Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 3896-3905, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Differential Effects of pp120 (Ceacam 1) on the
Mitogenic Action of Insulin and Insulin-Like Growth Factor 1 Are
Regulated by the Nonconserved Tyrosine 1316 in the Insulin
Receptor
Payal
Soni,
Montaha
Lakkis,
Matthew N.
Poy,
Mats A.
Fernström, and
Sonia M.
Najjar*
Department of Pharmacology and Therapeutics,
Medical College of Ohio, Toledo, Ohio 43614
Received 13 January 2000/Returned for modification 29 February
2000/Accepted 7 March 2000
 |
ABSTRACT |
pp120 (Ceacam 1) undergoes ligand-stimulated phosphorylation by the
insulin receptor, but not by the insulin-like growth factor 1 receptor
(IGF-1R). This differential phosphorylation is regulated by the C
terminus of the
-subunit of the insulin receptor, the least
conserved domain of the two receptors. In the present studies, deletion
and site-directed mutagenesis in stably transfected hepatocytes derived
from insulin receptor knockout mice (IR
/
) revealed that
Tyr1316, which is replaced by the nonphosphorylatable
phenylalanine in IGF-1R, regulated the differential phosphorylation of
pp120 by the insulin receptor. Similarly, the nonconserved
Tyr1316 residue also regulated the differential effect of
pp120 on IGF-1 and insulin mitogenesis, with pp120 downregulating the
growth-promoting action of insulin, but not that of IGF-1. Thus, it
appears that pp120 phosphorylation by the insulin receptor is required
and sufficient to mediate its downregulatory effect on the mitogenic action of insulin. Furthermore, the current studies revealed that the C
terminus of the
-subunit of the insulin receptor contains elements
that suppress the mitogenic action of insulin. Because IR
/
hepatocytes are derived from liver, an
insulin-targeted tissue, our observations have finally resolved the
controversy about the role of the least-conserved domain of insulin and
IGF-1Rs in mediating the difference in the mitogenic action of their
ligands, with IGF-1 being more mitogenic than insulin.
 |
INTRODUCTION |
The insulin receptor is essential to
mediate insulin action on target cells (1, 27). It is a cell
surface glycoprotein of a heterotetrameric structure that consists of
two
- and two
-subunits. The extracellular
-subunits contain
the insulin binding domains, and the transmembrane
-subunits contain
the tyrosine kinase and the phosphorylation sites. Insulin binding to
its receptor activates the tyrosine kinase to phosphorylate the
receptor and other endogenous substrates, such as pp120 (Ceacam 1)
(5a, 44), insulin receptor substrate proteins (IRS-1, -2, -3, and -4), Shc, and others (reviewed in references
65 and 66). Phosphorylation of
different substrates is required to mediate the diverse effects of
hormones on metabolism and growth (3, 60, 68).
Insulin and insulin-like growth factor 1 (IGF-1) receptors are
structurally related, and all conserved tyrosine residues that are
phosphorylated in the insulin receptor in response to insulin are also
phosphorylated in the IGF-1 receptor in response to IGF-1 (10, 17,
23, 48, 71). Moreover, these receptors share many substrates,
such as Shc and members of the IRS family, phosphorylation of which is
regulated by the conserved Tyr960 in the juxtamembrane
domain of the insulin receptor (18, 22, 67) and its
corresponding residue in the IGF-1 receptor (8). Phosphorylated IRS-1 engages, in turn, in the formation of signaling complexes via phosphotyrosine-containing binding motifs with Src homology 2 (SH2) found in molecules like growth factor receptor binding
protein (GRB2) (32, 56), Syp (SH PTP2) phosphotyrosine phosphatase (69), phosphatidylinositol (PI)-3' kinase
(4), and many others. By binding to GRB2 either directly or
through Syp, IRS-1 couples GRB2 to insulin and IGF-1 receptors.
Similarly, Shc couples these receptors to GRB2 even more predominantly
than the IRS proteins (49, 53). GRB2 coupling to the
receptors leads to its association with the Son of Sevenless (SOS) Ras
GDP/GTP exchanger. This causes translocation of SOS to the plasma
membrane in proximity to its p21ras substrate
(16), activation of the Ras/mitogen-activated protein (MAP)
kinase pathway, and regulation of cell growth, differentiation, and
proliferation in response to insulin and IGF-1 (6, 9). Activation of the PI-3' kinase-p70 ribosomal protein S6 kinase pathway
also plays a significant role in mediating the mitogenic effects of
insulin in many cell types, including hepatocytes (24, 52).
PI-3' kinase is coupled to the receptor via the IRS proteins, but can
also directly bind, albeit less stably, to the receptor on the C
terminus of the
-subunit of the receptor (57).
Because phosphorylation of substrates is required to mediate insulin
and IGF-1 action, the common phosphorylation cascades that underlie the
basic mechanism of insulin and IGF-1 action have failed to explain the
different, albeit overlapping, physiologic functions mediated by the
two receptors. The insulin receptor regulates metabolism
(1), and the IGF-1 receptor mediates growth and
differentiation (5, 31). Except for pp120 (41),
most other insulin receptor substrates are similarly phosphorylated by
the IGF-1 receptor. Moreover, pp120 phosphorylation is regulated by the
least conserved C terminus of the
-subunit of the insulin receptor
(41). Thus, the specificity of pp120 phosphorylation may
serve as a biochemical marker for the physiologic differences between
insulin and IGF-1 action. Therefore, delineation of the role of
specific residues in the C terminus of the
-subunit of the insulin
receptor in regulating pp120 phosphorylation may advance our
understanding of the basic mechanism of the diverse physiologic functions of insulin and IGF-1.
The C terminus of the
-subunit of the insulin receptor contains two
tyrosine residues that are phosphorylated in response to insulin:
Tyr1316 and Tyr1322. Of these,
Tyr1316 is not conserved in the IGF-1 receptor, where it is
replaced by Phe1310. To address the role of these residues
in pp120 phosphorylation, we examined the effect of abolishing their
phosphorylation, by deletion or site-directed mutagenesis, on pp120
phosphorylation in stably transfected simian virus 40 (SV40)-transformed hepatocytes derived from the insulin receptor
knockout (IR
/
) mouse (52). We observed that
the nonconserved Tyr1316 in the
-subunit of the insulin
receptor regulates the differential phosphorylation of pp120 by the
insulin receptor.
The function of pp120 remains elusive. It may function as a tumor
suppressor in colon, liver, and prostate (19, 20, 25, 26, 34, 46,
51, 62, 63) and as a downregulator of the mitogenic effects of
insulin (15). pp120 may upregulate the transport of bile
acids (55) and insulin (15) in the hepatocyte, as
suggested by studies with transfected cells. Supportive evidence for a
role in pp120 in cell adhesion has also emerged (7, 12). Because of the multiple functions ascribed to pp120, it has been referred to as pp120, C-CAM, and CBATP. Based on cDNA sequence analysis, pp120 has also been identified as
Ca2+/Mg2+ ecto-ATPase (30, 36).
Sequence analysis has also shown that pp120 is the rat homolog of the
human biliary glycoprotein (BGP) (45).
pp120 is expressed as two alternative spliced isoforms, the shorter of
which lacks most of the intracellular domain, including the
phosphorylation sites (40). The short isoform has been known to function as a cell adhesion molecule, but not to play a significant role in the other functions attributed to pp120 (7, 12, 15, 55).
The basic mechanism of pp120 functions is not completely understood.
However, pp120 phosphorylation is required for its function in insulin
endocytosis (15), bile acid transport (55), and tumor suppression (20, 33). Dependence on an intact
intracellular domain for the cell adhesion property of pp120 has also
been reported (7). We have observed that inhibition of pp120
expression increased the mitogenic action of insulin in rat hepatoma
H35 cells (15). Conversely, expression of pp120 decreased
insulin mitogenesis in NIH 3T3 cells coexpressing insulin receptors
compared to cells expressing insulin receptors alone (15).
The mechanism of the downregulatory effect of pp120 on insulin-induced
mitogenesis is not clear, but failure of the phosphorylation-defective
isoforms (truncated and site-directed mutants) to decrease
insulin-induced mitogenesis suggested that pp120 phosphorylation is
required (15). Thus, in the present studies, we examined
whether pp120 similarly regulates the mitogenic action of IGF-1 in
IR
/
hepatocytes. In contrast to insulin, pp120
coexpression did not downregulate cell growth in response to IGF-1.
Replacement of the C terminus of the
-subunit of the IGF-1 receptor
with that of the insulin receptor restored the downregulatory effect of pp120 on cell growth in response to IGF-1. Furthermore, pp120 downregulation of insulin-induced mitogenesis required intact phosphorylation of the nonconserved Tyr1316 between insulin
and IGF-1 receptors. Thus, pp120 phosphorylation by the insulin
receptor appears to be required and sufficient to mediate its
differential downregulation of insulin vis-à-vis IGF-1 mitogenesis.
 |
MATERIALS AND METHODS |
Materials.
All reagents for cell culture were from
Mediatech, Inc. (Herndon, Va.). The plasmid carrying the hygromycin
resistance gene Hygror, pREP4-Hygror, was
purchased from Stratagene (La Jolla, Calif.). The bovine papillomavirus-based expression vector (pBPV) and all reagents for
immunoblotting were from Amersham Pharmacia Biotech (Piscataway, N.J.).
Lipofectamine reagent and protein A-agarose were purchased from Life
Technologies, Inc. Hygromycin B was purchased from Calbiochem. Protease
inhibitors were purchased from Boehringer Mannheim (Indianapolis, Ind.). Triton X-100 and other reagents used in cell lysis were purchased from Sigma (St. Louis, Mo.). All reagents for polyacrylamide gel electrophoresis (PAGE) were purchased from Bio-Rad Laboratories (Richmond, Calif.). Human insulin was purchased from Lilly, and insulin-free bovine serum albumin (BSA) was purchased from Intergen Co.
(Des Plaines, Ill.). Recombinant human IGF-1, monoclonal
antiphosphotyrosine (
-pTyr) antibodies, and polyclonal anti-IRS-1
(
-IRS-1) and anti-IRS-2 (
-IRS-2) antibodies were purchased from
Upstate Biotechnology, Inc. (Lake Placid, N.Y.). The pp120 antibodies
used in these studies were described previously (41).
Briefly, the monoclonal antibody used to immunoprecipitate pp120
(
-HA4; an identical protein to pp120) was purified from ascites
fluid from HA4 c19 cells purchased from the Developmental Studies
Hybridoma Bank (Department of Biology, University of Iowa, Iowa City).
The polyclonal antibody used to immunoblot pp120 (
-295) was raised
in rabbit against a peptide (amino acids [aa] 51 to 64) in the
extracellular domain of rat liver pp120.
Cells and cell culture.
The SV40-transformed hepatocytes
were derived from the IR
/
mice (11, 52). As
described previously (43), these cells were routinely
maintained in complete medium A (alpha-modified Eagle's medium
(
-MEM) containing 8% fetal calf serum, 1% glutamine, 200 nM
dexamethasone, 100-U/ml penicillin, and 10-µg/ml streptomycin) at
33°C in 5% CO2.
Construction of expression vectors.
Synthesis and subcloning
into pBPV of the cDNA encoding the full-length isoform of rat pp120
(rFL) and the human insulin and IGF-1 receptors (hIR and hIGF-1R,
respectively) were described previously (14, 44). Similarly,
synthesis and subcloning into pBPV of recombinant cDNAs encoding the
chimeric IGF-1 receptor (CHI), in which the entire C terminus (aa 1230 to 1337) of the
-subunit was replaced by the corresponding tail of
the insulin receptor (aa 1245 to 1343), and the F1310Y IGF-1 receptor,
in which Phe1310 was replaced by tyrosine, were described
previously (13, 14). Synthesis and subcloning into pBPV of
recombinant cDNA encoding the
43 hIR deletion mutant (
43 hIR)
that lacks the terminal 43-aa tail of the
-subunit were also
described previously (28) (Fig.
1).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Insulin receptor deletion mutants. This diagram
illustrates the tyrosine kinase (TK) and the C terminus (CT) of the
-subunit of the hIR. Wild-type hIR (WT hIR) contains several serine
(S), threonine (T), and tyrosine (Y) phosphorylation sites. In the
43 CT hIR mutant, the terminal 43 aa containing both tyrosine
residues were deleted from the C terminus of the -subunit of the
insulin receptor. hIR-hIRRK represents a heterologous insulin receptor
in which the cytoplasmic domain of the insulin receptor was replaced
with that of the orphan IRR.
|
|
The hIR-IRRK heterologous receptor, in which the intracellular domain
of the hIR was replaced by the corresponding fragment
of the insulin
receptor-related receptor (IRR) was originally
subcloned into the
EcoRI and
XbaI sites of the pECE expression
vector (
72). The intracellular portion of the IRR, an orphan
receptor that belongs to the insulin receptor tyrosine kinase
subfamily
and for which a ligand has not yet been identified,
lacks in its C
terminus tyrosine and serine phosphorylation sites
known to be present
in the corresponding domain of the insulin
receptor (
54)
(Fig.
1). The DNA fragment spanning nucleotides
(nt) 1011 to 4043 was
excised from the pECE construct by
EcoRI-
XbaI
digestion and subcloned into the human elongation factor 1

