Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 3831-3842, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Two Distinct Notch1 Mutant Alleles Are Involved in the
Induction of T-Cell Leukemia in c-myc Transgenic Mice
C. D.
Hoemann,1,
N.
Beaulieu,1,
L.
Girard,1,§
N.
Rebai,1 and
P.
Jolicoeur1,2,3,*
Laboratory of Molecular Biology, Clinical
Research Institute of Montreal, Montreal, Quebec H2W
1R7,1 Department of Microbiology and
Immunology, Université de Montréal, Montreal, Quebec H3C
3J7,2 and Experimental Medicine,
McGill University, Montreal, Quebec H3G 1A4,3
Canada
Received 29 November 1999/Returned for modification 8 January
2000/Accepted 10 February 2000
 |
ABSTRACT |
We have previously characterized a large panel of provirus
insertion Notch1 mutant alleles and their products arising
in thymomas of MMTVD/myc transgenic mice. Here, we show
that these Notch1 mutations represent two clearly distinct
classes. In the first class (type I), proviral integrations were
clustered just upstream of sequences encoding the transmembrane domain.
Type I Notch1 alleles produced two types of mutant
Notch1 RNA, one of which encoded the entire Notch1
cytoplasmic domain [N(IC)] and the other of which encoded a soluble
ectodomain [N(EC)Mut] which, in contrast to the processed
wild-type ectodomain [N(EC)WT], did not reside at the
cell surface and became secreted in a temperature-dependent manner. A
second, novel class of mutant Notch1 allele (type II)
encoded a Notch1 receptor with the C-terminal PEST motif deleted
(
CT). The type II Notch1
CT protein was expressed as a
normally processed receptor [N(EC)WT and
N(IC)
CT] at the cell surface, and its ectodomain was
found to be shed into the extracellular medium in a temperature- and
calcium-dependent manner. These data suggest that both type I and type
II mutations generate two structurally distinct Notch1 N(EC) and N(IC)
proteins that may participate in tumor formation, in collaboration with the c-myc oncogene, through distinct mechanisms.
Constitutive type I N(IC) and type II N(IC)
CT expression
may enhance Notch1 intracellular signaling, while secreted or shed type
I N(EC)Mut and type II N(EC) proteins may differentially
interact in an autocrine or paracrine fashion with ligands of Notch1
and affect their signaling.
 |
INTRODUCTION |
Members of the Notch receptor family
are transmembrane glycoproteins, which have been implicated in the
mechanisms of differentiation, transformation, dementia, and stroke
(reviewed in references 1, 6, 9, 18, and
19). In mammals, there are four identified members
of this family, which display highly similar structures. The
extracellular domain encodes tandem extracellular epidermal growth
factor (EGF) repeats and a cysteine-rich region called the Notch/lin-12
repeat. The cytoplasmic domain of each family member harbors six
ankyrin repeats, as well as a C-terminal PEST motif. The Notch protein
and many of its identified signaling partners are conserved from
Drosophila to humans. Genetic studies on Notch
activation in Drosophila (25, 34),
Caenorhabditis elegans (38), and
Xenopus (11) have collectively suggested that
removal of the Notch extracellular domain results in a dominant gain-of-function Notch allele. Similar truncated NOTCH1
alleles have been discovered in sporadic human (2, 14), and
retrovirally-induced mouse (16, 17) T-cell leukemias. In
addition, in vitro transformation of T cells and fibroblasts has been
achieved using various engineered forms of cytoplasmic Notch1 (2,
3, 10, 31). Altogether, these data have given rise to the notion
that a constitutively active intracytoplasmic Notch1 protein, N(IC),
can operate as an oncoprotein, which has been most frequently observed
in T cells.
It is important to fully understand the structure of the Notch1
receptor, in order to predict how the receptor will function in its
mutated form. Original studies of the Drosophila Notch receptor initially suggested that the mature Notch polypeptide is a 300-kDa glycoprotein, since antisera to the
extracellular and intracellular domains of Drosophila Notch
recognized a ~300-kDa protein that had affinity for several lectins
(20, 21). However, antisera that recognize the mammalian
Notch1 cytoplasmic domain have consistently detected two species of
Notch1 proteins by Western blot analysis: a ~330-kDa protein and
smaller polypeptides ranging from 110 to 89 kDa, depending on
the source of proteins (2, 7, 16, 21, 31, 37, 43). A
pulse-chase analysis of Notch1 and Notch2 posttranslational processing
has revealed that the 330-kDa precursor is rapidly cleaved to give rise
to the smaller cytoplasmic proteins (2, 16, 43). More
recently, Drosophila Notch (30), human Notch2
(7), and murine Notch1 (26) have been shown to be
proteolytically processed from a 330-kDa precursor to a 110-kDa
membrane-anchored cytoplasmic chain. Several lines of evidence have
suggested that the Notch1 precursor becomes cleaved by the convertase
furin at a consensus sequence, which occurs just N-terminal of two
conserved cysteines (C1675 and C1682) in the juxtamembrane
extracellular domain (22, 26). The resulting cleavage
products are believed to form a heterodimer comprising an extracellular
domain, N(EC), that is tethered to the cell via its association with
the 69-amino-acid extracellular stalk preserved in the cytoplasmic
subunit, N(IC). The physical nature of the heterodimer association is
not well understood, although the conserved cysteine residues in the
extracellular stalk of the cytoplasmic subunit are believed to play an
essential role (reviewed in reference 18). Moreover,
it has been recently shown that ligand-induced activation of Notch1 can
induce additional proteolysis of Notch1 on the cytoplasmic face near
the plasma membrane, which releases a shorter Notch1 cytoplasmic
subunit for interaction with downstream signaling partners
(36). The fate of the extracellular cleavage product from
the Notch1 precursor, however, has yet to be rigorously analyzed.
Our previous analysis of T-cell tumors arising in MMTVD/myc
transgenic (Tg) mice infected with murine leukemia virus (MuLV) revealed the presence of provirus insertional Notch1
mutations in 65 out of 110 characterized tumors (16, 17).
These tumors, and derived T-cell lines, had the potential to express a
unique array of spontaneously selected and presumably gain-of-function mutant Notch1 proteins. A majority of the integrations occurred in
genomic regions coding for sequences between the 34th EGF repeat and
the transmembrane (TM) domain, resulting in the production of what we
term here "type I" mutant Notch1 alleles (16,
17). The characterized insertion sites seemed to respect a window
of integration, implying that specific sequence requirements had to be
met for the oncogenic conversion of Notch1. Almost all of the tumors
with type I proviral insertions produced elevated levels of two
distinct types of truncated transcripts (16, 17). The 3- to
4-kb RNAs initiated at the integration site and terminated at the 3'
end of the gene and thus encoded the TM and cytoplasmic domains
[N(IC)]. Another class of transcripts, measuring 6 to 9 kb, appeared
to originate at the Notch1 promoter and terminate at the
integration site, thus having the capacity to encode only a truncated
Notch1 ectodomain [N(EC)Mut] (16, 17).
Practically every tumor bearing this type of rearranged Notch1 allele expressed an abundant 280-kDa protein, in
addition to a 330-kDa Notch1 precursor (16, 17). This
280-kDa protein was recognized in Western analyses by extracellularly
but not intracellularly directed anti-Notch1 antisera, suggesting that p280 could represent the Notch1 ectodomain (16).
Using an array of Notch1-specific RNA probes and
domain-specific Notch1 antisera, we have now tested the possibility
that the 280-kDa protein expressed in some of the type I tumors
was being produced from a truncated Notch1 RNA template. In
this analysis, we also report a second type of proviral integration
event in Notch1, which we refer to as the type II mutation.
This newly described cluster of integrations occurred within an
800-nucleotide span, at the C-terminus-encoding region of
Notch1. The resulting mutant alleles encoded all of the
Notch1 receptor sequence except for the C terminus, which harbors a
PEST domain. These data are the first to suggest that such a mutation
in Notch1 could be oncogenic. One Notch1 mutant
allele encodes a disassembled Notch1 receptor that is rendered ligand
independent (type I), and the other allele retains a receptor
structure capable of ligand interaction (type II). Our data suggest
that these two distinct Notch1 mutant alleles can
nonetheless cooperate with c-myc and accelerate the
appearance of thymomas in MMTVD/myc Tg mice.
 |
MATERIALS AND METHODS |
Construction of full-length Notch1 and mutant
Notch1 derivatives in expression vectors.
