]-acetyl-CoA (ICN) in buffer
containing 50 mM Tris-HCl (pH 8.0), 30 mM KCl, 10% glycerol, 10 mM
sodium butyrate, 1 mM dithiothreitol, and 1.0 µM acetyl-CoA in a
total volume of 30 µl. Reactions were started by the addition of
acetyl-CoA and stopped by the addition of 10 µl of 4× SDS sample
buffer. Aliquots (20 µl) were fractionated on 18% acrylamide-0.48%
bisacrylamide SDS gels, stained with Coomassie blue, and destained by
standard methodology. Destained gels were then subjected to
fluorography by treatment with En3Hance (Dupont-NEN)
according to the manufacturer's instructions. Gels were dried, placed
in cassettes with X-ray film (Kodak XAR), and exposed at
80°C.
DAPI staining.
Nuclear and mitochondrial DNA was visualized
by DAPI (4',6'-diamidino-2-phenylindole; Sigma) staining following
established protocols (2) with slight modifications.
Briefly, ~107 cells were pelleted and resuspended in 70%
ethanol, incubated for 30 s, and washed twice with water. After
the final wash, cells were resuspended in mounting medium
(p-phenylenediamine [1 mg/ml] in PBS [pH 9], 90%
glycerol) containing DAPI (0.025 mg/ml) and viewed with UV optics. GFP
images were visualized with fluorescein isothiocyanate optics.
 |
RESULTS |
Comparison of yeast proteins with human Ing1.
We performed a
search of the public sequence databases for proteins related to the
human candidate tumor suppressor p33ING1. This comparison
revealed that three budding yeast proteins (Yng1, Yng2, and Pho23) and
two fission yeast proteins (Png1 and Png2) share significant sequence
identity with Ing1 (Fig. 1). The budding and fission yeast genes encode small proteins that are similar in
length (219 to 330 residues) to human Ing1 (279 residues). The
N-terminal regions of these proteins have not been well conserved, but
the C-terminal regions are very similar (50 to 60% identity) (Fig. 1).
These homologous regions contain PHD finger domains, which have been
found in proteins implicated in chromatin-mediated transcriptional
regulation (1). The strong similarity among the PHD finger
domains of these yeast proteins and human Ing1 suggests that they were
derived from the same common ancestral gene and that their functions
may have been conserved during evolution.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of PHD finger domains. The C-terminal ends of
human Ing1 (AAC00501), S. pombe Png1 (CAA15917) and Png2
(CAA21250), and S. cerevisiae Yng1 (P50947), Yng2 (P38806),
and Pho23 (S66947) were aligned to fit the PHD finger consensus
sequence (1). The symbols $ and # indicate semiconserved and
highly conserved hydrophobic residues, respectively. Regions of protein
sequence identity with Ing1 are shaded. Numbers at the right of each
sequence indicate the length of each protein.
|
|
Deletion of YNG1, YNG2, and
PHO23 results in pleotrophic phenotypes.
To
investigate the function of these proteins we have performed genetic
analysis in yeasts. First, we constructed S. cerevisiae strains that contain disruptions of each of the three Ing1 homologous genes, individually and in all possible combinations (described in
Materials and Methods) (Table 1). In almost all cases, asci derived
from sporulated diploid heterozygotes segregated the auxotrophic marker
2:2, demonstrating that neither Yng1, Yng2, nor Pho23 is required for
germination or cell growth. However, yng2
cells exhibited
slow growth compared with their parental cells (5.2- and 2.8-h doubling
times, respectively, in YPD at 30°C). Deletion of YNG1 or
PHO23 had little effect on growth or morphology, but yng2
cells were swollen and ~50% of cells were
multibudded, containing three to eight large buds (Fig.
2A). Incubation at elevated temperatures increased the severity of the abnormal morphology. DAPI staining demonstrated that ~80% of multibudded clumps contained large buds that lacked nuclear DNA (Fig. 2B). Disruption of all three genes in
combination was not lethal but resulted in more severe growth inhibition (9.7-h doubling time) and a more exaggerated morphological, multibudded phenotype than that of yng2
cells (Fig. 2A).
Both yng2
and yng1
cells were unable to
utilize nonfermentable carbon sources such as galactose, glycerol (Fig.
2C), and acetate (not shown). yng2
, yng1
,
and pho23
cells are all hypersensitive to heat shock,
albeit to varying degrees (Fig. 2D). Deletion of YNG2 alone
resulted in several other phenotypes, including a slight sensitivity to
UV irradiation but not gamma irradiation or treatment with alkylating
agents (not shown), temperature sensitivity, and sensitivity for growth
on media containing caffeine (Fig. 3B). Thus, there appear to be both functional similarities and differences between these three related yeast proteins.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion of YNG1, YNG2, and
PHO23 result in various phenotypes. (A) Normal wild-type
(WT) (JC1), yng1 (RL3-32), yng2 (RL3-53),
pho23 (RL3-17), and triple mutant
yng1 yng2 pho23 (RL5-36) cells
were grown in yeast extract-peptone-dextrose (YPD) at 30°C and
examined by differential interference contrast (DIC) microscopy. (B)
Localization of DNA in normal WT (JC1) and yng2 cells
(RL3-53) cells grown in YPD was examined by DAPI staining (Materials
and Methods). DIC and fluorescent images were overlaid to produce the
images shown. (C) The carbon source requirements of normal WT (JC1),
yng1 (RL3-32), yng2 (RL3-53), and
pho23 (RL3-17) cells were determined by growth on either
glucose (YPD), galactose (YPGal), or glycerol (YPGlyc) as the sole
carbon source at 30°C for 3 to 5 days. (D) Normal WT (JC1),
pho23 (RL3-17), yng2 (RL3-53), and
yng1 (RL3-32) were tested for heat shock sensitivity by
replica plating onto prewarmed YPD plates and incubated at 55°C for
0, 2, 4, or 8 min. Plates were then allowed to cool to room temperature
before incubation at 30°C for 3 days.
|
|

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of human Ing1 or S. pombe Png1
rescues yng2 null phenotypes. (A) Normal wild-type (WT)
(JC1) or yng2 (RL3-53) cells harboring a control vector,
or yng2 cells expressing either Yng2, Png1, or Ing1 were
grown at 30°C in SC-L synthetic medium and examined by differential
interference contrast microscopy. Plasmids used to express proteins
were pAD4.H (+vector), pADHA-Yng2 (+Yng2), pADHA-Png1 (+Png1), and
pADHA-Ing1 (+Ing1). (B) These strains were also tested for growth under
different conditions. Cells were grown on synthetic complete (SC)
medium (Glucose) at 30°C, SC containing galactose (Galactose) instead
of glucose as the sole carbon source at 30°C, SC containing 3 mM
caffeine (Caffeine) at 30°C, or SC at 37°C (37C). (C) These strains
and yng2 (RL3-53) overexpressing PDE2 (pYepPDE2) were
also tested for hypersensitivity to heat shock at 53°C for 0 or 4 min
(see Fig. 2 legend).
|
|
Expression of human Ing1 or fission yeast Png1 complements deletion
of YNG2.
Since these three yeast proteins share significant
sequence identity with human Ing1, we investigated whether the human
and yeast genes are also functionally related. We chose to focus our complementation studies on the yng2 null strain since it
exhibited the most pleotrophic and severe phenotypes. We found that
expression of either human Ing1 or S. pombe Png1 could
complement the yng2 mutant phenotypes, including the
swollen, multibudded morphology (Fig. 3A), the abnormal DNA
distribution (data not shown), carbon source sensitivity, caffeine
sensitivity, temperature sensitivity (Fig. 3B), and heat shock
sensitivity (Fig. 3C). However, there were some distinct differences in
the abilities of these proteins to complement; specifically, caffeine
sensitivity was only weakly rescued by Ing1, and temperature
sensitivity was very poorly rescued by Png1. Nevertheless, the
complementation results suggest that human Ing1, S. pombe
Png1, and S. cerevisiae Yng2 share conserved functional properties.
Since some of the phenotypes exhibited by
yng2
cells are
similar to those that result from elevated cyclic AMP (cAMP) levels,
we
suspected that Yng2 modulates the Ras-cAMP signaling pathway.
This was
further supported by our observation that overexpression
of the
high-affinity cAMP phosphodiesterase, Pde2, could suppress
the
yng2
heat shock-sensitive phenotype (Fig.
3C). However,
overexpression
of Pde2 failed to complement other phenotypes, including
the inability
to utilize galactose (data not shown), suggesting that
these phenotypes
are not simply a consequence of elevated cAMP
levels.
Yng2 is localized to the nucleus.