promoter-based
expression vector, pEF-1
Neo
(
43), at the same sites. The DNA
fragment spanning nt 1 to
1011 from hIR was excised from the pECE
construct by
EcoRI-
EcoRI digestion and subcloned into the
pEF-1
construct 5' of the hIR-hIRRK partial
fragment.
To synthesize the cDNA encoding the Y1316F insulin receptor mutant
(Y1316F hIR), two cDNA fragments were amplified by PCR
with wild-type
hIR (in the pGEM 4Z-WT hIR construct) as a template
in the presence of
Taq polymerase, as we have described previously
(
40). The first PCR
a fragment (nt 4072 to 4360)
was amplified
by using sense (S1;
4072-AGCT
TCGAGGAACACATCCCTTACACACA
tATGAAC-4107)
and antisense (

1; nt 4360 to 4331) primers. The S1 primer
contained
an A-to-
T point mutation at nt 4076 (underlined)
that encodes
phenylalanine instead of tyrosine at aa 1316. The
C
t mismatch
(lowercase boldface letter) at nt 4101 was
included in order to
introduce a new
NdeI site. The

1
primer spans the
SpeI and
PstI
sites at nt 4334 and 4345, respectively. The second PCR
b fragment
(nt 2086 to 4110) was amplified by using wild-type sense S2 (nt
2086 to 2121 spanning the
Tth111I site at nt 2100) and antisense

2
(complementary to S1) primers. PCR products were individually
subcloned
into the pCR II TA cloning plasmid per the manufacturer's
instructions
(Invitrogen). The DNA segment spanning nt 2100 to
4101 was isolated
from the pCR II
b construct by
XbaI-
NdeI digestion
and ligated into the pCR
II
a construct at the same sites upstream
of and in the same
orientation as the PCR
a DNA fragment (pCR
II
a+b).
The DNA fragment spanning nt 2100 to 4334 was then
isolated from
the pCR II
a+b by
Tth111I-
SpeI digestion and ligated into
the
pGEM4Z-WT hIR construct at the same sites in lieu of the wild-type
DNA
fragment. Following confirmation by enzyme digestion and sequence
analysis, the full Y1316F hIR cDNA was excised from the pGEM4Z-hIR
construct by
XbaI-
SpeI and ligated at the
XbaI site of pEF-1

.
The recombinant cDNA encoding the double Y1316F/1322F hIR mutant was
originally subcloned into the pCVSV expression vector
(
58).
The DNA fragment carrying the double mutations and spanning
nt 2100 to
4334 was removed from the pCVSV construct by
Tth111I-
SpeI
digestion and ligated into the
pGEM4Z-WT hIR construct at the
same sites in lieu of the wild-type
sequence. The cDNA encoding
the entire cDNA encoding the Y1316F/Y1322F
hIR mutant was then
excised from the pGEM4Z-construct by
SpeI-
XbaI digestion for subcloning
into the
XbaI site of the pEF-1

expression
vector.
Transfection.
Stable transfection of the SV40-transformed
IR
/
hepatocytes in the presence of the
pREP4-Hygror gene was achieved by the Lipofectamine method,
as described previously (43). Individual clones were picked
and expanded, and confluent cells were lysed in lysis buffer (1%
Triton X-100, 150 mM NaCl, 50 mM HEPES [pH 7.6], 1 mM
phenylmethylsulfonyl fluoride, 10-µg/ml [each] protease inhibitors
antipain dihydrochloride, pepstatin A, leupeptin, aprotinin, and
bacitracin) for analysis on 7.5% sodium dodecyl sulfate (SDS)-PAGE
gels and screening for pp120 expression by immunoblotting with a pp120
polypeptide antibody (
-295), as described previously
(44). Screening for expression of insulin and IGF-1
receptors was achieved by measuring insulin binding in intact cells, as
described previously (41, 44). The level of endogenous
wild-type IGF-1 receptors in IR
/
hepatocytes was
~1 × 105 to 2 × 105 IGF-1
receptors/cell (11). The level of mutant insulin and IGF-1
receptors in transfected IR
/
hepatocytes was
~0.5 × 106 to 1.3 × 106 receptors
per cell.
Phosphorylation of pp120 in intact cells.
IR
/
hepatocytes were expanded to confluence in
100-mm-diameter plates. Following overnight incubation in serum-free
medium containing 0.1% insulin-free BSA and 25 mM HEPES (pH 7.4) for 8 h, cells were treated with either buffer alone or ligand
(insulin or IGF-1) at 100 nM for 5 min prior to lysis in 1% Triton
X-100 in the presence of phosphatase (EDTA, 4 mM; NaF, 100 mM; sodium pyrophosphate, 10 mM; sodium phosphate, 10 mM; ATP, 2 mM; sodium orthovanadate, 20 mM; N-ethylmaleimide, 5 mM; HEPES, 40 mM
[pH 7.6]) and protease inhibitors (described above). Unless otherwise indicated, cell lysates were directly subjected to immunoprecipitation with either a monoclonal antibody against pp120/HA4 or
-pTyr prior
to analysis by 7.5% SDS-PAGE and immunoblotting with horseradish peroxidase (HRP)-coupled
-pTyr antibody to detect phosphorylated proteins by the Amersham Enhanced Chemiluminescence (ECL) detection system (41). In some experiments, cell lysates were
partially purified by wheat germ agglutinin affinity chromatography
(44) prior to being subjected to immunoprecipitation with
-pTyr monoclonal antibody to immunoprecipitate phosphorylated pp120
and insulin receptors (42).
To examine the activation state of receptors in stable transfectants,
cells were treated with ligand as mentioned above, and
their lysates
were subjected to immunoprecipitation with polyclonal
antibodies
against either IRS-1 (

-IRS-1) or IRS-2 (

-IRS-2).
Following
analysis by SDS-PAGE, proteins were transferred on nitrocellulose
membranes and immunoblotted with HRP-coupled

