Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 3928-3941, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Neoplastic Transformation by Notch Requires
Nuclear Localization
Shawn
Jeffries and
Anthony J.
Capobianco*
Department of Molecular Genetics,
Biochemistry and Microbiology, University of Cincinnati College of
Medicine, Cincinnati, Ohio 45267-0524
Received 28 December 1999/Returned for modification 28 February
2000/Accepted 8 March 2000
 |
ABSTRACT |
Notch proteins are plasma membrane-spanning receptors that mediate
important cell fate decisions such as differentiation, proliferation,
and apoptosis. The mechanism of Notch signaling remains poorly
understood. However, it is clear that the Notch signaling pathway
mediates its effects through intercellular contact between neighboring
cells. The prevailing model for Notch signaling suggests that ligand,
presented on a neighboring cell, triggers proteolytic processing of
Notch. Following proteolysis, it is thought that the intracellular
portion of Notch (Nic) translocates to the nucleus, where
it is involved in regulating gene expression. There is considerable
debate concerning where in the cell Notch functions and what proteins
serve as effectors of the Notch signal. Several Notch genes have
clearly been shown to be proto-oncogenes in mammalian cells. Activation
of Notch proto-oncogenes has been associated with tumorigenesis in
several human and other mammalian cancers. Transforming alleles of
Notch direct the expression of truncated proteins that primarily
consist of Nic and are not tethered to the plasma membrane.
However, the mechanism by which Notch oncoproteins (generically termed
here as Nic) induce neoplastic transformation is not known.
Previously we demonstrated that N1ic and N2ic
could transform E1A immortalized baby rat kidney cells (RKE) in vitro.
We now report direct evidence that N1ic must accumulate in
the nucleus to induce transformation of RKE cells. In addition, we
define the minimal domain of N1ic required to induce
transformation and present evidence that transformation of RKE cells by
N1ic is likely to be through a CBF1-independent pathway.
 |
INTRODUCTION |
Notch proteins are cell surface
transmembrane-spanning receptors which mediate critically important
cellular functions through direct cell-cell contact. Interaction
between Notch and its proposed ligand, Delta or Serrate/Jagged,
initiates a signaling cascade that governs cell fate decisions such as
differentiation, proliferation, and apoptosis in numerous tissue types
(2, 9, 27, 57, 58, 69). There are four mammalian Notch
genes, Notch1/TAN-1, Notch2, Notch3, and Notch4/Int-3, which are
expressed in both overlapping and distinct patterns throughout
mammalian tissues (11, 12, 17, 22, 45, 49, 71, 86, 90, 91,
93). Multiple genes for each ligand (6, 29, 38, 53, 60, 62,
64, 77, 87) as well as genes for numerous modulators of Notch
signaling (3, 5, 13, 19, 25, 34, 35, 37, 55, 88, 94) have
been identified. The growing array of elements in the Notch pathway
confers extensive complexity on this signaling system.
Substantial evidence indicates three members of the mammalian Notch
family are involved in the generation of neoplasia (8, 17, 50, 54,
67, 70, 74, 93). TAN-1 was identified as a chromosomal
translocation, t(7;9)(q34;q34.3), involving the T-cell receptor
locus and the human Notch1 gene in T-cell acute lymphoblastic leukemias
(17). This translocation resulted in constitutive expression
of aberrant Notch1 transcripts that consist primarily of the
intracellular domain. Mouse bone marrow infected with retroviral
vectors expressing analogous truncated Notch1/TAN-1 failed to
demonstrate transformation in vitro but, when reconstituted into
irradiated syngeneic mice, gave rise to T-cell neoplasms with a latency
of 11 to 40 weeks (3, 67).
Our lab has demonstrated that an E1A-immortalized baby rat kidney cell
line (RKE) can be directly transformed by ectopic expression of
constitutive alleles of Notch1 and Notch2 (N1ic and
N2ic), indicating these proteins have a direct role in the
transformation of cells. Furthermore, N1ic has the ability
to transform primary baby rat kidney cells in cooperation with E1A
(8).
Genetic evidence indicates Notch1 can cooperate with cellular
proto-oncogenes to accelerate tumorigenesis in different tissue types.
Retroviral insertion into the Notch1 locus has led to acceleration of
tumorigenesis in mouse mammary tumor virus
(MMTVD)/c-myc transgenic mice and in
MMTV/neu transgenic mice (14, 26). Both
insertional events led to expression of aberrant truncated transcripts
encoding intracellular sequences of Notch1.
Notch2 and Notch4 have also been implicated in neoplasia. Recombinant
feline leukemia virus isolated from a thymic lymphoma was found to
contain sequences derived from the feline Notch2 gene (74).
Evidence that Notch4 is involved in neoplasia has been derived through
studies of MMTV insertional mutagenesis. The int-3 locus was
initially identified as a common site of integration for MMTV
(24). Proviral insertion in this locus led to expression of
Notch4 intracellular sequences. The resulting aberrant Notch4 proteins
have been shown to contribute to the generation of mammary carcinoma in
the mouse as well as directly transform mouse mammary epithelia in
vitro (22, 23, 70, 80).
In all of the described incidences of Notch genes associated with
tumorigenesis, the common theme is the constitutive expression of
truncated Notch proteins consisting primarily of the intracellular domain that are not tethered to the plasma membrane. Once deleted of
extracellular sequences, Notch proteins are thought to be
constitutively active; when expressed in both vertebrates and
invertebrates, they localize primarily in the nucleus (1, 8, 18,
20, 35, 43, 52, 63, 75, 82).
A current model of Notch signal transduction suggests that ligand
binding to the extracellular domain induces proteolytic cleavage that
releases the intracellular domain (Nic) which then
translocates to the nucleus, where it alters gene expression (2,
20, 36, 44, 75, 81, 83). The mechanism by which Notch influences
gene expression is not well understood. In one model, Notch is believed
to directly control transcription via interactions with CBF1
[c-promoter binding factor, Su(H) (Suppressor of Hairless), or
RBP-J
]. CBF1 is a sequence-specific DNA binding protein
that functions to repress transcription of cellular genes (15,
85). Ligand-activated Notch proteins are thought to bind to CBF1
in the nucleus, displace a complex of corepressors, and, in turn, lead
to activation of target gene transcription (10, 30, 31, 33, 35,
40, 47, 48, 66, 84). However, recent evidence indicates that
Notch participates in cellular functions that are independent of CBF1
activation, implying alternative effectors of the Notch signaling
pathway (56, 61, 65, 78, 89).
The relevance of Notch nuclear translocation in signal transduction
remains controversial (2). A recent report has demonstrated evidence of nuclear accumulation of endogenous Notch upon ligand stimulation in mouse cortical neurons. However, these authors were not
able to define a strict correlation between Notch signaling and nuclear
translocation (76).
Indirect evidence that Notch might function within the nucleus has been
demonstrated in Drosophila, where ligand-activated Notch-GAL4-VP16 fusion proteins were found to activate transcription of
an upstream activation sequence-lacZ transgene containing
GAL4 DNA binding sites, presumably through proteolytic cleavage and subsequent nuclear translocation (51, 81).
Using the in vitro RKE transformation assay, we report that
N1ic must accumulate within the nucleus to elicit
biological function. In addition, we define the minimal domain of
Nic able to induce transformation of RKE cells, and we
report that transformation is likely to be independent of CBF1 activation.
 |
MATERIALS AND METHODS |
Plasmids, PCR mutagenesis, and expression constructs.
Human
Nic deletion mutants were generated with high-fidelity PCR
using a full-length human Notch1 expression vector as the template. Two
5' cloning primers were designed to initiate translation at either
Nic residue 1759 or residue 1848. Each contains a
BamHI restriction site upstream of the initiator codon and
the following sequences: Nic 1759 AAAGGATCCACCATGGCACGCAAGCGCCGGCGCAGTCAT;
and Nic 1848, AAAGGATCCACCATGGCACACCTGGATGCCGCTGACCTG
(BamHI site is shown in italics, initiator methionine
is in bold, and Nic sequences are underlined). Each of the
5' primers was paired with the following list of 3' cloning primers to
generate C-terminal truncations. Each primer contains an
XhoI restriction site (shown in italics), Nic
sequences are underlined, and the numbers indicate the C-terminal residue: Nic 2556, GCGCCTCGAGCTTGAACGCCTCCGGGATGCG;
Nic 2444, GCGCCTCGAGCACGTCTGCCTGGCTCGG;
Nic 2358, GCGCCTCGAGGCTGGCAGCAAGGCTACT;
Nic 2202, GCGCCTCGAGGTCCACGGGCGAGAGCAT;
Nic 2171, GCGCCTCGAGGCTTCCACAGGCCAGGCCTTT;
Nic 2120, GCGCCTCGAGCACCAGGTTGTACTCGTCCAG;
Nic 2095, GCGCCTCGAGGTCCATATGATCCGTGAT; and
Nic 1991, GCGCCTCGAGGGCATCCAGGTCTGTGGC. PCR
products were generated with Vent polymerase (New England Biolabs)
using the following cycling parameters: denature at 94°C for 1 min,
anneal at 58°C for 1 min, and extend at 72°C for 2 min (25 cycles).
PCR products were ligated into pBp283, a pBabe-puro derived retroviral
vector containing a C-terminal Myc epitope tag (EQKLISEEDL). Sequences for all constructs were verified by automated sequencing. Inserts containing the Myc epitope tag were subsequently subcloned into pcDNA3.1 (Invitrogen).
Site-directed mutagenesis of Nic was accomplished using the
QuickChange mutagenesis system (Stratagene) according to the
manufacturer's protocol. The following primer combinations were used
to introduce point mutations within the fourth ankyrin repeat:
NicANKm1 top,
CGCATGCATGATGCGACGGCGCCAGCGATCCTGGCTGCC; NicANKm1 bottom,
GGCAGCCAGGATCGCTGGCGCCGTCGCATCATGCATGCG; NicANKm2 top,
GACGCCACTGATCCTGGAATTCCGCCTGGCCGTGGAGG; and
NicANKm2 bottom,
CTCCACGGCCAGGCGGAATTCCAGGATCAGTGGCGTC.
Substituted codons are in bold. A 10-amino-acid deletion of
Nic residues 2105 to 2114 was engineered using the primers:
Nic
2105-2114 top
(CGCGACATCGCACAGGAGGACGAGTACAACCTGGTG) and
Nic
2105-2114 bottom
(CACCAGGTTGTACTCGTCCTCCTGTGCGATGTCGCG. 5' and 3' boundaries of the deletion are in bold.
N
ic constructs containing either a nuclear export signal
(NES) or a nuclear localization signal (NLS) were constructed by
subcloning
N
ic fragments into modified pBp283 vectors. To
generate pBp283NES,
oligonucleotides encoding the following amino acids
were annealed
and ligated into pBp283:
LALKLAGLDLEQKLISEEDL (NES sequence
is in
bold and Myc epitope is underlined [
92]).
pBp283NLS was
constructed to encode the following residues:
PKKKRKVEQKLISEEDL (NLS sequence is in
bold, and Myc epitope is underlined [
39]).