Ing1 has been previously
shown to localize in the nucleus (19). To examine the
localization of Yng2, we expressed GFP-tagged Yng2 in wild-type yeast
cells. Expression of the GFP-tagged Yng2 suppressed the
yng2
phenotypes, indicating that it was functional (data
not shown). Examination of cells expressing GFP-Yng2 by fluorescence
microscopy revealed that it colocalized with DAPI staining, suggesting
that it was predominately localized in the nucleus, whereas GFP alone
was distributed throughout the cell (Fig.
4). This observation is consistent with
conserved nuclear functions for Yng2 and Ing1.

View larger version (107K):
[in this window]
[in a new window]
|
FIG. 4.
Yng2 is localized in the nucleus. Normal JC1 cells
expressing GFP (left panels) or GFP-Yng2 (right panels) were grown in
HC medium, harvested, and briefly fixed before being mounted in medium
containing DAPI (Materials and Methods). Cells were visualized by
differential interference contrast microscopy (DIC [top row]), DNA
was visualized using UV optics (DAPI [middle row]), and GFP
localization was visualized using fluorescein isothiocyanate optics
(GFP [bottom row]). Images in each column are of the same field of
cells. Plasmids used to express proteins were pADGFPHA (GFP) and
pADGFPHA-Yng2 (GFP-Yng2).
|
|
Yng2 is associated with Tra1 and HAT activity.
To further
investigate the function of Yng2, we performed a yeast two-hybrid
screen for proteins that interact with Yng2 (Materials and Methods).
One class of proteins that we identified from this screen encoded a
short region (amino acid [aa] 1678 to 1740) of Tra1 (Fig.
5A). Tra1 is a 433-kDa protein that is
associated with HAT complexes involved in transcriptional regulation
(8, 24, 63). To verify the interaction between Yng2 and
Tra1, we coexpressed HA-Yng2 and myc-Tra1 in yeast and performed
coimmunoprecipitation experiments. Our results confirmed that these
proteins interact in vivo (Fig. 5B). This observation suggested that
Yng2, and possibly Yng1 and Pho23, are associated with HAT complexes,
although neither Yng1, Pho23, nor human Ing1 can interact with Tra1 (aa
1678 to 1740) as shown by two-hybrid analysis (data not shown). To
examine this possibility, we performed HAT assays on immunoprecipitated material from yeast expressing HA-Yng2, HA-Yng1, or HA-Pho23. We found
that anti-HA immunoprecipitates from such cells had significant levels
of HAT activity, while similar immunoprecipitates from control cells
expressing GFP-HA did not have detectable HAT activity (Fig.
6A). Interestingly, the patterns of
histone acetylation in vitro were different for the samples containing
the three yeast proteins, suggesting that they are associated with
different HAT complexes. Yng2 is associated with HAT activity that
preferentially acetylated H2A and H4, Yng1-associated HAT activity
preferentially acetylated H3 and H4, and Pho23 was associated with a
relatively weak and nonspecific activity. We also found that HA-Ing1
expressed in yeast is associated with HAT activity. This observation
and our complementation data strongly suggest that the functional properties of Yng2 and human Ing1 have been conserved.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Yng2 is associated with Tra1. (A) The Gal activation
domain (GAD) and a GAD fusion with Tra1 (residues 1678 to 1740) (p14-2)
were tested for their ability to interact with LexA fusions with lamin,
Yng2, the N-terminal domain (residues 1 to 222) of Yng2 (LexA- PHD),
or the C-terminal domain (residues 222 to 282) of Yng2 (LexA-PHD) by
the yeast two-hybrid test (Materials and Methods). Each patch
represents an independent transformant of the yeast two-hybrid tester
strain L40 expressing the indicated proteins. Interaction between
fusion proteins was assayed by their ability to induce expression of
-galactosidase by a filter assay (10). (B) Extracts from
JC1 cells expressing HA-Yng2 (lane 1), myc-Tra1 (lane 2), or HA-Yng2
and myc-Tra1 (lane 3) were assayed for expression of myc-tagged
proteins by Western blot analysis using anti-myc (monoclonal antibody
9E10) antibody (top panel). Ten milligrams of total protein from each
extract was immunoprecipitated (I.P.) with anti-HA (monoclonal antibody
12CA5) antibody; half of the immunoprecipitate was probed with anti-HA
antibody (middle panel), and half was probed with anti-myc antibody
(bottom panel). Plasmids used to express proteins were pADHA-Yng2 and
pUAD6 (lane 1), pAD4.H and pADmyc-Tra1 (lane 2), or pADHA-Yng2 and
pADmyc-Tra1 (lane 3).
|
|

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Yng1, Yng2, and Pho23 are associated with HAT
activities. (A) Extracts from JC1 cells expressing GFP-HA (GFP),
HA-Yng2 (Yng2), HA-Ing1 (Ing1), HA-Pho23 (Pho23), HA-Yng1 (Yng1),
GFP-HA-Esa1 (Esa1), or GFP-HA-Gcn5 (Gcn5) were immunoprecipitated with
anti-HA (12CA5) antibody. Immunoprecipitates were split, and half of
each sample was examined by Western blot analysis using anti-HA
antibody (top), and half was assayed for HAT activity (bottom panels)
(see Materials and Methods). The left lanes (GFP, Yng2, Ing1, Pho23,
and Yng1) and right lanes (Gcn5 and Esa1) of the HAT assay were run on
the same gel, but they were exposed to film for 15 and 3 days,
respectively. (B) Extracts from JC1 cells expressing GFP-HA (GFP), or
GFP-HA fusions with either Yng2 (Yng2), the N-terminal domain (residues
1 to 222) of Yng2 ( PHD), the C-terminal domain (residues 222 to 282)
of Yng2 (PHD), or Yng2/1 (Yng2 residues 1 to 222 fused to Yng1 residues
155 to 219) were immunoprecipitated with anti-HA antibody.
Immunoprecipitates were examined by a Western blot using anti-HA
antibody (top), or HAT assays (bottom). Plasmids used to express
proteins were pADGFPHA (GFP), pADHA-Yng2 (Yng2), pADHA-Ing1 (Ing1),
pADHA-Pho23 (Pho23), pADHA-Yng1 (Yng1), pADGFPHA-Esa1 (Esa1), and
pADGFPHA-Gcn5 (Gcn5) (in panel A) and pADGFPHA (GFP), pADGFPHA-Yng2
(Yng2), pADGFPHA-Yng2 PHD ( PHD), pADGFPHA-Yng2PHD (PHD), and
pADGFPHA-Yng2/1 (Yng2/1) (in panel B). Arrows denote migration of
relevant proteins. HC denotes antibody heavy chain. The panel on the
lower right shows a Coomassie-stained lane from the HAT gel and the
migration of histones H3, H2B, H2A, and H4.
|
|
The Yng2 PHD finger is not required for HAT association.
Since
the PHD finger domains are the highly conserved regions of these
proteins, we examined whether the Yng2 PHD or N-terminal domains were
sufficient or necessary for interaction with Tra1 and HAT activity.
Interestingly, we found that the N-terminal domain of Yng2 (aa 1 to
222) was capable of interacting with both Tra1 (aa 1678 to 1740) (Fig.
5A) and HAT activity (Fig. 6B), although the HAT activity was reduced
compared with that of full-length Yng2. In contrast, the PHD finger
domain (aa 222 to 282) was neither necessary nor sufficient for these
interactions. We also found that the N-terminal domain of Yng2, either
alone or fused to the PHD finger of Yng1, coimmunoprecipitated HAT
activity with a histone acetylation pattern similar to Yng2-associated
HAT activity (Fig. 6B). Thus, the PHD finger was not required to
maintain HAT specificity but appears to be required for efficient
association with, or activity of the HAT complex. However, we found
that expression of either the N-terminal domain of Yng2, the PHD finger
of Yng2, or a fusion of the N-terminal domain of Yng2 with the PHD
finger of Yng1 failed to suppress the inability of yng2
cells to utilize galactose (data not shown). Thus, each domain is
essential but not sufficient for the normal functions of Yng2, and even
though the PHD fingers of Yng1 and Yng2 share a high degree of
identity, they are not functionally redundant.
Esa1 is the Yng2-associated HAT.
To explore the nature of the
HAT associated with Yng2 we investigated two possible candidates: Esa1
and Gcn5. We expressed and immunoprecipitated GFP-HA-tagged Esa1 and
Gcn5 from yeast and performed HAT assays. We found that
HA-Yng2-associated HAT exhibited a specificity for H2A and H4 that was
remarkably similar to that of GFP-HA-Esa1 (Fig. 6A) (3, 68).
In contrast, immunoprecipitated GFP-HA-Gcn5 preferentially acetylated
H3, consistent with previous observations (8, 25).
Next, we performed Western blot analysis to examine acetylation of H3
and H4 in cells lacking Yng2, Yng1, Pho23, or Gcn5,
or in cells
containing an
esa1 temperature-sensitive (Ts) allele
at both
the restrictive (37°C) and nonrestrictive (30°C) temperatures.
