Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 3988-3995, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A 5' Splice Site-Proximal Enhancer Binds SF1 and
Activates Exon Bridging of a Microexon
Troy
Carlo,1,2,
Rebecca
Sierra,1 and
Susan M.
Berget1,2,*
Verna and Marrs McLean Department of
Biochemistry1 and Program in Cell and
Molecular Biology,2 Baylor College of
Medicine, Houston, Texas 77030
Received 14 July 1999/Returned for modification 25 August
1999/Accepted 15 March 2000
 |
ABSTRACT |
Internal exon size in vertebrates occurs over a narrow size range.
Experimentally, exons shorter than 50 nucleotides are poorly included
in mRNA unless accompanied by strengthened splice sites or accessory
sequences that act as splicing enhancers, suggesting steric
interference between snRNPs and other splicing factors binding
simultaneously to the 3' and 5' splice sites of microexons. Despite
these problems, very small naturally occurring exons exist. Here we
studied the factors and mechanism involved in recognizing a
constitutively included six-nucleotide exon from the cardiac troponin T
gene. Inclusion of this exon is dependent on an enhancer located
downstream of the 5' splice site. This enhancer contains six copies of
the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or
downstream of the target exon, suggesting an ability to bind factors
that bridge splicing units. A single copy of this sequence is
sufficient for in vivo exon inclusion and is the binding site for the
known bridging mammalian splicing factor 1 (SF1). The enhancer and its
bound SF1 act to increase recognition of the upstream exon during exon
definition, such that competition of in vitro reactions with RNAs
containing the GGGGCUG repeated sequence depress splicing of
the upstream intron, assembly of the spliceosome on the 3' splice site
of the exon, and cross-linking of SF1. These results suggest a model in
which SF1 bridges the small exon during initial assembly, thereby
effectively extending the domain of the exon.
 |
INTRODUCTION |
One of the fundamental problems in
pre-mRNA splicing is initial splice site recognition. This is
especially true for splicing in vertebrate pre-mRNAs with small exons
surrounded by considerably larger introns. Observations that vertebrate
splice sites are better recognized in pairs, especially exonic pairs
(reviewed in references 3, 5, 11, 34, and
35), suggested one mechanism by which the splicing
machinery detects small exons. In these exon bridging or definition
events, concerted recognition of an exon occurs early during
spliceosome assembly via interactions between U2 snRNP auxiliary
factors (U2AF) bound to the pyrimidine tract of the 3' splice site and
U1 snRNPs bound to the 5' splice site. Such interaction is thought to
be either a direct interaction between the SR dipeptide containing
subunits of U2AF (U2AF35) and U1 snRNPs (U1 70K protein) or
an indirect contact mediated through SR proteins or other splicing
factors bound to exonic enhancer sequences (11, 29, 34).
Both U2AF and U1 snRNPs are thought to be general splicing factors used
for recognition of all exons, although it has been possible to
individually bypass requirements for both in vitro in the presence of
saturating amounts of SR proteins (14, 28, 41).
The exonic model for splice site pairing can be contrasted to a more
classical model in which splice sites interact across introns. Although
such pairing can occur by the SR protein and U2AF-mediated model
mentioned above, an alternative model for intron bridging invokes an
interaction between U2AF65 and U1 snRNPs mediated by
splicing factor 1 (SF1) in mammals or branchpoint binding protein (BBP)
in Saccharomyces cerevisiae (1, 2). SF1 is
required for initial ATP-dependent complex formation in mammals
(25) and contacts the large subunit of U2AF
(U2AF65) to promote binding of the latter to the
branchpoint (4, 6-8). In yeast, BBP has been genetically
shown to interact with proteins that are associated with U1 snRNPs
(2). Although most of these U1-associated proteins (20,
23, 27) have not yet been reported to exist in vertebrates, the
similarity between SF1 and BBP suggests that they do. Thus, U2AF
becomes a pivotal branchpoint/pyrimidine tract binding protein that can
communicate with either an upstream 5' splice site (thereby bridging
the intron) via SF1 or SR proteins or a downstream 5' splice site
(thereby bridging the exon) via SR proteins. Because these two
interaction modes utilize different subunits of U2AF, both could occur simultaneously.