-pTyr antibody to
detect phosphorylated proteins by the ECL system (
41).
Experiments
were carried out with at least two independent clones for
each
construct derived from the same
transfection.
Quantitation of proteins.
Autoradiograms were scanned on an
imaging densitometer (Bio-Rad model GS-670), and the proteins were
quantitated by the Image NIH version 1.61 Macintosh software program.
Cell growth and proliferation.
The cell growth and
proliferation assay was performed according to the method of Li et al.
(29), with some modifications. Transfected
IR
/
hepatocytes were seeded in triplicate into 12-well
plates at a density of 3 × 103 cells per well. Cells
were allowed to attach for 24 h in complete medium A prior to
incubation in serum-free medium supplemented with 0.1% BSA and 25 mM
HEPES for 24 h to reach quiescence. Insulin or IGF-1 at
concentrations of 0, 0.1, 10, and 100 nM was added to triplicate wells,
whereas complete medium A was added to some others. Following
incubation for 24 and 48 h, cells were trypsinized and counted in
a Coulter counter (Z1 model). Basal growth was measured as
the number of cells grown in the absence of serum and hormones. Maximal
growth was measured as the number of cells grown in the presence of
serum. Hormone-induced cell growth was calculated as the percent
maximal minus basal growth divided by the number of cells grown in
complete medium (52). These experiments were repeated at
least three times for each clone.
Statistical analysis.
Curves were compared by a multivariate
analysis of variance, and individual points were compared by paired
t tests. P values of less than 0.05 were
considered statistically significant.
 |
RESULTS |
Phosphorylation of recombinant pp120 by deleted insulin
receptors.
Deletion of the terminal 43 amino acids or replacement
of the intracellular domain of the insulin receptor with that of the IRR impaired neither the affinity of the receptor to its ligand nor its
tyrosine kinase activity (35, 72). Thus, we transfected IR
/
hepatocytes with mutant receptors to investigate
the role of the C terminus of the
-subunit of the insulin receptor
in pp120 phosphorylation. Cells transfected with full-length rat pp120 (rFL) alone or with comparable amounts of wild-type (WT) and mutant (
43 hIR and hIR-hIRRK) insulin receptors were incubated in the presence (Fig. 2, even lanes) or absence
(Fig. 2, odd lanes) of insulin (100 nM) for 5 min at 33°C. Following
partial purification of cell lysates, 50 µg of proteins was
immunoprecipitated with
-pTyr monoclonal antibody prior to
immunoblotting with
-pTyr (Fig. 2A) to detect
tyrosine-phosphorylated proteins. To account for the amount of pp120 in
the samples, amounts of proteins equal to those in panel A were
immunoprecipitated with
-pp120/HA4 monoclonal antibody, analyzed by
SDS-PAGE in parallel to the gel in panel A, and immunoblotted with
-pp120 polyclonal antibody (Fig. 2B). As expected, insulin at a high
100 nM concentration activated both IGF-1 and insulin receptors (Fig.
2A, even lanes). Because the level of endogenous IGF-1 receptors in
IR
/
cells is lower than the level of recombinant
insulin receptors, we exposed the immunoblot of lanes 1 to 2 longer
than the rest of the immunoblot (lanes 3 to 8). As expected from our
previous experiments (41), endogenous mouse (m) IGF-1
receptors failed to phosphorylate pp120 in cells transfected with rat
pp120 alone (WT mIGF-1Ra/rFL pp120; "a" represents the
clone used) (Fig. 2A, lane 2 versus 1). In contrast, insulin led to an
~10-fold increase in the amount of phosphorylated tyrosine in pp120
derived from cells transfected with wild-type insulin receptors and
pp120 (WT hIRa/rFL; "a" represents the clone used)
(Fig. 2A, lane 8 versus 7). It is noteworthy that the low level of
phosphotyrosines in the pp120 band is due to Tyr488 being
the only residue in pp120 undergoing phosphorylation in response to
insulin (44). Because endogenous IGF-1 receptors failed to
phosphorylate pp120, pp120 phosphorylation in the WT hIRa/rFL pp120 clone was probably due to insulin activation
of wild-type insulin receptors. However, when the distal 43 aa were removed from the C terminus of the
-subunit of the insulin receptor (
43 hIR) or when the C terminus was replaced with that of the IRR
which lacks phosphorylation sites (hIR-hIRRK), insulin-stimulated pp120
phosphorylation was abolished (Fig. 2A, lanes 4 and 6, respectively). Thus, it appears that the distal 43 aa of the insulin receptor are
required for pp120 phosphorylation by the insulin receptor.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Phosphorylation of recombinant pp120 by truncated
insulin receptors in intact cells. IR / hepatocytes were
stably transfected with cDNAs encoding the full-length isoform of rat
pp120 (rFL) with either wild-type insulin receptors (WT
hIRa/rFL) or with the 43 deletion mutant ( 43
hIRa/rFL) or the heterologous hIR/hIRRK receptors
(hIR/hIRRKa/rFL). Cells expressing full-length pp120 alone
were used as controls (WT mIGF-1Ra/rFL, with m denoting
endogenous mouse IGF-1 receptors). Subscripts denote the clone number.
Cells were serum starved for 8 h prior to incubation in the
presence (+ lanes) or absence ( lanes) of insulin (100 nM) for 5 min.
Following partial purification on affinity chromatography, ~50 µg
of proteins was immunoprecipitated (Ip) with a monoclonal antibody
against either phosphotyrosines ( -pTyr) (A) or pp120 ( -pp120)
(B), analyzed in parallel by SDS-PAGE, and immunoblotted (Ib) with
either HRP-coupled -pTyr (A) or with a polyclonal antibody against
pp120 (B). To examine IRS-2 phosphorylation in these cells, proteins
derived from nonpurified cell lysates were immunoprecipitated with a
polyclonal antibody against IRS-2 ( -IRS-2) and immunoblotted with
-pTyr antibody following electrophoresis (C). For optimal
photographic visualization, the autoradiogram corresponding to lanes 1 to 2 was exposed threefold longer than the one corresponding to lanes 3 to 8. The number of receptors per cell expressed in each transfectant
is shown at the bottom of the figure. Molecular mass markers are
indicated on the left-hand side of the gel. Bands of ~100, 95, and 90 kDa in panel A correspond to the -subunits of the IGF-1R, insulin
receptor, and 43 and IRR, respectively.
|
|
To investigate whether expressed receptors were capable of
phosphorylating endogenous proteins in response to ligand, we examined
phosphorylation of IRS-2 in transfected cells. Thus, serum-starved
cells were treated with insulin (100 nM) prior to lysis and
immunoprecipitation
with

-IRS-2 antibody. Following transfer onto
nitrocellulose
membranes, proteins were probed with

-pTyr antibody
to detect
tyrosine-phosphorylated IRS-2. As shown in Fig.
2C,
insulin-activated
insulin and IGF-1 receptors phosphorylated IRS-2 in
all transfectants,
suggesting that IRS-2 is a common substrate of the
tyrosine kinase
of IGF-1, insulin, and IRRs. Moreover, these data
support the
notion that, in contrast to pp120, IRS-2 phosphorylation
does
not require the distal 43 aa of the C terminus of the

-subunit
of the insulin
receptor.
Phosphorylation of recombinant pp120 by site-directed insulin
receptor mutants.
As Fig. 1 indicates, the distal 43 aa of the C
terminus of the
-subunit of the insulin receptor include the
tyrosine phosphorylation sites of this domain (Tyr1316 and
Tyr1322). To determine which of these residues regulates
pp120 phosphorylation by the insulin receptor, we mutated the
nonconserved tyrosine to nonphosphorylatable phenylalanine either alone
(Y1316F) or with Tyr1322 (Y1316F/Y1322F). Mutation of both
residues to phenylalanine did not impair either the affinity of the
receptor to its ligand or its tyrosine kinase activity (58).
Similarly, replacing Tyr1316 with phenylalanine did not
impair the affinity of the receptor to insulin (data not shown). To
examine the tyrosine kinase activity of the Y1316F insulin receptor
mutant, we subjected cell lysates derived from cells cotransfected with
pp120 and comparable amounts of either wild-type or Y1316F insulin
receptors to immunoprecipitation and immunoblotting with
-pTyr
antibodies. As Fig. 3 reveals, insulin-induced tyrosine phosphorylation levels of the
-subunit (IR
) of the receptors and of many unidentified proteins
(p190, p180, and p125) were comparable in cells expressing Y1316F and those expressing wild-type receptors (lane 2 versus 4). This suggests that mutating Tyr1316 to phenylalanine did not alter the
tyrosine kinase activity of the receptor. In contrast to wild-type
insulin receptors, which induced tyrosine phosphorylation of a protein
of Mr ~120 kDa (p120) in response to insulin
(Fig. 3, lane 4 versus 3), Y1316F receptors failed to phosphorylate
this protein (Fig. 3, lane 2 versus 1). As expected, mutation of
Tyr1322 in addition to Tyr1316 to phenylalanine
led to the same observation (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Phosphorylation of endogenous substrates by
site-directed mutant insulin receptors in intact cells.
IR / hepatocytes coexpressing full-length rat pp120
(rFL) with comparable numbers (1.2 × 106 to 1.3 × 106) of either wild-type (WT hIRa/rFL) or
Y1316F (Y1316F hIRa/rFL) insulin receptors were treated
with insulin as described in the legend to Fig. 2. Cell lysates were
subjected to immunoprecipitation (Ip) with -pTyr. Following analysis
by SDS-PAGE, proteins were transferred on nitrocellulose membrane for
immunoblotting (Ib) with HRP-coupled -pTyr antibody and detection by
the ECL system. Molecular mass markers are indicated on the left-hand
side of the gel. Phosphorylated proteins of ~190, 180, 125, and 120 kDa were referred to as p190, p180, p125, and p120, respectively. The
~95-kDa band corresponds to the -subunit of insulin receptors
(IR ).
|
|
To determine whether the p120 protein is identical to pp120, the
insulin receptor substrate, we treated transfected IR
/
hepatocytes with either buffer alone (Fig.
4, odd lanes) or 100
nM insulin (Fig.
4,
even lanes) prior to lysis, immunoprecipitation
with

-pp120/HA4
antibody, and immunoblotting with

-pTyr antibody
(Fig
4A). The
immunoblot was then reprobed with

-pp120 polyclonal
antibody (Fig.
4B). Comparison of the immunoblot with

-pTyr antibody
(Fig.
4A) to
that with

-pp120 antibody (Fig.
4B) revealed the
identity of the
~120-kDa band as pp120. Moreover, insulin treatment
of cells
transfected with rat pp120 alone (WT mIGF-1R
b/rFL; "b"
denotes a different clone from that of Fig.
2) did not increase
tyrosine phosphorylation of pp120 by endogenous mouse IGF-1 receptors
(Fig.
4A, lane 2 versus 1), as expected from our previous experiments
(
41) and from experiments shown in Fig.
2. In fact, pp120
phosphorylation
in cells expressing IGF-1 receptors alone is decreased
in response
to insulin. Tyrosine phosphorylation of pp120 in the
absence of
ligand in cells expressing IGF-1 receptors alone is not at
the
present fully understood, but must certainly be related to the
complexity of pp120 phosphorylation (
44). For instance,
pp120
phosphorylation is regulated not only by the activities of serine
and tyrosine kinases, but also by a phosphatase activity associated
with it (
39). Additionally, since the IGF-1 receptor is not
significantly phosphorylated in the absence of ligand (see below),
it
cannot be fully responsible for basal pp120 phosphorylation.
Nonetheless, it is interesting that in contrast to cells expressing
IGF-1 receptors alone, insulin treatment led to an ~10-fold increase
in tyrosine phosphorylation of pp120 in cells coexpressing wild-type
insulin receptors (WT hIR
b/rFL, where b denotes a different
clone
from that of Fig.
2) (Fig.
4A, lane 4 versus lane 3). Insulin
treatment of cells coexpressing pp120 and Y1316F insulin receptors
(Y1316F hIR
a/rFL) did not increase pp120 phosphorylation
(Fig.
4A, lane 6 versus lane 5). Thus, replacing the nonconserved
Tyr
1316 in the insulin receptor with the corresponding
residue in the
IGF-1 receptor abolished pp120 phosphorylation by the
insulin
receptor. Unidentified proteins of higher molecular weights
were
detected on this blot (Fig.
4A, bands x and y). However, their
detection was not reproducible.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
Phosphorylation of recombinant pp120 by site-directed
mutant insulin receptors in intact cells. IR /
hepatocytes stably transfected with cDNAs encoding the full-length
isoform of rat pp120 (rFL) either alone (WT mIGF-1Rb/rFL,
where b denotes the clone number and represents a different clone from
that of Fig. 2) or with comparable numbers (1.3 × 106
to 1.4 × 106) of wild-type (WT hIRb/rFL)
and Y1316F (Y1316F hIRa/rFL) insulin receptors were treated
with insulin as described in the legend to Fig. 2. Cell lysates were
subjected to immunoprecipitation (Ip) with a monoclonal antibody
against pp120 ( -pp120) (A), analyzed by SDS-PAGE, and immunoblotted
(Ib) with HRP-coupled -pTyr (A). To assess the amount of pp120 in
the immunopellets, the immunoblot in panel A was reprobed with
-pp120 polyclonal antibody (B). Molecular mass markers are indicated
on the right-hand side of the gel. Bands x and y were not identified,
but their detection was not reproducible.
|
|
These data suggest that, in contrast to other substrates of the insulin
receptor, pp120 phosphorylation requires an intact
nonconserved
Tyr
1316 in the C terminus of the