We
found that
yng2
cells exhibited a significant decrease in
the level of acetylation of H4 residues K5, K8, and K12 compared
to
wild-type cells, whereas the levels of acetylated H3 remained
unchanged
(Fig.
7). However,
yng1
or
pho23
cells did not exhibit
significant differences in
acetylation of either H3 or H4.
esa1(Ts)
cells exhibited a
decrease in H4-K5, H4-K8, H4-K12, and total
H4 acetylation at the
restrictive temperature similar to that
exhibited by
yng2
cells. In contrast,
gcn5
cells did not exhibit
a
noticeable decrease in H4 acetylation, but there was a decrease
in
total H3 acetylation.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 7.
yng2 and esa1(Ts) cells exhibit
similar H4 acetylation deficiency. Whole-cell extracts from wild-type
strain FY105 (WT), gcn5 , wild-type strain LPY3498 grown
at 30°C (WT 30) or 37°C (WT 37), esa1(Ts) strain LPY3291
grown at 30°C (esa1 30) or 37°C (esa1 37),
wild-type strain JC1, yng1 , yng2 , and
pho23 cells were separated on an SDS-18% polyacrylamide
gel and analyzed by Western blotting using antibodies (Upstate
Biochemical) that specifically recognize acetylated H3 (H3), acetylated
lysine (H4; histone H4 region of gel shown), and H4 acetylated at
lysine residues 12 (H4K12), 8 (H4K8), and 5 (H4K5), or stained with
Coomassie brilliant blue (total protein).
|
|
Next, we compared HA-Yng2-associated HAT activity in wild-type,
gcn5
, and
esa1(Ts) cells (Fig.
8). We did not observe a detectable
difference in Yng2-associated HAT activity between wild-type and
gcn5
cells. However, we found that Yng2-associated HAT
activity
was undetectable in two different
esa1(Ts) strains
at 37°C, whereas
wild-type cells showed similar activity at both 30 and 37°C. The
two
esa1(Ts) alleles examined were
esa1-L254P, which exhibits
the most severe phenotypes, and esa1-414,
which exhibits more
moderate defects at 37°C, as previously described
(
13). Yng2-associated
HAT activity was undetectable in cells
containing the more severe
esa1-L254P allele at 30°C, suggesting that
this mutation disrupts
complex formation and/or severely reduces HAT
activity. In contrast,
immunoprecipitated GFP-HA-Gcn5 exhibited similar
levels of activity
in either wild-type or
esa1(Ts) cells at
both temperatures, indicating
that HAT activities were not generally
impaired in
esa1(Ts) cells
at elevated temperatures.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 8.
Yng2-associated HAT activity is deficient in
esa1(Ts) cells. Extracts from cells containing a control
plasmid pAD4.H (vector), or expressing HA-Yng2 (Yng2) or GFP-HA-Gcn5
(Gcn5) were immunoprecipitated with anti-HA. Immunoprecipitates were
split, and half of each sample was examined by Western blot analysis
using anti-HA antibody (top), and half was assayed for HAT activity
(bottom). Strains used include FY105 (WT), gcn5 , LPY3498
grown at 30°C (WT 30) or 37°C (WT 37), LPY3291 grown at 30°C
(esa1-1 30) or 37°C (esa1-1 37), and LPY3500
grown at 30°C (esa1-2 30) or 37°C (esa1-2
37).
|
|
Finally, we examined whether Yng2 associates with Esa1. We coexpressed
myc-tagged Yng2 with GFP-HA-Esa1 in yeast and performed
coimmunoprecipitation experiments. We found that a detectable
level of
myc-Yng2 coimmunoprecipitated with GFP-HA-Esa1 but not
with GFP-HA
(Fig.
9). Together, our observations
provide strong
evidence that Yng2 is associated with a HAT complex
containing
Esa1.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 9.
Yng2 and Esa1 form a complex in vivo. Extracts from JC1
cells expressing GFP-HA (lane 1), GFP-HA and myc-Yng2 (lane 2),
GFP-HA-Esa1 (HA-Esa1) (lane 3), or GFP-HA-Esa1 and myc-Yng2 (lane 4)
were assayed for expression of myc-tagged proteins by Western blot
analysis using anti-myc (mAb 9E10) antibody (top panel). 10 mg of total
protein from each extract was immunoprecipitated with anti-HA
(monoclonal antibody 12CA5) antibody; half of the immunoprecipitate was
probed with anti-HA antibody (middle panel), and half was probed with
anti-myc antibody (bottom panel). myc-Yng2 was only precipitated when
coexpressed with GFP-HA-Esa1. Plasmids used to express proteins were
pADGFPHA and pUAD6 (lane 1), pADGFPHA and pADmyc-Yng2 (lane 2),
pADGFPHA-Esa1 and pUAD6 (lane 3), or pADGFPHA-Esa1 and pADmyc-Yng2
(lane 4).
|
|
 |
DISCUSSION |
Yeast Ing1 homologs are associated with HAT complexes.
We have
investigated the functions of three yeast proteins that share strong
sequence identity in their C-terminal PHD finger domains with the human
candidate tumor suppressor Ing1. Our results provide several clues to
the functions of these proteins and suggest that they have a role in
chromatin remodeling and transcriptional regulation. Such a role is
suggested by our observations that Yng2 is nuclear and associates with
Tra1 and that Yng1, Yng2, and Pho23 are complexed with HAT activities.
Furthermore, the pleotrophic phenotypes exhibited by yng2
mutant strains are consistent with a role for Yng2 in regulating the
expression of a subset of genes. Also, a previous report suggests that
Pho23 is involved in the transcriptional regulation of Pho5
(40).
HAT activities are often found in large, modular, multiprotein
complexes containing known transcriptional regulators (
8,
24,
63). At least five HAT complexes have been identified
in
S. cerevisiae (
25). Our results indicate that Yng1, Yng2,
and Pho23 associate with HAT activities with preferences for different
histones, suggesting that they are associated with different HAT
complexes (
58). Based on its association with Tra1, Yng2 may
be a component of one or all of the Tra1-associated complexes:
SAGA,
SLIK, or NuA4. Gcn5 colocalizes with Tra1 to the SAGA complex
(
25). Deletion of Gcn5 is not lethal but results in various
phenotypes, including slow growth, temperature sensitivity, inability
to grow on some nonfermentable carbon sources, and sensitivity
to amino
acid starvation (
22,
45). Many of these phenotypes
are
similar to those exhibited by Yng2 deficient cells. However,
in
contrast to
yng2
cells, Gcn5-deficient cells are viable
in
media with galactose as the sole carbon source. In addition, Yng2
seems to associate with H2A-H4 HAT activity similar to NuA4, whereas
Gcn5 predominately acts on H3 and H2B (reviewed in reference
8).
Our studies provide strong evidence that Yng2 is associated with a
complex containing Esa1. First, temperature-sensitive
esa1 alleles exhibit morphological and cytokinesis defects (swollen,
multibudded cells often lacking nuclei) that are very similar
to the
morphology of
yng2
cells (
13). Second, both
Yng2 and
Esa1 associate with Tra1. Third, the HA-Yng2-associated HAT
activity
has an identical substrate preference compared to
immunoprecipitated
GFP-HA-Esa1. Fourth, in vivo deficiencies in histone
H4 acetylation
in
yng2
and
esa1(Ts) cells at
the nonpermissive temperature are
remarkably similar. Fifth, Yng2 fails
to coimmunoprecipitate HAT
activity in
esa1(Ts) strains at
the restrictive temperature, or
in a severe
esa1(Ts) strain
at the nonrestrictive temperature.
Sixth, myc-Yng2 can be
coimmunoprecipitated with GFP-HA-Esa1.
Esa1 is the HAT component of
NuA4, and all cellular Esa1 is predicted
to be associated with the NuA4
complex (
3). Thus, it seems
likely that Yng2 is a component
of the NuA4 complex. Immunopurification
of NuA4 demonstrated the tight
association of a 32-kDa protein
(
3), which is identical in
size to the predicted molecular
mass of Yng2. However, it should be
noted that these observations
do not exclude the possibility that Yng2
functions in additional
HAT
complexes.
HA-Yng1 coimmunoprecipitates a HAT activity with a preference for H3
that appears to be very similar to that of immunoprecipitated
GFP-HA-Gcn5, raising the possibility that Yng1 is associated with
Gcn5
functions. Interestingly, a silver-stained gel of purified
SAGA complex
indicates the existence of an ~25-kDa protein similar
in size to
Yng1. Further studies may reveal if Yng1 is a component
of SAGA, ADA,
NuA3 (which also acetylates H3), and/or previously
unidentified HAT
complexes.