One prediction of models that pair splice sites across exons is that
exon size should be important for recognition. Statistical data suggest
optimal recognition of splice sites over a narrow size range
(21), implying recognition problems for either small or
large internal exons. Artificially shortening an internal exon leads to
inefficient recognition (17, 18), presumably due to both
deletion of exon accessory sequences and steric hindrance of factors,
especially large factors like U1 and U2 snRNPs, binding simultaneously
to bordering splice sites. Despite this problem, a number of very small
exons exist that are constitutively included in vertebrate mRNAs. To
gain insight into the mechanism of recognition of small exons, we have
undertaken analysis of the sequences and factors required for
recognition of the 6-nucleotide (nt) microexon 17 of the chicken
cardiac troponin T gene (cTNT). Recognition of this exon requires a
130-nt sequence element located in the downstream intron
(12). This element, termed the cTNT intron splicing enhancer
(ISE), contains multiple copies of a short G-rich repeat, GGGGCUG,
with the first repeat located immediately adjacent to the 5'
splice site. The cTNT ISE is capable of enhancing the recognition of
heterologous small exons in vivo. In addition, the cTNT ISE is unique
in that it can facilitate enhanced exon inclusion when located either
upstream or downstream of its target exon. This latter property
suggested that the ISE might be recognized by a factor capable of
interacting with factors bound to both the 5' and 3' splice sites.
Here we report identification of one trans-acting factor
recognizing the short G-rich repeat and this factor's interaction with
the splicing machinery. UV-cross-linking experiments and immunoprecipitation identified a 90-kDa protein binding to the GGGGCUG element as SF1. The involvement of a known bridging
protein in microexon recognition may suggest why the ISE functions to stimulate inclusion when positioned before or after target microexons. Using precursor RNAs consisting of an isolated internal exon followed by the ISE (i.e., substrates that contain a single 3' and 5' splice site in an exonic polarity), assembly of complex A was stimulated by
the presence of the ISE downstream of the 5' splice site and inhibited
by competition with small RNAs containing the enhancer repeated
GGGGCUG sequence. The binding of SF1 to the enhancer sequence GGGGCUG may be very similar to the binding of SF1
to the branchpoint sequence YNCURA because replacement of nucleotides surrounding the central CU in the branchpoint with G's, a conversion that would make a branchpoint resemble the cTNT enhancer, have been
previously reported to have no effect on SF1 binding (6). These results suggest that the presence of an SF1 binding site downstream of a microexon effectively extends the domain of the microexon during early recognition so as to permit spliceosome assembly.
 |
MATERIALS AND METHODS |
Plasmid constructs.
The constructs used for the experiment
in Table 1 involved addition of the ISE to the intron preceding a
heterologous miniexon and were based on the previously reported E3
minigene (12). The basal construct contained chicken
skeletal troponin I (sTNI) exon 3 flanked by 111 and 173 nt of introns
2 and 3 (40). Wild-type (WT) or mutant (M1, M2, or M3, as
defined in Fig. 3) constructs were created by the insertion of
double-stranded oligonucleotides (purchased from Gibco BRL) containing
a single ISE repeat sequence (with the additional bases CTAG at the 5'
end for annealing to the SpeI restriction site) into the
SpeI site upstream of sTNI exon 3. The sequence of the exon
whose inclusion is activated by the ISE is TGAAGAG, and that
of its 3' pyrimidine tract is CCTTTTCTCCCCTTTCTCTTCCTTCCCTTCCTCGCCCATCTACTCTCCCT. All
constructs were confirmed by DNA sequencing.
The in vitro constructs (E45.ISE and E45.ISE OPP) used for the
experiments in Fig. 2, 5, 7, and 8 have been described previously (12) and are based on cTNT exons and intron sequences. The
in vitro substrates containing only the second exon (E5.ISE and E5.ISE OPP) were created by NcoI-XhoI deletion to remove
92 nt including the first exon. The second exon in this construct is 30 nt and has the sequence GTTCACAACCATCTAAGGCAAGATGTCCA, with
a 3' pyrimidine tract of CTTCTTCCCTTCCCTCCTCCCT.
The in vivo construct used in for the experiment displayed in Fig. 6
was based on a
-globin construct, DUP33 (17). For cloning
purposes, the second exon was removed from the parental construct via
BbsI digestion and replaced with a short polylinker. The
polylinker was digested and the second exon was reinserted, creating
unique BglII site upstream of the exon and a unique
ClaI site downstream of the exon (construct TC 161).