-subunit of the
receptor.
Phosphorylation of recombinant pp120 by IGF-1 receptor
mutants.
We then examined whether mutation of the nonconserved
Phe1310 in the C terminus of the
-subunit of the IGF-1
receptor to tyrosine (the corresponding residue in the insulin
receptor) restored pp120 phosphorylation by the receptor. This mutation
impaired neither the affinity of the receptor to its ligand nor its
tyrosine kinase activity in transfected NIH 3T3 cells (13).
Thus, IR
/
hepatocytes were transfected with rat pp120
alone (WT mIGF-1Rc/rFL) or with either wild-type (WT
hIGF-1Ra/rFL), F1310Y (F1310Y hIGF-1Ra/rFL), or
chimeric IGF-1 receptors in which the C terminus of the
-subunit was
replaced with the corresponding fragment of the insulin receptor (CHI
hIGF-1Ra/rFL). Transfected cells were treated with IGF-1 (100 nM) prior to lysis and immunoprecipitation with antibodies against
either pp120 (Fig. 5A;
-pp120),
phosphotyrosines (Fig. 5C;
-pTyr), IRS-1 (Fig. 5D;
-IRS-1), or
IRS-2 (Fig. 5E;
-IRS-2). To account for the amount of pp120 in the
immunopellets, the immunoblot in Fig. 5A was reprobed with
-pp120
antibody (Fig. 5B). IGF-1 treatment caused comparable phosphorylation
of the
-subunit (IGF-1R
) of the wild type receptor
(Fig. 5C, lanes 2 versus 1 and 8 versus 7) and IGF-1 receptor mutants
(Fig. 5C, chimeric, lane 4 versus 3, and F1310Y, lane 6 versus 5),
supporting previous observations that these mutations did not impair
the tyrosine kinase activity of the receptor and its
autophosphorylation in transfected NIH 3T3 cells (13, 14).
As expected from our previous experiments (41) and from
experiments in Fig. 2 and 4, activated wild-type IGF-1 receptors failed
to stimulate pp120 phosphorylation in cells transfected with pp120
alone (WT mIGF-1Rc/rFL) (Fig. 5A, lane 2 versus 1) or with
pp120 and wild-type IGF-1 receptors (WT hIGF-1Ra/rFL) (Fig.
5A, lane 8 versus 7). As in our previous reports (41), replacing the C terminus of the
-subunit of the IGF-1 receptor with
that of the insulin receptor restored pp120 phosphorylation by the
chimeric IGF-1 receptor, as indicated by the ~15-fold increase in the
amount of phosphorylated tyrosine in pp120 in cells coexpressing chimeric receptors (CHI hIGF-1Ra/rFL) (Fig. 5A, lane 4 versus 3). Similarly, mutating Phe1310 to tyrosine in the
IGF-1 receptor resulted in an approximately five-fold increase in the
amount of phosphorylated tyrosines in pp120 (Fig. 5A, lane 6 versus 5),
suggesting that replacing the nonconserved Phe1310 residue
with the corresponding residue in the insulin receptor restored pp120
phosphorylation by the IGF-1 receptor. Interestingly, basal pp120
phosphorylation was higher in cells overexpressing the F1310Y mutant
(Fig. 5A, lane 5) than that in cells overexpressing either wild-type
(Fig. 5A, lane 7) or chimeric (Fig. 5A, lane 3) IGF-1 receptors.
Because the F1310Y IGF-1 receptor was not basally phosphorylated (Fig.
5C, lane 5), it is not probably the kinase responsible for pp120 in the
absence of ligand (Fig. 5A, lane 5). This lends more credence to the
notion that other kinases may cause pp120 phosphorylation in the
absence of ligand.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Phosphorylation of recombinant pp120 by site-directed
mutant IGF-1 receptors in intact cells. IR / hepatocytes
were stably transfected with cDNAs encoding the full-length isoform of
rat pp120 (rFL) either alone (WT mIGF-1Rc/rFL) or with
wild-type (WT hIGF-1Ra/rFL), chimeric (CHI
hIRa/rFL), and F1310Y IGF-1 (F1310Y
hIGF-1Ra/rFL) receptors. Transfectants expressed 0.2 × 106, 0.5 × 106, 0.8 × 106, and 1.2 × 106 receptors per cell,
respectively. Cells were serum starved for 8 h prior to incubation
in the presence (+ lanes) or absence ( lanes) of IGF-1 (100 nM) for 5 min. Cell lysates were then subjected to immunoprecipitation (Ip) with
antibodies against pp120 (A), phosphotyrosines (C), IRS-1 (D), or IRS-2
(E) prior to analysis by SDS-PAGE and immunoblotting (Ib) with
HRP-coupled -pTyr. To assess the amount of pp120 in the
immunopellets, the immunoblot in panel A was reprobed with a polyclonal
antibody against pp120 (B). Molecular mass markers are indicated on the
left-hand side of the gel.
|
|
As indicated in Fig.
5D and E, transfecting pp120 in the hepatocytes
did not impair the ability of IGF-1 to activate its receptor
to
phosphorylate other substrates, such as IRS-1 (Fig.
5D, lanes
2 versus
1 and 8 versus 7) and IRS-2 (Fig.
5E, lanes 2 versus
1 and 8 versus 7).
As opposed to previous experiments with IR
/
hepatocytes
(
52), the level of basal IRS-1 phosphorylation
was high
(Fig.
5D, lane 1). The insignificant basal phosphorylation
of IRS-2 in
these cells (Fig.
5E, odd lanes) suggests that the
high basal
phosphorylation of IRS-1 is not largely due to intrinsic
activation of
these cells, perhaps upon their transformation with
SV40. Because basal
IRS-1 phosphorylation in cells transfected
with the Hygro
r
plasmid alone was similarly high (data not shown), we conclude
that
pp120 transfection did not alter IRS-1 phosphorylation in
these cells.
Thus, the high basal IRS-1 phosphorylation in our
experiments, compared
to that in previous reports (
52), is probably
due to
differences in the amount of proteins immunoprecipitated
and in the

-IRS-1 antibodies used, among other technical variabilities.
Nonetheless, replacing the C-terminus domain of the IGF-1 receptor
with
that of the insulin receptor or mutating its Phe
1310 to the
corresponding residue in the insulin receptor did not
impair either
IRS-1 phosphorylation or IRS-2 phosphorylation by
IGF-1 receptors in
response to ligand (Fig.
5D and E, lanes 4
versus 3 and 6 versus 5, respectively). This is in agreement with
previous observations that
phosphorylation of IRS-1, Shc, and
Crk-II by these mutant IGF-1
receptors was intact in transfected
NIH 3T3 cells (
13).
Moreover, our data indicate that these IGF-1
mutations did not impair
the tyrosine activity of the receptor
in transfected
IR
/
hepatocytes.
Proliferation and growth of cells expressing insulin receptor
mutants.
Because hepatocytes constitute a major site of the
insulin receptor's expression, we aimed at transfecting
IR
/
hepatocytes with insulin receptor mutants to
investigate the role of the C terminus of the
-subunit of the
insulin receptor in insulin mitogenesis. Because expression of the
IGF-1 receptors in these hepatocytes was slightly elevated to
~0.1 × 105 to 0.2 × 105
receptors/cell (11), we treated cells with insulin at the
low concentration of 0.1 nM in order to avoid potential activation of
endogenous IGF-1 receptors and measured cell growth and proliferation as a marker of mitogenesis. Stable transfectants expressing comparable numbers of receptors per cell in each clonal pair (with or without pp120) and among the different receptor types were used in these studies. As Fig. 6 reveals, deletion of the 43 aa from the C terminus or replacement of the intracellular tail of the insulin receptor with
that of the IRR increased insulin-induced cell growth in comparison
with that of cells expressing wild-type insulin receptors (
43 hIR,
8.88 ± 2.53, and hIR-hIRRK, 11.3 ± 1.26, versus WT hIR, 2.46 ± 0.10; p < 0.05). Similarly, mutation of
Tyr1316 to phenylalanine resulted in an approximately
fourfold increase in insulin-induced cell growth in comparison with
that of cells expressing wild-type insulin receptors (Y1316F hIR,
8.16 ± 1.55, versus WT hIR, 2.46 ± 0.10; P < 0.05). Although not shown, double Y1316F and Y1322F mutations
produced the same effect as the single Y1316F mutation. Increased
insulin-induced cell growth upon removing the C terminus of the
-subunit of the insulin receptor or abolishing its tyrosine
phosphorylation sites in a cell derived from hepatocytes suggests that
this domain contains elements that suppress the mitogenic action of
insulin. Because a similar observation was made in cells that do not
express endogenous pp120 (2, 47, 58), the increase in the
growth-promoting action of insulin in IR
/
hepatocytes
upon mutation of the C terminus of the
-subunit of the insulin
receptor is not regulated by the endogenous expression of pp120 in hepatocytes.
In agreement with our previous thymidine uptake assays (
15),
pp120 expression decreased the effect of insulin on the growth
of cells
expressing wild-type insulin receptors by approximately
threefold (Fig.
6; WT hIR/pp120, 0.82 ± 0.12, versus WT hIR, 2.46
± 0.10;
P < 0.05). In
contrast, pp120 expression did not alter
the mitogenic action of
insulin in cells coexpressing insulin
receptors with a mutated C
terminus (

43 hIR/pp120, 7.67 ± 0.50,
versus

43 hIR,
8.88 ± 2.53; hIR-hIRRK/pp120, 12.0 ± 1.57, versus
hIR-hIRRK, 11.3 ± 1.26; and Y1316F hIR/pp120, 8.46 ± 1.09, versus
Y1316F hIR, 8.16 ± 1.55;
P > 0.05). These
data suggest that the
downregulatory effect of pp120 on insulin
mitogenesis is mediated
by the C terminus of the