HA-Pho23 coimmunoprecipitated a much weaker and nonspecific HAT
activity than Yng1 or Yng2. A clue to the macromolecular associations
of Pho23 comes from a recent report that Gcn5 regulates the remodeling
of chromatin at the Pho5 promoter in vivo (
26). Pho23 was
originally
characterized in a genetic selection to isolate mutants that
express
Pho5 constitutively (Pho
c) (
40). Null
alleles of
PHO23 result in a partial Pho
c
phenotype; however, the mechanism by which loss of Pho23 leads
to a
Pho
c phenotype is not understood. As both Pho23 and Gcn5
appear to
be involved in regulation of Pho5 expression, perhaps they
colocalize
to the same HAT complex (SAGA or
ADA).
There are several possible roles of Yng2, Yng1, or Pho23 in HAT
complexes. They may be involved in regulation of acetyltransferase
activity, complex formation, or complex stability, or perhaps
they
serve as specificity factors to direct certain HAT complexes
to
appropriate targets. Recently, the activities of several HAT
complex
components other than acetyltransferase have been reported.
For
example, Ada2 protein has been shown to be required for the
assembly of
Gcn5 and the potentiation of its HAT activity (
73).
Other
published data also suggests that HATs need to be part of
a native
complex to work efficiently (
3,
25). Interestingly,
genetic
and biochemical studies suggest that SAGA possesses both
HAT-dependent
and -independent activities important for transcription
(
15,
71). Thus, it is possible that yeast Ing1 homologs perform
additional functions in HAT complexes in a capacity not related
to
histone
acetylation.
PHD fingers are implicated in transcriptional regulation and
cancer.
The strong similarity between Ing1 and the yeast homologs
is primarily restricted to the PHD finger domains. This homology was
the initial basis for suggesting that these proteins are functionally related. Indeed, our evidence indicates that all three yeast proteins are associated with HAT complexes. Furthermore, Ing1 associates with
HAT activity when it is expressed in yeast. These observations support
the model that PHD finger domains are involved in multiprotein complexes that modulate chromatin structure, as previously suggested (1). However, we have shown that the PHD finger is not
required for the association of Yng2 with either Tra1 or HAT activity. These results suggest that the unique N-terminal domains are the regions that determine the interaction with specific HAT complexes while the PHD fingers provide a more general and conserved function. Exactly how the PHD fingers of these proteins are involved in the
formation or function of HAT complexes remains to be determined. PHD
fingers have been identified in several genes associated with genetic
syndromes, including genes encoding WSTF in Williams syndrome, PHF2 in
hereditary sensory neuropathy type 1, AIRE in autoimmune polyglandular
syndrome type 1, ATRX in X-linked alpha-thalassemia mental retardation
syndrome, and MOZ in chromosomal translocations in acute myeloid
leukemias (23, 27, 33, 34, 43, 50, 57). Further
characterization of PHD finger function may potentially shed light on
the molecular mechanisms of these diseases.
Human, budding yeast, and fission yeast Ing1 homologs are
functionally conserved.
The strong similarity among human, budding
yeast, and fission yeast Ing1 homologs suggest that these proteins have
been structurally conserved throughout eukaryote evolution. Our genetic
complementation and biochemical results further suggest that these
proteins perform related and functionally conserved roles. Human Ing1
and fission yeast Png1 functionally rescue yng2
phenotypes; however, Png1 rescues caffeine lethality more efficiently
than Ing1, and Png1 rescues temperature sensitivity very poorly. Thus,
Yng2 may perform more than a single discrete biochemical function, and
these functions may have been differentially conserved throughout
eukaryote evolution.
The structure and function of Ing1 and Yng2 seem to have been
particularly well conserved, suggesting that human Ing1 may
be
associated with HAT activity and TRRAP, the mammalian homolog
of Tra1,
in mammals. TRRAP has been shown to interact with c-Myc
and E2F-1, and
inhibition of TRRAP function blocks c-Myc and E1A-mediated
oncogenic
transformation, suggesting that TRRAP is an essential
cofactor for
c-Myc and E1A-E2F oncogenic transcription factor
pathways (
14,
47,
62). Interestingly, Ing1 has been shown
to cooperate with c-Myc
to induce apoptosis (
28). Such cooperation
may be mediated
by TRRAP and its associated HAT
activity.
Approximately one-third of the genes in
S. cerevisiae have
significant similarity to human cDNAs reported in the expressed
sequence tag database (
7). However, among those conserved
genes
are only a few known oncogenes or tumor suppressors. Most notably
absent in yeast are homologs of p53, a tumor suppressor associated
with
over 50% of human cancers. Thus, identification of yeast
homologs of
the mammalian Ing1 putative tumor suppressor is quite
novel and
suggests that these proteins function in a conserved
primeval
mechanism. A model in which Ing1 regulates HAT activity
would be
consistent with its putative tumor-suppressive role.
Several recent
reports implicate HATs and HDACs in cell cycle
regulation,
differentiation, and cancer development (
4,
34,
37). Also,
the tumor suppressor BRCA2 has been shown to possess
intrinsic HAT
activity (
67).
 |
ACKNOWLEDGMENTS |
We thank Chris Brandl, Lorraine Pillus, George Thireos, and John
Colicelli for providing strains and plasmids.
This research was supported by grants from the Alberta Cancer Board and
the National Cancer Institute of Canada. R.L. was supported by the
National Science and Engineering Research Council of Canada, the
Alberta Heritage Foundation for Medical Research, and the University of
Calgary Silver Anniversary Scholarship. D.Y. is a Senior Scholar of the
Alberta Heritage Foundation for Medical Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Biochemistry and Molecular Biology and Oncology, University of Calgary Health Sciences Centre, Calgary, Alberta T2N 4N1, Canada. Phone: (403)
220-3030. Fax: (403) 283-8727. E-mail: young{at}ucalgary.ca.
 |
REFERENCES |
| 1.
|
Aasland, R.,
T. J. Gibson, and A. F. Stewart.
1995.
The PHD finger: implications for chromatin-mediated transcriptional regulation.
Trends Biochem. Sci.
20:56-59[CrossRef][Medline].
|
| 2.
|
Adams, A.,
D. E. Gottschling,
C. A. Kaiser, and T. Stearns.
1998.
Methods in yeast genetics, 1997 ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 3.
|
Allard, S.,
R. T. Utley,
J. Savard,
A. Clarke,
P. Grant,
C. J. Brandl,
L. Pillus,
J. L. Workman, and J. Cote.
1999.
NuA4, an essential transcription adaptor/histone H4 acetyltransferase complex containing Esa1p and the ATM-related cofactor Tra1p.
EMBO J.
18:5108-5119[CrossRef][Medline].
|
| 4.
|
Archer, S. Y., and R. A. Hodin.
1999.
Histone acetylation and cancer.
Curr. Opin. Genet. Dev.
9:171-174[CrossRef][Medline].
|
| 5.
|
Bannister, A. J., and T. Kouzarides.
1996.
The CBP co-activator is a histone acetyltransferase.
Nature
384:641-643[CrossRef][Medline].
|
| 6.
|
Bartel, P.,
C. T. Chien,
R. Sternglanz, and S. Fields.
1993.
Elimination of false positives that arise in using the two-hybrid system.
BioTechniques
14:920-924[Medline].
|
| 7.
|
Bassett, D. E.,
M. S. Boguski,
F. Spencer,
R. Reeves,
S. Kim,
T. Weaver, and P. Hieter.
1997.
Genome cross-referencing and XREFdb: implications for the identification and analysis of genes mutated in human disease.
Nat. Genet.
15:339-344[CrossRef][Medline].
|
| 8.
|
Berger, S. L.
1999.
Gene activation by histone and factor acetyltransferases.
Curr. Opin. Cell Biol.
11:336-341[CrossRef][Medline].
|
| 9.
|
Bradbury, E. M.
1992.
Reversible histone modifications and the chromosome cell cycle.
Bioessays
14:9-16[CrossRef][Medline].
|
| 10.
|
Breeden, L., and K. Nasmyth.
1985.
Regulation of yeast HO gene.
Cold Spring Harb. Symp. Quant. Biol.
50:643-650[Abstract/Free Full Text].
|
| 11.
|
Brownell, J. E.,
J. Zhou,
T. Ranalli,
R. Kobayashi,
D. G. Edmondson,
S. Y. Roth, and C. D. Allis.
1996.
Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation.
Cell
84:843-851[CrossRef][Medline].
|
| 12.
|
Chen, H.,
R. J. Lin,
R. L. Schiltz,
D. Chakravarti,
A. Nash,
L. Nagy,
M. L. Privalsky,
Y. Nakatani, and R. M. Evans.
1997.
Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300.
Cell
90:569-580[CrossRef][Medline].
|
| 13.
|
Clarke, A. S.,
J. E. Lowell,
S. J. Jacobson, and L. Pillus.
1999.