Cell culture and transformation assays.
Generation of baby
rat kidney cells immortalized with E1A (RKE cells) has been previously
described (8). RKE, HeLa, Bosc23 (68), and 293T
cells were incubated at 37°C in 5.5% CO2 and propagated
in Dulbecco's modified Eagle medium (DMEM) supplemented with 10%
fetal bovine serum (FBS), 2 mM L-glutamine, 100 U of penicillin per ml, and 100 µg of streptomycin per ml (Life
Technologies). For focus formation assays 106 RKE cells
were seeded onto 100-mm-diameter dishes 12 h prior to
transfection; 10 µg of pBp283 expression construct DNA was diluted in
1.5 ml of OptiMEM (Life Technologies) containing 15 µl of
Lipofectamine (Life Technologies) and incubated with cells for 8 h
at 37°C in 5.5% CO2 in a total volume of 6.5 ml of
OptiMEM. At 48 h posttransfection, cells were trypsinized and
split; half of the cells were selected in puromycin (2 µg/ml) to
score transfection efficiency, while the remaining half were maintained
in culture and fed fresh medium twice per week. After 2 weeks, the
puromycin-selected colonies were fixed in methanol and stained with a
solution of 0.5% methylene blue in 70% isopropanol, and
drug-resistant colonies were counted. After 4 weeks, the focus assay
plates were processed as described above and foci were counted. Focus
formation efficiency was calculated as the number of foci formed
divided by the number of puromycin-resistant colonies for each assay.
Clonal lines of transformed RKE cells were established by trypsin
dissociation of foci isolated with cloning cylinders. Isolated
cells
were propagated in DMEM supplemented with the appropriate
selectable
marker (2 µg of puromycin per ml or 400 µg of neomycin
per ml).
Polyclonal cell lines for mutant constructs were established
by
transfection of expression vector DNA and subsequent drug selection.
After 2 weeks, drug-resistant colonies were pooled and propagated
under
selection
conditions.
Transformed RKE cells were assayed for anchorage-independent growth
using the following protocol. A total of 5.0 × 10
3
cells from the indicated stable cell lines were suspended in
6 ml of
DMEM containing 20% FBS and 0.35% low-melting-point agarose.
The
suspension was overlaid onto a 6-ml base of DMEM, 10% FBS,
and 0.7%
low-melting-point agarose in 60-mm-diameter dishes. Plates
were
incubated at 37°C in 5.5% CO
2 for 3 weeks and then
photographed
with a Zeiss IM-35 inverted microscope at a magnification
of ×100.
Protein expression analysis.
For transient expression,
3.0 × 106 Bosc23 or 293T cells were transfected with
5 µg of the indicated plasmid DNA using calcium phosphate
precipitation. At 48 h posttransfection, cell lysates were
prepared in standard lysis buffer (150 mM NaCl, 50 mM HEPES [pH 7.4],
1 mM EDTA, 0.5 mM dithiothreitol, 10% glycerol, 1% NP-40) supplemented with the protease inhibitors Pefabloc (2 mM), leupeptin (5 µg/ml), and aprotinin (2 µg/ml). Proteins were separated on sodium
dodecyl sulfate (SDS)-8% polyacrylamide gels and immobilized on
a nitrocellulose membrane (Schleicher & Schuell) by wet transfer, and equal loading was verified by staining with Ponceau S. Notch proteins were detected with the indicated antibodies using standard immunoblotting procedures. Proteins were visualized with enhanced chemiluminescence (ECL kit; Amersham) and exposure to X-ray film.
Indirect immunofluorescence (IF).
Cells expressing the
indicated Nic mutant were seeded at 5.0 × 104 cells per well on four-chamber glass slides (LabTech)
12 h prior to processing. Unless noted otherwise, all steps were
performed at 4°C. Cells were washed twice with ice-cold
phosphate-buffered saline (PBS) and then fixed for 30 min in 3%
paraformaldehyde. Cells were washed in PBS supplemented with 3% FBS,
permeabilized for 5 min in 0.2% Triton X-100, and washed in PBS-3%
FBS. Cells were incubated for 1 h at room temperature in a
blocking solution consisting of PBS-3% FBS and 0.5% Tween 20. Where
indicated, either 9E10 (1:500) or bTAN15A (1:2) diluted in PBS-3% FBS
was added to each chamber and incubated with rocking at room
temperature for 1 h. Slides were washed in PBS-3% FBS and were
then incubated with an appropriate Cy3-conjugated secondary antibody
(1:1,000 dilution) for 30 min at room temperature. Following final
washes, cells were mounted in 70% glycerol containing
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (DAPI; 0.1 µg/ml), and Nic proteins were visualized and photographed
on a Zeiss Axiophot fluorescent microscope with a Hamamatsu digital
camera at a magnification of ×400.
Luciferase reporter gene assay.
A luciferase reporter
plasmid (8x-CBF1-luc) containing eight copies of the CBF1 DNA binding
consensus sequence (CGTGGGAA) cloned into the pGL2 reporter
vector (Promega) (21) (provided by P. D. Ling, Baylor
College of Medicine) was used to analyze the ability of Nic
deletion constructs to interact with CBF1 within cells. For luciferase activity, 2.5 × 105 HeLa cells were seeded in
six-well plates and were cotransfected with 400 ng of 8x-CBF1-luc, 400 ng of RL-TK (renilla luciferase control plasmid; Promega), and 800 ng
of the indicated expression plasmid. Cells were transfected using 8 µl of Lipofectamine in a total volume of 2 ml of OptiMEM; 48 h
posttransfection, cells were lysed and luciferase and renilla light
units were measured in a Xylux Femptomaster FB 12 luminometer according
to manufacturer's suggested protocol for the Dual Luciferase assay
(Promega). Luciferase values were corrected for transfection efficiency
by dividing luciferase light units by renilla light units (expressed as
relative luciferase units).
Immunoprecipitation and GST-CBF1 pull-down from stable
Nic-expressing lysates.
Whole cell lysates were made
from stable RKE cell lines expressing the indicated mutant construct.
Approximately 2 × 107 cells were washed twice in
ice-cold PBS, scraped into centrifuge tubes, collected by
centrifugation, and lysed on ice for 20 min in 1 ml of standard lysis
buffer. Cell debris was cleared by centrifugation for 30 min at
10,000 × g in a Heraus benchtop 4°C centrifuge. The
resulting supernatant was divided into two 500-µl aliquots. To
determine protein expression, one aliquot was immunoprecipitated with
Nic polyclonal antiserum 925, a rabbit polyclonal antiserum
directed against residues 1759 to 2095 of human Nic. Immune
complexes were collected on protein A-Sepharose beads, washed in
standard lysis buffer, and separated by SDS-polyacrylamide gel
electrophoresis (PAGE) on an 8% gel, and Nic proteins were
detected by Western blotting against the Myc epitope. The other
500-µl aliquot was precleared for 2 h with 10 µg of glutathione S-transferase (GST)-Sepharose beads. Beads were
removed following brief centrifugation, and the lysates were then split into two equal aliquots (250 µl); one received approximately 10 µg
of GST-CBF1 fusion protein-bound beads, and the other received approximately 10 µg of GST-bound beads. Complexes were formed at
4°C with constant rocking for 8 h. Following incubation, beads were washed five times in standard lysis buffer, and protein complexes were separated by SDS-PAGE (8% gel) Nic proteins were
detected by Western blotting against the Myc epitope.
 |
RESULTS |
Construction and expression of human Notch1 deletion
mutants.
Previously we reported that ectopic expression of
Nic can transform primary baby rat kidney cells in
cooperation with E1A or a cell line immortalized by E1A (RKE).
Moreover, cells transformed by Nic exhibit
anchorage-independent growth and are tumorigenic in nude mice
(8).
To determine the functional domains in N
ic that are
necessary and/or sufficient for neoplastic transformation, we generated
a series of N- and C-terminal deletion mutants of N
ic (see
Materials and Methods for details; Fig.
1A). The boundaries
of these deletion
mutants were designed to systematically eliminate
primary sequence
motifs in N
ic. N
ic
2444 is deleted for the
entire PEST region at the C-terminal tail
of N
ic.
N
ic
2358 is deleted of sequences that encode both the
PEST and OPA motifs.
N
ic
2202 is deleted of 156 additional residues N terminal to the OPA motif
and terminates adjacent
to a putative NLS. An additional C-terminal
truncation
(N
ic
2095) removes all 461 amino acids C terminal to the
ankyrin repeat
(ANK) domain, leaving the ANK domain sequences intact.
The sole
N-terminal deletion (N
ic
R) removes two putative
NLSs and the binding site for the mammalian
Su(H) homologue CBF1 (RAM
domain). Deletion of the RAM domain
has previously been shown to
abolish the ability of N
ic to interact with CBF1 (
4,
31,
75,
84). C-terminal deletions
were made in the context of
both the full-length N
ic and the N-terminally deleted form
of N
ic. All deletion mutants encode a C-terminal Myc
epitope tag for
detection with 9E10.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of Nic deletion
constructs used in this study. (A) Constructs were designed to delete
apparent secondary structure motifs, namely, C-terminal PEST, OPA, and
ANK domains and a putative NLS. N-terminal deletions
(Nic R) were designed to remove putative NLSs and the
binding site for CBF1 (RAM domain). All constructs have been engineered
with a C-terminal Myc epitope tag to facilitate detection (m). The N
terminus begins at residue 1759 in Nic constructs and at
residue 1848 in Nic R constructs. Indicated are the
residue numbers from full-length human Notch1, which form the
C-terminal boundaries of all deletion constructs. Transformation
potential refers to the ability of these constructs to elicit focus
formation. (B) Verification of Nic deletion mutant
expression in transiently transfected Bosc23 cells. Bosc23 cells were
transfected with the indicated Nic expression vector as
described in Materials and Methods. Cell lysates were analyzed for
protein expression by Western blotting against the Myc epitope with
9E10. Indicated above each lane is the residue number that forms the
C-terminal boundaries for each deletion construct (top, Nic
deletion constructs; bottom, Nic R deletion constructs).
Molecular mass markers are indicated to the left.
|
|
To verify that these constructs expressed stable proteins of the
anticipated size, expression plasmids were transiently transfected
into
the retroviral packaging cell line Bosc23. Western blot analysis
of
cellular lysates from transfected Bosc23 cells revealed that
all
deletion constructs expressed the predicted size protein (Fig.
1B).
The 354 C-terminal amino acid residues encoding the OPA and PEST
domains are dispensable for neoplastic transformation.
To assay
for focus formation, plasmids encoding Nic C-terminal
deletion mutants expressed from a retroviral long terminal repeat were
transfected into RKE cells. At 48 h posttransfection, cells were
harvested and split into two plates. Half of the cells were plated into
medium containing puromycin (2 µg/ml) to select for the linked drug
resistance marker (Fig.