A PCR
product corresponding to nucleotides +1 to +565 (using the base pair
coordinates of a published complete murine Notch1 cDNA
sequence, mmnotcha [GenBank]) was used to screen a
-ZAP, random-primed murine spleen cDNA library (Stratagene) for
Notch1 5' cDNA sequences, from which clone N1c5 (bp
105 to
+406) was isolated after automatic excision (the methods were those
specified by Stratagene). Clone N1c27 (bp +256 to +3521) was isolated,
using the same PCR probe, from a
-ZAP murine embryonic kidney
18-day-postcoitum random-primed cDNA library (from J. Pelletier, McGill
University). Partial sequencing of each cDNA clone revealed 99%
homology to mmnotcha (GenBank), with several silent mutations, except
for N1c27, which had a TAT
CAT change (Y
H, codon 75). The
full-length murine Notch1 (Notch8.0) cDNA was constructed by
ligating the SmaI-DraIII fragment of N1c5 (+50 to
+274), the DraIII-ClaI fragment of N1c27 (+274 to
+2801), the ClaI-BclI fragment of plasmid pMN4.0 (+2801 to +5553), (33), and the
BclI-EcoRI fragment of pKS Motch (+5553 to +8054)
(23). The N
ANK plasmid was derived from
Notch8.0 by religating a blunt-end NcoI (+5618) to the
EcoRV (+6368) site, which deleted amino acids 1848 to 2097. Both Notch8.0 and N
ANK were subcloned into a modified
pcDNA3 vector, pcDNA3puro, in which the neomycin resistance gene was
replaced with the puromycin resistance gene by exchanging the
SmaI-BsmI fragment of pcDNA3 (Invitrogen) with a
fragment harboring the puromycin resistance gene from pBabepuro
(28) and a simian virus 40 polyadenylation sequence. The
N(EC)Nar plasmid was derived from pcDNA3-Notch8.0 by
digestion with NarI and religation of a linearized DNA which
retained the vector and 1,651 amino acids (aa) of the Notch1
ectodomain. The N(EC)Stu clone was generated by subcloning
an EcoRI-StuI fragment from Notch8.0 into
pcDNA3(neo), which included 1,468 aa of the 36 Notch1 EGF repeats. The
N
CT plasmid was generated by introducing a stop codon at
the HindIII site (aa 2293) of full-length Notch8.0. The
integration sites for T28853, L48, T28840, T14418, T14469, T30966, and
T3465 were determined by sequencing the chimeric Notch1-proviral PCR
product obtained with tumor or cell line genomic DNA, using sense
primer 232 (GCTTATGAATTTCACCGTGGGTG at bp 6925 of Notch1 cDNA) and antisense primer 110 from the U3 region of the MuLV LTR, or
antisense primer 231 (GAGGAAAGTGGGCTCTGGCAC at bp 7536 of
Notch1 cDNA) and sense primer 112 from the U3 region, or sense primer
541 (GAGTGATTGACTACCCGTCAG) from the U5 region of MuLV long
terminal repeat (LTR) and antisense primer 540 (GCATCCCACATCTCTGTTTA at bp 7691 of Notch1 cDNA), as
previously described (16).
Cell transfection and cell culture.
Isolation and
propagation of T-cell lines L42, L45, L46, L48, and L96 have been
previously described (16). Lymphocytes were maintained in
RPMI 1640 containing 10% fetal bovine serum (Hyclone) and 5 × 10
5 M
-mercaptoethanol at 37°C under 5%
CO2. Plasmid DNA was transfected transiently or stably into
293T cells by the calcium phosphate precipitation method, as previously
described (5). Individual, stable clones of 293T cells
expressing full-length Notch1 (Notch8.0), N
ANK,
N(EC)Nar, or pcDNA3puro vector were obtained by selecting
colonies after culturing for 2 weeks in 5 µg of puromycin per ml in
Dulbecco's minimal essential medium containing 10% fetal calf serum
(HyClone). Pools of 293T cells expressing N(EC)Stu or
pcDNA3(neo) vector were obtained through selection in 400 µg of G418
per ml for 2 weeks.
Protein extraction and Western blotting.
For Western blot
analysis, cells were rinsed twice in 4°C phosphate-buffered saline
(PBS) and lysed directly into RIPA buffer (10 mM Tris [pH 7.5], 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate [SDS],
1.0% sodium desoxycholate) with protease inhibitors (2 µg
of aprotinin per ml, 2 µg of leupeptin per ml, 1 µg of pepstatin
per ml, 50 µg of 1-chloro-3-tosylamido-7-amino-L-2-heptanone (TLCK) per ml, 100 µg of phenylmethylsulfonyl fluoride per ml). Extracts were cleared by centrifugation at 150,000 × g
for 30 min. Protein extracts were mixed with double-strength SDS sample buffer with dithiothreitol or
-mercaptoethanol, boiled for 5 min, subjected to SDS-polyacrylamide gel electrophoresis (PAGE) using 6% acrylamide gels, and transferred to nylon membranes. Protein
molecular mass standards including thyroglobulin (~330 kDa) and
myosin (205 kDa) were purchased from Sigma (SDS-6H) and Bio-Rad.
Filters were blocked with 5% milk powder in TBST (10 mM Tris [pH
7.5], 150 mM NaCl, 0.1% Tween 20) and then probed with primary
antiserum in 0.5% milk powder in TBST. The generation and
characterization of Notch1-specific antisera, extra-2, extra-1, intra-1, and intra-2, has been described previously (16).
Immunodetection was performed using secondary horseradish
peroxidase-conjugated anti-rabbit antiserum (Sigma A0545) followed by
chemiluminescent detection (Amersham). After primary Western analyses,
blots were incubated in stripping buffer (62.5 mM Tris [pH 6.8], 100 mM
-mercaptoethanol, 2% SDS) for 1 h at 50°C and then
reanalyzed with another antiserum. All the resulting autoradiographs
were scanned with HP Deskscan II and reproduced for
publication using Powerpoint (Microsoft) software.
Trypsinization of cells.
Cells (5 × 107)
from each cell line were rinsed in 37°C RPMI, separated into five
aliquots for each condition, and incubated for 15 min at 37°C in 5 ml
of RPMI containing 0, 0.1, 1, 10, or 100 µg of trypsin per ml. The
cells were pelleted and then rinsed twice in 4°C PBS containing
phenylmethylsulfonyl fluoride. Final cell pellets were lysed in 250 µl of RIPA buffer containing protease inhibitors. Equal volumes of
each lysate were combined with double-strength SDS sample buffer,
boiled for 5 min, loaded onto 6% acrylamide-SDS gels, and analyzed by
Western blotting with anti-Notch1 antisera.
Notch1 ectodomain dissociation assay.
T lymphocytes (3 × 107 for each condition) were briefly rinsed twice in
room temperature PBS and then incubated for 10 min in 250 µl of PBS
at 37 or 4°C or 250 µl of PBS with 1 mM EGTA at 4°C. Transiently
transfected 293T cells (2 × 106) (48 h
posttransfection) were rinsed twice in room temperature PBS and then
incubated for 10 min in 100 µl of PBS at 37 or 4°C. After 10 min,
the cells were pelleted in a desktop microcentrifuge for 15 s. The
supernatant was recovered, and the cell pellet was lysed in RIPA buffer
containing protease inhibitors. The supernatant was recentrifuged at
150 × g for 30 min at 4°C, and the pellet was
discarded. Equal volumes of each sample were subjected to Western
analysis with extra-1 antiserum as described above. The blots were then
stripped, reprobed with anti-gp70 followed by horseradish
peroxidase-conjugated anti-goat (Sigma) antiserum, and subjected to
chemiluminescent detection. The film was scanned and processed for
publication using the software mentioned above.
 |
RESULTS |
Many type I insertional Notch1 mutant alleles produce
truncated Notch1 ectodomain proteins, N(EC)Mut, from
truncated RNA and not from processing.
Our analysis of tumors
harboring type I Notch1 mutations revealed that some tumors
which expressed high levels of truncated 5' Notch1 RNA and
no full-length Notch1 transcripts also produced elevated levels of
~280-kDa proteins. This suggested that some of the 280-kDa proteins
made in these tumors were produced from a truncated Notch1
RNA template and represented a mutated Notch1 ectodomain
[N(EC)Mut]. If tumors harboring type I integrations
expressed and secreted N(EC)Mut proteins, this could have a
potential impact on the transformation mechanism by Notch1. We
therefore conducted experiments to test whether N(EC)Mut
proteins were expressed, if they resided in a secretory
compartment, and whether they became secreted. This analysis was
rendered more complicated by the fact that the normal Notch1 receptor,
which was retained as an unrearranged allele in most type I tumors, was
processed into an ectodomain [N(EC)WT] and an
intracytoplasmic domain [N(IC)WT].
N(EC)WT proteins would be expected to have an almost
identical structure to N(EC)Mut proteins encoded by the
truncated Notch1 RNAs detected in type I tumors. Two tumor
cell lines, L96 and L45, were therefore critical in analyzing the
putative N(EC)Mut proteins, since these lines harbored
distinct type I integrations and abundant, truncated Notch1
5' RNAs (16) (Fig. 1). Both
cell lines were subjected to a Western analysis, using four antisera (16) that have been previously shown to specifically
recognize extra- and intracellular epitopes of Notch1 (Fig.
2).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of type I and type II provirus
insertional Notch1 mutant alleles with their encoded
truncated 5' transcripts and proteins in T-cell tumors arising in
MMTVD/myc Tg mice. (A) Simple schematic of the wild-type
processed Notch1 receptor at the cell membrane in absence of ligand
binding. Cleavage of the molecule has occurred, and the extracellular
and intracellular fragments form a complex (vertical double thin
lines). Encoded domains are represented: EGF, EGF repeats; NLR,
Notch-Lin12 repeats; TM, transmembrane domain; ANK, ankyrin repeats;
OPA and PEST, motifs; out, extracellular; in, intracellular. (B) Two
distinct clusters of proviral integrations were observed within the
middle and C-terminal portions of the Notch1 gene.
Mutational insertions were found in tumors (T) and cell lines (L). Type
I insertions have been previously mapped (16, 17). Introns
are not necessarily drawn to scale, and exons are arbitrarily numbered.
PCR and sequencing analysis of exon I between the
HindIII site and C terminus revealed no introns.