Esa1 is an essential histone acetyltransferase required for cell cycle progression.
Mol. Cell. Biol.
19:2515-2526[Abstract/Free Full Text].
|
| 14.
|
Cole, M., and S. B. McMahon.
1999.
The Myc oncoprotein: a critical evaluation of transactivation and target gene regulation.
Oncogene
18:2916-2924[CrossRef][Medline].
|
| 15.
|
Dudley, A. M.,
C. Rougeulle, and F. Winston.
1999.
The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo.
Genes Dev.
13:2940-2945[Abstract/Free Full Text].
|
| 16.
|
Eberharter, A.,
D. E. Sterner,
D. Schieltz,
A. Hassan,
J. R. Yates III,
S. L. Berger, and J. L. Workman.
1999.
The ADA complex is a distinct histone acetyltransferase complex in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:6621-6631[Abstract/Free Full Text].
|
| 17.
|
Elble, R. A.
1992.
Simple and efficient procedure for transformation of yeasts.
BioTechniques
13:18-20[Medline].
|
| 18.
|
Garkavstev, I., and K. Riabowol.
1997.
Extension of the replicative life span of human diploid fibroblasts by inhibition of the p33ING1 candidate tumor suppressor.
Mol. Cell. Biol.
17:2014-2019[Abstract].
|
| 19.
|
Garkavtsev, I.,
D. Demetrick, and K. Riabowol.
1997.
Cellular localization and chromosome mapping of a novel candidate tumor suppressor gene (ING1).
Cytogenet. Cell Genet.
76:176-178[Medline].
|
| 20.
|
Garkavtsev, I.,
I. A. Grigorian,
V. S. Ossovskaya,
M. V. Chernov,
P. M. Chumakov, and A. V. Gudkov.
1998.
The candidate tumor suppressor p33ING1 cooperates with p53 in cell growth control.
Nature
391:295-298[CrossRef][Medline].
|
| 21.
|
Garkavtsev, I.,
A. Kazarov,
A. Gudkov, and K. Riabowol.
1996.
Suppression of the novel growth inhibitor p33ING1 promotes neoplastic transformation.
Nat. Genet.
14:415-420[CrossRef][Medline].
|
| 22.
|
Georgakopoulos, T., and G. Thireos.
1992.
Two distinct yeast transcriptional activators require the function of the GCN5 protein to promote normal levels of transcription.
EMBO J.
11:4145-4152[Medline].
|
| 23.
|
Gibbons, R. J.,
S. Bachoo,
D. J. Picketts,
S. Aftimos,
B. Asenbauer,
J. Bergoffen,
S. A. Berry,
N. Dahl,
A. Fryer,
K. Keppler,
K. Kurosawa,
M. L. Levin,
M. Masuno,
G. Neri,
M. E. Pierpont,
S. F. Slaney, and D. R. Higgs.
1997.
Mutations in transcriptional regulator ATRX establish the functional significance of a PHD-like domain.
Nat. Genet.
17:146-148[CrossRef][Medline].
|
| 24.
|
Grant, P. A.,
D. Schieltz,
M. G. Pray-Grant,
J. R. Yates III, and J. L. Workman.
1998.
The ATM-related cofactor Tra1 is a component of the purified SAGA complex.
Mol. Cell
2:863-867[CrossRef][Medline].
|
| 25.
|
Grant, P. A.,
L. Duggan,
J. Cote,
S. M. Roberts,
J. E. Brownell,
R. Candau,
R. Ohba,
T. Owen-Hughes,
C. D. Allis,
F. Winston,
S. L. Berger, and J. L. Workman.
1997.
Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex.
Genes Dev.
11:1640-1650[Abstract/Free Full Text].
|
| 26.
|
Gregory, P. D.,
A. Schmid,
M. Zavari,
L. Lui,
S. L. Berger, and W. Hörz.
1998.
Absence of Gcn5 HAT activity defines a novel state in the opening of chromatin at the PHO5 promoter in yeast.
Mol. Cell
1:495-505[CrossRef][Medline].
|
| 27.
|
Hasenpusch-Theil, K.,
B. P. Chadwick,
T. Theil,
S. K. Heath,
D. G. Wilkinson, and A. M. Frischauf.
1999.
PHF2, a novel PHD finger gene located on human chromosome 9q22.
Mamm. Genome
10:294-298[CrossRef][Medline].
|
| 28.
|
Helbing, C. C.,
C. Veillette,
K. Riabowol,
R. N. Johnston, and I. Garkavtsev.
1997.
A novel candidate tumor suppressor, ING1, is involved in the regulation of apoptosis.
Cancer Res.
57:1255-1258[Abstract/Free Full Text].
|
| 29.
|
Hill, J.,
K. A. Donald,
D. E. Griffiths, and G. Donald.
1991.
Enhanced whole cell yeast transformation.
Nucleic Acids Res.
19:5791[Free Full Text].
|
| 30.
|
Hollenberg, S. M.,
R. Sternglanz,
P. F. Chenag, and H. Weintraub.
1995.
Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.
Mol. Cell. Biol.
15:3813-3822[Abstract].
|
| 31.
|
Hong, L.,
G. P. Schroth,
H. R. Matthews,
P. Yau, and E. M. Bradbury.
1993.
Studies of the DNA binding properties of the histone H4 amino terminus.
J. Biol. Chem.
268:305-314[Abstract/Free Full Text].
|
| 32.
|
Hubberstey, A.,
G. Yu,
R. J. Loewith,
C. Lakusta, and D. Young.
1996.
Mammalian CAP interacts with CAP, CAP2 and actin.
J. Cell. Biochem.
61:459-466[CrossRef][Medline].
|
| 33.
|
Ito, T.,
M. E. Levenstein,
D. V. Fyodorov,
A. K. Kutach,
R. Kobayashi, and J. T. Kadonaga.
1999.
ACF consists of two subunits, Acf1 and ISWI, that function cooperatively in the ATP-dependent catalysis of chromatin assembly.
Genes Dev.
13:1529-1539[Abstract/Free Full Text].
|
| 34.
|
Jacobson, S., and L. Pillus.
1999.
Modifying chromatin and concepts of cancer.
Curr. Opin. Gen. Dev.
9:175-184[CrossRef][Medline].
|
| 35.
|
Jeggo, P. A.,
A. M. Carr, and A. R. Lehmann.
1998.
Splitting the ATM: distinct repair and checkpoint defects in ataxia-telangiectasia.
Trends Genet.
14:312-316[CrossRef][Medline].
|
| 36.
|
Kleff, S.,
E. D. Andrulis,
C. W. Anderson, and R. Sternglanz.
1995.
Identification of a gene encoding a yeast histone H4 acetyltransferase.
J. Biol. Chem.
270:24674-25677[Abstract/Free Full Text].
|
| 37.
|
Kouzarides, T.
1999.
Histone acetylases and deacetylases in cell proliferation.
Curr. Opin. Genet. Dev.
9:40-48[CrossRef][Medline].
|
| 38.
|
Kuo, M. H., and C. D. Allis.
1998.
Roles of histone acetyltransferases and deacetylases in gene regulation.
Bioessays
20:615-626[CrossRef][Medline].
|
| 39.
|
Kuo, M. H.,
J. Zhou,
P. Jambeck,
M. E. A. Churchill, and C. D. Allis.
1998.
Histone acetyltransferase activity of Gcn5p is required for the activation of targeted genes in vivo.
Genes Dev.
12:627-639[Abstract/Free Full Text].
|
| 40.
|
Lau, W. W.,
K. R. Schneider, and E. K. O'Shea.
1998.
A genetic study of signaling processes for repression of PHO5 transcription in Saccharomyces cerevisiae.
Genetics
150:1349-1359[Abstract/Free Full Text].
|
| 41.
|
Lee, D. Y.,
J. J. Hayes,
D. Pruss, and A. P. Wolffe.
1993.
A positive role for histone acetylation in transcription factor access to nucleosomal DNA.
Cell
72:73-84[CrossRef][Medline].
|
| 42.
|
Lees-Miller, S. P.
1996.
The DNA-dependent protein kinase, DNA-PK: 10 years and still no ends in sight.
Biochem. Cell Biol.
74:503-512[Medline].
|
| 43.
|
Lu, X.,
X. Meng,
C. A. Morris, and M. T. Keating.
1998.
A novel human gene, WSTF, is deleted in Williams syndrome.
Genomics
54:241-249[CrossRef][Medline].
|
| 44.
|
Luger, K.,
A. W. Mader,
R. K. Richmond,
D. F. Sargent, and T. J. Richmond.
1997.
Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature
389:251-260[CrossRef][Medline].
|
| 45.
|
Marcus, G. A.,
N. Silverman,
S. L. Berger,
J. Horiuchi, and L. Guarente.
1994.