2A,
bottom row). Cells were maintained in culture for 2 weeks until
drug-resistant colonies were detected. These plates were used to
control for total number of transfected cells and to determine
transformation efficiency for each deletion construct (Table
1). The remaining transfected cells were
plated and monitored for focus formation as described in Materials and
Methods (Fig. 2A, top row).

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion analysis maps the minimal Nic
transforming domain. (A) Nic deletion construct focus assay
plates (top row) with corresponding puromycin selection plates (bottom
row); (B) Nic R deletion construct focus assay plates
(top row) with corresponding puromycin selection plates (bottom row).
Transfected plasmid DNA is indicated above each set of plates
(Nic and Nic R mutant constructs are
diagrammed in Fig. 1A). Four weeks posttransfection, the plates were
fixed and stained, and foci were counted as described in Materials and
Methods. (C) Expression of Nic mutant proteins in RKE cell
lines. Transformed RKE cell lysates were immunoprecipitated with
Nic polyclonal antiserum 925; proteins were detected by
Western blotting with 9E10. (D) Nic-transformed RKE cell
lines exhibit anchorage-independent growth in soft agar. Stable RKE
cell lines were suspended in 0.35% agarose and monitored for growth; 3 weeks after plating, colonies were photographed at a magnification of
×100. (A) Parental RKE cell line; (B) RKE cell line expressing GFP;
(C) Nic, (D) Nic R; (E)
Nic -2444; (F) Nic R-2444; (G)
Nic 2202; (H) Nic R-2202.
|
|
Deletion of 354 C-terminal residues flanking the putative NLS
(N
ic
2202) did not greatly affect ability of
N
ic to induce foci. Cells transfected with
N
ic
2202 formed foci with similar efficiency as cells
transfected with
N
ic (Table
1); however,
N
ic
2202-induced foci were consistently smaller than
N
ic-induced foci (Fig.
2A). We found that a C-terminal
deletion that
removes both the OPA and PEST domains
(N
ic
2358) resulted in an increase from 46.9% to 67.1%
in the efficiency
of focus formation compared to full-length
N
ic (Table
1). Although more efficient in transformation,
the foci
resulting from transfection of RKE cells with
N
ic
2358 are indistinguishable in appearance from
N
ic-induced foci (Fig.
2A, top row). Removal of the PEST
domain (N
ic
2444) had no effect on
N
ic-induced focus formation (Table
1; plate not shown). In
contrast,
N
ic
2095 resulted in a complete loss of
transformation when transfected
into RKE cells (Fig.
2A). Transfection
efficiencies for these
constructs were essentially equal as determined
by selection in
puromycin (Fig.
2A, bottom
row).
The RAM domain of Nic is not required for focus
formation or growth in semisolid medium.
We determined if deletion
of amino-terminal NLSs and the binding site for the transcriptional
regulatory protein CBF1 (RAM domain) had any consequence on the ability
of Nic to transform RKE cells. Nic constructs
comprised of both C-terminal and N-terminal deletions were assayed for
focus formation (Fig. 2B, top row). Each Nic
R mutant was
approximately 70 to 85% as efficient in focus formation as their
cognate Nic deletion clone which contains the RAM domain
(Table 1). The growth characteristics of Nic
R-induced
foci are equivalent to Nic deletion constructs pictured in
Fig. 2A.
To determine protein expression and the ability of the transformed
cells to form colonies in semisolid media, individual foci
were
isolated for each transforming N
ic mutant. Figure
2C shows
the results of Western blot analysis
of cellular lysates from
transformed cell lines. All isolated
foci expressed proteins of the
predicted size, indicating that
expression of N
ic deletion
constructs are responsible for the observed transformed
phenotype.
Cells from transformed RKE lines were seeded into semisolid media to
assay for anchorage-independent growth. Results obtained
from this
analysis revealed that all of the N
ic and
N
ic
R deletion mutants that formed foci were equally
capable of forming
colonies in soft agar (Fig.
2D). The parental RKE
cells and cells
stably expressing green fluorescent protein (GFP)
failed to form
colonies (Fig.
2D). No apparent difference in colony
size was
observed between N
ic and N
ic
R
mutant constructs. Furthermore, RKE cells expressing
N
ic
R were tumorigenic when injected into nude mice (data
not
shown).
The results obtained from focus formation analysis and soft agar assays
indicate that the minimal transformation domain of
N
ic
consists of 355 amino acids encompassing residues 1848 through
2202. These sequences encode the ANK domain and 107 additional
C-terminal
residues. The minimal transformation domain will subsequently
be
referred to as the TFD (transformation
domain).
Nic TFD is sensitive to mutation.
To define
elements within the TFD that are required for focus formation, we
engineered C-terminal deletion mutants in the region between
Nic
2202 and Nic
2095. In addition, we
constructed a small internal deletion and two site-directed mutations
within the context of Nic (Fig.
3A). Nic
2171, which is
deleted of only 31 N-terminal amino acid residues from Nic
2202, was severely impaired for focus formation (Fig.
3B). Transfection of RKE cells with this construct resulted in only
18.1% efficiency of focus formation (Table 1). However, the size of
foci generated with Nic
2171 was greatly reduced compared
to that of Nic
2202 (Fig. 3B; compare to Fig. 2A).
Nic
2120, which expresses a mutant protein missing an
additional 51 amino acids N terminal to 2171, resulted in a phenotype
identical to that of Nic
2171 (Table 1; focus plate not
shown).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
The TFD is sensitive to mutation. (A) Schematic diagram
of additional mutations designed within the TFD (see text). All
constructs have been engineered with a C-terminal Myc epitope tag to
facilitate detection (m). The N terminus begins at residue 1759 in all
Nic mutant constructs; C-terminal boundaries of deletion
mutants (Nic 2171 and Nic 2120) are
indicated. Full-length mutant constructs terminate at reside 2556. Letters (AxAxA in NicANKm1 and EF in NicANKm2)
correspond to amino acid substitutions made within the fourth ankyrin
repeat; a 10-amino-acid deletion (Nic 2105-2114) is
represented by a gap in full-length Nic. Transformation
potential is indicated as + for strong, +/ for weak, and for negative. (B) Focus assay plates stained 4 weeks after transfection
of RKE cells with the indicated Nic mutant constructs.
|
|
N
ic
2105-2114 has a 10-amino-acid deletion
(2105-RMHHDIVRLL-2114) located between N
ic
2120 (a
weakly transforming construct) and N
ic
2095 (a
nontransforming construct). Deletion of these 10 amino acids
from
N
ic is sufficient to eliminate transforming activity as
determined
by the focus assay (Fig.
3B). The requirement for an intact
ANK
domain was determined by making two separate mutants
(N
icANKm1 and N
icANKm2) that encode amino
acid substitutions in the fourth ANK repeat
(
40,
42,
43,
79). N
icANKm1 has a three-amino-acid substitution
that changes the N
ic primary sequence from
1995-D
GT
TP
LI-2001
to
1995-D
AT
AP
AI-2001. In
N
icANKm2, amino acids 2003 to 2005 are changed from
2002-L
AAR-2006
to 2002-L
EFR-2006. Both of these
ANK mutants were incapable
of transforming RKE cells (Fig.
3B).
Transforming and nontransforming mutants of Nic
localize to the nucleus.
Subcellular localization of
Nic constructs in RKE cells was determined by IF in
polyclonal cell lines expressing Nic mutant constructs. For
IF, cells were seeded onto plastic chamber slides and Nic
mutant proteins were detected using 9E10 and visualized with a
Cy3-conjugated secondary antibody as described in Materials and Methods
(Fig. 4).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 4.
All Nic deletion mutants exhibit nuclear
staining regardless of neoplastic properties or NLS deletions. (A)
Polyclonal RKE cell lines for each indicated Nic deletion
mutant immunostained with 9E10 and visualized with a Cy3-conjugated
secondary antibody (left); nuclei are stained with DAPI (right). (B)
Nuclear localization is not sufficient for focus formation. Shown are
polyclonal RKE cell lines for each indicated Nic deletion
or site-directed mutant. Nic 2171 and site-directed
mutant RKE cell lines (NicANKm1, NicANKm2, and
Nic 2105-2114) are immunostained with 9E10 and 15A,
respectively, and visualized with a Cy3-conjugated secondary antibody
(left); nuclei are indicated by staining with DAPI (right).
|
|
Previously we reported that N
ic is primarily localized to
the nuclei of RKE cells (
8). Analysis of the C-terminal
deletion
mutants revealed that all mutant proteins resided primarily
within
the nucleus to the same extent as N
ic (Fig.
4A). In
contrast, deletion of both N-terminal putative
NLSs and the RAM domain
(N
ic
R) resulted in an increase of cytoplasmic staining,
though each
N
ic
R construct retained prominent nuclear
immunoreactivity.
When subcellular localization was examined for weakly transforming and
nontransforming N
ic mutants, we observed that all
N
ic mutant proteins localized to the nucleus regardless of
their
ability to induce focus formation in RKE cells (Fig.
4B).
Activation of CBF1 is not required for transformation by Notch
proteins.
Activation of CBF1-dependent transcription is considered
to be an important component of the Notch signal transduction pathway. We analyzed the requirement of CBF1-mediated transcriptional activation using transient transfection assays in HeLa cells (Fig.
5A). Transfection of 8x-CBF1-luc with a
GFP expression plasmid or wild-type Notch1 resulted in low basal
activity. In contrast, transfection of a Nic expression
vector resulted in a 45-fold increase in luciferase activity over that
obtained with GFP (expressed as relative luciferase units in Fig. 5A).
Transfection of vectors expressing deletion mutants
Nic
2202 and Nic
2120 resulted in a 30- and
6-fold increases of luciferase activity compared to the GFP control.


View larger version (1328K):
[in this window]
[in a new window]
|
FIG. 5.
Deletion of the RAM domain from Nic
constructs results in loss of CBF1-responsive reporter activity and
abolishes binding. (A) HeLa cells were transiently transfected with the
indicated Nic expression vector (0.8 µg), 8x-CBF1-luc
plasmid (0.4 µg), and RL-TK plasmid (0.4 µg). At 48 h
posttransfection, luciferase values were determined for each construct
and normalized as described in Materials and Methods (given as relative
luciferase units). Shown are the results from one experiment done in
triplicate which are representative of multiple assays performed with
each deletion construct. (B) Nic R mutant constructs do
not physically associate with GST-CBF1 fusion polypeptide. Cellular
lysates were made from stable RKE cell lines expressing the indicated
Nic construct. Lysates were incubated with either GST-CBF1
beads (lanes P) or GST beads (lanes C). Nic deletion
constructs were detected by Western blotting against the Myc epitope
with 9E10. An equivalent amount of each lysate was immunoprecipitated
with anti-Notch1 polyclonal antiserum 925 and detected by Western
blotting against the Myc epitope (shown in Fig. 2C). Molecular mass
markers are shown to the left.
|
|
Deletion of the RAM domain in N
ic
R mutants abolished
their ability to activate CBF1-mediated transcription from the 8x-CBF1
reporter
(Fig.