-subunit of the
insulin receptor and,
in particular, by its Tyr
1316
residue, a nonconserved residue between the insulin and IGF-1
receptors.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Cell proliferation in response to insulin.
IR / hepatocytes were transfected with the wild-type
insulin receptor (WT hIR) or insulin receptor mutants ( 43,
hIR-hIRRK, Y1316F and Y960F), either alone (solid bars) or in addition
to pp120 (shaded bars). Following incubation for 24 h in
serum-containing complete medium (to determine maximum growth) or in
serum-free medium supplemented with 0.1% BSA either alone (to
determine basal growth) or with 0.1 nM insulin, cells were trypsinized
and counted. Numbers in parentheses denote the number of receptors per
cell in millions in transfectants with receptors alone (first number)
or with receptors and pp120 (second number). These experiments were
performed in triplicate and repeated at least three times. Data
represent the mean ± standard deviation of these repeated
experiments.
|
|
In contrast to mutation on the C-terminus domain of the insulin
receptor, mutation of Tyr
960 in the juxtamembrane domain
markedly decreased cell growth in
response to insulin (Y960F hIR,
0.12 ± 0.01, versus WT hIR, 2.46
± 0.10;
P < 0.05). This suggests that phosphorylation on Tyr
960 in
the juxtamembrane domain of the insulin receptor promotes
the mitogenic
action of insulin. Because IRS-2 phosphorylation
requires intact
Tyr
960 in the insulin receptor, the marked decrease in cell
growth upon
abolishing phosphorylation of this residue is not
surprising in
light of the observation that the IRS-2-PI-3' kinase
pathway mediated
insulin mitogenesis in IR
/
hepatocytes
(
52). Moreover, pp120 expression was correlated
with
decreased growth of cells transfected with Y960F receptors
(Fig.
6;

1.89 ± 0.24). Whether this is due to a proapoptotic
effect of
pp120 is not clear at the present time. Nonetheless,
as in cells
expressing wild-type insulin receptors, pp120 expression
markedly
decreased insulin-mediated growth of cells expressing
Y960F insulin
receptors compared to that of cells expressing Y960F
receptors alone
(Y960F hIR/pp120,

1.89 ± 0.24, versus Y960F hIR,
0.12 ± 0.01;
P < 0.05). This suggests that the downregulatory
effect of pp120 on the growth-promoting action of insulin does
not
require intact Tyr
960 in the juxtamembrane domain of the
receptor.
Proliferation and growth of cells expressing IGF-1 receptor
mutants.
Next, we investigated the role of pp120 on the
growth-promoting action of IGF-1 in transfected IR
/
hepatocytes. To this end, we used transfectants expressing comparable numbers of receptors per cell in each clonal pair (with or without pp120). In marked contrast to insulin, pp120 expression did not decrease the mitogenic action of IGF-1 in IR
/
hepatocytes that were cotransfected with either wild-type IGF-1 receptors (Fig. 7; WT hIGF-1R/pp120) or
with Hygror (Fig. 7; WT mIGF-1R/pp120). The effect of pp120
on IGF-1 mitogenesis ranged from a modest increase (Fig. 7; WT
hIGF-1R/pp120, 14.6 ± 0.85 versus 10.3 ± 0.45; P < 0.05) to a twofold increase (Fig. 7; WT mIGF-1R/pp120,
11.8 ± 0.89, versus WT mIGF-1R, 5.07 ± 0.65; P < 0.05). The level of increase is perhaps inversely related to
the level of phosphorylation of pp120 in response to IGF-1 in cells
expressing IGF-1 receptors (Fig. 5). Replacing the C terminus of the
IGF-1 receptor with the corresponding fragment of the insulin receptor
decreased the effect of IGF-1 on cell growth compared to that in cells
expressing wild-type receptors (Fig. 7; CHI hIGF-1R, 2.91 ± 0.37, versus WT mIGF-1R, 5.07 ± 0.65, or WT hIGF-1R, 10.3 ± 0.45;
P < 0.05). The level of decrease is marked in light of
the fact that the transfectants express about twofold more chimeric
than wild-type receptors (~1.0 × 106 versus
0.5 × 106 receptors/cell). These data suggest that
the C terminus of the
-subunit of the insulin receptor contains
elements that suppress the mitogenic action of hormones. Expressing
pp120 further decreased the effect of IGF-1 on the growth of cells
coexpressing chimeric IGF-1 receptors (Fig. 7; CHI hIGF-1R/pp120,
0.97 ± 0.13, versus CHI hIGF-1R, 2.91 ± 0.37; P < 0.05). Similarly, pp120 expression decreased the effect of
IGF-1 on the growth of IR
/
hepatocytes coexpressing
F1310Y IGF-1 receptors (Fig. 7; F1310Y hIGF-1R/pp120, 6.04 ± 0.39, versus F1310Y hIGF-1R, 11.4 ± 1.53; P < 0.05). Because replacing the C terminus of the
-subunit of the
IGF-1 receptor with the corresponding fragment of the insulin receptor
and replacing its Phe1310 with tyrosine (the corresponding
residue in the insulin receptor) restored pp120 phosphorylation in
response to IGF-1 (Fig. 5), it appears that pp120 phosphorylation is
required for its downregulatory effect on mitogenesis.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
Cell proliferation in response to IGF-1. WT mIGF-1R
represents IR / hepatocytes transfected with
Hygror plasmid alone, but expressing endogenous IGF-1
receptors. These cells were transfected with either pp120 alone (shaded
bars) or with wild-type (WT), chimeric (CHI), or F1310Y hIGF-1
receptors either alone (solid bars) or in addition to pp120 (shaded
bars). Following incubation with 0.1 nM IGF-1, as described in the
legend to Fig. 5, cells were trypsinized and counted. Numbers in
parentheses denote the number of receptors per cell in millions in
transfectants with receptors alone (first number) or with receptors and
pp120 (second number). These experiments were performed in triplicate
and repeated at least three times. Data represent the mean ± standard deviation of these repeated experiments.
|
|
Growth of cells expressing F1310Y IGF-1 receptors in response to IGF-1
was comparable to that of cells expressing wild-type
receptors (Fig.
7;
F1310Y hIGF-1R, 11.4 ± 1.53, versus WT hIGF-1R,
10.3 ± 0.45;
P > 0.05). This suggests that elements other
than
intact Phe
1310 in the C terminus of the IGF-1 receptor
play a significant role
in the growth-promoting action of IGF-1, in
agreement with previous
observations with NIH 3T3 fibroblasts
(
13). However, in light
of the endogenous expression of
IGF-1 receptors in IR
/
hepatocytes, it is hard to
conclude from the current studies
the precise effect of the
Phe
1310-to-tyrosine mutation on IGF-1 mitogenesis. Despite
the reasonably
elevated expression of IGF-1 receptors in
IR
/
hepatocytes derived from the insulin receptor
knockout mice,
the expression of IGF-1 receptors in hepatocytes is
usually much
less significant (
37). Thus, physiologic cells
derived from
the IGF-1 receptor knockout mice, for example, would
constitute
a better system to address the exact role of the
nonconserved
Phe
1310 in the IGF-1 receptor in the
differential mitogenic action of
insulin and IGF-1. Nonetheless,
mutating Phe
1310 in the IGF-1 receptor to tyrosine (the
corresponding residue
in the insulin receptor) restored the
downregulatory effect of
pp120 on IGF-1 mitogenesis. Conversely,
replacing Tyr
1316 of the insulin receptor with
phenylalanine (the corresponding
residue in the IGF-1 receptor)
abolished the downregulatory effect
of pp120 on insulin mitogenesis.
Taken together, these data suggest
that the differential effect of
pp120 on insulin vis-à-vis IGF-1
mitogenesis is regulated by the
nonconserved Tyr
1316 residue of the insulin
receptor.
 |
DISCUSSION |
The physiologic functions of insulin and IGF-1 are initiated upon
binding to their receptors followed by activation of multiple phosphorylation cascades. Because insulin and IGF-1 receptors are
related and they share many signaling mechanisms, it has been difficult
to depict the molecular basis of the different functions elicited by
their ligands (1, 5, 31).
Differential phosphorylation of pp120 by the insulin receptor is
regulated by Tyr1316, a nonconserved phosphorylation site
in the C terminus of the insulin receptor.
Using stably
transfected NIH 3T3 fibroblasts (41) and hepatocytes
(current studies), we have shown that pp120 is unique among other
substrates of the insulin receptor insofar as it does not undergo
ligand-stimulated phosphorylation by the IGF-1 receptor kinase.
Additionally, its insulin-stimulated phosphorylation is regulated by
the C terminus of the
-subunit of the insulin receptor, as opposed
to other major substrates, such as IRS-1 and Shc (2, 38).
Instead, phosphorylation of these substrates is regulated by
Tyr960 in the juxtamembrane domain of the insulin receptor
(22, 67) and its corresponding residue in the IGF-1 receptor
(8). The present studies revealed that deleting the distal
43 aa from the C terminus of the
-subunit of the insulin receptor
and, in particular, mutating the Tyr1316 residue therein
contained to phenylalanine, as is the case in the IGF-1 receptor,
abolished insulin-induced pp120 phosphorylation by the insulin receptor
without significantly altering the phosphorylation state of the
receptor. Conversely, mutating the corresponding Phe1310 in
the IGF-1 receptor to tyrosine, its corresponding residue in the
insulin receptor, restored pp120 phosphorylation by the IGF-1 receptor
in response to IGF-1. This suggests that differential pp120
phosphorylation by the insulin receptor requires intact Tyr1316, a nonconserved residue in the two receptors. These
data represent the first evidence of a single amino acid regulating
differential phosphorylation of a substrate by two closely related
receptors with ~84% homology in their tyrosine kinase domains.
Differential pp120 phosphorylation by the insulin receptor
regulates its specific downregulatory effect on insulin-induced
mitogenesis.
Because the C termini of the
-subunits of insulin
and IGF-1 receptors are the least conserved, it has long been
postulated that they regulate functional diversity between these two
related receptors. However, there has been no experimental evidence to support this hypothesis. Despite the recent evidence supporting a role
for the C terminus of the
-subunit of the insulin receptor in
regulating the metabolic action of insulin (50), most
reports agree that this domain does not regulate the metabolic action of insulin or its receptor-mediated endocytosis (2, 38, 59). More controversial is the role of the C terminus of the
-subunit of
the insulin receptor in regulating the mitogenic action of insulin
(2, 38, 59). For instance, insulin-induced thymidine uptake
and MAP kinase activity were either normal (38, 70) or
enhanced (2, 47, 58) in cells transfected with insulin receptor mutants depleted of phosphorylation sites in the C terminus. The controversy has been attributed to transfection of nonphysiologic cells in these experiments. Our current studies are the first to invoke
transfection of hepatocytes, which physiologically express high levels
of insulin receptors, to address the role of the C terminus of the
-subunit of the insulin receptor in the growth-promoting action of
insulin. Despite the fact that transforming the IR
/
hepatocytes with SV40 may decrease their physiologic state, their derivation from the liver of the insulin receptor knockout mouse rendered them ideal to study the regulation of insulin signaling by the
insulin receptor. Insulin treatment of IR
/
hepatocytes
overexpressing wild-type insulin receptors induced cell growth at a
lower level than that elicited by IGF-1 treatment of hepatocytes
transfected with wild-type IGF-1 receptors. This supports the notion
that IGF-1 is more mitogenic than insulin (1, 5, 31).
Replacement of the C terminus of the
-subunit of the IGF-1 receptor
with the corresponding fragment in the insulin receptor decreased cell
growth in response to IGF-1. Thus, the C terminus of the
-subunit of
the insulin receptor contains negative regulators of the
growth-promoting action of insulin in hepatocytes. Our data are in
disagreement with those from previous reports in which expression of
identical chimeric IGF-1 receptors in NIH 3T3 cells resulted in either
unchanged or slightly increased thymidine uptake (14) and
MAP kinase activity (61) in response to IGF-1. The
discrepancy between those results and ours may be attributed to the
different cell lines used. Nonetheless, abolishing tyrosine phosphorylation in the C terminus of the
-subunit of the insulin receptor, either by deletion or by site-directed mutagenesis, enhanced
the growth-promoting action of insulin in IR
/
hepatocytes. This suggests that tyrosine phosphorylation in the C
terminus of the
-subunit of the insulin receptor regulates the low
mitogenic action of insulin. Because we transfected cells derived from
insulin-targeted tissues, we believe that our data have finally
resolved the controversy over the downregulation of the mitogenic
action of insulin by the C terminus of the
-subunit of its receptor.
In contrast to insulin (Fig.
6) (
15), pp120 expression was
not correlated with a decrease in the mitogenic action of IGF-1
in
IR
/
hepatocytes (Fig.
7). In light of the low abundance
of IGF-1
receptors compared to that of insulin receptors in hepatocytes
(
37), the differential downregulatory effect of pp120 on the
growth-promoting action of insulin is probably physiologic. Because
pp120 phosphorylation was increased by ligand-activated insulin
receptors, but not by IGF-1 receptors (Fig.
4 and
5) (
41),
pp120
phosphorylation appears to be required for its downregulation
of
the growth-promoting action of insulin. This conclusion is
supported by
our observations that (i) restoring pp120 phosphorylation
by chimeric
and F1310Y IGF-1 receptors (Fig.
5) was correlated
with decreased IGF-1
mitogenesis by pp120 (Fig.
7), and (ii) abolishing
pp120
phosphorylation by mutating tyrosine phosphorylation sites
on either
the C terminus of the