Functional similarity and physical association between GCN5 and ADA2: putative transcriptional adaptors.
EMBO J.
13:4807-4815[Medline].
|
| 46.
|
Matviw, H.,
G. Yu, and D. Young.
1992.
Identification of a human cDNA encoding a protein that is structurally related to the yeast adenylyl cyclase-associated CAP proteins.
Mol. Cell. Biol.
12:5033-5040[Abstract/Free Full Text].
|
| 47.
|
McMahon, S. B.,
H. A. Van Buskirk,
K. A. Dugan,
T. D. Copeland, and M. D. Cole.
1998.
The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins.
Cell
94:363-374[CrossRef][Medline].
|
| 48.
|
Mizzen, C. A.,
X. J. Yang,
T. Kokubo,
J. E. Brownell,
A. J. Bannister,
T. Owen-Hughes,
J. L. Workman,
L. Wang,
S. L. Berger,
T. Kouzarides,
Y. Nakatani, and C. D. Allis.
1996.
The TAFII250 subunit of TFIID has histone acetyltransferase activity.
Cell
87:1261-1270[CrossRef][Medline].
|
| 49.
|
Mizzen, C. A.,
J. E. Brownell,
R. G. Cook, and C. D. Allis.
1999.
Histone acetyltransferases: preparation of substrates and assay procedures.
Methods Enzymol.
304:675-696[Medline].
|
| 50.
|
Nagamine, K.,
P. Peterson,
H. S. Scott,
J. Kudoh,
S. Minoshima,
M. Heino,
K. J. Krohn,
M. D. Lalioti,
P. E. Mullis,
S. E. Antonarakis,
K. Kawasaki,
S. Asakawa,
F. Ito, and N. Shimizu.
1997.
Positional cloning of the APECED gene.
Nat. Genet.
17:393-398[CrossRef][Medline].
|
| 51.
|
Ogryzko, V. O.,
R. L. Schiltz,
V. Russanova,
B. H. Howard, and Y. Nakatani.
1996.
The transcriptional coactivators p300 and CBP are histone acetyltransferases.
Cell
87:953-959[CrossRef][Medline].
|
| 52.
|
Ohmori, M.,
M. Nagai,
T. Tasaka,
H. P. Koeffler,
K. Riabowol, and J. Takahara.
1999.
Decreased expression of p33ING1 mRNA in lymphoid malignancies.
Am. J. Hematol.
62:118-119[CrossRef][Medline].
|
| 53.
|
Owen-Hughes, T., and J. L. Workman.
1994.
Experimental analysis of chromatin function in transcription control.
Crit. Rev. Eukaryot. Gene Expr.
4:401-441.
|
| 54.
|
Paranjape, S. M.,
R. T. Kamakaka, and J. T. Kadonaga.
1994.
Role of chromatin structure in the regulation of transcription by RNA polymerase II.
Annu. Rev. Biochem.
63:265-297[CrossRef][Medline].
|
| 55.
|
Parthun, M. R.,
J. Widom, and D. E. Gottschling.
1996.
The major cytoplasmic histone acetyltransferase in yeast: links to chromatin replication and histone metabolism.
Cell
87:85-94[CrossRef][Medline].
|
| 56.
|
Pazin, M. J., and J. T. Kadonaga.
1997.
What's up and down with histone deacetylation and transcription?
Cell
89:325-328[CrossRef][Medline].
|
| 57.
|
Rinderle, C.,
H. M. Christensen,
S. Schweiger,
H. Lehrach, and M. L. Yaspo.
1999.
AIRE encodes a nuclear protein co-localizing with cytoskeletal filaments: altered subcellular distribution of mutants lacking the PHD zinc fingers.
Hum. Mol. Genet.
8:277-290[Abstract/Free Full Text].
|
| 58.
|
Roth, S. Y., and C. D. Allis.
1996.
The subunit-exchange model of histone acetylation.
Trends Cell Biol.
6:371-375[CrossRef][Medline].
|
| 59.
|
Rothstein, R. J.
1983.
One-step gene disruption in yeast.
Methods Enzymol.
101:202-211[Medline].
|
| 60.
|
Ruiz-Garcia, A. B.,
R. Sendra,
M. Galiana,
M. Pambianco,
J. E. Perez-Ortin, and V. Tordera.
1998.
HAT1 and HAT2 proteins are components of a yeast nuclear histone acetyltransferase enzyme specific for free histone H4.
J. Biol. Chem.
273:12599-12605[Abstract/Free Full Text].
|
| 61.
|
Russell, P., and P. Nurse.
1986.
cdc25+ functions as an inducer in the mitotic control of fission yeast.
Cell
45:145-153[CrossRef][Medline].
|
| 62.
|
Sakamuro, D., and G. C. Prendergast.
1999.
New Myc-interacting proteins: a second Myc network emerges.
Oncogene
18:2942-2954[CrossRef][Medline].
|
| 63.
|
Saleh, A.,
D. Schieltz,
N. Ting,
S. B. McMahon,
D. W. Litchfield,
J. R. Yates III,
S. P. Lees-Miller,
M. D. Cole, and C. J. Brandl.
1998.
Tra1 is a component of the yeast Ada-Spt transcriptional regulatory complexes.
J. Biol. Chem.
273:26559-26565[Abstract/Free Full Text].
|
| 64.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 65.
|
Sass, P.,
J. Field,
J. Nikawa,
T. Toda, and M. Wigler.
1986.
Cloning and characterization of the high-affinity cAMP phosphodiesterase of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
83:9303-9307[Abstract/Free Full Text].
|
| 66.
|
Schiestl, R. H., and R. D. Gietz.
1989.
High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier.
Curr. Genet.
16:339-346[CrossRef][Medline].
|
| 67.
|
Siddique, H.,
J. P. Zou,
V. N. Rao, and E. S. Reddy.
1998.
The BRAC2 is a histone acetyltransferase.
Oncogene
16:2283-2285[CrossRef][Medline].
|
| 68.
|
Smith, E. R.,
A. Eisen,
W. Gu,
M. Sattah,
A. Pannuti,
J. Zhou,
R. G. Cook,
J. C. Lucchesi, and C. D. Allis.
1998.
Esa1 is a histone acetyltransferase that is essential for growth in yeast.
Proc. Natl. Acad. Sci. USA
95:3561-3565[Abstract/Free Full Text].
|
| 69.
|
Spencer, T. E.,
G. Jenster,
M. M. Burcin,
C. D. Allis,
J. Zhou,
C. A. Mizzen,
N. J. McKenna,
S. A. Onate,
S. Y. Tsai,
M. J. Tsai, and B. W. O'Malley.
1997.
Steroid receptor coactivator-1 is a histone acetyltransferase.
Nature
389:194-198[CrossRef][Medline].
|
| 70.
|
Steger, D. J.,
A. Eberharter,
S. John,
P. A. Grant, and J. L. Workman.
1998.
Purified histone acetyltransferases stimulate HIV-1 transcription from preassembled nucleosomal arrays.
Proc. Natl. Acad. Sci. USA
95:12924-12929[Abstract/Free Full Text].
|
| 71.
|
Sterner, D. E.,
P. A. Grant,
S. M. Roberts,
L. J. Duggan,
R. Belotserkovskaya,
L. A. Pacella,
F. Winston,
J. L. Workman, and S. L. Berger.
1999.
Functional organization of the yeast SAGA complex: distinct components involved in structural integrity, nucleosome acetylation, and TATA-binding protein interaction.
Mol. Biol. Cell
19:86-98.
|
| 72.
|
Struhl, K.
1998.
Histone acetylation and transcriptional regulatory mechanisms.
Genes Dev.
12:599-606[Free Full Text].
|
| 73.
|
Syntichaki, P., and G. Thireos.
1998.
The Gcn5-Ada complex potentiates the histone acetyltransferase activity of Gcn5.
J. Biol. Chem.
273:24414-24419[Abstract/Free Full Text].
|
| 74.
|
Toyama, T.,
I. Hirotaka,
P. Watson,
H. Muzik,
E. Saettler,
A. Magliocco,
L. DiFrancesco,
P. Forsyth,
I. Garkavtsev,
S. Kobayashi, and K. Riabowol.
1999.
Suppression of ING1 expression in sporadic breast cancer.
Oncogene
18:5187-5193[CrossRef][Medline].
|
| 75.
|
Turner, B. M., and L. P. O'Neill.
1995.
Histone acetylation in chromatin and chromosomes.
Semin. Cell Biol.
6:229-236[Medline].
|
| 76.
|
Utley, R. T.,
K. Ikeda,
P. A. Grant,
J. Cote,
D. J. Steger,
A. Eberharter,
S. John, and J. L. Workman.
1998.