5A). All N
ic
R mutants tested in this
assay exhibited luciferase activities
at basal levels, demonstrating
loss of functional association
with
CBF1.
To establish that N
ic
R constructs do not physically
associate with CBF1, we tested for protein-protein binding interactions
using
a GST pull-down assay. Whole cell lysates prepared from
transformed
RKE cells were incubated with either GST or GST-CBF1
adsorbed
to glutathione-agarose beads and processed as described in
Materials
and Methods. Using a GST-CBF1 fusion protein, we could
affinity
precipitate only N
ic deletion proteins that encode
the RAM domain (Fig.
5B). Deletion
of the RAM domain completely
abolished the ability of N
ic
R proteins from transformed
RKE cells to physically interact with
GST-CBF1. To control for the
presence of Notch proteins in this
assay, an equivalent amount of each
lysate was immunoprecipitated
with the anti-Notch1 polyclonal antiserum
925 and detected by
Western blotting against the Myc epitope (Fig.
2C).
CBF1 binding to Nic is not sufficient for
transformation.
Mutational analysis of the TFD revealed that
site-directed mutations in the fourth ANK repeat (NicANKm1
and NicANKm2) and a 10-amino-acid deletion
(Nic
2105-2114) resulted in transformation-defective
Nic proteins (Fig. 3). Since each of these constructs
encodes the RAM domain, we determined if these Nic site
mutants maintained molecular interactions with CBF1. Previous studies
have shown that the NicANKm1 and NicANKm2 point
mutations ablate Nic mediated transcriptional activation of
a CBF1-responsive reporter (35, 40, 48). As predicted,
cotransfection of NicANKm1 and NicANKm2
expression plasmids with 8x-CBF1-luc resulted in negligible reporter activity in HeLa cells (Fig. 6A).
Similarly, when assayed for CBF1 reporter activity,
Nic
2105-2114 also failed to appreciably activate
transcription from the reporter gene (Fig. 6A).


View larger version (1139K):
[in this window]
[in a new window]
|
FIG. 6.
Site-directed mutations within the TFD abrogate CBF1
reporter activity without affecting CBF1 binding. (A) HeLa cells were
transfected with the indicated Nic mutant construct (see
text), and luciferase activity was measured as described in Materials
and Methods. (B) Mutations within the TFD do not affect CBF1 binding
interactions. Lysates were made from transiently transfected Bosc23
cell lines expressing the indicated Nic constructs and were
incubated with either GST-CBF1 beads (lanes P) or GST beads (lanes C).
Nic deletion constructs were detected by Western blotting
against the Myc epitope with 9E10 (top). Then 10% of each Bosc23
lysate was analyzed for protein expression by Western blotting with
9E10: Nic, lane 1; Nic R, lane 2;
NicANKm1, lane 3; NicANKm2, lane 4 and
Nic 2105-2114, lane 5 (bottom). Molecular mass markers
are shown to the left.
|
|
To determine if loss of reporter activity was due to a failure of
N
ic mutants to physically associate with CBF1, we assayed
for protein
binding using the GST-CBF1 pull-down experiment (Fig.
6B).
Whole
cell lysates were prepared from Bosc23 cells transiently
transfected
with either N
icANKm1, N
icANKm2, or
N
ic
2105-2114 and assayed for GST-CBF1 binding as
described in Materials and
Methods. In contrast to deletion of the RAM
domain, N
icANKm1, N
icANKm2, and
N
ic
2105-2114 mutants bound CBF1 in GST pull-down
experiments as well as N
ic (Fig.
6B). This result indicates
that binding CBF1 is not sufficient
to either activate transcription
from a reporter or induce focus
formation.
Nuclear localization is required for neoplastic
transformation.
We showed that Nic and all deletion
mutants of Nic are primarily localized to the nucleus of
RKE cells, regardless of their ability to transform RKE cells (Fig. 4).
To address the significance of nuclear localization in
Nic-mediated transformation, we used a mechanism to
efficiently control subcellular localization of Nic
proteins. We created a series of Nic
2444 and
Nic
R-2444 constructs that encode at their C termini
either a cyclic AMP-dependent protein kinase inhibitor (PKI)-like NES
(amino acids LALKLAGLDL [92]) or the simian virus40
large T NLS (amino acids PKKKRKV [39]) followed by the
Myc epitope tag. Addition of an ectopic NES should result in active
export of Nic
2444 and Nic
R-2444 from the
nucleus to the cytoplasm. The NLS should not have any effect on nuclear
localization of Nic
2444 but should rescue the loss of
nuclear localization associated with the
RAM mutation in
Nic
R-2444.
To test the ability of these constructs to induce focus formation, we
transfected plasmids expressing either the NES or NLS
derivatives into
RKE cells and performed the focus assay. The
ability of
N
ic
2444 to form foci in RKE cells was significantly
diminished by addition
of the NES (Fig.
7A, top row: +NES, Table
1). In contrast,
addition
of the NLS had no effect on transformation by
N
ic
2444 (Fig.
7A, top row, +NLS; Table
1). When combined
with the N-terminal
RAM domain deletion in N
ic
R-2444,
the effect of the NES was more pronounced, resulting in a dramatic
loss
of focus formation (Fig.
7A, bottom row, +NES; Table
1).
Addition of an
NLS to N
ic
R-2444 increased transformation efficiency to
that observed with N
ic
2444 (Fig.
7A, bottom row, +NLS;
Table
1). This indicates that the
reduction in transformation
efficiency associated with the

RAM
Notch mutants is a result of
decreased nuclear localization and
not with a loss of CBF1 binding.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 7.
Nuclear localization is required for
Nic-induced transformation of RKE cells. (A) Derivatives of
both Nic 2444 and Nic R-2444 containing
either a PKI-like nuclear export sequence (+NES) or the SV40 large T
NLS (+NLS) were constructed and assayed for focus formation in RKE
cells as described in Materials and Methods. The transfected expression
vector is indicated above each plate. (B) Expression was documented
from transiently transfected 293T cells for each indicated construct.
Cell lysates were collected and subjected to SDS-PAGE (8% gel), and
proteins were visualized by Western blotting with 9E10. Molecular mass
markers are shown to the left.
|
|
NES constructs show reduced levels of Nic in the
nucleus.
Subcellular localization of +NES and +NLS constructs was
determined by IF in polyclonal RKE cell lines. Addition of the NES to
Nic
2444 resulted in more diffuse total cell distribution
compared to the exclusively nuclear localization of
Nic
2444; however, it retained prominent nuclear staining
(Fig. 8A,
+NES). Addition of the NLS had no
effect on subcellular localization of Nic
2444 (Fig. 8A,
+NLS). Analysis of Nic
R-2444 subcellular localization
revealed an increase in cytoplasmic staining compared to
Nic
2444 (Fig. 8A). Addition of the NES to
Nic
R-2444 resulted in a complete exclusion of the
protein from the nucleus (Fig. 8A, +NES). In contrast, addition of the
NLS to Nic
R-2444 rescued the decrease in nuclear
localization associated with the RAM domain deletion (Fig. 8A, +NLS).



View larger version (554844K):
[in this window]
[in a new window]
|
FIG. 8.
Exclusion from the nucleus correlates with loss of
transforming activity. (A) Indicated polyclonal RKE cell lines were
processed for IF as described in the text. +NES, clone containing an
NES; +NLS, clone containing an NLS. Panels are arranged so that the
+NES and +NLS derivatives of the indicated construct follow.
Nic constructs are visualized with Cy3 (left); nuclei are
stained with DAPI (middle); merged Cy3 and DAPI images are pictured at
the right (BOTH). (B) Exclusion from the nucleus depends on active
nuclear export. Indicated polyclonal RKE cell lines were plated onto
microscope slides and incubated with either the nuclear export
inhibitor leptomycin B at 1 ng/ml (+LMB) or with vehicle ( LMB) for
2 h prior to processing for IF. (C) Subcellular localization in
transiently transfected HeLa cells. Labels are as indicated for panel
A. +NES versions of the construct indicated are to the right.
|
|
To authenticate that the N
ic
R-2444NES construct was
being exported via the nuclear export machinery, we treated RKE cell
lines with the
nuclear export inhibitor leptomycin B (Fig.
8B)
(
46). Treatment
of the N
ic
R-2444NES
expressing polyclonal cell line with leptomycin B resulted in
nuclear
accumulation of the protein, whereas treatment with vehicle
had no
effect on subcellular localization as determined by indirect
IF (Fig.
8B, center column, +NES). Subcellular localization of
N
ic
R-2444 and the NLS derivative was not affected by
treatment with either
leptomycin B or vehicle (Fig.
8B, right and left
columns). Taken
together, these results indicate the NES derivatives
are functioning
through the NES pathway and fail to proficiently
transform RKE
cells due to a lack of nuclear
localization.
To determine if localization of N
ic
R-2444NES and
N
ic
2444NES was truly reflective of the subcellular
distribution of these proteins and not a result
of selecting polyclonal
RKE cell lines, we performed IF on transiently
transfected HeLa cells.
HeLa cells were transfected with the indicated
expression vectors, and
subcellular localization of the N
ic proteins was determined
as described above (Fig.
8C). As we demonstrated
for RKE cells,
N
ic
2444NES retained prominent nuclear localization and
to a lesser extent
cytoplasmic localization. The subcellular
distribution of N
ic
2444NES was now remarkably similar to
that of N
ic
R-2444, indicating that addition of an NES is
equivalent to removal
of the RAM-NLS (Fig.
8C). Addition of an NES to
N
ic
R-2444 resulted in the complete redistribution of the
protein to the
cytoplasm, consistent with the results obtained with
polyclonal
RKE
lines.
 |
DISCUSSION |
Nic functions in the nucleus.
Nuclear accumulation
is a hallmark of ectopically expressed Nic proteins in
diverse cellular systems from invertebrates to vertebrates (2, 57,
58). This property of Notch proteins has confounded interpretations of where within the cell this plasma membrane-spanning receptor exerts its influence. Previously, we have shown that permanently tethering Nic to the plasma membrane as a
CD8-Nic fusion protein abolishes Nic
transformation activity in RKE cells (8).
Drosophila expressing myristylated-Nic
derivatives that predominantly localize to membranes also have a loss
of Nic activity (81). These results support the
hypothesis that Notch does not function at the membrane and must be
released from the membrane to signal. However, neither of these
approaches was able to discriminate between cytoplasmic or nuclear
signaling events required for Nic activity. To resolve the
issue of nuclear versus cytoplasmic signaling, we engineered
Nic proteins that encode a functional NES at the C
terminus. Our hypothesis was that if nuclear localization was required
for transformation, addition of an NES to Nic would block
nuclear accumulation and thus Nic would fail to transform
RKE cells. Our data clearly demonstrate that active export of
Nic molecules from the nucleus to the cytoplasm results in
loss of transforming activity.