-subunit of the insulin receptor
(Fig.
2,
3,
and
4) or on pp120 (
15) eliminated the effect of
pp120 on
insulin mitogenesis. Furthermore, mutating Tyr
960 in the
juxtamembrane domain of the

-subunit of the insulin receptor
did not
alter either the effect of pp120 on insulin mitogenesis
(Fig.
6) or its
phosphorylation by the insulin receptor (
42).
Taken
together, these data suggest that pp120 phosphorylation
by the insulin
receptor is required and sufficient to regulate
its differential
downregulatory effect on the mitogenic effects
of insulin
vis-à-vis IGF-1.
How pp120 phosphorylation regulates its effect on insulin mitogenesis
is not clear. However, Syp has recently been found to
bind to
Tyr
488 and Tyr
515 of BGP1, the human homolog of
rat pp120 (
21). Moreover, we
have recently observed that
pp120 binds to Shc and that this association
is increased upon
insulin-stimulated pp120 phosphorylation by
the insulin receptor
tyrosine kinase (M. N. Poy, M. Fernström,
and S. M. Najjar, Diabetes
48[Suppl. 1], abstr. A33, 1999).
Given
the positive role of Shc and Syp in insulin mitogenesis,
it is possible
that pp120 binding to these molecules sequesters
them and limits their
availability for GRB2 coupling to the receptor.
This would downregulate
the Ras/MAP kinase pathway, leading to
decreased cell growth,
proliferation, and mitogenesis. Insulin-induced
growth of hepatocytes
expressing Y960F insulin receptors supports
this model. Given the
regulation of phosphorylating Shc and the
IRS proteins by
Tyr
960 and their role in activating the Ras/MAP kinase and
the PI-3'
kinase pathways, it is expected that mutating
Tyr
960 in the insulin receptor to nonphosphorylatable
phenylalanine
would markedly decrease cell growth in response to
insulin (Fig.
6). When coexpressed with Y960F insulin receptors, pp120
binds
to Syp. This reduces the Syp pool available to associate with
Tyr
1322 in the receptor (
57,
64) and decreases
mitogenesis and cell
growth in response to insulin compared to that of
cells expressing
Y960F receptors
alone.
Downregulation of the mitogenic effects of insulin appears to be unique
to pp120 in comparison to that of other substrates
of the insulin
receptor, such as IRS-1, genetic ablation of which
resulted in growth
retardation in mice (
3,
60). Because IRS-1
phosphorylation
requires intact Tyr
960 in the juxtamembrane, whereas that
of pp120 requires intact Tyr
1316 in the C terminus of the
insulin receptor, phosphorylation of
pp120 by the insulin receptor
appears to provide an alternative
signaling pathway via which the
insulin receptor kinase modulates
the biologic action of insulin. In
view of the relationship between
the regulation of pp120
phosphorylation by the C terminus of the