PCR-based mutagenesis was used to further modify this clone and create
a StuI site located 9 nt downstream of the 5' splice site of
the second exon (construct TC 312). TC 161 was digested with
ClaI and the entire cTNT ISE was inserted in both
orientations to yield +121 sense and +121 antisense constructs. TC 312 was digested with StuI and a shortened ISE was inserted in
both orientations to yield +29 sense and +29 antisense constructs. The
second exon in this construct has the sequence
GCTGCTGGTGGTCCATGGAGGCCCTGGGCAG, preceded by the 3'
pyrimidine tract TCTCTCGCCTATTGGTCTATTTTCCCACCCTT.
In vitro splicing.
Standard splicing conditions consisted of
40% HeLa nuclear extract, 25 mM creatine phosphate, 0.625 mM ATP, 3.0 mM MgCl2, 1.2 mM dithiothreitol, and 1.56% polyethylene
glycol 8000. In vitro splicing and splicing competition assays were
performed in 25-µl reactions incubated under standard splicing
conditions at 30°C for 60 min. In vitro assembly assays were
incubated at 30°C under standard splicing conditions for the times
indicated prior to the addition of heparin to a final concentration of
2 mg/ml and display on neutral gels (12). UV-cross-linking
experiments, performed under standard splicing conditions, were
incubated for 5 min at 30°C, after which heparin was added to the
reaction at a final concentration of 2.4 mg/ml. Samples were then
subjected to 10 min of UV irradiation on ice followed by digestion with RNases A and T1 and sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE). Cross-linking reactions using synthetic RNA oligonucleotides (purchased from Oligos Etc.), phosphorylated with
radiolabeled [
-32P]ATP, were not subjected to RNase treatment.
Extract depletions.
Standard HeLa nuclear extract was
biochemically modified to create poly(G)-depleted nuclear extract.
Extract was dialyzed to a deplete glycerol and raise the KCl
concentration to 1.0 M. Dialyzed extract was subsequently passed over
column containing poly(G) beads (Sigma catalog no. P 1908) in the same
buffer. An approximate equal ratio of beads to extract was used. The
flowthrough was collected and dialyzed against Roeder D
(16).
Immunoprecipitations.
Immunoprecipitations were performed
using standard UV-cross-linking reactions. After exposure to UV
irradiation, 10 µl of polyclonal SF1 or U2AF65-specific
antipeptide antibody was added to the reaction mixture, which was then
incubated for 60 min on ice. Immune complexes were collected on Gamma
Bind G-Sepharose beads (Pharmacia). Samples were repeatedly washed in
NET buffer (0.15 M NaCl, 0.05 M Tris-HCl [pH 7.5], 2 mM EDTA, 0.05%
NP-40) after 60 min of constant rocking at 0°C. Immunoprecipitated
proteins were visualized by SDS-PAGE followed by autoradiography.
 |
RESULTS |
GGGGCUG is the core repeat unit of the cTNT ISE.
We
previously described (12) the presence of an ISE located
downstream of the 6-nt cTNT exon 17 (Fig.
1A). The 130-nt ISE is composed of
several copies of a short G-rich repeat with a consensus of
GGGGCUG (Fig. 1A and B). Multiple copies of this repeat are
capable of enhancing the recognition and inclusion of a heterologous
7-nt microexon, sTNI exon 3. To further define the minimal sequence
required to effect exon recognition, a single GGGGCUG
sequence containing either the WT or mutant sequence were tested
for the ability to facilitate exon inclusion.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of the cTNT miniexon 17 and surrounding intron
sequences including the G-rich ISE. (A) Exon-intron structure of the
region of the cTNT gene including the 6-nt exon 17. (B) Sequence of the
ISE. Exon 17 sequences are indicated within the box, the enhancer is
indicated in capitals, and each G-rich repeat is underlined. (C)
Comparison of the individual repeats within the ISE with the derived
consensus.