Analysis of the subcellular localization of N
ic
2444NES
in a polyclonal RKE cell line revealed that this protein retained
prominent
nuclear localization. When transfected into RKE cells, this
molecule
is capable of eliciting focus formation, albeit at a lesser
efficiency
that N
ic
2444. However, the
N
ic
R-2444NES clone is completely excluded from the
nucleus and is severely
compromised in the transformation assay. One
explanation for the
incomplete penetrance of the
N
ic
2444NES clone is that this clone retains a strong NLS
within the RAM
domain that cannot be completely overcome by the
addition of a
single NES. Recent reports have demonstrated that in
cases where
proteins are actively exported out of the nucleus, there is
a
balance between NLS and NES strength (
16,
28). This is
likely
the case in our situation since removal of a strong NLS in the
RAM domain in N
ic
R-2444NES results in a complete loss of
nuclear staining. Moreover, analysis
of subcellular localization in
polyclonal RKE cells might overemphasize
nuclear localization. Since we
know that N
ic
2444NES is capable of transforming RKE
cells (at a low level), it is
reasonable to suspect that polyclonal
lines contain a large percentage
of cells that have selected for active
nuclear N
ic
2444NES proteins. In support of this
explanation, transient expression
of this clone in HeLa cells reveals a
whole cell distribution
of N
ic
2444NES more intense than
what we observe in the polyclonal RKE line
(Fig.
8C). Taken together,
these results strongly establish that
neoplastic transformation of RKE
cells by N
ic requires nuclear
localization.
Recently, we have characterized chimeras of N
ic and the
hormone binding domain of the estrogen receptor
(Notch
ic-ER) that requires stimulation with
4-hydroxytamoxifen (OHT) to
induce transformation of RKE cells (C. Ronchini and A. J. Capobianco,
submitted for publication). In the
absence of OHT, the Notch
ic-ER chimeras are diffusely
distributed throughout the cell and
are unable to induce
transformation. When stimulated with OHT,
Notch
ic-ER
proteins induce transformation of RKE cells and the proteins
accumulate
in the nucleus. This supports our argument that nuclear
accumulation of
N
ic is required for its biological
effects.
Identification of the Nic transformation domain.
Deletion analysis of Nic demonstrates that the C-terminal
sequences encoding the PEST and OPA domains are not required for
transforming activity. Deletions of these sequences from mouse Notch1
have previously been shown to have no effect of Nic
inhibition of granulocytic differentiation or myogenesis (7, 43,
59). Our data also indicate that deletion of the OPA and PEST
domains results in an increase in transforming activity, indicating
that these domains might mediate negative regulation of Nic
within RKE cells.
We have defined the TFD as amino acids 1848 to 2202 of human Notch1.
This domain consists primarily of the ankyrin repeats
and an additional
107 C-terminal residues. Furthermore, we have
shown that the 107 amino
acids juxtaposed to the ANK domain are
sensitive to mutation,
indicating that their integrity as a domain
is necessary. Notch
molecules corresponding to the TFD are endowed
with intrinsic signaling
ability in other systems (
7,
43,
56,
59,
72,
73,
82),
indicating the conserved role of
the ANK domain in
N
ic-mediated biological
effects.
C-terminal deletion and site-directed mutagenesis have implicated the
region located immediately downstream of the ANK domain
as a region
important for transformation. C-terminal deletion
of 31 residues into
the TFD (N terminal to amino acid 2202) greatly
attenuated focus
formation, without affecting nuclear localization.
Furthermore, a
site-directed deletion of 10 amino acids within
this region was
sufficient to destroy the ability of N
ic to transform RKE
cells. These results indicate important functional
interactions are
likely to occur within this
region.
Previously we reported that N2
ic was considerably weaker as
a transforming molecule than N1
ic in the focus assay
(
8). It is likely that sequences within
the TFD account for
this difference. Sequence comparison between
the TFD of Notch1 and the
corresponding region in Notch2 reveals
that these proteins share
approximately 66% identity, considering
similarity it is 74%.
Interestingly, this region has been reported
to mediate differences in
signaling between Notch1 and Notch2
in granulocyte differentiation by
granulocyte-macrophage colony-stimulating
factor (GM-CSF) and
granulocyte colony-stimulating factor (G-CSF),
in that GM-CSF signals
through N2 and G-CSF signals through N1
to inhibit differentiation
(
7).
CBF1 activation is not a critical target for
Nic-induced transformation of RKE cells.
CBF1-dependent versus independent signaling pathways is a topic of
considerable debate within the Notch field (2, 40, 61).
Based on published reports, we engineered an Nic mutant
with an N-terminal deletion that removes both primary and secondary
CBF1 binding sites (Nic
R) within the RAM domain
(31, 32, 48, 61, 84). Consistent with these reports, we
demonstrate that Nic
R mutants no longer retain the
ability to interact with CBF1 from analysis of protein-protein
interaction and CBF1 reporter assays. Nic
R constructs
retain the ability to induce transformation when expressed in RKE cells
even though they are unable to interact with CBF1. Based on this
evidence, we conclude that transformation of RKE cells by
Nic does not require direct activation of CBF1. Moreover,
we have demonstrated that the ability of Nic to bind CBF1
is not sufficient to induce transformation. We analyzed several Notch
constructs that had point mutations within the ANK domain. These ANK
mutants were defective for transformation and for the ability to
activate the CBF1 reporter in HeLa cells. These constructs all
contained the RAM domain and were able to bind to CBF1 in a GST
pull-down experiment (Fig. 6B). Similar ANK mutants have been reported
to abolish Nic activation of CBF1-responsive reporter
assays (35, 40, 48) and fail to inhibit muscle
differentiation in vitro (40, 43).
Several lines of evidence indicate that the C terminus of
N
ic encodes an intrinsic transcriptional activation domain.
These
observations were primarily made by experiments utilizing either
LexA- or GAL4-N
ic fusion proteins (
31,
41,
48).
Data from these reports define
the N
ic transcriptional
activation domain as sequences between the OPA
domain and the
C-terminal putative NLS (C terminal to amino acid
2202)
(
48). Our CBF1 reporter data confirm that the C-terminal
portion of N
ic does contain a transcriptional activation
domain, but with one
consideration. We show that reporter activity
descreases with
C-terminal truncations between the OPA domain and the
NLS (amino
acid 2202), which is in agreement with the above reports.
However,
our minimal transforming domain (amino acids 1848 to 2202)
does
not contain the C-terminal residues that have been attributed
to
the intrinsic transcriptional activation potential of N
ic.
While not arguing against a role for N
ic in transcriptional
activation, our data instead imply that amino
acids within the TFD
(i.e., N-terminal to amino acid 2202) appear
to be directly responsible
for transcriptional
activation.
We have concluded that CBF1 activation is not a requirement for
transformation of RKE cells. However, we support the hypothesis
that a
transcriptional activation domain is required for Notch
activity. All
of our data indicate that the RAM domain is solely
responsible for
mediating the interaction with CBF1 and that deletion
of this domain
does not affect the ability of N
ic to transform cells. How
can we justify the apparent correlation
between loss of CBF1 activity
and transformation for the ANK mutants
and the 10-amino-acid deletion
in the TFD? If we assume that the
CBF1 reporter assay in HeLa cells is
simply reflective of transcriptional
activation and not of a CBF1
function in RKE cells (i.e., similar
to a GAL4 fusion experiment), then
we can conclude that the correlation
is between transcriptional
activation and transformation of RKE
cells. Furthermore, we suggest
that the transcriptional activation
required for transformation is not
mediated through
CBF1.
A recent report describing in vitro transformation of a mouse mammary
epithelial cell line (HC11) by intracellular Notch1
concluded that
transformation required the N-terminal putative
NLS and the RAM domain
(
14). Data concerning subcellular localization
of
N
ic constructs of functional association with CBF1 within
HC11 cells
were not presented. However, the authors did attempt to show
activation
of a potential cellular target of N
ic via CBF1
in N
ic-transformed HC11 cells. The ERBB2 promoter contains
CBF1 binding
sites and can be activated by N
ic expression
in reporter assays (
10). The study by Dievart et
al. was
unable to detect elevated ERBB2 message (
14), indicating
N
ic may not target CBF1 repressed genes within HC11 cells
to induce
transformation. Alternatively, the requirement for CBF1 might
be cell type specific in that immortalized mammary epithelial
cells but
not RKE cells require CBF1 activity. One could imagine
that in RKE
cells, expression of E1A somehow provides a redundant
function for CBF1
activity, and therefore additional CBF1 activity
from interaction with
N
ic is not
necessary.
 |
ACKNOWLEDGMENTS |
We thank members of the Capobianco lab for support and technical
assistance. We also thank David Robbins and his laboratory for
insightful comments on this work. We are grateful to P. D. Ling
(Baylor College of Medicine) for providing the 8x-CBF1-luc reporter and
to Minoru Yoshida (University of Tokyo) for generously supplying
leptomycin B. We thank W. Pear (University of Pennsylvania) for Bosc23 cells.
This work was funded in part by ACS grant LBC99465 (to A.J.C.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics, Biochemistry and Microbiology, University of
Cincinnati College of Medicine, Cincinnati, OH 45267-0524. Phone: (513)
558-3664. Fax: (513) 558-8474. E-mail:
tony.capobianco{at}uc.edu.
 |
REFERENCES |
| 1.
|
Ahmad, I.,
P. Zagouras, and S. Artavanis-Tsakonas.
1995.
Involvement of Notch-1 in mammalian retinal neurogenesis: association of Notch-1 activity with both immature and terminally differentiated cells.
Mech. Dev.
53:73-85[CrossRef][Medline].
|
| 2.
|
Artavanis-Tsakonas, S.,
M. D. Rand, and R. J. Lake.
1999.
Notch signaling: cell fate control and signal integration in development.
Science
284:770-776[Abstract/Free Full Text].
|
| 3.
|
Aster, J.,
W. Pear,
R. Hasserjian,
H. Erba,
F. Davi,
B. Luo,
M. Scott,
D. Baltimore, and J. Sklar.
1994.
Functional analysis of the TAN-1 gene, a human homolog of Drosophila notch.
Cold Spring Harbor Symp. Quant. Biol.
59:125-136[Abstract/Free Full Text].
|
| 4.
|
Aster, J. C.,
E. S. Robertson,
R. P. Hasserjian,
J. R. Turner,
E. Kieff, and J. Sklar.
1997.
Oncogenic forms of NOTCH1 lacking either the primary binding site for RBP-Jkappa or nuclear localization sequences retain the ability to associate with RBP-Jkappa and activate transcription.
J. Biol. Chem.
272:11336-11343[Abstract/Free Full Text].
|
| 5.
|
Axelrod, J. D.,
K. Matsuno,
S. Artavanis-Tsakonas, and N. Perrimon.
1996.
Interaction between Wingless and Notch signaling pathways mediated by dishevelled.
Science
271:1826-1832[Abstract].
|
| 6.
|
Bettenhausen, B.,
M. Hrabe de Angelis,
D. Simon,
J. L. Guenet, and A. Gossler.
1995.
Transient and restricted expression during mouse embryogenesis of Dll1, a murine gene closely related to Drosophila Delta.