-subunit of the insulin
receptor and the implication of this
domain in the mitogenic response
to insulin, an extension of our
hypothesis is that abnormal pp120
expression is associated with
abnormal growth and development. Further
studies are required
to shed light on this
possibility.
 |
ACKNOWLEDGMENTS |
We thank Richard A. Roth (Stanford University), Jerrold M. Olefsky (University of California, San Diego), Derek LeRoith (NIDDK, NIH), and Domenico Accili (NICHD, NIH) for providing recombinant hIR-hIRRK, Y1316F/Y1322F hIR, F1310Y hIGF-1R, and
43 hIR mutant receptors, respectively. We also thank D. Accili for providing us with
the IR
/
hepatocytes, Myrna Saouda for her technical
assistance with cloning experiments, and Curtis V. Choice and Yan Yang
for their technical assistance in transfection experiments.
This work was supported by the National Science Foundation (grant
MCB-9601427 to S.M.N.)
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Medical College
of Ohio, 3035 Arlington Ave., HSci Building, Room 270, Toledo, OH
43614. Phone: (419) 383-4059. Fax: (419) 383-2871. E-mail:
snajjar{at}mco.edu.
 |
REFERENCES |
| 1.
|
Accili, D.,
J. Drago,
E. J. Lee,
M. D. Johnson,
M. H. Cool,
P. Salvatore,
L. D. Asico,
P. A. Jose,
S. I. Taylor, and H. Westphal.
1996.
Early neonatal death in mice homozygous for a null allele of the insulin receptor gene.
Nat. Genet.
12:106-109[CrossRef][Medline].
|
| 2.
|
Ando, A.,
K. Momomura,
K. Tobe,
R. Yamamoto-Honda,
H. Sakura,
Y. Tamori,
Y. Kaburagi,
O. Koshio,
Y. Akanuma,
Y. Yazaki, et al.
1992.
Enhanced insulin-induced mitogenesis and mitogen-activated protein kinase activities in mutant insulin receptors with substitution of two COOH-terminal tyrosine autophosphorylation sites by phenylalanine.
J. Biol. Chem.
267:12788-12796[Abstract/Free Full Text].
|
| 3.
|
Araki, E.,
M. A. Lipes,
M. E. Patti,
J. C. Bruning,
B. R. Haag,
R. S. Johnson, and C. R. Kahn.
1994.
Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene.
Nature
372:186-190[CrossRef][Medline].
|
| 4.
|
Backer, J. M.,
G. G. Schroeder,
C. R. Kahn,
M. J. Myers,
P. A. Wilden,
D. A. Cahill, and M. F. White.
1992.
Insulin stimulation of phosphatidylinositol 3-kinase activity maps to insulin receptor regions required for endogenous substrate phosphorylation.
J. Biol. Chem.
267:1367-1374[Abstract/Free Full Text].
|
| 5.
|
Baker, J.,
J. P. Liu,
E. J. Robertson, and A. Efstratiadis.
1993.
Role of insulin-like growth factors in embryonic and postnatal growth.
Cell
75:73-82[CrossRef][Medline].
|
| 5a.
|
Beauchemin, N., et al.
1999.
Nomenclature announcement.
Exp. Cell Res.
252:243-249[CrossRef][Medline].
|
| 6.
|
Blenis, J.
1993.
Signal transduction via the MAP kinases: proceed at your own RSK.
Proc. Natl. Acad. Sci. USA
90:5889-5892[Abstract/Free Full Text].
|
| 7.
|
Cheung, P. H.,
N. L. Thompson,
K. Earley,
O. Culic,
D. Hixson, and S. H. Lin.
1993.
Cell-CAM105 isoforms with different adhesion functions are coexpressed in adult rat tissues and during liver development.
J. Biol. Chem.
268:6139-6146[Abstract/Free Full Text].
|
| 8.
|
Craparo, A.,
T. J. O'Neill, and T. A. Gustafson.
1995.
Non-SH2 domains within insulin receptor substrate-1 and SHC mediate their phosphotyrosine-dependent interaction with the NPEY motif of the insulin-like growth factor I receptor.
J. Biol. Chem.
270:15639-15643[Abstract/Free Full Text].
|
| 9.
|
Crews, C. M., and R. L. Erikson.
1993.
Extracellular signals and reversible protein phosphorylation: what to Mek of it all.
Cell
74:215-217[Medline].
|
| 10.
|
Danielsen, A. G.,
F. Liu,
Y. Hosomi,
K. Shii, and R. A. Roth.
1995.
Activation of protein kinase C alpha inhibits signaling by members of the insulin receptor family.
J. Biol. Chem.
270:21600-21605[Abstract/Free Full Text].
|
| 11.
|
Di Cola, G.,
M. H. Cool, and D. Accili.
1997.
Hypoglycemic effect of insulin-like growth factor-1 in mice lacking insulin receptors.
J. Clin. Investig.
99:2538-2544[Medline].
|
| 12.
|
Edlund, M., and B. Öbrink.
1993.
Evidence for calmodulin binding to the cytoplasmic domains of two C-CAM isoforms.
FEBS Lett.
327:90-94[CrossRef][Medline].
|
| 13.
|
Esposito, D. L.,
V. A. Blakesley,
A. P. Koval,
A. G. Scrimgeour, and D. LeRoith.
1997.
Tyrosine residues in the C-terminal domain of the insulin-like growth factor-I receptor mediate mitogenic and tumorigenic signals.
Endocrinology
138:2979-2988[Abstract/Free Full Text].
|
| 14.
|
Faria, T. N.,
V. A. Blakesley,
H. Kato,
B. Stannard,
D. LeRoith, and C. T. Roberts, Jr.
1994.
Role of the carboxyl-terminal domains of the insulin and insulin-like growth factor I receptors in receptor function.
J. Biol. Chem.
269:13922-13928[Abstract/Free Full Text].
|
| 15.
|
Formisano, P.,
S. M. Najjar,
C. N. Gross,
N. Philippe,
F. Oriente,
C. I. Kern-Buell,
D. Accili, and P. Gorden.
1995.
Receptor-mediated internalization of insulin. Potential role of pp120/HA4, a substrate of the insulin receptor kinase.
J. Biol. Chem.
270:24073-24077[Abstract/Free Full Text].
|
| 16.
|
Gale, N. W.,
S. Kaplan,
E. J. Lowenstein,
J. Schlessinger, and D. Bar-Sagi.
1993.
Grb2 mediates the EGF-dependent activation of guanine nucleotide exchange on Ras.
Nature
363:88-92[CrossRef][Medline].
|
| 17.
|
Grønborg, M.,
B. S. Wulff,
J. S. Rasmussen,
T. Kjeldsen, and S. Gammeltoft.
1993.
Structure-function relationship of the insulin-like growth factor-I receptor tyrosine kinase.
J. Biol. Chem.
268:23435-23440[Abstract/Free Full Text].
|
| 18.
|
Gustafson, T. A.,
W. He,
A. Craparo,
C. D. Schaub, and T. J. O'Neill.
1995.
Phosphotyrosine-dependent interaction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domain.
Mol. Cell. Biol.
15:2500-2508[Abstract].
|
| 19.
|
Hixson, D. C.,
K. D. McEntire, and B. Obrink.
1985.
Alterations in the expression of a hepatocyte cell adhesion molecule by transplantable rat hepatocellular carcinomas.
Cancer Res.
45:3742-3749[Abstract/Free Full Text].
|
| 20.
|
Hsieh, J.-T.,
W. Luo,
W. Song,
Y. Wang,
D. I. Kleinerman,
N. T. Van, and S.-H. Lin.
1995.
Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cell revealed by sense and antisense approaches.
Cancer Res.
55:190-197[Abstract/Free Full Text].
|
| 21.
|
Huber, M.,
L. Izzi,
P. Grondin,
C. Houde,
T. Kunath,
A. Veillette, and N. Beauchemin.
1999.
The carboxy-terminal region of biliary glycoprotein controls its tyrosine phosphorylation and association with protein-tyrosine phosphatases SHP-1 and SHP-2 in epithelial cells.
J. Biol. Chem.
274:335-344[Abstract/Free Full Text].
|
| 22.
|
Kaburagi, Y.,
K. Momomura,
H. R. Yamamoto,
K. Tobe,
Y. Tamori,
H. Sakura,
Y. Akanuma,
Y. Yazaki, and T. Kadowaki.
1993.
Site-directed mutagenesis of the juxtamembrane domain of the human insulin receptor.
J. Biol. Chem.
268:16610-16622[Abstract/Free Full Text].
|
| 23.
|
Kato, H.,
T. N. Faria,
B. Stannard,
C. T. Roberts, Jr., and D. LeRoith.
1994.
Essential role of tyrosine residues 1131, 1135, and 1136 of the insulin-like growth factor-I (IGF-I) receptor in IGF-I action.
Mol. Endocrinol.
8:40-50[Abstract/Free Full Text].
|
| 24.
|
Kimura, M., and M. Ogihara.
1997.
Proliferation of adult rat hepatocytes in primary culture induced by insulin is potentiated by cAMP-elevating agents.
Eur. J. Pharmacol.
327:87-95[CrossRef][Medline].
|
| 25.
|
Kleinerman, D. I.,
C. P. Dinney,
W. W. Zhang,
S. H. Lin,
N. T. Van, and J. T. Hsieh.
1996.
Suppression of human bladder cancer growth by increased expression of C-CAM1 gene in an orthotopic model.
Cancer Res.
56:3431-3425[Abstract/Free Full Text].
|
| 26.
|
Kleinerman, D. I.,
P. Troncoso,
S. H. Lin,
L. L. Pisters,
E. R. Sherwood,
T. Brooks,
A. C. von Eschenbach, and J. T. Hsieh.
1995.
Consistent expression of an epithelial cell adhesion molecule (C-CAM) during human prostate development and loss of expression in prostate cancer: implication as a tumor suppressor.
Cancer Res.
55:1215-1220[Abstract/Free Full Text].
|
| 27.
|
Lee, J., and P. F. Pilch.
1994.
The insulin receptor: structure, function and signalling.
Am. J. Physiol.
266:C319-C334[Abstract/Free Full Text].
|
| 28.
|
Levy-Toledano, R.,
L. H. Caro,
D. Accili, and S. I. Taylor.
1994.
Investigation of the mechanism of the dominant negative effect of mutations in the tyrosine kinase domain of the insulin receptor.
EMBO J.
13:835-842[Medline].
|
| 29.
|
Li, S.,
M. Resnicoff, and R. Baserga.
1996.
Effect of mutations at serines 1280-1283 on the mitogenic and transforming activities of the insulin-like growth factor I receptor.
J. Biol. Chem.
271:12254-12260[Abstract/Free Full Text].
|
| 30.
|
Lin, S. H., and G. Guidotti.
1989.
Cloning and expression of a cDNA coding for a rat liver plasma membrane ecto-ATPase. The primary structure of the ecto-ATPase is similar to that of the human biliary glycoprotein I.
J. Biol. Chem.
264:14408-14414[Abstract/Free Full Text].
|
| 31.
|
Liu, J. P.,
J. Baker,
A. S. Perkins,
E. J. Robertson, and A. Efstratiadis.
1993.
Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r).
Cell
75:59-72[Medline].
|
| 32.
|
Lowenstein, E. J.,
R. J. Daly,
A. G. Batzer,
W. Li,
B. Margolis,
R. Lammers,
A. Ullrich,
E. Y. Skolnik,
D. Bar-Sagi, and J. Schlessinger.
1992.
The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling.
Cell
70:431-442[CrossRef][Medline].
|
| 33.
|
Luo, W.,
K. Earley,
V. Tantingco,
D. C. Hixson,
T. C. Liang, and S. H. Lin.
1998.
Association of an 80 kDa protein with C-CAM1 cytoplasmic domain correlates with C-CAM1-mediated growth inhibition.
Oncogene
16:1141-1147[CrossRef][Medline].
|
| 34.
|
Luo, W.,
C. G. Wood,
K. Earley,
M. C. Hung, and S. H. Lin.
1997.
Suppression of tumorigenicity of breast cancer cells by an epithelial cell adhesion molecule (C-CAM1): the adhesion and growth suppression are mediated by different domains.
Oncogene
14:1697-1704[CrossRef][Medline].
|
| 35.
|
Maegawa, H.,
D. A. McClain,
G. Freidenberg,
J. M. Olefsky,
M. Napier,
T. Lipari,
T. J. Dull,
J. Lee, and A. Ullrich.
1988.
Properties of a human insulin receptor with a COOH-terminal truncation. II. Truncated receptors have normal kinase activity but are defective in signaling metabolic effects.
J. Biol. Chem.