|
|
Using a test system developed in a previous study (12), the
7-nt GGGGCUG sequence was placed upstream of a heterologous miniexon (sTNI exon 3) in a minigene in which exon inclusion could be
assayed following transient transfection. In the absence of an added
enhancer, only 13% of the mRNA included exon 7 (Table 1). The addition of a single copy of the
G-rich repeat GGGGCUG (WT) enhanced the level of exon
inclusion to around 50%, indicating that a single copy of GGGGCUG
has enhancing capacity. Mutation of the repeat sequence to
AAAACUG (M1), GGGGAAA (M2), or GUGUCAG (M3) destroyed enhanced levels of exon recognition and inclusion, producing levels of exon inclusion of 13, 11, and 14%, respectively. These data suggest that GGGGCUG is a specific splicing
enhancer sequence and that an entire GGGGCUG sequence is
necessary. The sequence GGGGGGG supported slightly improved
exon inclusion compared to the other mutant elements (23% inclusion),
suggesting that ISE-binding factors might demonstrate a binding
preference for oligo(G).
An oligonucleotide containing the ISE sequence GGGGCUG
competes the splicing enhancement afforded by the cTNT ISE.
We have previously reported that the ISE enhances in vitro splicing of
heterologous test substrates (12). To ascertain if the ISE
GGGGCUG sequence is the binding site for factors involved in
ISE-mediated enhancement, we performed competition experiments to test
whether WT or mutant copies of GGGGCUG could inhibit in vitro splicing of precursor RNAs containing an ISE (Fig.
2). The in vitro splicing test substrates
consisted of cTNT exon 4, intron 4, and the relatively small exon 5 (30 nt) with the cTNT ISE located downstream of exon 5 in either the sense
(E45.ISE) or antisense (E45.ISE OPP) orientation. The presence of the
enhancer stimulated splicing of this precursor RNA (Fig. 2B, compare
lanes 1 and 2).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Competitor RNAs containing a WT GGGGCUG repeat sequence
but not mutant sequence inhibit in vitro splicing using intact HeLa or
poly(G)-depleted nuclear extracts. Increasing amounts of competitor
RNAs as indicated were added to splicing reactions with a test
precursor RNA using standard HeLa (A) or poly(G)-depleted nuclear
extract (B). Depleted extract was passed over poly(G) at high salt; the
unbound fraction was dialyzed against Roeder D buffer prior to assay.
The test RNA substrate consisted of a weak two-exon precursor RNA
dependent on the enhancer for maximal activity (12). The
cTNT ISE was positioned downstream of the second exon to assay the
effect of the enhancer sequence on splicing of intron 1. Competitor
RNAs were added to 25-µl reactions at 200, 400, 600, and 800 pmol.
Competitor sequences were GGGGCUG (WT), AAAACUG (M1), and GGGGAAA (M2).
(B) In vitro splicing using poly(G)-depleted extract. Lanes 1 and 2 show splicing activity with precursors containing the WT ISE in either
sense (E45.ISE) or antisense (E45.ISE.OPP) orientation to demonstrate
that element-enhanced splicing occurs in poly(G)-depleted extract.
Splicing reactions were performed for 60 min. RNAs were displayed on a
5% denaturing polyacrylamide gel. Precursor and product RNAs are
indicated.
|
|
Radiolabeled in vitro-transcribed RNA substrates were incubated under
standard splicing conditions in the presence of increasing amounts of
RNA oligonucleotides corresponding to wild-type or mutant versions of
the short G-rich repeat located in the ISE. As shown in Fig. 2A (lanes
1 to 4), the addition of increasing amounts of the specific RNA
competitor GGGGCUG (WT RNA oligonucleotide) resulted in a
reduction in the amount of spliced product RNA. Competition reduced the
observed level of splicing down to the level observed when substrate
lacking the enhancer sequence was used, suggesting that competition of
the binding of factors to the enhancer was occurring. In contrast, the
nonspecific competitor GGGGAAA (M1 RNA oligonucleotide) or
AAAACUG (M2 RNA oligonucleotide) had little or no effect on
the level of splicing (Fig. 2A, lanes 5 to 12). Thus, an RNA
oligonucleotide consisting of a single G-rich repeat from the cTNT ISE
is capable of competing the splicing enhancement afforded by the entire
cTNT ISE. In addition, the inability of RNA oligonucleotides M1 and M2
to compete splicing activity supports the in vivo results suggesting
that a functional enhancer unit requires both GGGG and CUG.
GGGGCUG binds to p90, a 90-kDa protein in nuclear
extract.