Symbols: thin line, introns; open rectangles, exons; vertical arrows,
sites of provirus integration; horizontal arrows, transcriptional
orientation of provirus 5' to 3'. Restriction sites: B,
BamHI; Bg, BglII; H, HindIII; K,
KpnI; P, PstI; Pv, PvuII; RV,
EcoRV; S, SacI. (C) Notch1 cDNA, with
encoded domains as in panel A; black oval, furin cleavage consensus
sequence. The fragments used for DNA probes (thick lines) and for
raising antibodies (double bars) are indicated. Restriction sites are
the same as in panel B; also N, NarI; St, StuI.
(D) Schematic of truncated Notch1 transcripts (thick lines)
detected in distinct T-cell lines with their corresponding primary
translational products (16, 17). L42 cells harbor no
rearrangement in Notch1, while L45 and L96 cells harbor type
I Notch1 mutation. The molecular masses of transcripts (in kilobases)
and the number of amino acids in Notch1 are indicated. Symbols: LTR,
MuLV LTR; AAAAA, poly(A) tail; triple bar, nonsense coding regions from
the LTR region. The normally processed p280 N(EC)WT and
p110 N(IC)WT products from the full-length precursor are
not illustrated in this section but are shown in panel A.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Western blot analysis of Notch1 proteins produced by
T-cell lines harboring type I Notch1 proviral integrations, compared
with full-length and truncated Notch1 receptors ectopically expressed
in 293T cells. RIPA cell lysates were subjected to 6% acrylamide
SDS-PAGE followed by Western blot analysis using anti-extra-1 (A),
anti-extra-2 (B), anti-intra-1 (C), or anti-intra-2 (D) antibodies. The
source of protein for individual samples is marked above each lane and
includes the following: 293T cells (lane 1) and 293T cells ectopically
expressing full-length Notch1 (clone Notch8.0) (lanes 2 and 10) or
mutant N CT (lane 3), N ANK (lane 4),
N(EC)Nar (lane 5), or N(EC)Stu (lane 6) or
T-cell line L42 (lane 7) (wild type [WT] harboring no
Notch1 rearrangement), L96 (lane 8), or L45 (lane 9) (both
harboring type I proviral insertions in Notch1). The symbols
denoting the various Notch1 proteins are indicated in the figure.
|
|
L96 cells were previously shown to express a truncated 6-kb
Notch1 5' RNA and no full-length Notch1 transcripts
(
16) (Fig.
1D). By Western analysis, L96 cells expressed an
abundant ~275-kDa
protein that was recognized by extra-1 (Fig.
2A,
lane 8; also
see Fig.
7), as well as extra-2 (Fig.
2B, lane 8), but by
neither
of the two antisera recognizing intracellular epitopes
(Fig.
2C
and D, lanes 8). This p275 protein could therefore have been
derived
only from the truncated 6-kb
Notch1 RNA. L45 cells
were previously
shown to express both full-length
Notch1 8- and 10-kb RNA and,
in addition, a 5-kb truncated
Notch1 5'
RNA (
16) (Fig.
1D).
L45 cells expressed a ~280-kDa protein
that was detected with
extra-1 and extra-2 (Fig.
2A and B, lanes 9).
This 280-kDa protein
comigrated with the wild-type processed 280-kDa
ectodomain [N(EC)
WT] produced by L42 cells, which carry
no Notch1 rearrangements
(
16), and most probably arose from
the full-length
Notch1 transcripts.
In addition, L45 cells
expressed a unique ~250-kDa protein that
was detected with extra-2
antiserum (Fig.
2B, lane 9) and, more
importantly, undetected with
extra-1 antiserum (Fig.
2A, lane
9). The coding potential of the 5-kb
Notch1 transcript in L45
cells terminated prior to the
extra-1 epitopes (Fig.
1D). A similar
~250-kDa protein was
detected in protein extracts of thymoma
T28860,
which carried a
proviral integration close to that of L45 cells
(data not shown).
Collectively, these data indicated that N(EC)
Mut proteins
were stably produced from truncated 5'
Notch1 RNAs in
independent T cells or thymomas (see Fig.
7).
The molecular mass (~250 to 280 kDa) of the truncated
N(EC)
Mut or processed N(EC)
WT ectodomain
proteins was much larger than the expected mass of
these proteins
(~215 kDa or less, in the absence of posttranslational
modifications). Therefore, we constructed two distinct truncated
Notch1 cDNAs, N(EC)
Nar and N(EC)
Stu,
which had roughly the same coding potential as the type I mutated
Notch1 5' RNAs to generate an internal molecular weight
marker
for the Notch1 ectodomain in our SDS-PAGE system.
N(EC)
Nar encoded the whole 1,651-aa ectodomain preceding
the furin cleavage
site at aa 1654. N(EC)
Stu encoded the 36 EGF repeats (1,468 aa). Each construct was transiently
expressed in
293T cells, which express very low levels of the
endogenous Notch1
receptor, and the resulting translation products
were analyzed by
Western blotting (Fig.
2). The protein produced
by N(EC)
Nar
migrated at ~275 kDa (lane 5), whereas the protein produced by
N(EC)
Stu (lane 6) migrated faster at ~250 kDa (Fig.
2A
and B). Although
the C terminus of the N(EC)
Stu protein
harbored only part of the extra-1 epitopes, the protein
was still
detected with extra-1 antiserum (Fig.
2A, lane 6). The
molecular masses
(~250 to 280 kDa) of the proteins produced by
the mutated alleles in
tumors with a type I insertion and by in
vitro-constructed
Notch1 deletion mutants were in agreement, reinforcing
the
notion that the ~250- to 280-kDa N(EC)
Mut proteins
detected in type I tumors originated from the 5'-truncated
RNAs.
To summarize, our Western analysis indicated that the Notch1
ectodomain could be generated by quite different mechanisms:
by
normal processing of wild-type Notch1 precursor, or from truncated
RNAs
produced by type I mutant
alleles.
In contrast to the processed 280-kDa N(EC)WT proteins,
the mutant truncated N(EC)Mut proteins are not located on
the cell surface and reside in the secretory compartment.
From the
predicted translation products of the truncated Notch1 5'
RNAs, it appeared likely that the N(EC)Mut proteins would
be secreted. The predicted coding sequence for these
N(EC)Mut proteins included a signal recognition (leader)
sequence, which should route these proteins to the secretory pathway.
However, these truncated proteins had no TM sequence and would not be
expected to lodge in the plasma membrane. We therefore tested whether
the N(EC)Mut proteins detected in L96 and L45 cells
(harboring the type I Notch1 mutation) resided on the cell
surface by treating live cells with increasing amounts of trypsin and
then performing a Western analysis. In comparison, we analyzed the
trypsin sensitivity of the normally processed Notch1 receptor
[N(EC)WT] in L42 cells, which do not harbor an
insertional Notch1 mutation. Probing of the resulting
immunoblots with extra-1 revealed that p280 N(EC)WT in L42
cells became progressively degraded with increasing amounts of trypsin
(Fig. 3A, upper panel). This suggested
that nearly all of the processed Notch1 ectodomain detected in L42
cells existed as an assembled receptor at the cell surface. In support
of this notion, the p110 N(IC) subunit and Notch1 precursor remained
trypsin resistant (Fig. 3A, lower panel). These results were consistent with earlier results (7, 26) showing that extracellular
cleavage of the Notch1 precursor occurs before or simultaneously with
the export of the processed Notch1 receptor to the cell surface.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis of Notch1 proteins after trypsin
treatment of live T cells. The T-cell lines chosen for this analysis
include two lines with type I mutation, L45 (B) and L96 (D), and one
line with type II mutation, L48 (E). Controls include L42 (A) (wild
type [WT], no Notch1 rearrangement) and 293T cells
expressing N(EC)Stu as the molecular mass standard (C). The
same number of cells (~107) was used for each trypsin
condition. Cells were washed once with RPMI medium without serum at
37°C and then incubated for 15 min at 37°C in RPMI without trypsin
(lanes 1 and 6) or with trypsin at 0.1 µg/ml (lane 2), 1 µg/ml
(lane 3), 10 µg/ml (lane 4), or 100 µg/ml (lane 5). The cells were
washed twice at 4°C in PBS with trypsin inhibitor and immediately
lysed in RIPA buffer with protease inhibitors for subsequent Western
blot analysis. Immunoblots were first processed with extra-1 (A and D)
or extra-2 (B, C, and E) antiserum (upper panel). The blots were then
stripped of antisera and reprobed with intra-1 antiserum (lower panel).
Symbols for immunoreactive bands are as shown in Fig. 2.
|
|
In contrast, the ~p275 truncated N(EC)
Mut in L96 cells
appeared to be trypsin resistant (Fig.
3D, upper panel). Furthermore,
in L45 cells, the mutant ~p250 N(EC)
Mut was also trypsin
resistant, even though the p280 N(EC)
WT from the processed
Notch1 receptor was trypsin sensitive (Fig.
3B, upper panel). Taken
together, these results suggested that
the truncated
N(EC)
Mut proteins are not exposed to the external surface
of the plasma
membrane and therefore most probably reside in the
secretory
pathway.
To test whether the truncated ~p275 N(EC)
Mut proteins
become secreted, we performed an in vitro assay by incubating live L96
cells in PBS at 37 or 4°C for 15 min and then analyzing the PBS
supernatant for the appearance of p275. When live L96 cells were
incubated at 37°C but not 4°C, the ~p275 N(EC)
Mut
proteins appeared in the PBS medium (Fig.
4C). Reprobing of the
Western membrane
with intra-1 showed that no N(IC) was released
into the PBS medium
under any conditions tested (data not shown).
Since the truncated
N(EC)
Mut proteins expressed in L96 cells were not membrane
associated
(trypsin resistant, Fig.