Development
121:2407-2418[Abstract].
|
| 7.
|
Bigas, A.,
D. I. Martin, and L. A. Milner.
1998.
Notch1 and Notch2 inhibit myeloid differentiation in response to different cytokines.
Mol. Cell. Biol.
18:2324-2333[Abstract/Free Full Text].
|
| 8.
|
Capobianco, A. J.,
P. Zagouras,
C. M. Blaumueller,
S. Artavanis-Tsakonas, and J. M. Bishop.
1997.
Neoplastic transformation by truncated alleles of human NOTCH1/TAN1 and NOTCH2.
Mol. Cell. Biol.
17:6265-6273[Abstract].
|
| 9.
|
Carlesso, N.,
J. C. Aster,
J. Sklar, and D. T. Scadden.
1999.
Notch1-induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics.
Blood
93:838-848[Abstract/Free Full Text].
|
| 10.
|
Chen, Y.,
W. H. Fischer, and G. N. Gill.
1997.
Regulation of the ERBB-2 promoter by RBPJkappa and NOTCH.
J. Biol. Chem.
272:14110-14114[Abstract/Free Full Text].
|
| 11.
|
del Amo, F. F.,
M. Gendron-Maguire,
P. J. Swiatek,
N. A. Jenkins,
N. G. Copeland, and T. Gridley.
1993.
Cloning, analysis, and chromosomal localization of Notch-1, a mouse homolog of Drosophila Notch.
Genomics
15:259-264[CrossRef][Medline].
|
| 12.
|
Del Amo, F. F.,
D. E. Smith,
P. J. Swiatek,
M. Gendron-Maguire,
R. J. Greenspan,
A. P. McMahon, and T. Gridley.
1992.
Expression pattern of Motch, a mouse homolog of Drosophila Notch, suggests an important role in early postimplantation mouse development.
Development
115:737-744[Abstract].
|
| 13.
|
Diederich, R. J.,
K. Matsuno,
H. Hing, and S. Artavanis-Tsakonas.
1994.
Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway.
Development
120:473-481[Abstract].
|
| 14.
|
Dievart, A.,
N. Beaulieu, and P. Jolicoeur.
1999.
Involvement of notch1 in the development of mouse mammary tumors.
Oncogene
18:5973-5981[CrossRef][Medline].
|
| 15.
|
Dou, S.,
X. Zeng,
P. Cortes,
H. Erdjument-Bromage,
P. Tempst,
T. Honjo, and L. D. Vales.
1994.
The recombination signal sequence-binding protein RBP-2N functions as a transcriptional repressor.
Mol. Cell. Biol.
14:3310-3319[Abstract/Free Full Text].
|
| 16.
|
Ducret, C.,
S. M. Maira,
A. Dierich, and B. Wasylyk.
1999.
The Net repressor is regulated by nuclear export in response to anisomycin, UV, and heat shock.
Mol. Cell. Biol.
19:7076-7087[Abstract/Free Full Text].
|
| 17.
|
Ellisen, L. W.,
J. Bird,
D. C. West,
A. L. Soreng,
T. C. Reynolds,
S. D. Smith, and J. Sklar.
1991.
TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms.
Cell
66:649-661[CrossRef][Medline].
|
| 18.
|
Fehon, R. G.,
K. Johansen,
I. Rebay, and S. Artavanis-Tsakonas.
1991.
Complex cellular and subcellular regulation of notch expression during embryonic and imaginal development of Drosophila: implications for notch function.
J. Cell Biol.
113:657-669[Abstract/Free Full Text].
|
| 19.
|
Fortini, M. E., and S. Artavanis-Tsakonas.
1994.
The suppressor of hairless protein participates in notch receptor signaling.
Cell
79:273-282[CrossRef][Medline].
|
| 20.
|
Fortini, M. E.,
I. Rebay,
L. A. Caron, and S. Artavanis-Tsakonas.
1993.
An activated Notch receptor blocks cell-fate commitment in the developing Drosophila eye.
Nature
365:555-557[CrossRef][Medline].
|
| 21.
|
Fuentes-Panana, E. M., and P. D. Ling.
1998.
Characterization of the CBF2 binding site within the Epstein-Barr virus latency C promoter and its role in modulating EBNA2-mediated transactivation.
J. Virol.
72:693-700[Abstract/Free Full Text].
|
| 22.
|
Gallahan, D., and R. Callahan.
1997.
The mouse mammary tumor associated gene INT3 is a unique member of the NOTCH gene family (NOTCH4).
Oncogene
14:1883-1890[CrossRef][Medline].
|
| 23.
|
Gallahan, D.,
C. Jhappan,
G. Robinson,
L. Hennighausen,
R. Sharp,
E. Kordon,
R. Callahan,
G. Merlino, and G. H. Smith.
1996.
Expression of a truncated Int3 gene in developing secretory mammary epithelium specifically retards lobular differentiation resulting in tumorigenesis.
Cancer Res.
56:1775-1785[Abstract/Free Full Text].
|
| 24.
|
Gallahan, D.,
C. Kozak, and R. Callahan.
1987.
A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17.
J. Virol.
61:218-220[Abstract/Free Full Text].
|
| 25.
|
Giniger, E.
1998.
A role for Ab1 in Notch signaling.
Neuron
20:667-681[CrossRef][Medline].
|
| 26.
|
Girard, L.,
Z. Hanna,
N. Beaulieu,
C. D. Hoemann,
C. Simard,
C. A. Kozak, and P. Jolicoeur.
1996.
Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis.
Genes Dev.
10:1930-1944[Abstract/Free Full Text].
|
| 27.
|
Greenwald, I.
1998.
LIN-12/Notch signaling: lessons from worms and flies.
Genes Dev.
12:1751-1762[Free Full Text].
|
| 28.
|
Harhaj, E. W., and S. C. Sun.
1999.
Regulation of RelA subcellular localization by a putative nuclear export signal and p50.
Mol. Cell. Biol.
19:7088-7095[Abstract/Free Full Text].
|
| 29.
|
Henrique, D.,
J. Adam,
A. Myat,
A. Chitnis,
J. Lewis, and D. Ish-Horowicz.
1995.
Expression of a Delta homologue in prospective neurons in the chick.
Nature
375:787-790[CrossRef][Medline].
|
| 30.
|
Honjo, T.
1996.
The shortest path from the surface to the nucleus: RBP-J kappa/Su(H) transcription factor.
Genes Cells
1:1-9[Abstract].
|
| 31.
|
Hsieh, J. J.,
T. Henkel,
P. Salmon,
E. Robey,
M. G. Peterson, and S. D. Hayward.
1996.
Truncated mammalian Notch1 activates CBF1/RBPJ -repressed genes by a mechanism resembling that of Epstein-Barr virus EBNA2.
Mol. Cell. Biol.
16:952-959[Abstract].
|
| 32.
|
Hsieh, J. J.,
D. E. Nofziger,
G. Weinmaster, and S. D. Hayward.
1997.
Epstein-Barr virus immortalization: Notch2 interacts with CBF1 and blocks differentiation.
J. Virol.
71:1938-1945[Abstract].
|
| 33.
|
Hsieh, J. J.,
S. Zhou,
L. Chen,
D. B. Young, and S. D. Hayward.
1999.
CIR, a corepressor linking the DNA binding factor CBF1 to the histone deacetylase complex.
Proc. Natl. Acad. Sci. USA
96:23-28[Abstract/Free Full Text].
|
| 34.
|
Hubbard, E. J.,
Q. Dong, and I. Greenwald.
1996.
Evidence for physical and functional association between EMB-5 and LIN-12 in Caenorhabditis elegans.
Science
273:112-115[Abstract].
|
| 35.
|
Jarriault, S.,
C. Brou,
F. Logeat,
E. H. Schroeter,
R. Kopan, and A. Israel.
1995.
Signalling downstream of activated mammalian Notch.
Nature
377:355-358[CrossRef][Medline].
|
| 36.
|
Jarriault, S.,
O. Le Bail,
E. Hirsinger,
O. Pourquie,
F. Logeat,
C. F. Strong,
C. Brou,
N. G. Seidah, and A. Israel.
1998.
Delta-1 activation of notch-1 signaling results in HES-1 transactivation.
Mol. Cell. Biol.
18:7423-7431[Abstract/Free Full Text].
|
| 37.
|
Jehn, B. M.,
W. Bielke,
W. S. Pear, and B. A. Osborne.
1999.
Protective effects of notch-1 on TCR-induced apoptosis.
J. Immunol.
162:635-638[Abstract/Free Full Text].
|
| 38.
|
Jen, W. C.,
D. Wettstein,
D. Turner,
A. Chitnis, and C. Kintner.
1997.
The Notch ligand, X-Delta-2, mediates segmentation of the paraxial mesoderm in Xenopus embryos.
Development
124:1169-1178[Abstract].
|
| 39.
|
Kalderon, D.,
B. L. Roberts,
W. D. Richardson, and A. E. Smith.
1984.
A short amino acid sequence able to specify nuclear location.
Cell
39:499-509[CrossRef][Medline].
|
| 40.
|
Kato, H.,
Y. Taniguchi,
H. Kurooka,
S. Minoguchi,
T. Sakai,
S. Nomura-Okazaki,
K. Tamura, and T. Honjo.
1997.
Involvement of RBP-J in biological functions of mouse Notch1 and its derivatives.
Development
124:4133-4141[Abstract].
|
| 41.
|
Kidd, S.,
T. Lieber, and M. W. Young.
1998.
Ligand-induced cleavage and regulation of nuclear entry of Notch in Drosophila melanogaster embryos.
Genes Dev.
12:3728-3740[Abstract/Free Full Text].
|
| 42.
|
Kodoyianni, V.,
E. M. Maine, and J. Kimble.
1992.
Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans.
Mol. Biol. Cell
3:1199-1213[Abstract].
|
| 43.
|
Kopan, R.,
J. S. Nye, and H. Weintraub.
1994.
The intracellular domain of mouse Notch: a constitutively activated repressor of myogenesis directed at the basic helix-loop-helix region of MyoD.
Development
120:2385-2396[Abstract/Free Full Text].
|
| 44.
|
Kopan, R.,
E. H. Schroeter,
H. Weintraub, and J. S. Nye.
1996.
Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain.
Proc. Natl. Acad. Sci. USA
93:1683-1688[Abstract/Free Full Text].
|
| 45.
|
Kopan, R., and H. Weintraub.
1993.
Mouse notch: expression in hair follicles correlates with cell fate determination.
J. Cell Biol.
121:631-641[Abstract/Free Full Text].
|
| 46.
|
Kudo, N.,
B. Wolff,
T. Sekimoto,
E. P. Schreiner,
Y. Yoneda,
M. Yanagida,
S. Horinouchi, and M. Yoshida.
1998.
Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1.
Exp. Cell Res.
242:540-547[CrossRef][Medline].
|
| 47.
|
Kuroda, K.,
S. Tani,
K. Tamura,
S. Minoguchi,
H. Kurooka, and T. Honjo.
1999.
Delta-induced Notch signaling mediated by RBP-J inhibits MyoD expression and myogenesis.