To determine what factor(s) binds to the G-rich repeat,
UV-cross-linking experiments were performed. Radiolabeled RNA
oligonucleotides containing the WT or mutant enhancer GGGGCUG
sequence were incubated under splicing conditions. A number of
proteins cross-linked to the WT sequence (Fig.
3A, lanes 1 to 4). A protein migrating at 90 kDa (p90) cross-linked to the WT oligonucleotide, not at all to
mutant oligonucleotide AAAACUG or GUGUCAG, and
very weakly to mutant oligonucleotide GGGGAAA. Two larger
proteins with apparent molecular masses of 110 and 150 kDa also
cross-linked to the WT oligonucleotide but not to AAAACUG or
GUGUCAG. Both of these proteins, however, cross-linked at WT
levels to the mutant GGGGAAA, suggesting less specificity
for the WT GGGGCUG sequence than p90. In addition to these
proteins, both hnRNP F and H (as determined by immunoprecipitation [data not shown]) strongly cross-linked to any of the
oligonucleotides with high G content, including the mutant
GGGGAAA.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
The ISE GGGGCUG repeated sequence can be UV cross-linked
to a 90-kDa protein in both HeLa and poly(G)-depleted extract. (A)
Radiolabeled RNA oligonucleotides consisting of WT or mutant ISE
GGGGCUG sequence were UV cross-linked using standard splicing
conditions in HeLa (lanes 1 to 4) or poly(G)-depleted (lanes 5 to 8)
nuclear extracts. Cross-linked reactions were not treated with RNase
prior to electrophoresis; therefore, the substrate oligonucleotides are
still attached to the proteins and affect apparent molecular weights.
Cross-linked bands of interest are indicated. (B) Competition of UV
cross-linking of the 90-kDa protein by the WT ISE GGGGCUG sequence but
not mutant sequences. Proteins that bind to the ISE GGGGCUG sequence
were detected by UV cross-linking in the presence of increasing amounts
of WT or mutant competitor RNAs using poly(G)-depleted nuclear extract.
The cross-linking substrate (WT) consisted of a short radiolabeled RNA
oligonucleotide, GGGGCUG. The competitors used were GGGGCUG (WT),
AAAACUG (M1), and GGGGAAA (M2). The amount of added competitor RNA is
indicated.
|
|
The ability of hnRNP F and H to strongly cross-link to mutant versions
of the ISE GGGGCUG sequence suggested that their binding might not be pivotal to enhancer function. We therefore decided to
adopt a purification strategy for ISE-binding proteins that would
fractionate interesting proteins such as p90 away from hnRNP F and H. We chose chromatography on poly(G) as an initial step in this
purification because of the strong affinity of hnRNP F and H for this
resin. HeLa nuclear extract was passed over poly(G) at high salt (1.0 M
KCl), conditions that should bind hnRNP F and H (30, 39) but
which might not bind other proteins with lower affinity for G
nucleotides. UV cross-linking with the flowthrough fraction from such
chromatography [referred to here as the poly(G)-depleted extract]
revealed that the hnRNP F and H concentrations were substantially reduced by this procedure but that p90 remained, as did the 110- and
150-kDa proteins. Furthermore, p90 retained its cross-linking preference for the WT ISE sequence, suggesting that fractionation had
not removed specificity (Fig. 3A, lanes 5 to 8).
Splicing assays performed with the poly(G)-depleted extract were used
to ascertain if the depleted extract maintained ISE-dependent splicing
enhancement (Fig. 2B). The splicing of the test substrate was still ISE
dependent in the depleted extract, indicating that factors necessary
for the ISE effect remained following depletion. The ISE-mediated
enhancement in the depleted extract was competed by WT oligonucleotides
but not the AAAACUG mutant. A competitor with the sequence
GGGGAAA was capable of competing this activity but to a
lesser extent than the WT oligonucleotide. Competitions were more
effective in the depleted extract, suggesting removal of proteins that
bound the sequence but which were not essential for enhancer activity
(compare Fig. 2A and B).
GGGGCUG competes UV cross-linking to p90.
The
preceding experiments suggested that p90 was an interesting candidate
for an enhancer-binding protein because the protein failed to
cross-link to a mutant ISE sequence and survived poly(G) depletion.