3D), their presence in the
L96-conditioned
PBS medium suggests that they have been secreted.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analysis of the Notch1 ectodomain released
in the medium of T-lymphocyte lines and transiently transfected 293T
cells. Cells tested include one line with type I mutation, L96 (C), and
one line with type II mutation, L48 (B). Controls were cells from line
L42 (A) (wild type [WT], no Notch1 rearrangement), as well as 293T
cells transiently transfected with an expression vector harboring
full-length Notch1 (Notch8.0) (D), N CT (E), or
expression vector alone (F). Cells (3 × 107) were
incubated for 10 min in PBS at 37°C (lanes 1), in PBS at 4°C (lanes
2), or in PBS plus 1 mM EGTA at 4°C (lanes 3). For transiently
transfected cells, one 100-mm petri dish of cells was transfected with
5 µg of plasmid vector DNA. Two days after transfection, the cells
were divided into two aliquots and incubated for 15 min in PBS at
either 4 or 37°C, as indicated. After incubation, cells were
separated from the supernatants by low-speed centrifugation
(1,000 × g) and the supernatants were cleared with a
30-min high-speed centrifugation (150,000 × g). The
supernatants were analyzed by Western blotting with extra-1 antiserum
(top panel) or with anti-gp70 envelope protein (bottom panel). The cell
pellets were extracted with RIPA and analyzed by Western blotting with
extra-1 antiserum as a control for the number of cells (middle
panel).
|
|
A second class of Notch1 mutant alleles (type II)
detected in T-cell tumors carries provirus inserted at the 3' end of
the gene, resulting in truncation of 3'-end sequences.
Other
provirus integrations were previously detected downstream of the exon
encoding the TM domain but were not mapped precisely (16,
17). We have now mapped these 3'-end provirus integrations (type
II insertions) by Southern blot analysis with KpnI- or
EcoRV-digested tumor DNAs using probe K or Z (Fig. 1C), as
previously described (reference 16 and data not
shown). The positions and orientations of these newly mapped
integration sites are shown in Fig.
5. Further, the precise integration
sites in cell line L48 and in tumors T14418, T14469, T30966,
T28840, T28853, and T3465 were mapped by PCR and sequence analysis and
were found to occur between amino acids 2318 and 2462 (Fig. 5C). The
open reading frame of each mutant Notch1 allele was found to
terminate at a position corresponding to roughly 20 nonsense amino
acids after the integration site, in the U3 region of the MuLV LTR.
These provirus insertional mutations formed a distinct cluster, and
they represented 29% (19 out of 65) of the total provirus insertional
mutations detected in Notch1 (16, 17) (Table
1). These type II mutations always
occurred within the exon coding for the fifth and sixth ankyrin
repeats, prior to the PEST domain, resulting in a 3'-end truncation of the gene (Fig. 1 and 5). Thus, all of the mutated alleles ultimately conserved the cytoplasmic ankyrin repeats and the second putative nuclear localization signal (nls2) while deleting the C-terminal PEST
domain (
CT). Intriguingly, all of the type II integrations appeared
to be in the sense orientation (Fig. 5A), in contrast to the type I
integrations, which occurred in either polarity (16, 17).
Nearly all of the tumors harboring the 3'-end type II insertions
expressed abundant truncated 6.5- to 7.5-kb transcripts that could have
been produced only by the mutated Notch1 allele (Fig. 5B and
data not shown). This was specifically verified in cell line L48 by
Northern analysis, where a truncated 7.5-kb Notch1 transcript hybridized with probes derived from everywhere along the
cDNA (probes A, M, and K) (16) but not with a
probe (probe Z) covering the last 1,000 bp (data not shown). Therefore,
the 3'-end type II insertional mutations found in the Notch1
gene of a number of T-cell tumors are distinct from the type I
insertions previously found near the TM domain and are expected to
encode different gene products.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Schematic representation of type II proviral insertions
in the Notch1 gene 3' coding region (exon "I"). (A)
Horizontal arrows show the orientation of provirus integrations as
assessed by Southern blot analysis (arrowheads) or by PCR or sequencing
of genomic DNA (arrows). The PCR primers used within the MuLV LTR are
shown in Fig. 1B (see Materials and Methods). All other tumors were
predicted to have sense proviral integrations based on Southern blot
analysis, as previously described (16). (B) Schematic of
truncated Notch1 transcript detected in L48 cells harboring the type II
Notch1 mutation. (C) Carboxy terminus of type II mutant
Notch1 proteins predicted from the site of integration. The actual
translational stop signal occurred within 25 nonsense amino acids for
each protein, in the U3 region of the MuLV LTR. The PEST motif is
underlined. Symbols: *, C terminus of Notch1; vertical arrowheads,
the point at which a provirus interrupted the Notch1 open reading frame
for individual mutated Notch1 alleles.
|
|
The novel type II insertional Notch1 mutant alleles
code for C-terminally truncated Notch1 receptors with deletions of the
PEST domain, which become normally processed.
Our characterization
of the new cluster of type II integrations suggested that the encoded
mutant Notch1 protein could be a novel oncogenic form of Notch1. To
decipher the mutant Notch1 protein structure, we studied the T-cell
line L48 that we previously established (16) and that was
subsequently discovered to harbor a type II insertional
Notch1 mutation. We conducted a Western analysis of Notch1
proteins expressed in L48 cells. The L48 Notch1 precursor (Fig.
6A and B, lanes 7 and 12) appeared
truncated, migrating slightly faster (at ~320 kDa) than the wild-type
receptor (330 kDa) of L42 cells (lanes 3) or than the full-length
Notch1 receptor in 293T cells (lanes 11). This ~320-kDa precursor was not detected with intra-2 (which recognizes the C-terminal OPA domain)
(Fig. 6D, lane 12), indicating that the precursor lacked the C
terminus.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Western blot analysis of Notch1 proteins expressed by
thymomas harboring type II proviral integrations. Proteins from frozen
tumors or from cells in culture were extracted in RIPA buffer with
protease inhibitors and then subjected to Western analysis using
extra-1 (A), extra-2 (B), intra-1 (C), and intra-2 (D) antisera.
Approximately 80 µg of total extract was loaded in each lane.
Extracts were from control tumor cells with no detectable Notch1
integration, namely thymomas T28852 (lane 1) and T28849 (lane 2) and
cell line L42 (wild type [WT]) (lane 3) and from thymomas with type
II integration, including thymomas T30908 (lane 4), T30952 (lane 5),
T30940 (lane 6), and T30942 (lane 8) and one cell line, L48 (lanes 7 and 12). Other controls included 293T cells ectopically expressing
N CT (lane 9), N ANK (lane 10), and
full-length Notch1 (clone Notch8.0) (lane 11). The type II tumor
samples are presented from the most N-terminal (lane 4) to the most
C-terminal (lane 8) integration. Lane 7 in panel C (bracketed with
dotted lines) had a shorter exposure time. The p320 Notch1 precursor
was clearly visible on a longer exposure of this lane (not shown).
Symbols are the same as in Fig. 2. N(IC) CT proteins are
demarcated by a symbol on the right.
|
|
Two distinct N(IC) cytoplasmic cleavage products were detected in L48
cells with the intra-1 antiserum: p110, which probably
arose from the
unrearranged allele, and a much more abundant p89,
most probably
encoded by the mutant allele (Fig.
6C, lanes 7 and
12). The 89-kDa
protein was not recognized by intra-2 (Fig.
6D,
lane 12), suggesting
that this protein was a cytoplasmic Notch1
protein with a C-terminal
truncation [N(IC)
CT]. The L48 mutant
Notch1
allele also expressed a normal 280-kDa
ectodomain [N(EC)] (Fig.
6A
and B, lanes 7 and 12) that comigrated
with wild-type p280 found in the
control unrearranged cell line
L42 (lanes 3) and in transiently
transfected 293T cells expressing
full-length
Notch1 DNA
(lanes 11). These data suggested that the
abundant 280- and 89-kDa
proteins detected in L48 cells are the
processed N(EC) and
N(IC)
CT domains, respectively, generated from the
truncated precursor
(Fig.
7). These data
have been further supported by immunoprecipitation
and Western analysis
of L48 cell extracts, where immunoprecipitation
with an ankyrin
repeat-directed antiserum, intra-1, was capable
of coprecipitating
N(IC) with a 280-kDa protein (
16), the latter
of which was
recognized by extracellularly directed antisera (results
not shown).
Together, our data indicated that the C-terminal OPA
and PEST sequences
are not required for receptor processing.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
Summary of the data on Notch1 proteins studied. A
schematic structure for each protein is presented. Individual Notch1
proteins immunodetected in each cell line are listed, along with
epitopes present in or absent from each characteristic Notch1
protein, with their distinct molecular masses. The N(EC)WT
and N(IC)WT proteins have been reported to associate and to
form heterodimers (7, 26). Symbols are the same as in Fig.
1.
|
|
To determine whether other tumors harboring type II proviral insertion
mutations produced a mutant Notch1 receptor protein,
a Western analysis
was conducted on four thymomas with distinct
type II C-terminal
insertions (Fig.
5). The results of this analysis
(Fig.
6, lanes 4 to 6 and 8) were similar to those obtained for
L48 cells. The intra-1
antiserum detected truncated N(IC)
CT proteins that
ranged in molecular mass from ~70 to 90 kDa, in
good agreement with
the mapped integration sites (Fig.