J. Biol. Chem.
274:7238-7244[Abstract/Free Full Text].
|
| 48.
|
Kurooka, H.,
K. Kuroda, and T. Honjo.
1998.
Roles of the ankyrin repeats and C-terminal region of the mouse notch1 intracellular region.
Nucleic Acids Res.
26:5448-5455[Abstract/Free Full Text]. (Erratum, 27:following 1407, 1999.)
|
| 49.
|
Lardelli, M.,
J. Dahlstrand, and U. Lendahl.
1994.
The novel Notch homologue mouse Notch 3 lacks specific epidermal growth factor-repeats and is expressed in proliferating neuroepithelium.
Mech. Dev.
46:123-136[CrossRef][Medline].
|
| 50.
|
Larsson, C.,
M. Lardelli,
I. White, and U. Lendahl.
1994.
The human NOTCH1, 2, and 3 genes are located at chromosome positions 9q34, 1p13-p11, and 19p13.2-p13.1 in regions of neoplasia-associated translocation.
Genomics
24:253-258[CrossRef][Medline].
|
| 51.
|
Lecourtois, M., and F. Schweisguth.
1998.
Indirect evidence for Delta-dependent intracellular processing of notch in Drosophila embryos.
Curr. Biol.
8:771-774[CrossRef][Medline].
|
| 52.
|
Lieber, T.,
S. Kidd,
E. Alcamo,
V. Corbin, and M. W. Young.
1993.
Antineurogenic phenotypes induced by truncated Notch proteins indicate a role in signal transduction and may point to a novel function for Notch in nuclei.
Genes Dev.
7:1949-1965[Abstract/Free Full Text].
|
| 53.
|
Lindsell, C. E.,
J. Boulter,
G. diSibio,
A. Gossler, and G. Weinmaster.
1996.
Expression patterns of Jagged, Delta1, Notch1, Notch2, and Notch3 genes identify ligand-receptor pairs that may function in neural development.
Mol. Cell Neurosci.
8:14-27[CrossRef][Medline].
|
| 54.
|
Liu, Y.,
G. Dehni,
K. J. Purcell,
J. Sokolow,
M. L. Carcangiu,
S. Artavanis-Tsakonas, and S. Stifani.
1996.
Epithelial expression and chromosomal location of human TLE genes: implications for notch signaling and neoplasia.
Genomics
31:58-64[CrossRef][Medline].
|
| 55.
|
Matsuno, K.,
D. Eastman,
T. Mitsiades,
A. M. Quinn,
M. L. Carcanciu,
P. Ordentlich,
T. Kadesch, and S. Artavanis-Tsakonas.
1998.
Human deltex is a conserved regulator of Notch signalling.
Nat. Genet.
19:74-78[CrossRef][Medline].
|
| 56.
|
Matsuno, K.,
M. J. Go,
X. Sun,
D. S. Eastman, and S. Artavanis-Tsakonas.
1997.
Suppressor of Hairless-independent events in Notch signaling imply novel pathway elements.
Development
124:4265-4273[Abstract].
|
| 57.
|
Miele, L., and B. Osborne.
1999.
Arbiter of differentiation and death: notch signaling meets apoptosis.
J. Cell Physiol.
181:393-409[CrossRef][Medline].
|
| 58.
|
Milner, L. A., and A. Bigas.
1999.
Notch as a mediator of cell fate determination in hematopoiesis: evidence and speculation.
Blood
93:2431-2448[Free Full Text].
|
| 59.
|
Milner, L. A.,
A. Bigas,
R. Kopan,
C. Brashem-Stein,
I. D. Bernstein, and D. I. Martin.
1996.
Inhibition of granulocytic differentiation by mNotch1.
Proc. Natl. Acad. Sci. USA
93:13014-13019[Abstract/Free Full Text].
|
| 60.
|
Myat, A.,
D. Henrique,
D. Ish-Horowicz, and J. Lewis.
1996.
A chick homologue of Serrate and its relationship with Notch and Delta homologues during central neurogenesis.
Dev. Biol.
174:233-247[CrossRef][Medline].
|
| 61.
|
Nofziger, D.,
A. Miyamoto,
K. M. Lyons, and G. Weinmaster.
1999.
Notch signaling imposes two distinct blocks in the differentiation of C2C12 myoblasts.
Development
126:1689-1702[Abstract].
|
| 62.
|
Nye, J. S., and R. Kopan.
1995.
Developmental signaling. Vertebrate ligands for Notch.
Curr. Biol.
5:966-969[CrossRef][Medline].
|
| 63.
|
Nye, J. S.,
R. Kopan, and R. Axel.
1994.
An activated Notch suppresses neurogenesis and myogenesis but not gliogenesis in mammalian cells.
Development
120:2421-2430[Abstract/Free Full Text].
|
| 64.
|
Oda, T.,
A. G. Elkahloun,
P. S. Meltzer, and S. C. Chandrasekharappa.
1997.
Identification and cloning of the human homolog (JAG1) of the rat Jagged1 gene from the Alagille syndrome critical region at 20p12.
Genomics
43:376-379[CrossRef][Medline].
|
| 65.
|
Ordentlich, P.,
A. Lin,
C. P. Shen,
C. Blaumueller,
K. Matsuno,
S. Artavanis-Tsakonas, and T. Kadesch.
1998.
Notch inhibition of E47 supports the existence of a novel signaling pathway.
Mol. Cell. Biol.
18:2230-2239[Abstract/Free Full Text].
|
| 66.
|
Oswald, F.,
S. Liptay,
G. Adler, and R. M. Schmid.
1998.
NF- B2 is a putative target gene of activated Notch-1 via RBP-J .
Mol. Cell. Biol.
18:2077-2088[Abstract/Free Full Text].
|
| 67.
|
Pear, W. S.,
J. C. Aster,
M. L. Scott,
R. P. Hasserjian,
B. Soffer,
J. Sklar, and D. Baltimore.
1996.
Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles.
J. Exp. Med.
183:2283-2291[Abstract/Free Full Text].
|
| 68.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 69.
|
Pui, J. C.,
D. Allman,
L. Xu,
S. DeRocco,
F. G. Karnell,
S. Bakkour,
J. Y. Lee,
T. Kadesch,
R. R. Hardy,
J. C. Aster, and W. S. Pear.
1999.
Notch1 expression in early lymphopoiesis influences B versus T lineage determination.
Immunity
11:299-308[CrossRef][Medline].
|
| 70.
|
Robbins, J.,
B. J. Blondel,
D. Gallahan, and R. Callahan.
1992.
Mouse mammary tumor gene int-3: a member of the notch gene family transforms mammary epithelial cells.
J. Virol.
66:2594-2599[Abstract/Free Full Text].
|
| 71.
|
Robey, E.
1997.
Notch in vertebrates.
Curr. Opin. Genet. Dev.
7:551-557[CrossRef][Medline].
|
| 72.
|
Roehl, H.,
M. Bosenberg,
R. Blelloch, and J. Kimble.
1996.
Roles of the RAM and ANK domains in signaling by the C. elegans GLP-1 receptor.
EMBO J.
15:7002-7012[Medline].
|
| 73.
|
Roehl, H., and J. Kimble.
1993.
Control of cell fate in C. elegans by a GLP-1 peptide consisting primarily of ankyrin repeats.
Nature
364:632-635[CrossRef][Medline].
|
| 74.
|
Rohn, J. L.,
A. S. Lauring,
M. L. Linenberger, and J. Overbaugh.
1996.
Transduction of Notch2 in feline leukemia virus-induced thymic lymphoma.
J. Virol.
70:8071-8080[Abstract].
|
| 75.
|
Schroeter, E. H.,
J. A. Kisslinger, and R. Kopan.
1998.
Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain.
Nature
393:382-386[CrossRef][Medline].
|
| 76.
|
Sestan, N.,
S. Artavanis-Tsakonas, and P. Rakic.
1999.
Contact-dependent inhibition of cortical neurite growth mediated by notch signaling.
Science
286:741-746[Abstract/Free Full Text].
|
| 77.
|
Shawber, C.,
J. Boulter,
C. E. Lindsell, and G. Weinmaster.
1996.
Jagged2: a serrate-like gene expressed during rate embryogenesis.
Dev. Biol.
180:370-376[CrossRef][Medline].
|
| 78.
|
Shawber, C.,
D. Nofziger,
J. J. Hsieh,
C. Lindsell,
O. Bogler,
D. Hayward, and G. Weinmaster.
1996.
Notch signaling inhibits muscle cell differentiation through a CBF1-independent pathway.
Development
122:3765-3773[Abstract].
|
| 79.
|
Sidorova, J., and L. Breeden.
1993.
Analysis of the SW14/SW16 protein complex, which directs G1/S-specific transcription in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:1069-1077[Abstract/Free Full Text].
|
| 80.
|
Smith, G. H.,
D. Gallahan,
F. Diella,
C. Jhappan,
G. Merlino, and R. Callahan.
1995.
Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development.
Cell Growth Differ.
6:563-577[Abstract].
|
| 81.
|
Struhl, G., and A. Adachi.
1998.
Nuclear access and action of notch in vivo.
Cell
93:649-660[CrossRef][Medline].
|
| 82.
|
Struhl, G.,
K. Fitzgerald, and I. Greenwald.
1993.
Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo.
Cell
74:331-345[CrossRef][Medline].
|
| 83.
|
Struhl, G., and I. Greenwald.
1999.
Presenilin is required for activity and nuclear access of Notch in Drosophila.
Nature
398:522-525[CrossRef][Medline].
|
| 84.
|
Tamura, K.,
Y. Taniguchi,
S. Minoguchi,
T. Sakai,
T. Tun,
T. Furukawa, and T. Honjo.
1995.
Physical interaction between a novel domain of the receptor Notch and the transcription factor RBP-J kappa/Su(H).
Curr. Biol.
5:1416-1423[CrossRef][Medline].
|
| 85.
|
Tun, T.,
Y. Hamaguchi,
N. Matsunami,
T. Furukawa,
T. Honjo, and M. Kawaichi.
1994.
Recognition sequence of a highly conserved DNA binding protein RBP-J kappa.
Nucleic Acids Res.
22:965-971[Abstract/Free Full Text].
|
| 86.
|
Uyttendaele, H.,
G. Marazzi,
G. Wu,
Q. Yan,
D. Sassoon, and J. Kitajewski.
1996.
Notch4/int-3, a mammary proto-oncogene, is an endothelial cell-specific mammalian Notch gene.
Development
122:2251-2259[Abstract].
|
| 87.
|
Valsecchi, C.,
C. Ghezzi,
A. Ballabio, and E. I. Rugarli.
1997.
JAGGED2: a putative Notch ligand expressed in the apical ectodermal ridge and in sites of epithelial-mesenchymal interactions.
Mech. Dev.
69:203-207[CrossRef][Medline].
|
| 88.
|
Wakamatsu, Y.,
T. M. Maynard,
S. U. Jones, and J. A. Weston.
1999.