Oligonucleotide competition experiments were used to demonstrate that
the failure of p90 to UV cross-link to mutant ISE sequences was caused
by a failure to bind rather than an inability to cross-link due to a
sequence change in the mutant substrates (Fig. 3B). The radiolabeled
substrate used in these reactions, the WT RNA oligonucleotide, was
incubated in poly(G)-depleted HeLa nuclear extract in the presence of
increasing amounts of unlabeled competitor RNAs. Self-competition
resulted in a decrease in radiolabeled p90 as well as a decrease in the
150-kDa species but no decrease in p110 (Fig. 3B, lanes 1 to 5). This
experiment indicated that p90 and p150 might be interesting
enhancer-binding proteins to study, but not p110 (indeed, p110 was
sequenced and found to be nucleolin [data not shown]). The
AAAACAG mutant RNA oligonucleotide competitor had little to
no effect on the pattern of cross-linked proteins (Fig. 3B, lanes 6 to
9). Similar to the WT RNA oligonucleotide, addition of the M2 RNA
oligonucleotide (GGGGAAA) resulted in decreased levels of
cross-linked p90 and the 150-kDa species (Fig. 3B, lanes 10 to 13).
This experiment also demonstrated a highly reproducible distinction
between p90 and the 150-kDa species
p90 appeared to preferentially
bind to GGGGCUG, while the 150-kDa protein preferentially
bound GGGGAAA as assayed by competition experiments (Fig. 3,
compare lanes 2 to 5 to lanes 10 to 13). This result concentrated our
attention on p90 as the protein of immediate interest.
p90 is SF1.
Fractionation of nuclear extract aimed at
biochemical isolation of p90 demonstrated that the cross-linked protein
had several characteristics in common with mammalian SF1. Most
significantly, SF1 and p90 both demonstrated affinity for poly(G) and
did not bind to DEAE at low to moderate salt concentrations (reference 25 and data not shown). Both factors were present in
S100 as well as nuclear extract (Fig. 4).
Although p90 is slightly larger than SF1 (75 kDa), in our tests of
cross-linking to oligonucleotides, no RNase treatment was used so that
the observed species still contained a full-length oligonucleotide
covalently coupled to the protein. Therefore, the cross-linked species
could well be SF1 despite its slightly greater size. The similarities
in properties of p90 and SF1 suggested that p90 and SF1 could be
related.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
SF1-specific antibodies immunoprecipitate the 90-kDa
UV-cross-linked protein. Radiolabeled GGGGCUG (WT) and AAAACUG (M1) RNA
oligonucleotides were UV cross-linked to proteins in HeLa or S100
extracts. Following cross-linking, the reactions were subjected to
immunoprecipitation using antisera specific for SF1 or U2AF proteins as
indicated. Lanes 8 and 9 contain 2 and 4 µl of the cross-linked
reaction using nuclear extract without immunoprecipitation. The
positions of SF1 and p90 are indicated.
|
|
To test this hypothesis, antiserum specific for SF1 was used to
immunoprecipitate UV-cross-linked proteins. The SF1-specific antipeptide antibody H3 (33) was capable of precipitating
p90 cross-linked to the WT RNA oligonucleotide in both nuclear and S100
extracts (Fig. 4, lanes 2 and 6). In contrast, beads alone (Fig. 4,
lanes 1 and 5) or polyclonal antiserum specific for the 65-kDa subunit
of U2AF (Fig. 4, lane 4) did not immunoprecipitate p90. More
importantly, the anti-SF1 antibody did not immunoprecipitate proteins
cross-linked to a control mutant RNA (Fig. 4, lanes 3 and 7).
Reactivity with the anti-SF1 antibody data demonstrated that p90 is the
previously identified splicing factor SF1.
The cTNT ISE enhances initial spliceosome formation.