5A). The
tumors also produced
a 110-kDa cytoplasmic Notch1 protein and
a 280-kDa
ectodomain, N(EC). The bulk of p280 could be predicted
to arise from
processing of the truncated Notch1 receptor. The
p110 most probably
corresponded to the processed N(IC) from the
unrearranged allele in the
tumor cells. The stromal cells and
multiclonal cells within the tumor
may also have expressed wild-type
Notch1 and thus contributed to the
signals observed at p280 and
p110. These data showed that the
3'-truncated
Notch1 alleles produced
fairly abundant levels
of processed, mutant Notch1
receptors.
To independently confirm the expression profile arising from the
C-terminally truncated Notch1 receptor, we constructed a
C-terminal
deletion mutant of the murine Notch1 receptor, N
CT,
deleting all sequences beyond the
HindIII site (Fig.
1B
and
5A), and analyzed the ectopically expressed proteins in 293T cells.
Simultaneously, as a control, we also analyzed a completely different
Notch1 deletion mutant in which the ankyrin repeats were missing
(N
ANK). The N
ANK mutation has been
previously characterized in
Drosophila as having
dominant
loss of function (
25,
34). High-level expression
of each
clone was achieved in either transient (Fig.
2, lanes
3 and 4; Fig.
6,
lanes 9 and 10) or stable (data not shown) transfection
of 293T cells,
which expressed very low levels of endogenous Notch1
(Fig.
2A, lane 1).
The N
CT and N
ANK constructs gave rise to
a truncated Notch1 precursor that was
recognized by both of the
extracellularly directed antisera and
one of each intracellularly
directed antisera (Fig.
2, lanes 3
and 4). Both N
CT and
N
ANK constructs gave rise to a processed 280-kDa N(EC)
that was recognized
by extra-2 and extra-1 but not by intra-1 or
intra-2 (lanes 3
and 4). As observed for ectopically expressed
full-length Notch1,
p280 appeared as a doublet in the Western blot of
293T cells expressing
the deletion mutants N
CT or
N
ANK when analyzed with anti-extra-1 (Fig.
2A, lanes 3 and 4), which
can recognize both murine and human Notch1 epitopes
(unpublished
observations). This p280 doublet was also observed for
ectopically
expressed full-length Notch1 (lane 2). These data suggested
that
high-level expression of ectopic processed Notch1 receptor, either
full-length or cytoplasmic deletion mutants, was augmenting and
stabilizing the expression of the endogenous human Notch1 receptor
in
293T cells. Of note, this apparent stabilization was not seen
with the
ectopically expressed N(EC)
Nar or N(EC)
Stu
proteins (lanes 3 and 4). The processed cytoplasmic domain produced
by
each deletion mutant was shorter (~80 to ~89 kDa) and lacked
the
deleted epitopes: N(IC)
ANK lacked intra-1
epitopes, and N(IC)
CT lacked intra-2 epitopes
(Fig.
2C and D, lanes 3 and 4; Fig.
6C,
lanes 9 and 10). Since each
construct gave rise to one species
of RNA in transfected cells (data
not shown), this ruled out the
possibility that an artifactual
alternative splicing of the transcript
produced from the cDNA
was somehow giving rise to the truncated
proteins. These results
strongly indicated that p280 and p80/89
corresponded to the normally
processed N(EC) and truncated N(IC)
subunits, respectively. Moreover,
these data demonstrated that
Notch1 receptor processing can occur in
the absence of the ankyrin
repeat or of the C-terminal
domain.
The processed 280-kDa N(EC) proteins generated from C-terminally
truncated type II mutant Notch1 precursor are expressed on the cell
surface, as are the N(EC)WT proteins.
As shown above,
the type II C-terminally truncated Notch1 receptors appeared to become
normally processed. To confirm that these receptors were expressed on
the cell surface, live L48 cells were treated with increasing amounts
of trypsin to degrade extracellular proteins, and the resulting
cellular proteins were analyzed by Western blotting with extra-1 or
intra-1. The results of this analysis revealed that processed p280
N(EC) protein expressed by L48 cells was progressively degraded by
increasing amounts of trypsin (Fig. 3E, upper panel). The C-terminally
truncated precursor, ~p320, and the truncated N(IC) subunit, p89,
remained trypsin resistant, as revealed by the stable presence of these proteins in the intra-1 immunoblot (Fig. 3E, lower panel). Iodination of cell surface proteins of L48 cells confirmed that the processed p280
resided on the cell surface, since the p280/N(EC) protein but not the
p320, p110, or p89 Notch1 proteins, became strongly iodinated (data not
shown). These data showed that the processed N(EC) resides at the cell
surface of L48 cells.
The processed Notch1 p280 type II ectodomain N(EC) proteins are
shed from transformed T lymphocytes, in a temperature-dependent and
calcium-sensitive manner.
It is likely that the proteolytic
cleavage that generates the Notch1 ectodomain, which we described as
p280 N(EC), occurs at an extracellular, juxtamembrane site of the
precursor (26). Our data are consistent with this argument,
since the molecular mass of the furin processed N(EC) protein (1,654 aa) was nearly identical to that of the truncated N(EC)Mut
produced in L96 cells (1,640 aa) and to that of the
N(EC)Nar mutant generated in vitro (1,651 aa). As a
strictly extracellular protein, it was possible that the processed
Notch1 ectodomain might be able to dissociate from the cell surface
under certain circumstances. To test this hypothesis, the supernatants
of Notch1-expressing cells were analyzed for shed p280 after incubation
under various conditions. Since Notch1 receptor adhesion is calcium
dependent (15), we chose to look for ectodomain dissociation
in PBS-1 mM EGTA at 4°C to test whether calcium could be mediating
the association of N(EC) with the cell surface. Incubation of the T
cells at 37°C with 1 mM EGTA provoked a high level of cell death, which precluded testing this condition. The cells were also incubated for 10 min in PBS at 37 or 4°C. The cell supernatants were analyzed by Western blotting for the release of processed N(EC) into the PBS
supernatant (Fig. 4).
Soluble p280 was released into the medium after cells were incubated at
37°C in PBS, regardless of whether the cells expressed
a full-length
Notch1 receptor (control L42 cells) (Fig.
4A, lane
1) or a C-terminally
truncated receptor (L48 cells) (Fig.
4B,
lane 1). Neither the Notch1
precursor nor the Notch1 cytoplasmic
domain was detected in the media
under any conditions, showing
that the cells were not simply becoming
lysed and releasing cellular
contents into the PBS (data not shown). We
showed above that practically
all of the processed Notch1 p280
expressed in L42 and L48 cells
was trypsin sensitive and thus present
at the cell surface (Fig.
3A and E). Therefore, the p280 found in the
PBS medium from L42
and L48 cells was likely to have been shed, not
secreted. Very
little p280 was released from the cells during a 4°C
incubation
(Fig.
4A and B, lanes 2), indicating that release of p280
from
the cells was temperature dependent. However, the addition of
EGTA
to the 4°C incubation resulted in a measurable release of
p280 from
both L42 and L48 cells (lanes 3). These data suggested
that a portion
of the p280 detected on the cell surface was bound
via a
calcium-sensitive interaction. Under all the conditions
tested, a large
portion of the immunoreactive p280 remained associated
with the cell
pellet (Fig.
4, middle panel). The differential
amounts of p280
released by the cells under the various conditions
were not seen for a
distinct viral protein that is constitutively
shed (
42), the
MuLV envelope gp70 protein (Fig.
4, bottom
panel).
The same assay was conducted on 293T cells transiently transfected with
full-length Notch1 (Notch8.0), C-terminally-truncated
Notch1
(N
CT), or expression vector alone. In all three groups
of cells incubated
at 37°C, but not at 4°C, the presence of p280 in
the medium could
be detected (Fig.
4D to F). Significantly, the
ectodomain of the
human Notch1 protein expressed endogenously by 293T
cells was
also observed to be released at 37°C (Fig.
4F, lane
1).
In summary, our data revealed that the processed Notch1 p280 N(EC)
generated from the wild-type ~p330 precursor or from the
type II
C-terminally truncated mutant ~p320 precursor behave similarly
and
are both released into the extracellular medium under physiological
conditions.
 |
DISCUSSION |
Two distinct Notch1 proviral insertional mutant alleles
are associated with the development of murine T-cell leukemia.
We
report here a comparative analysis of two distinct clusters of proviral
insertional mutations of the Notch1 gene separated by
approximately 20 kbp. One cluster, previously reported (16), occurred within a 3-kbp domain in the extracellular-encoding
region prior to the TM domain (type I), whereas the second newly
identified cluster occurred within an 800-bp segment of the exon coding
for the Notch1 C terminus (type II). Several features distinguish these
two types of insertional Notch1 mutants. First, in type I
mutants, the proviruses are inserted in both sense and antisense orientations around the TM-coding region, whereas in all 16 type II
C-terminal mutants analyzed, the provirus was integrated in the sense
orientation. This indicates a strong selection for such a sense
orientation of the provirus and suggests that the LTR may be required
to function as a promoter (promoter insertion), although the putative
1.3-kb 3'-end RNAs which could be synthesized from the LTR promoter
have not yet been detected. Second, the truncated cytoplasmic N(IC)
type I mutant proteins are synthesized from a truncated 3.5- to 4.0-kb
RNA, while the N(IC)
CT type II mutant proteins are
generated by receptor processing. Third, before any cytoplasmic
processing, the N(IC) mutant proteins produced from the type I mutant
alleles encode the TM domain and the complete cytoplasmic domain while
the N(IC)
CT type II mutant proteins harbor the
extracellular stalk, the TM domain, and the cytoplasmic domain with the
PEST motif deleted. Fourth, N(IC) type I mutant proteins are produced
constitutively under the regulation of a surrogate promoter (LTR or
cryptic, respectively, for sense and antisense provirus orientations), while N(IC)
CT type II C-terminally truncated mutant
proteins are made under the regulation of the Notch1
promoter itself. Finally, the N(EC)Mut truncated proteins
produced by type I mutant alleles are trypsin resistant and appear to
reside not at the cell surface but, rather, in the secretory pathway.