NUMB localizes in the basal cortex of mitotic avian neuroepithelial cells and modulates neuronal differentiation by binding to NOTCH-1.
Neuron
23:71-81[CrossRef][Medline].
|
| 89.
|
Wang, S.,
S. Younger-Shepherd,
L. Y. Jan, and Y. N. Jan.
1997.
Only a subset of the binary cell fate decisions mediated by Numb/Notch signaling in Drosophila sensory organ lineage requires Suppressor of Hairless.
Development
124:4435-4446[Abstract].
|
| 90.
|
Weinmaster, G.,
V. J. Roberts, and G. Lemke.
1991.
A homolog of Drosophila Notch expressed during mammalian development.
Development
113:199-205[Abstract].
|
| 91.
|
Weinmaster, G.,
V. J. Roberts, and G. Lemke.
1992.
Notch2: a second mammalian Notch gene.
Development
116:931-941[Abstract].
|
| 92.
|
Wen, W.,
J. L. Meinkoth,
R. Y. Tsien, and S. S. Taylor.
1995.
Identification of a signal for rapid export of proteins from the nucleus.
Cell
82:463-473[CrossRef][Medline].
|
| 93.
|
Zagouras, P.,
S. Stifani,
C. M. Blaumueller,
M. L. Carcangiu, and S. Artavanis-Tsakonas.
1995.
Alterations in Notch signaling in neoplastic lesions of the human cervix.
Proc. Natl. Acad. Sci. USA
92:6414-6418[Abstract/Free Full Text].
|
| 94.
|
Zhang, N., and T. Gridley.
1998.
Defects in somite formation in lunatic fringe-deficient mice.
Nature
394:374-377[CrossRef][Medline].
|
Molecular and Cellular Biology, June 2000, p. 3928-3941, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Joshi, I., Minter, L. M., Telfer, J., Demarest, R. M., Capobianco, A. J., Aster, J. C., Sicinski, P., Fauq, A., Golde, T. E., Osborne, B. A.
(2009). Notch signaling mediates G1/S cell-cycle progression in T cells via cyclin D3 and its dependent kinases. Blood
113: 1689-1698
[Abstract]
[Full Text]
-
Michie, A. M., Chan, A. C., Ciofani, M., Carleton, M., Lefebvre, J. M., He, Y., Allman, D. M., Wiest, D. L., Zuniga-Pflucker, J. C., Izon, D. J.
(2007). Constitutive Notch signalling promotes CD4 CD8 thymocyte differentiation in the absence of the pre-TCR complex, by mimicking pre-TCR signals. Int Immunol
19: 1421-1430
[Abstract]
[Full Text]
-
Wu, J., Bresnick, E. H.
(2007). Glucocorticoid and Growth Factor Synergism Requirement for Notch4 Chromatin Domain Activation. Mol. Cell. Biol.
27: 2411-2422
[Abstract]
[Full Text]
-
Liu, Z.-J., Xiao, M., Balint, K., Soma, A., Pinnix, C. C., Capobianco, A. J., Velazquez, O. C., Herlyn, M.
(2006). Inhibition of endothelial cell proliferation by Notch1 signaling is mediated by repressing MAPK and PI3K/Akt pathways and requires MAML1. FASEB J.
20: 1009-1011
[Abstract]
[Full Text]
-
Liu, Z.-J., Xiao, M., Balint, K., Smalley, K. S.M., Brafford, P., Qiu, R., Pinnix, C. C., Li, X., Herlyn, M.
(2006). Notch1 Signaling Promotes Primary Melanoma Progression by Activating Mitogen-Activated Protein Kinase/Phosphatidylinositol 3-Kinase-Akt Pathways and Up-regulating N-Cadherin Expression.. Cancer Res.
66: 4182-4190
[Abstract]
[Full Text]
-
Dumortier, A., Jeannet, R., Kirstetter, P., Kleinmann, E., Sellars, M., dos Santos, N. R., Thibault, C., Barths, J., Ghysdael, J., Punt, J. A., Kastner, P., Chan, S.
(2006). Notch Activation Is an Early and Critical Event during T-Cell Leukemogenesis in Ikaros-Deficient Mice. Mol. Cell. Biol.
26: 209-220
[Abstract]
[Full Text]
-
Beverly, L. J., Felsher, D. W., Capobianco, A. J.
(2005). Suppression of p53 by Notch in Lymphomagenesis: Implications for Initiation and Regression. Cancer Res.
65: 7159-7168
[Abstract]
[Full Text]
-
Veeraraghavalu, K., Subbaiah, V. K., Srivastava, S., Chakrabarti, O., Syal, R., Krishna, S.
(2005). Complementation of Human Papillomavirus Type 16 E6 and E7 by Jagged1-Specific Notch1-Phosphatidylinositol 3-Kinase Signaling Involves Pleiotropic Oncogenic Functions Independent of CBF1;Su(H);Lag-1 Activation. J. Virol.
79: 7889-7898
[Abstract]
[Full Text]
-
Purow, B. W., Haque, R. M., Noel, M. W., Su, Q., Burdick, M. J., Lee, J., Sundaresan, T., Pastorino, S., Park, J. K., Mikolaenko, I., Maric, D., Eberhart, C. G., Fine, H. A.
(2005). Expression of Notch-1 and Its Ligands, Delta-Like-1 and Jagged-1, Is Critical for Glioma Cell Survival and Proliferation. Cancer Res.
65: 2353-2363
[Abstract]
[Full Text]
-
Le Gall, M., Giniger, E.
(2004). Identification of Two Binding Regions for the Suppressor of Hairless Protein within the Intracellular Domain of Drosophila Notch. J. Biol. Chem.
279: 29418-29426
[Abstract]
[Full Text]
-
Nefedova, Y., Cheng, P., Alsina, M., Dalton, W. S., Gabrilovich, D. I.
(2004). Involvement of Notch-1 signaling in bone marrow stroma-mediated de novo drug resistance of myeloma and other malignant lymphoid cell lines. Blood
103: 3503-3510
[Abstract]
[Full Text]
-
Trifonova, R., Small, D., Kacer, D., Kovalenko, D., Kolev, V., Mandinova, A., Soldi, R., Liaw, L., Prudovsky, I., Maciag, T.
(2004). The non-transmembrane form of Delta1 but not of jagged1 Induces normal migratory behavior accompanied by FGF receptor 1-dependent transformation. J. Biol. Chem.
0: 300564200-1
[Abstract]
-
Chu, J., Bresnick, E. H.
(2004). Evidence That C Promoter-binding Factor 1 Binding Is Required for Notch-1-mediated Repression of Activator Protein-1. J. Biol. Chem.
279: 12337-12345
[Abstract]
[Full Text]
-
Tsunematsu, R., Nakayama, K., Oike, Y., Nishiyama, M., Ishida, N., Hatakeyama, S., Bessho, Y., Kageyama, R., Suda, T., Nakayama, K. I.
(2004). Mouse Fbw7/Sel-10/Cdc4 Is Required for Notch Degradation during Vascular Development. J. Biol. Chem.
279: 9417-9423
[Abstract]
[Full Text]
-
Espinosa, L., Ingles-Esteve, J., Aguilera, C., Bigas, A.
(2003). Phosphorylation by Glycogen Synthase Kinase-3{beta} Down-regulates Notch Activity, a Link for Notch and Wnt Pathways. J. Biol. Chem.
278: 32227-32235
[Abstract]
[Full Text]
-
Bao, J., Wolpowitz, D., Role, L. W., Talmage, D. A.
(2003). Back signaling by the Nrg-1 intracellular domain. JCB
161: 1133-1141
[Abstract]
[Full Text]
-
Johansen, L. M., Deppmann, C. D., Erickson, K. D., Coffin, W. F. III, Thornton, T. M., Humphrey, S. E., Martin, J. M., Taparowsky, E. J.
(2003). EBNA2 and Activated Notch Induce Expression of BATF. J. Virol.
77: 6029-6040
[Abstract]
[Full Text]
-
Ascano, J. M., Beverly, L. J., Capobianco, A. J.
(2003). The C-terminal PDZ-Ligand of JAGGED1 Is Essential for Cellular Transformation. J. Biol. Chem.
278: 8771-8779
[Abstract]
[Full Text]
-
Weng, A. P., Nam, Y., Wolfe, M. S., Pear, W. S., Griffin, J. D., Blacklow, S. C., Aster, J. C.
(2003). Growth Suppression of Pre-T Acute Lymphoblastic Leukemia Cells by Inhibition of Notch Signaling. Mol. Cell. Biol.
23: 655-664
[Abstract]
[Full Text]
-
Cronshaw, J. M., Krutchinsky, A. N., Zhang, W., Chait, B. T., Matunis, M. J.
(2002). Proteomic analysis of the mammalian nuclear pore complex. JCB
158: 915-927
[Abstract]
[Full Text]
-
Jeffries, S., Robbins, D. J., Capobianco, A. J.
(2002). Characterization of a High-Molecular-Weight Notch Complex in the Nucleus of Notchic-Transformed RKE Cells and in a Human T-Cell Leukemia Cell Line. Mol. Cell. Biol.
22: 3927-3941
[Abstract]
[Full Text]
-
Sriuranpong, V., Borges, M. W., Strock, C. L., Nakakura, E. K., Watkins, D. N., Blaumueller, C. M., Nelkin, B. D., Ball, D. W.
(2002). Notch Signaling Induces Rapid Degradation of Achaete-Scute Homolog 1. Mol. Cell. Biol.
22: 3129-3139
[Abstract]
[Full Text]
-
Chu, J., Jeffries, S., Norton, J. E., Capobianco, A. J., Bresnick, E. H.
(2002). Repression of Activator Protein-1-mediated Transcriptional Activation by the Notch-1 Intracellular Domain. J. Biol. Chem.
277: 7587-7597
[Abstract]
[Full Text]
-
Oswald, F., Tauber, B., Dobner, T., Bourteele, S., Kostezka, U., Adler, G., Liptay, S., Schmid, R. M.
(2001). p300 Acts as a Transcriptional Coactivator for Mammalian Notch-1. Mol. Cell. Biol.
21: 7761-7774
[Abstract]
[Full Text]
-
Ronchini, C., Capobianco, A. J.
(2001). Induction of Cyclin D1 Transcription and CDK2 Activity by Notchic: Implication for Cell Cycle Disruption in Transformation by Notchic. Mol. Cell. Biol.
21: 5925-5934
[Abstract]
[Full Text]
-
Aster, J. C., Xu, L., Karnell, F. G., Patriub, V., Pui, J. C., Pear, W. S.
(2000). Essential Roles for Ankyrin Repeat and Transactivation Domains in Induction of T-Cell Leukemia by Notch1. Mol. Cell. Biol.
20: 7505-7515
[Abstract]
[Full Text]
-
Ingles-Esteve, J., Espinosa, L., Milner, L. A., Caelles, C., Bigas, A.
(2001). Phosphorylation of Ser2078 Modulates the Notch2 Function in 32D Cell Differentiation. J. Biol. Chem.
276: 44873-44880
[Abstract]
[Full Text]