SF1 has
been implicated in the earliest steps of spliceosome formation (2,
7, 8, 25). If SF1 binds the ISE GGGGCUG sequences,
then the enhancer should enhance early spliceosome assembly. To attempt
to determine if the ISE affects these steps in vitro, spliceosome
assembly assays were performed. In these experiments, substrates were
tested for the ability to form ATP-dependent splicing complexes in the
presence or absence of the cTNT ISE. Two single-intron constructs,
E45.ISE and E45.ISE OPP, were used. In these constructs, the ISE is
positioned downstream of exon 2 within the incomplete intron 2. The
assembly being assayed is that of intron 1; therefore, in this
precursor RNA the enhancer is affecting exon definition of exon 2 and
subsequent assembly of intron 1. The presence of the ISE in the sense
orientation, E45.ISE, facilitated increased levels of complex A
formation compared to the substrate containing the ISE in the antisense
orientation, E45.ISE OPP (Fig. 5A). The
E45.ISE construct also had enhanced levels of complex B formation
presumably due to the increased levels of complex A. This finding
indicates that ISE-binding proteins binding to a sequence downstream of
the second exon promote recognition of the upstream intron, suggesting
that the ISE is involved in defining the second exon and implicating
SF1 in exon definition of an upstream exon.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 5.
The ISE stimulates assembly of complex A. (A) Two-exon,
single-intron substrates with the ISE positioned downstream of the
second exon in the sense (E45.ISE) or antisense (E45.ISE.OPP)
orientation were incubated under standard splicing conditions for the
times indicated, and spliceosome complexes were visualized via native
gel electrophoresis. Splicing complexes H, A, and B are indicated. (B)
Assembly of substrates consisting of a single internal exon followed by
the ISE in the sense (E5.ISE) or antisense (E5.ISE.OPP) orientation.
Substrates are diagrammed below the gels. Substrates are identical or
derived from those in Fig. 2.
|
|
To further test the role of the ISE in exon definition, assembly
substrates were created that contained only the single internal exon,
exon 5, followed by the ISE in either the sense or antisense orientation (E5.ISE and E5.ISE OPP). Such isolated exon precursor RNAs
are capable of forming only complex A (Fig. 5B). The construct containing the ISE in the sense orientation (E5.ISE) assembled significantly better than the substrate containing the ISE in the
antisense orientation (E5.ISE.OPP). The increased level of complex A
formation in the presence of the ISE suggested that SF1 binding to the
cTNT ISE promotes early steps in exon recognition.
The cTNT ISE is a distance-dependent element.
The observations
in Fig. 5 indicated that the ISE participates in exon definition when
downstream of a target exon. In its parent gene, the ISE is positioned
immediately downstream of the exon beginning one nucleotide beyond the
5' splice site. This positioning coupled with the observation that the
element is recognized by a protein rather than an snRNP suggested that
the element might need to be close to the exon it affects. To test this
hypothesis, we created minigenes for in vivo transfections in which the
ISE was positioned at different distances downstream of a target small exon.
The gene used in this experiment was the artificially created DUP33
construct based on the
-globin gene that only minimally includes the
middle 33-nt exon unless supplemented with improved splice site
sequences or enhancers (17, 18). The basal construct was
modified to add the ISE, in both sense and antisense orientations, either 29 or 121 nt downstream of the 5' slice site of exon 2. Reverse
transcription-PCR (RT-PCR) analysis of in vivo RNA splicing phenotypes
following transfection of HeLa cells demonstrated that the construct
containing the ISE in a sense but not antisense orientation directed
considerable inclusion of the middle exon when it was placed 20 nt
downstream of the 5' splice site (Fig. 6,
lanes 2 and 3). Even a modest increase in the distance between the 5'
splice site and enhancer to 121 nt reduced splicing enhancement compared to the control (Fig. 6, lanes 4 and 5). These data demonstrate that the cTNT ISE is a distance-dependent element. Such a distance requirement suggests that factors binding to the enhancer, including SF1, must be placed near the exon to have effect.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
The ISE functions to activate an upstream exon only when
positioned close to the 5' splice site. The ISE was positioned either
29 or 121 nt downstream of the second exon in the three exon -globin
substrate DUP33 (17). Both sense and antisense versions of
the enhancer were used. The constructs were transfected into HeLa
cells, and RNA splicing phenotypes were assessed using RT-PCR and
primers specific for exons 1 and 3. Species resulting from inclusion or
skipping of the middle exon are indicated.
|
|
 |
DISCUSSION |
Studies directed at understanding the recognition of small
vertebrate exons have led to the consistent observation that intronic enhancers located adjacent to the exons are necessary for efficient exon recognition and splicing (9, 10, 12, 18, 32, 36, 40, 44,
47). In this study we have identified a core repeat unit within
such an enhancer and a protein recognizing the core sequence. The
intron enhancer under study (ISE) is located immediately adjacent to
the 5' splice site of a 6-nt microexon from the cTNT gene. The ISE is
required for both splicing and initial recognition of the microexon.