263:8912-8917[Abstract/Free Full Text].
|
| 36.
|
Margolis, R. N.,
M. J. Schell,
S. I. Taylor, and A. L. Hubbard.
1990.
Hepatocyte plasma membrane ecto-ATPase (pp120/HA4) is a substrate for tyrosine kinase activity of the insulin receptor.
Biochem. Biophys. Res. Commun.
166:562-566[CrossRef][Medline].
|
| 37.
|
Morgan, D.,
K. Jarnagin, and R. Roth.
1986.
Purification and characterization of the receptor for insulin-like growth factor 1.
Biochemistry
25:5560-5564[CrossRef][Medline].
|
| 38.
|
Murakami, M. S., and O. M. Rosen.
1991.
The role of insulin receptor autophosphorylation in signal transduction.
J. Biol. Chem.
266:22653-22660[Abstract/Free Full Text].
|
| 39.
|
Najjar, S. M.
1998.
pp120, a substrate of the insulin receptor tyrosine kinase, is associated with phosphatase activity.
Biochem. Biophys. Res. Commun.
247:457-461[CrossRef][Medline].
|
| 40.
|
Najjar, S. M.,
D. Accili,
N. Philippe,
J. Jernberg,
R. Margolis, and S. I. Taylor.
1993.
pp120/ecto-ATPase, an endogenous substrate of the insulin receptor tyrosine kinase, is expressed as two variably spliced isoforms.
J. Biol. Chem.
268:1201-1206[Abstract/Free Full Text].
|
| 41.
|
Najjar, S. M.,
V. A. Blakesley,
S. Li Calzi,
H. Kato,
D. LeRoith, and C. V. Choice.
1997.
Differential phosphorylation of pp120 by insulin and insulin-like growth factor-1 receptors: role for the C-terminal domain of the beta-subunit.
Biochemistry
36:6827-6834[CrossRef][Medline].
|
| 42.
|
Najjar, S. M.,
C. V. Choice,
P. Soni,
C. M. Whitman, and M. N. Poy.
1998.
Effect of pp120 on receptor-mediated insulin endocytosis is regulated by the juxtamembrane domain of the insulin receptor.
J. Biol. Chem.
273:12923-12928[Abstract/Free Full Text].
|
| 43.
|
Najjar, S. M., and R. E. Lewis.
1999.
Persistent expression of foreign genes in cultured hepatocytes: expression vectors.
Gene
230:41-45[CrossRef][Medline].
|
| 44.
|
Najjar, S. M.,
N. Philippe,
Y. Suzuki,
G. A. Ignacio,
P. Formisano,
D. Accili, and S. I. Taylor.
1995.
Insulin-stimulated phosphorylation of recombinant pp120/HA4, an endogenous substrate of the insulin receptor tyrosine kinase.
Biochemistry
34:9341-9349[CrossRef][Medline].
|
| 45.
|
Nédellec, P.,
G. S. Dveksler,
E. Daniels,
C. Turbide,
B. Chow,
A. A. Basile,
K. V. Holmes, and N. Beauchemin.
1994.
Bgp2, a new member of the carcinoembryonic antigen-related gene family, encodes an alternative receptor for mouse hepatitis viruses.
J. Virol.
68:4525-4537[Abstract/Free Full Text].
|
| 46.
|
Neumaier, M.,
S. Paululat,
A. Chan,
P. Matthaes, and C. Wagener.
1993.
Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas.
Proc. Natl. Acad. Sci. USA
90:10744-10748[Abstract/Free Full Text].
|
| 47.
|
Pang, L.,
K. L. Milarski,
M. Ohmichi,
Y. Takata,
J. M. Olefsky, and A. R. Saltiel.
1994.
Mutation of two carboxyl-terminal tyrosines in the insulin receptor results in enhanced activation of mitogen-activated protein kinase.
J. Biol. Chem.
269:10604-10608[Abstract/Free Full Text].
|
| 48.
|
Pillay, T. S.,
J. Whittaker,
R. Lammers,
A. Ullrich, and K. Siddle.
1991.
Multisite serine phosphorylation of the insulin and IGF-I receptors in transfected cells.
FEBS Lett.
288:206-211[CrossRef][Medline].
|
| 49.
|
Pronk, G. J.,
J. McGlade,
G. Pelicci,
T. Pawson, and J. I. Bos.
1993.
Insulin-induced phosphorylation of the 46- and 52-kDa Shc proteins.
J. Biol. Chem.
268:5748-5753[Abstract/Free Full Text].
|
| 50.
|
Reusch, J. E.,
P. Hsieh,
P. Bhuripanyo,
K. Carel,
J. W. Leitner,
J. M. Olefsky, and B. Draznin.
1995.
Insulin inhibits nuclear phosphatase activity: requirement for the C-terminal domain of the insulin receptor.
Endocrinology
136:2464-2469[Abstract].
|
| 51.
|
Rosenberg, M.,
P. Nedellec,
S. Jothy,
D. Fleiszer,
C. Turbide, and N. Beauchemin.
1993.
The expression of mouse biliary glycoprotein, a carcinoembryonic antigen-related gene, is down-regulated in malignant mouse tissues.
Cancer Res.
53:4938-4945[Abstract/Free Full Text].
|
| 52.
|
Rother, K. I.,
Y. Imai,
M. Caruso,
F. Beguinot,
P. Formisano, and D. Accili.
1998.
Evidence that IRS-2 phosphorylation is required for insulin action in hepatocytes.
J. Biol. Chem.
273:17491-17497[Abstract/Free Full Text].
|
| 53.
|
Sasaoka, T.,
D. W. Rose,
A. R. Saltiel,
B. Draznin, and J. M. Olefsky.
1994.
Evidence for a functional role of Shc proteins in mitogenic signaling induced by insulin, insulin-like growth factor-I, and epidermal growth factor.
J. Biol. Chem.
269:13689-13694[Abstract/Free Full Text].
|
| 54.
|
Shier, P., and V. M. Watt.
1992.
Tissue-specific expression of the rat insulin receptor-related receptor gene.
Mol. Endocrinol.
6:723-729[Abstract/Free Full Text].
|
| 55.
|
Sippel, C. J.,
R. J. Fallon, and D. H. Perlmutter.
1994.
Bile acid efflux mediated by the rat liver canalicular bile acid transport/ecto-ATPase protein requires serine 503 phosphorylation and is regulated by tyrosine 488 phosphorylation.
J. Biol. Chem.
269:19539-19545[Abstract/Free Full Text].
|
| 56.
|
Skolnik, E. Y.,
A. Batzer,
N. Li,
C. H. Lee,
E. Lowenstein,
M. Mohammadi,
B. Margolis, and J. Schlessinger.
1993.
The function of GRB2 in linking the insulin receptor to Ras signaling pathways.
Science
260:1953-1955[Abstract/Free Full Text].
|
| 57.
|
Staubs, P. A.,
D. R. Reichart,
A. R. Saltiel,
K. L. Milarski,
H. Maegawa,
P. Berhanu,
J. M. Olefsky, and B. L. Seely.
1994.
Localization of the insulin receptor binding sites for the SH2 domain proteins p85, Syp, and GAP.
J. Biol. Chem.
269:27186-27192[Abstract/Free Full Text].
|
| 58.
|
Takata, Y.,
N. J. Webster, and J. M. Olefsky.
1991.
Mutation of the two carboxyl-terminal tyrosines results in an insulin receptor with normal metabolic signaling but enhanced mitogenic signaling properties.
J. Biol. Chem.
266:9135-9139[Abstract/Free Full Text].
|
| 59.
|
Takata, Y.,
N. J. G. Webster, and J. M. Olefsky.
1992.
Intracellular signaling by a mutant human insulin receptor lacking the carboxyl-terminal tyrosine autophosphorylation sites.
J. Biol. Chem.
267:9065-9070[Abstract/Free Full Text].
|
| 60.
|
Tamemoto, H.,
T. Kadowaki,
K. Tobe,
T. Yagi,
H. Sakura,
T. Hayakawa,
Y. Terauchi,
K. Ueki,
Y. Kaburagi,
S. Satoh, et al.
1994.
Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1.
Nature
372:182-186[CrossRef][Medline].
|
| 61.
|
Tartare, S.,
I. Mothe,
A. Kowalski-Chauvel,
J. P. Breittmayer,
R. Ballotti, and E. Van Obberghen.
1994.
Signal transduction by a chimeric insulin-like growth factor-1 (IGF-1) receptor having the carboxyl-terminal domain of the insulin receptor.
J. Biol. Chem.
269:11449-11455[Abstract/Free Full Text].
|
| 62.
|
Thompson, N. L.,
S. H. Lin,
M. A. Panzica, and D. C. Hixson.
1994.
Cell CAM 105 isoform RNA expression is differentially regulated during rat liver regeneration and carcinogenesis.
Pathobiology
62:209-220[CrossRef][Medline].
|
| 63.
|
Turbide, C.,
T. Kunath,
E. Daniels, and N. Beauchemin.
1997.
Optimal ratios of biliary glycoprotein isoforms required for inhibition of colonic tumor cell growth.
Cancer Res.
57:2781-2788[Abstract/Free Full Text].
|
| 64.
|
Van Horn, D. J.,
M. G. Myers, Jr., and J. M. Backer.
1994.
Direct activation of the phosphatidylinositol 3-kinase by the insulin receptor.
J. Biol. Chem.
269:29-32[Abstract/Free Full Text].
|
| 65.
|
White, M. F.
1998.
The IRS-signalling system: a network of docking proteins that mediate insulin and interleukin signalling.
Mol. Cell. Biochem.
182:3-11[CrossRef][Medline].
|
| 66.
|
White, M. F., and C. R. Kahn.
1994.
The insulin signaling system.
J. Biol. Chem.
269:1-4[Free Full Text].
|
| 67.
|
White, M. F.,
J. N. Livingston,
J. M. Backer,
V. Lauris,
T. J. Dull,
A. Ullrich, and C. R. Kahn.
1988.
Mutation of the insulin receptor at tyrosine 960 inhibits signal transmission but does not affect its tyrosine kinase activity.
Cell
54:641-649[CrossRef][Medline].
|
| 68.
|
Withers, D. J.,
J. S. Gutierrez,
H. Towery,
D. J. Burks,
J. M. Ren,
S. Previs,
Y. Zhang,
D. Bernal,
S. Pons,
G. I. Shulman,
S. Bonner-Weir, and M. F. White.
1998.
Disruption of IRS-2 causes type 2 diabetes in mice.
Nature
391:900-904[CrossRef][Medline].
|
| 69.
|
Xiao, S.,
D. W. Rose,
T. Sasaoka,
H. Maegawa,
T. R. J. Burke,
P. P. Roller,
S. E. Shoelson, and J. M. Olefsky.
1994.
Syp (SH-PTP2) is a positive mediator of growth factor-stimulated mitogenic signal transduction.
J. Biol. Chem.
269:21244-21248[Abstract/Free Full Text].
|
| 70.
|
Yamamoto-Honda, R.,
T. Kadowaki,
K. Momomura,
K. Tobe,
Y. Tamori,
Y. Shibasaki,
Y. Mori,
Y. Kaburagi,
O. Koshio,
Y. Akanuma, et al.
1993.
Normal insulin receptor substrate-1 phosphorylation in autophosphorylation-defective truncated insulin receptor. Evidence that phosphorylation of substrates might be sufficient for certain biological effects evoked by insulin.
J. Biol. Chem.
268:16859-16865[Abstract/Free Full Text].
|
| 71.
|
Yamasaki, H.,
D. Prager,
S. Gebremedhin, and S. Melmed.
1992.
Human insulin-like growth factor I receptor 950 tyrosine is required for somatotroph growth factor signal transduction.
J. Biol. Chem.
267:20953-20958[Abstract/Free Full Text].
|
| 72.
|
Zhang, B., and R. A. Roth.
1992.
The insulin receptor-related receptor. Tissue expression, ligand binding specificity, and signaling capabilities.
J. Biol. Chem.
267:18320-18328[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 2000, p. 3896-3905, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Park, S.-Y., Cho, Y.-R., Kim, H.-J., Hong, E.-G., Higashimori, T., Lee, S. J., Goldberg, I. J., Shulman, G. I., Najjar, S. M., Kim, J. K.
(2006). Mechanism of glucose intolerance in mice with dominant negative mutation of CEACAM1. Am. J. Physiol. Endocrinol. Metab.
291: E517-E524
[Abstract]
[Full Text]
-
Dupont, J., Dunn, S. E., Barrett, J. C., LeRoith, D.
(2003). Microarray Analysis and Identification of Novel Molecules Involved in Insulin-like Growth Factor-1 Receptor Signaling and Gene Expression. Recent Prog Horm Res
58: 325-342
[Abstract]
[Full Text]
-
Poy, M. N., Ruch, R. J., Fernstrom, M. A., Okabayashi, Y., Najjar, S. M.
(2002). Shc and CEACAM1 Interact to Regulate the Mitogenic Action of Insulin. J. Biol. Chem.
277: 1076-1084
[Abstract]
[Full Text]