Transcriptional activators direct histone acetyltransferase complexes to nucleosomes.
Nature
394:498-502[CrossRef][Medline].
|
| 77.
|
Vassilev, A.,
J. Yamauchi,
T. Kotani,
C. Prives,
M. L. Avantaggianti,
J. Qin, and Y. Nakatani.
1998.
The 400 kDa subunit of the PCAF histone acetylase complex belongs to the ATM superfamily.
Mol. Cell
2:869-875[CrossRef][Medline].
|
| 78.
|
Verreault, A.,
P. D. Kaufman,
R. Kobayashi, and B. Stillman.
1998.
Nucleosomal DNA regulates the core-histone-binding subunit of the human Hat1 acetyltransferase.
Curr. Biol.
8:96-108[CrossRef][Medline].
|
| 79.
|
Vettese-Dadey, M.,
P. A. Grant,
T. R. Hebbes,
C. Crane-Robinson,
C. D. Allis, and J. L. Workman.
1996.
Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro.
EMBO J.
15:2508-2518[Medline].
|
| 80.
|
Vojtek, A. B.,
S. M. Hollenberg, and J. A. Cooper.
1993.
Mammalian RAS interacts directly with the serine/threonine kinase Raf.
Cell
74:205-214[CrossRef][Medline].
|
| 81.
|
Wang, L.,
L. Liu, and S. L. Berger.
1998.
Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo.
Genes Dev.
12:640-653[Abstract/Free Full Text].
|
| 82.
|
Yang, X. J.,
V. Ogryzko,
J. Nishikawa,
B. H. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.
Nature
382:319-324[CrossRef][Medline].
|
| 83.
|
Zeremski, M.,
J. E. Hill,
S. S. S. Kwek,
I. A. Grigorian,
K. V. Gurova,
I. V. Garkavtsev,
L. Diatchenko,
E. V. Koonin, and A. V. Gudkov.
1999.
Structure and regulation of the mouse ing1 gene.
J. Biol. Chem.
274:32172-32181[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 2000, p. 3807-3816, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Luo, J., Shah, S., Riabowol, K., Mains, P. E.
(2009). The Caenorhabditis elegans ing-3 Gene Regulates Ionizing Radiation-Induced Germ-Cell Apoptosis in a p53-Associated Pathway. Genetics
181: 473-482
[Abstract]
[Full Text]
-
Lu, Y., Su, C., Mao, X., Raniga, P. P., Liu, H., Chen, J.
(2008). Efg1-mediated Recruitment of NuA4 to Promoters Is Required for Hypha-specific Swi/Snf Binding and Activation in Candida albicans. Mol. Biol. Cell
19: 4260-4272
[Abstract]
[Full Text]
-
Sarker, K. P., Kataoka, H., Chan, A., Netherton, S. J., Pot, I., Huynh, M. A., Feng, X., Bonni, A., Riabowol, K., Bonni, S.
(2008). ING2 as a Novel Mediator of Transforming Growth Factor-{beta}-dependent Responses in Epithelial Cells. J. Biol. Chem.
283: 13269-13279
[Abstract]
[Full Text]
-
Lottersberger, F., Panza, A., Lucchini, G., Longhese, M. P.
(2007). Functional and Physical Interactions between Yeast 14-3-3 Proteins, Acetyltransferases, and Deacetylases in Response to DNA Replication Perturbations. Mol. Cell. Biol.
27: 3266-3281
[Abstract]
[Full Text]
-
Feng, X., Bonni, S., Riabowol, K.
(2006). HSP70 Induction by ING Proteins Sensitizes Cells to Tumor Necrosis Factor Alpha Receptor-Mediated Apoptosis. Mol. Cell. Biol.
26: 9244-9255
[Abstract]
[Full Text]
-
Martin, D. G. E., Baetz, K., Shi, X., Walter, K. L., MacDonald, V. E., Wlodarski, M. J., Gozani, O., Hieter, P., Howe, L.
(2006). The Yng1p Plant Homeodomain Finger Is a Methyl-Histone Binding Module That Recognizes Lysine 4-Methylated Histone H3. Mol. Cell. Biol.
26: 7871-7879
[Abstract]
[Full Text]
-
Gong, W., Russell, M., Suzuki, K., Riabowol, K.
(2006). Subcellular Targeting of p33ING1b by Phosphorylation-Dependent 14-3-3 Binding Regulates p21WAF1 Expression. Mol. Cell. Biol.
26: 2947-2954
[Abstract]
[Full Text]
-
Durant, M., Pugh, B. F.
(2006). Genome-Wide Relationships between TAF1 and Histone Acetyltransferases in Saccharomyces cerevisiae.. Mol. Cell. Biol.
26: 2791-2802
[Abstract]
[Full Text]
-
Selleck, W., Fortin, I., Sermwittayawong, D., Cote, J., Tan, S.
(2005). The Saccharomyces cerevisiae Piccolo NuA4 Histone Acetyltransferase Complex Requires the Enhancer of Polycomb A Domain and Chromodomain To Acetylate Nucleosomes. Mol. Cell. Biol.
25: 5535-5542
[Abstract]
[Full Text]
-
He, G. H.Y., Helbing, C. C., Wagner, M. J., Sensen, C. W., Riabowol, K.
(2005). Phylogenetic Analysis of the ING Family of PHD Finger Proteins. Mol Biol Evol
22: 104-116
[Abstract]
[Full Text]
-
Panchenko, M. V., Zhou, M. I., Cohen, H. T.
(2004). von Hippel-Lindau Partner Jade-1 Is a Transcriptional Co-activator Associated with Histone Acetyltransferase Activity. J. Biol. Chem.
279: 56032-56041
[Abstract]
[Full Text]
-
Yang, X.-J.
(2004). The diverse superfamily of lysine acetyltransferases and their roles in leukemia and other diseases. Nucleic Acids Res
32: 959-976
[Abstract]
[Full Text]
-
Kameyama, K., Huang, C.-l., Liu, D., Masuya, D., Nakashima, T., Sumitomo, S., Takami, Y., Kinoshita, M., Yokomise, H.
(2003). Reduced ING1b Gene Expression Plays an Important Role in Carcinogenesis of Non-Small Cell Lung Cancer Patients. Clin. Cancer Res.
9: 4926-4934
[Abstract]
[Full Text]
-
Kataoka, H., Bonnefin, P., Vieyra, D., Feng, X., Hara, Y., Miura, Y., Joh, T., Nakabayashi, H., Vaziri, H., Harris, C. C., Riabowol, K.
(2003). ING1 Represses Transcription by Direct DNA Binding and through Effects on p53. Cancer Res.
63: 5785-5792
[Abstract]
[Full Text]
-
Le Masson, I., Yu, D. Y., Jensen, K., Chevalier, A., Courbeyrette, R., Boulard, Y., Smith, M. M., Mann, C.
(2003). Yaf9, a Novel NuA4 Histone Acetyltransferase Subunit, Is Required for the Cellular Response to Spindle Stress in Yeast. Mol. Cell. Biol.
23: 6086-6102
[Abstract]
[Full Text]
-
Fricke, W. M., Brill, S. J.
(2003). Slx1--Slx4 is a second structure-specific endonuclease functionally redundant with Sgs1--Top3. Genes Dev.
17: 1768-1778
[Abstract]
[Full Text]
-
Nouman, G S, Anderson, J J, Lunec, J, Angus, B
(2003). The role of the tumour suppressor p33ING1b in human neoplasia. J. Clin. Pathol.
56: 491-496
[Abstract]
[Full Text]
-
Boudreault, A. A., Cronier, D., Selleck, W., Lacoste, N., Utley, R. T., Allard, S., Savard, J., Lane, W. S., Tan, S., Cote, J.
(2003). Yeast Enhancer of Polycomb defines global Esa1-dependent acetylation of chromatin. Genes Dev.
17: 1415-1428
[Abstract]
[Full Text]
-
Yang, X., Makaroff, C. A., Ma, H.
(2003). The Arabidopsis MALE MEIOCYTE DEATH1 Gene Encodes a PHD-Finger Protein That Is Required for Male Meiosis. Plant Cell
15: 1281-1295
[Abstract]
[Full Text]
-
Nourani, A., Howe, L., Pray-Grant, M. G., Workman, J. L., Grant, P. A., Cote, J.
(2003). Opposite Role of Yeast ING Family Members in p53-dependent Transcriptional Activation. J. Biol. Chem.
278: 19171-19175
[Abstract]
[Full Text]
-
Shiseki, M., Nagashima, M., Pedeux, R. M., Kitahama-Shiseki, M., Miura, K., Okamura, S., Onogi, H., Higashimoto, Y., Appella, E., Yokota, J., Harris, C. C.
(2003). p29ING4 and p28ING5 Bind to p53 and p300, and Enhance p53 Activity. Cancer Res.