In contrast, the N(EC) proteins produced from the C-terminally
truncated type II mutant receptor appear to be normally processed and
expressed at the cell surface (trypsin sensitive). Therefore, type I
and type II Notch1 mutant proteins generated in this biological system
have very different structures.
Removal of PEST as a novel mechanism to activate Notch1
oncogenically.
C-terminal truncating mutations in
Notch1 or in other members of the mammalian Notch
family have not been previously reported. However, the type II
C-terminal truncations arising in our thymomas closely resemble the
Drosophila mutants N60g11 and
l(l)N3, both of which carry a deletion of the
Drosophila Notch OPA and PEST sequences (8, 27).
Excision of just the OPA domain, but not the PEST domain, from the
full-length Drosophila Notch receptor generates a protein
that behaves similarly to the wild-type receptor (25, 34).
The existing data would thus seem to indicate that removal of the PEST
domain, and not the OPA domain, is what gives rise to mutant Notch1
receptor activity. Controversy exists whether
l(l)N3 and N60g11 alleles
behave as gain-of-function mutations (4, 27) or not
(8). If N
CT behaved as a hypomorphic allele
in our system, a higher incidence of type II than type I mutations
might have been expected in a Notch1+/
-deficient background; however, we did
not observe such bias (Table 1) (17). Moreover, the
wild-type Notch1 allele is retained and expressed by tumors
harboring type II C-terminal insertions, suggesting that the
N
CT mutations behave as dominant alleles. In further
support of this argument, the evidence implicating Notch1 in
T-cell tumor formation is heavily biased toward the notion that
constitutive activation of Notch1 can give rise to an
oncogenic protein (2, 10, 13, 31). Based on the high
frequency of proviral integration within the Notch1 C
terminus in tumors arising in MMTVD/myc Tg mice, it is
arguable that type II N
CT alleles, like the truncated
N(IC) Notch1 mutants (2, 3, 14, 16, 17), are
gain-of-function mutations involved in tumor formation in collaboration
with the c-myc transgene.
There are several possible mechanisms by which C-terminally truncated
Notch1 mutants may participate in T-cell transformation.
It seems
logical to presume that deletion of the PEST sequences
could contribute
to the generation of an oncogenic form of Notch1.
Removal of the PEST
domain from the c-
fos proto-oncogene contributes
to its
oncogenic activation (
40). Deletion of PEST sequences
from
various proteins is known to stabilize and to augment their
levels
(reviewed in reference
35). This also appears to be
the
case with the Notch1 intracytoplasmic domain
[N(IC)
CT], since high levels of the C-terminally
truncated N(IC)
CT (89 kDa) were detected in L48 cells
and in other tumors harboring
C-terminal provirus integrations.
Furthermore, a previous pulse-chase
analysis of the mutant Notch1
receptor expressed in L48 cells
showed that the truncated
N(IC)
CT, p89, had a longer half-life than did the
coexpressed wild-type
p110 N(IC) protein (
16). From the
analysis of the various
Notch1 insertional mutants, it
appears that constitutively high levels
of N(IC) proteins are required
for transformation. This could
be achieved by overexpression of a
truncated
Notch1 3' end RNA
(type I mutations) or by
deletion of the PEST domain (type II
mutations). Thus, by seemingly
different mechanisms, two structurally
different mutant
Notch1 alleles may have the same final impact
on cytoplasmic
signaling.
It is also possible that deletion of the Notch1 C terminus could
influence Notch1 signaling apart from simply augmenting N(IC)
protein
levels. The region C-terminal of the ankyrin repeats is
known to
contain a binding site for the products of the
dishevelled (dsh) and the
numb genes. Dsh is a downstream
component of the
wingless signaling pathway, and Numb is an
asymmetrically localized
cell fate determinant. Both gene
products inhibit Notch signaling
by binding to its C-terminal domain
(
4), more specifically
its PEST domain in the case of Numb
(
41). Deletion of its Dsh
binding domain or its PEST domain
(binding Numb) allows Notch
to escape suppression by Dsh (
4)
or Numb (
41), respectively.
Moreover, ectopic expression of
the C-terminal Notch domain alone
in transgenic flies was sufficient to
suppress Dsh-dependent bristle
production, presumably by competitively
binding the inhibitory
Dsh protein from the wild-type Notch receptor
(
4). Since 100%
of the type II C-terminal integrations
analyzed here occurred
in the sense orientation, this opens the
possibility that 3' transcripts
are made from the LTR promoter and
actively produce C-terminal
Notch1 proteins. Such proteins would be
expected to bind to and
titrate out Dsh-like proteins and inhibit their
function, as reported
for
Drosophila (
4).
However, we have so far been unable to
detect such transcripts or
proteins in tumors or cells producing
type II C-terminally truncated
Notch1 receptors. Such short PEST-containing
Notch1 proteins could be
active at relatively low levels. Future
work should be performed to
determine whether this pathway is
involved in cell
transformation.
Fate of the wild-type and mutant Notch1 ectodomains.
Our
results with trypsinized T cells are consistent with a proposed model
suggesting that the Notch1 receptor precursor resides in a subcellular
compartment and that upon processing, the receptor transits to the cell
surface (7, 26, 30). It is furthermore possible that the
mutated N(IC) proteins have undergone additional processing events on
their cytoplasmic face, as has been observed by Kopan's group
(12, 22, 36). We have found that the truncated N(EC)Mut proteins remain trypsin resistant, even though
their structures closely resemble the processed p280
N(EC)WT subunit. These data suggest that stable expression
of the wild-type ectodomain at the cell surface can possibly be
achieved only with normal processing and subsequent association with
the N(IC) cytoplasmic subunit. Our coimmunoprecipitation analysis has
shown that a portion of the processed p280 N(EC)WT remains
associated with the intracellular N(IC) or N(IC)
CT
fragment, as a heterodimer (16). Since the Notch1 receptor with a deletion in the ankyrin repeat domain also produced the processed N(EC) and N(IC)
ANK subunits, it is likely that
this receptor also resides at the cell surface as an assembled
heterodimer. Our data therefore agree with the results obtained by
others with the wild-type Notch2 (7) and Notch1
(26) proteins and extend them to Notch1 receptors carrying
cytoplasmic deletions.
Another unusual property of the N(EC) proteins was observed in the
course of our dissociation assays. We found that under
physiological
conditions, the N(EC) proteins processed from wild-type
or C-terminally
truncated type II mutant precursors were shed
while
N(EC)
Mut generated from type I mutants were secreted at a
significant
rate in the medium of expressing cells (Fig.
4). Shedding
and
secretion occurred in a temperature-sensitive manner, and at least
a portion of the ectodomain released could be enhanced by the
chelation
of calcium ions from the medium. Shedding of N(EC) from
the type II
C-terminally truncated Notch1 receptor could give
rise to an uncoupled
cytoplasmic domain that would resemble previously
identified oncogenic
versions of Notch1 (
2,
10,
14,
16,
31). It is interesting
that the truncated Notch1 proteins produced
by type I alleles,
N(EC)
Mut and N(IC), are in fact the individual components
of a decoupled
Notch1 receptor as
well.
The notion that both Notch1 (Fig.
4) and its ligand Delta
(
32) may naturally shed their ectodomains in different
physiological
contexts adds another intriguing but complex facet to the
Notch
signaling cascade. It has recently been reported that soluble
forms of
Drosophila Delta are generated by cleavage at the
cell
surface and that these forms act as an agonist of Notch activity
(
32). In contrast, artificially truncated and secreted
ectodomain
from the Notch ligands Delta and Serrate were found to
antagonize
Notch signaling (
39). Similar truncation
mutations of the human
homologue of
Serrate,
Jagged
1, found in patients with Alagille
syndrome, are likely to yield
extracellular secreted forms and
to antagonize Notch1 signaling
(
24,
29). Together, these data
suggest that precise
processing of Delta is essential to producing
an agonist soluble form.
Since Notch and its ligand have the same
general structure, it is of
interest that the soluble forms of
the Notch ligands previously studied
are very similar to the soluble
forms of Notch1 ectodomain generated by
type I and type II mutations
in our system. If the same paradigm
applies for Notch as for its
ligands, the observed extracellular
shedding of the processed
N(EC) from type II tumors would be
expected to stimulate signaling
of the ligand(s) of Notch1, whereas
secretion of the truncated
N(EC)
Mut ectodomain
from type I tumors would be expected to antagonize
the signaling of the
ligand(s) of Notch1. Such an enhanced or
decreased signaling of
possibly more than one ligand of Notch1
distributed on the tumor cell
itself (autocrine effect) or on
other stromal cells (paracrine effect)
could somehow contribute
to the tumor development. This would represent
a new role for
the soluble Notch1 ectodomain in the complex mechanism
of tumor
formation.
 |
ACKNOWLEDGMENTS |
This work was supported by grants to P.J. from the Medical
Research Council of Canada and from the National Cancer Institute of Canada.