63: 2373-2378
[Abstract]
[Full Text]
-
Choy, J. S., Kron, S. J.
(2002). NuA4 Subunit Yng2 Function in Intra-S-Phase DNA Damage Response. Mol. Cell. Biol.
22: 8215-8225
[Abstract]
[Full Text]
-
Breyne, P., Dreesen, R., Vandepoele, K., De Veylder, L., Van Breusegem, F., Callewaert, L., Rombauts, S., Raes, J., Cannoot, B., Engler, G., Inze, D., Zabeau, M.
(2002). Transcriptome analysis during cell division in plants. Proc. Natl. Acad. Sci. USA
99: 14825-14830
[Abstract]
[Full Text]
-
Vieyra, D., Loewith, R., Scott, M., Bonnefin, P., Boisvert, F.-M., Cheema, P., Pastyryeva, S., Meijer, M., Johnston, R. N., Bazett-Jones, D. P., McMahon, S., Cole, M. D., Young, D., Riabowol, K.
(2002). Human ING1 Proteins Differentially Regulate Histone Acetylation. J. Biol. Chem.
277: 29832-29839
[Abstract]
[Full Text]
-
Vieyra, D., Toyama, T., Hara, Y., Boland, D., Johnston, R., Riabowol, K.
(2002). ING1 Isoforms Differentially Affect Apoptosis in a Cell Age-dependent Manner. Cancer Res.
62: 4445-4452
[Abstract]
[Full Text]
-
Howe, L., Kusch, T., Muster, N., Chaterji, R., Yates, J. R. III, Workman, J. L.
(2002). Yng1p Modulates the Activity of Sas3p as a Component of the Yeast NuA3 Histone Acetyltransferase Complex. Mol. Cell. Biol.
22: 5047-5053
[Abstract]
[Full Text]
-
Huang, Y.
(2002). Transcriptional silencing in Saccharomyces cerevisiae and Schizosaccharomyces pombe. Nucleic Acids Res
30: 1465-1482
[Abstract]
[Full Text]
-
Takahashi, M., Seki, N., Ozaki, T., Kato, M., Kuno, T., Nakagawa, T., Watanabe, K.-i., Miyazaki, K., Ohira, M., Hayashi, S., Hosoda, M., Tokita, H., Mizuguchi, H., Hayakawa, T., Todo, S., Nakagawara, A.
(2002). Identification of the p33ING1-regulated Genes that Include Cyclin B1 and Proto-oncogene DEK by Using cDNA Microarray in a Mouse Mammary Epithelial Cell Line NMuMG. Cancer Res.
62: 2203-2209
[Abstract]
[Full Text]
-
Kuzmichev, A., Zhang, Y., Erdjument-Bromage, H., Tempst, P., Reinberg, D.
(2002). Role of the Sin3-Histone Deacetylase Complex in Growth Regulation by the Candidate Tumor Suppressor p33ING1. Mol. Cell. Biol.
22: 835-848
[Abstract]
[Full Text]
-
Meijer, M., Karimi-Busheri, F., Huang, T. Y., Weinfeld, M., Young, D.
(2002). Pnk1, a DNA Kinase/Phosphatase Required for Normal Response to DNA Damage by gamma -Radiation or Camptothecin in Schizosaccharomyces pombe. J. Biol. Chem.
277: 4050-4055
[Abstract]
[Full Text]
-
Nagy, P. L., Griesenbeck, J., Kornberg, R. D., Cleary, M. L.
(2001). A trithorax-group complex purified from Saccharomyces cerevisiae is required for methylation of histone H3. Proc. Natl. Acad. Sci. USA
10.1073/pnas.221596698v1
[Abstract]
[Full Text]
-
Wagner, M. J., Gogela-Spehar, M., Skirrow, R. C., Johnston, R. N., Riabowol, K., Helbing, C. C.
(2001). Expression of Novel ING Variants Is Regulated by Thyroid Hormone in the Xenopus laevis Tadpole. J. Biol. Chem.
276: 47013-47020
[Abstract]
[Full Text]
-
Choy, J. S., Tobe, B. T. D., Huh, J. H., Kron, S. J.
(2001). Yng2p-dependent NuA4 Histone H4 Acetylation Activity Is Required for Mitotic and Meiotic Progression. J. Biol. Chem.
276: 43653-43662
[Abstract]
[Full Text]
-
Nourani, A., Doyon, Y., Utley, R. T., Allard, S., Lane, W. S., Cote, J.
(2001). Role of an ING1 Growth Regulator in Transcriptional Activation and Targeted Histone Acetylation by the NuA4 Complex. Mol. Cell. Biol.
21: 7629-7640
[Abstract]
[Full Text]
-
Nagashima, M., Shiseki, M., Miura, K., Hagiwara, K., Linke, S. P., Pedeux, R., Wang, X. W., Yokota, J., Riabowol, K., Harris, C. C.
(2001). DNA damage-inducible gene p33ING2 negatively regulates cell proliferation through acetylation of p53. Proc. Natl. Acad. Sci. USA
10.1073/pnas.161151798v1
[Abstract]
[Full Text]
-
Yochum, G. S., Ayer, D. E.
(2001). Pf1, a Novel PHD Zinc Finger Protein That Links the TLE Corepressor to the mSin3A-Histone Deacetylase Complex. Mol. Cell. Biol.
21: 4110-4118
[Abstract]
[Full Text]
-
Park, J., Kunjibettu, S., McMahon, S. B., Cole, M. D.
(2001). The ATM-related domain of TRRAP is required for histone acetyltransferase recruitment and Myc-dependent oncogenesis. Genes Dev.
15: 1619-1624
[Abstract]
[Full Text]
-
Chen, L., Matsubara, N., Yoshino, T., Nagasaka, T., Hoshizima, N., Shirakawa, Y., Naomoto, Y., Isozaki, H., Riabowol, K., Tanaka, N.
(2001). Genetic Alterations of Candidate Tumor Suppressor ING1 in Human Esophageal Squamous Cell Cancer. Cancer Res.
61: 4345-4349
[Abstract]
[Full Text]
-
Scott, M., Boisvert, F.-M., Vieyra, D., Johnston, R. N., Bazett-Jones, D. P., Riabowol, K.
(2001). UV induces nucleolar translocation of ING1 through two distinct nucleolar targeting sequences. Nucleic Acids Res
29: 2052-2058
[Abstract]
[Full Text]
-
Scott, M., Bonnefin, P., Vieyra, D., Boisvert, F.-M., Young, D., Bazett-Jones, D. P., Riabowol, K.
(2001). UV-induced binding of ING1 to PCNA regulates the induction of apoptosis. J. Cell Sci.
114: 3455-3462
[Abstract]
[Full Text]
-
Halbach, T., Scheer, N., Werr, W.
(2000). Transcriptional activation by the PHD finger is inhibited through an adjacent leucine zipper that binds 14-3-3 proteins. Nucleic Acids Res
28: 3542-3550
[Abstract]
[Full Text]
-
Loewith, R., Smith, J. S., Meijer, M., Williams, T. J., Bachman, N., Boeke, J. D., Young, D.
(2001). Pho23 Is Associated with the Rpd3 Histone Deacetylase and Is Required for Its Normal Function in Regulation of Gene Expression and Silencing in Saccharomyces cerevisiae. J. Biol. Chem.
276: 24068-24074
[Abstract]
[Full Text]
-
Wang, X., Yeh, S., Wu, G., Hsu, C.-L., Wang, L., Chiang, T., Yang, Y., Guo, Y., Chang, C.
(2001). Identification and Characterization of a Novel Androgen Receptor Coregulator ARA267-alpha in Prostate Cancer Cells. J. Biol. Chem.
276: 40417-40423
[Abstract]
[Full Text]
-
Nagashima, M., Shiseki, M., Miura, K., Hagiwara, K., Linke, S. P., Pedeux, R., Wang, X. W., Yokota, J., Riabowol, K., Harris, C. C.
(2001). DNA damage-inducible gene p33ING2 negatively regulates cell proliferation through acetylation of p53. Proc. Natl. Acad. Sci. USA
98: 9671-9676
[Abstract]
[Full Text]
-
Nagy, P. L., Griesenbeck, J., Kornberg, R. D., Cleary, M. L.
(2002). A trithorax-group complex purified from Saccharomyces cerevisiae is required for methylation of histone H3. Proc. Natl. Acad. Sci. USA
99: 90-94
[Abstract]
[Full Text]
-
Kawaji, H., Schonbach, C., Matsuo, Y., Kawai, J., Okazaki, Y., Hayashizaki, Y., Matsuda, H.
(2002). Exploration of Novel Motifs Derived from Mouse cDNA Sequences. Genome Res
12: 367-378
[Abstract]
[Full Text]