We thank Benoît Laganière and Ginette Massé for
excellent technical assistance. We are grateful to Jerry Pelletier
(McGill University) for providing the kidney cDNA library and
to Rita Gingras for typing the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Clinical
Research Institute of Montreal, 110 Pine Ave. West, Montreal,
Québec, Canada H2W 1R7. Phone: (514) 987-5569. Fax: (514)
987-5794. E-mail: jolicop{at}ircm.qc.ca.
Present address: BIOSYNTECH, Laval, Quebec, Canada H7V 4A7.
Present address: MethylGene, St. Laurent, Quebec, Canada H4S 2A1.
§
Present address: Hamon Center for Therapeutic Oncology Research, UT
Southwestern Medical Center, Dallas, TX 75235-8593.
 |
REFERENCES |
| 1.
|
Artavanis-Tsakonas, S.,
K. Matsuno, and M. E. Fortini.
1995.
Notch signaling.
Science
268:225-232[Abstract/Free Full Text].
|
| 2.
|
Aster, J.,
W. Pear,
R. Hasserjian,
H. Erba,
F. Davi,
B. Luo,
M. Scott,
D. Baltimore, and J. Sklar.
1994.
Functional analysis of the tan-1 gene, a human homolog of drosophila notch.
Cold Spring Harbor Symp. Quant. Biol.
59:125-136[Abstract/Free Full Text].
|
| 3.
|
Aster, J. C.,
E. S. Robertson,
R. P. Hasserjian,
J. R. Turner,
E. Kieff, and J. Sklar.
1997.
Oncogenic forms of NOTCH1 lacking either the primary binding site for RBP-Jkappa or nuclear localization sequences retain the ability to associate with RBP-Jkappa and activate transcription.
J. Biol. Chem.
272:11336-11343[Abstract/Free Full Text].
|
| 4.
|
Axelrod, J. D.,
K. Matsuno,
S. Artavanis-Tsakonas, and N. Perrimon.
1996.
Interaction between wingless and notch signaling pathways mediated by dishevelled.
Science
271:1826-1832[Abstract].
|
| 5.
|
Balsalobre, A., and P. Jolicoeur.
1995.
Fos proteins can act as negative regulators of cell growth independently of the fos transforming potential.
Oncogene
11:455-465[Medline].
|
| 6.
|
Blaumueller, C. M., and S. Artavanis-Tsakonas.
1997.
Comparative aspects of Notch signaling in lower and higher eukaryotes.
Perspect. Dev. Neurobiol.
4:325-343[Medline].
|
| 7.
|
Blaumueller, C. M.,
H. Qi,
P. Zagouras, and S. Artavanis-Tsakonas.
1997.
Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane.
Cell
90:281-291[CrossRef][Medline].
|
| 8.
|
Brennan, K.,
R. Tateson,
K. Lewis, and A. Martinez Arias.
1997.
A functional analysis of Notch mutations in Drosophila.
Genetics
147:177-188[Abstract].
|
| 9.
|
Campos-Ortega, J. A.
1996.
Numb diverts notch pathway off the tramtrack.
Neuron
17:1-4[CrossRef][Medline].
|
| 10.
|
Capobianco, A. J.,
P. Zagouras,
C. M. Blaumueller,
S. Artavanis-Tsakonas, and J. M. Bishop.
1997.
Neoplastic transformation by truncated alleles of human NOTCH1/TAN1 and NOTCH2.
Mol. Cell. Biol.
17:6265-6273[Abstract].
|
| 11.
|
Coffman, C. R.,
P. Skoglund,
W. A. Harris, and C. R. Kintner.
1993.
Expression of an extracellular deletion of Xotch diverts cell fate in Xenopus embryos.
Cell
73:659-671[CrossRef][Medline].
|
| 12.
|
De Strooper, B.,
W. Annaert,
P. Cupers,
P. Saftig,
K. Craessaerts,
J. S. Mumm,
E. H. Schroeter,
V. Schrijvers,
M. S. Wolfe,
W. J. Ray,
A. Goate, and R. Kopan.
1999.
A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain.
Nature
398:518-522[CrossRef][Medline].
|
| 13.
|
Diévart, A.,
N. Beaulieu, and P. Jolicoeur.
1999.
Involvement of Notch1 in the development of mouse mammary tumors.
Oncogene
18:5973-5981[CrossRef][Medline].
|
| 14.
|
Ellisen, L. W.,
J. Bird,
D. C. West,
A. L. Soreng,
T. C. Reynolds,
S. D. Smith, and J. Sklar.
1991.
TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms.
Cell
66:649-661[CrossRef][Medline].
|
| 15.
|
Fehon, R. G.,
P. J. Kooh,
I. Rebay,
C. L. Regan,
T. Xu,
M. A. T. Muskavitch, and S. Artavanis-Tsakonas.
1990.
Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila.
Cell
61:523-534[CrossRef][Medline].
|
| 16.
|
Girard, L.,
Z. Hanna,
N. Beaulieu,
C. D. Hoemann,
C. Simard,
C. A. Kozak, and P. Jolicoeur.
1996.
Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis.
Genes Dev.
10:1930-1944[Abstract/Free Full Text].
|
| 17.
|
Girard, L., and P. Jolicoeur.
1998.
A full-length Notch1 allele is dispensable for transformation associated with a provirally activated truncated Notch1 allele in Moloney MuLV-infected MMTV(D)/myc transgenic mice.
Oncogene
16:517-522[CrossRef][Medline].
|
| 18.
|
Greenwald, I.
1994.
Structure/function studies of lin-12/Notch proteins.
Curr. Opin. Genet. Dev.
4:556-562[CrossRef][Medline].
|
| 19.
|
Gridley, T.
1996.
Human genetics. Notch, stroke and dementia.
Nature
383:673[CrossRef][Medline].
|
| 20.
|
Johansen, K. M.,
R. G. Fehon, and S. Artavanis-Tsakonas.
1989.
The notch gene product is a glycoprotein expressed on the cell surface of both epidermal and neuronal precursor cells during Drosophila development.
J. Cell Biol.
109:2427-2440[Abstract/Free Full Text].
|
| 21.
|
Kidd, S.,
M. K. Baylies,
G. P. Gasic, and M. W. Young.
1989.
Structure and distribution of the Notch protein in developing Drosophila.
Genes Dev.
3:1113-1129[Abstract/Free Full Text]. (Erratum, 3:2020.)
|
| 22.
|
Kopan, R.,
E. H. Schroeter,
H. Weintraub, and J. S. Nye.
1996.
Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain.
Proc. Natl. Acad. Sci. USA
93:1683-1688[Abstract/Free Full Text].
|
| 23.
|
Kopan, R., and H. Weintraub.
1993.
Mouse notch: expression in hair follicles correlates with cell fate determination.
J. Cell Biol.
121:631-641[Abstract/Free Full Text].
|
| 24.
|
Li, L.,
I. D. Krantz,
Y. Deng,
A. Genin,
A. B. Banta,
C. C. Collins,
M. Qi,
B. J. Trask,
W. L. Kuo,
J. Cochran,
T. Costa,
M. E. Pierpont,
E. B. Rand,
D. A. Piccoli,
L. Hood, and N. B. Spinner.
1997.
Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1.
Nat. Genet.
16:243-251[CrossRef][Medline].
|
| 25.
|
Lieber, T.,
S. Kidd,
E. Alcamo,
V. Corbin, and M. W. Young.
1993.
Antineurogenic phenotypes induced by truncated Notch proteins indicate a role in signal transduction and may point to a novel function for Notch in nuclei.
Genes Dev.
7:1949-1965[Abstract/Free Full Text].
|
| 26.
|
Logeat, F.,
C. Bessia,
C. Brou,
O. LeBail,
S. Jarriault,
N. G. Seidah, and A. Israel.
1998.
The Notch1 receptor is cleaved constitutively by a furin-like convertase.
Proc. Natl. Acad. Sci. USA
95:8108-8112[Abstract/Free Full Text].
|
| 27.
|
Lyman, D., and M. W. Young.
1993.
Further evidence for function of the Drosophila Notch protein as a transmembrane receptor.
Proc. Natl. Acad. Sci. USA
90:10395-10399[Abstract/Free Full Text].
|
| 28.
|
Morgenstern, J. P., and H. Land.
1990.
A series of mammalian expression vectors and characterisation of their expression of a reporter gene in stably and transiently transfected cells.
Nucleic Acids Res.
18:3587-3596[Abstract/Free Full Text].
|
| 29.
|
Oda, T.,
A. G. Elkahloun,
B. L. Pike,
K. Okajima,
I. D. Krantz,
A. Genin,
D. A. Piccoli,
P. S. Meltzer,
N. B. Spinner,
F. S. Collins, and S. C. Chandrasekharappa.
1997.
Mutations in the human Jagged1 gene are responsible for Alagille syndrome.
Nat. Genet.
16:235-242[CrossRef][Medline].
|
| 30.
|
Pan, D., and G. M. Rubin.
1997.
Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis.
Cell
90:271-280[CrossRef][Medline].
|
| 31.
|
Pear, W. S.,
J. C. Aster,
M. L. Scott,
R. P. Hasserjian,
B. Soffer,
J. Sklar, and D. Baltimore.
1996.
Exclusive development of t cell neoplasms in mice transplanted with bone marrow expressing activated notch alleles.
J. Exp. Med.
183:2283-2291[Abstract/Free Full Text].
|
| 32.
|
Qi, H.,
M. D. Rand,
X. Wu,
N. Sestan,
W. Wang,
P. Rakic,
T. Xu, and S. Artavanis-Tsakonas.
1999.
Processing of the Notch ligand Delta by the metalloprotease kuzbanian.
Science
283:91-94[Abstract/Free Full Text].
|
| 33.
|
Reaume, A. G.,
R. A. Conlon,
R. Zirngibl,
T. P. Yamaguchi, and J. Rossant.
1992.
Expression analysis of a Notch homologue in the mouse embryo.
Dev. Biol.
154:377-387[CrossRef][Medline].
|
| 34.
|
Rebay, I.,
R. G. Fehon, and S. Artavanis-Tsakonas.
1993.
Specific truncations of Drosophila Notch define dominant activated and dominant negative forms of the receptor.
Cell
74:319-329[CrossRef][Medline].
|
| 35.
|
Rechsteiner, M., and S. W. Rogers.
1996.
PEST sequences and regulation by proteolysis.
Trends Biochem. Sci.
21:267-271[CrossRef][Medline].
|
| 36.
|
Schroeter, E. H.,
J. A. Kisslinger, and R. Kopan.
1998.
Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain.
Nature
393:382-386[CrossRef][Medline].
|
| 37.
|
Shawber, C.,
D. Nofziger,
J. J. Hsieh,
C. Lindsell,
O. Bogler,
D. Hayward, and G. Weinmaster.
1996.
Notch signaling inhibits muscle cell differentiation through a CBF1-independent pathway.
Development
122:3765-3773[Abstract].
|
| 38.
|
Struhl, G.,
K. Fitzgerald, and I. Greenwald.
1993.
Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo.
Cell
74:331-345[CrossRef][Medline].
|
| 39.
|
Sun, X., and S. Artavanis-Tsakonas.
1997.
Secreted forms of DELTA and SERRATE define antagonists of Notch signaling in Drosophila.
Development
124:3439-3448[Abstract].
|
| 40.
|
Tsurumi, C.,
N. Ishida,
T. Tamura,
A. Kakizuka,
E. Nishida,
E. Okumura,
T. Kishimoto,
M. Inagaki,
K. Okazaki,
N. Sagata, et al.
1995.
Degradation of c-Fos by the 26S proteasome is accelerated by c-Jun and multiple protein kinases.
Mol. Cell. Biol.
15:5682-5687[Abstract].
|
| 41.
|
Wakamatsu, Y.,
T. M. Maynard,
S. U. Jones, and J. A. Weston.
1999.
NUMB localizes in the basal cortex of mitotic avian neuroepithelial cells and modulates neuronal differentiation by binding to Notch-1.
Neuron
23:71-81[CrossRef][Medline].
|
| 42.
|
Yu, Y., and P. K. Wong.
1992.
Studies on compartmentation and turnover of murine retrovirus envelope proteins.
Virology
188:477-485[CrossRef][Medline].
|
| 43.
|
Zagouras, P.,
S. Stifani,
C. M. Blaumueller,
M. L. Carcangiu, and S. Artavanis-Tsakonas.
1995.
Alterations in Notch signaling in neoplastic lesions of the human cervix.
Proc. Natl. Acad. Sci. USA
92:6414-6418[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 2000, p. 3831-3842, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fasseu, M., Aplan, P. D., Chopin, M., Boissel, N., Bories, J.-C., Soulier, J., von Boehmer, H., Sigaux, F., Regnault, A.
(2007). p16INK4A tumor suppressor gene expression and CD3{epsilon} deficiency but not pre-TCR deficiency inhibit TAL1-linked T-lineage leukemogenesis. Blood
110: 2610-2619
[Abstract]
[Full Text]
-
Li, X., Calvo, E., Cool, M., Chrobak, P., Kay, D. G., Jolicoeur, P.
(2007). Overexpression of Notch1 Ectodomain in Myeloid Cells Induces Vascular Malformations through a Paracrine Pathway. Am. J. Pathol.
170: 399-415
[Abstract]
[Full Text]
-
Priceputu, E., Bouallaga, I., Zhang, Y., Li, X., Chrobak, P., Hanna, Z. S., Poudrier, J., Kay, D. G., Jolicoeur, P.
(2006). Structurally Distinct Ligand-Binding or Ligand-Independent Notch1 Mutants Are Leukemogenic but Affect Thymocyte Development, Apoptosis, and Metastasis Differently. J. Immunol.
177: 2153-2166
[Abstract]
[Full Text]
-
Chiang, M. Y., Xu, M. L., Histen, G., Shestova, O., Roy, M., Nam, Y., Blacklow, S. C., Sacks, D. B., Pear, W. S., Aster, J. C.
(2006). Identification of a Conserved Negative Regulatory Sequence That Influences the Leukemogenic Activity of NOTCH1.. Mol. Cell. Biol.
26: 6261-6271
[Abstract]
[Full Text]
-
Weng, A. P., Millholland, J. M., Yashiro-Ohtani, Y., Arcangeli, M. L., Lau, A., Wai, C., del Bianco, C., Rodriguez, C. G., Sai, H., Tobias, J., Li, Y., Wolfe, M. S., Shachaf, C., Felsher, D., Blacklow, S. C., Pear, W. S., Aster, J. C.
(2006). c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev.
20: 2096-2109
[Abstract]
[Full Text]
-
Zhu, Y.-M., Zhao, W.-L., Fu, J.-F., Shi, J.-Y., Pan, Q., Hu, J., Gao, X.-D., Chen, B., Li, J.-M., Xiong, S.-M., Gu, L.-J., Tang, J.-Y., Liang, H., Jiang, H., Xue, Y.-Q., Shen, Z.-X., Chen, Z., Chen, S.-J.
(2006). NOTCH1 Mutations in T-Cell Acute Lymphoblastic Leukemia: Prognostic Significance and Implication in Multifactorial Leukemogenesis.. Clin. Cancer Res.
12: 3043-3049
[Abstract]
[Full Text]
-
Hu, C., Dievart, A., Lupien, M., Calvo, E., Tremblay, G., Jolicoeur, P.
(2006). Overexpression of Activated Murine Notch1 and Notch3 in Transgenic Mice Blocks Mammary Gland Development and Induces Mammary Tumors. Am. J. Pathol.
168: 973-990
[Abstract]
[Full Text]
-
O'Neil, J., Calvo, J., McKenna, K., Krishnamoorthy, V., Aster, J. C., Bassing, C. H., Alt, F. W., Kelliher, M., Look, A. T.
(2006). Activating Notch1 mutations in mouse models of T-ALL. Blood
107: 781-785
[Abstract]
[Full Text]
-
Dumortier, A., Jeannet, R., Kirstetter, P., Kleinmann, E., Sellars, M., dos Santos, N. R., Thibault, C., Barths, J., Ghysdael, J., Punt, J. A., Kastner, P., Chan, S.
(2006). Notch Activation Is an Early and Critical Event during T-Cell Leukemogenesis in Ikaros-Deficient Mice. Mol. Cell. Biol.
26: 209-220
[Abstract]
[Full Text]
-
Kawagoe, H., Grosveld, G. C.
(2005). MN1-TEL myeloid oncoprotein expressed in multipotent progenitors perturbs both myeloid and lymphoid growth and causes T-lymphoid tumors in mice. Blood
106: 4278-4286
[Abstract]
[Full Text]
-
Armstrong, S. A., Look, A. T.
(2005). Molecular Genetics of Acute Lymphoblastic Leukemia. JCO
23: 6306-6315
[Abstract]
[Full Text]
-
Landais, S., Quantin, R., Rassart, E.
(2005). Radiation Leukemia Virus Common Integration at the Kis2 Locus: Simultaneous Overexpression of a Novel Noncoding RNA and of the Proximal Phf6 Gene. J. Virol.
79: 11443-11456
[Abstract]
[Full Text]
-
Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. IV, Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T., Aster, J. C.
(2004). Activating Mutations of NOTCH1 in Human T Cell Acute Lymphoblastic Leukemia. Science
306: 269-271
[Abstract]
[Full Text]
-
Tsunematsu, R., Nakayama, K., Oike, Y., Nishiyama, M., Ishida, N., Hatakeyama, S., Bessho, Y., Kageyama, R., Suda, T., Nakayama, K. I.
(2004). Mouse Fbw7/Sel-10/Cdc4 Is Required for Notch Degradation during Vascular Development. J. Biol. Chem.
279: 9417-9423
[Abstract]
[Full Text]
-
Tsuji, H., Ishii-Ohba, H., Ukai, H., Katsube, T., Ogiu, T.
(2003). Radiation-induced deletions in the 5' end region of Notch1 lead to the formation of truncated proteins and are involved in the development of mouse thymic lymphomas. Carcinogenesis
24: 1257-1268
[Abstract]
[Full Text]
-
Cooper, A., Johannsen, E., Maruo, S., Cahir-McFarland, E., Illanes, D., Davidson, D., Kieff, E.
(2002). EBNA3A Association with RBP-J{kappa} Down-Regulates c-myc and Epstein-Barr Virus-Transformed Lymphoblast Growth. J. Virol.
77: 999-1010
[Abstract]
[Full Text]
-
Jiang, X., Hanna, Z., Kaouass, M., Girard, L., Jolicoeur, P.
(2002). Ahi-1, a Novel Gene Encoding a Modular Protein with WD40-Repeat and SH3 Domains, Is Targeted by the Ahi-1 and Mis-2 Provirus Integrations. J. Virol.
76: 9046-9059
[Abstract]
[Full Text]
-
Yan, B., Raben, N., Plotz, P.
(2002). The Human Acid alpha -Glucosidase Gene Is a Novel Target of the Notch-1/Hes-1 Signaling Pathway. J. Biol. Chem.
277: 29760-29764
[Abstract]
[Full Text]