Within the 130-nt ISE are six copies of the short G-rich repeat
GGGGCUG. RNA oligonucleotides containing this short sequence
were able to compete the splicing enhancement afforded by the entire
130-nt ISE in in vitro splicing and spliceosome assembly assays.
UV-cross-linking experiments demonstrated that the mammalian splicing
factor SF1 binds to the ISE GGGGCUG repeated sequence. Consistent with SF1 binding to the ISE, the presence of the ISE enhanced early steps of spliceosome assembly, as assayed by complex A
formation. Oligonucleotides containing the ISE GGGGCUG
sequence effectively competed splicing, complex A assembly, and
SF1 cross-linking. These observations suggest that SF1 binding to the
ISE GGGGCUG sequences participates in exon definition of the
microexon. Mutant ISE GGGGCUG sequences that failed to bind
SF1 and failed to compete ISE-dependent in vitro splicing also failed
to stimulate in vivo recognition of the ISE, suggesting that the
binding of SF1 to the enhancer is required for in vivo activity.
Because we were unable to use available reagents to effectively deplete
endogenous SF1, however, formal proof of the requirement for SF1 in
this splicing reaction must await further experimentation.
SF1 has recently been shown to bind to the branchpoint sequence, which
at first glance bears little similarity to the enhancer GGGGCUG
sequence. Mutation studies of nucleotides important for SF1
recognition of branchpoints (6), however, indicate that the
central CUA of the yeast UACUAAC branchpoint is critical for binding, although the A could be altered to a G without serious impairment of binding (Fig. 7C). Thus,
SF1 would be predicted to bind via its KH domain to the terminal CUG
within the enhancer repeat. In addition, mutational analysis also
indicated that mutation of the two nucleotides within the branchpoint
preceding the CUA to G's also had little effect on SF1 binding
(6). Therefore, binding of SF1 to the ISE repeated sequence
GGGGCUG is not surprising.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Model for SF1 binding to the enhancer GGGGCUG enhancer
sequence. (A) Comparison of the zinc knuckle domains within SF1 (bone)
and the HIV nucleocapsid protein NL4-3. The zinc knuckle is indicated
by the box, and amino acids found to contact RNA within the HIV protein
are indicated with asterisks. (B) Model for binding of SF1 to the
enhancer GGGGCUG sequence. (C) Alignment of the enhancer core with
branchpoints from mammalian or yeast genes.
|
|
The zinc knuckle within SF1 could also participate in RNA binding.
Studies with another zinc knuckle-containing protein, the human
immunodeficiency virus (HIV) nucleocapsid protein, indicate a preferred
GGAG binding site for this zinc knuckle (15), similar to the
sequence at the beginning of the enhancer repeat. The region of the HIV
protein containing the zinc knuckle has 37% overall identity with SF1
in this region (Fig. 7A), suggesting they may have similar binding
preferences. In addition, purified SF1 has a preference for binding to
poly(G) at low salt (4). These observations suggest a model
for binding (Fig. 7B) in which both the zinc knuckle and the KH domain
contact the enhancer GGGGCUG in a fashion similar to that
postulated for contact between BBP and branchpoints (8).
Our data suggest a mechanism whereby SF1 activates exon definition. We
suggest, in the case of cTNT exon 17, that SF1 (or an SF1-U2AF
heterodimer) binds to the short G-rich repeat GGGGCUG located in the ISE downstream of the 5' splice site of this very small exon. After initial interactions with the RNA, bound SF1 stabilizes association of U2AF65 to the upstream pyrimidine
tract. In this model, SF1 becomes an exon bridging factor rather than
an intron bridging factor (Fig. 8).
Binding of SF1 to the ISE and activation of U2AF may help to explain
the previously startling observation that the ISE functions to activate
exon inclusion of microexons when positioned either downstream or
upstream of the target exon (12); i.e., as a bridging
protein, SF1 should be able to operate in either an exonic or intron
polarity.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8.
Model for SF1-mediated exon versus intron bridging. (A)
Intron bridging as described for S. cerevisiae; (B) exon
bridging as discussed for the exon in this study.
|
|
It should be noted that the 3' splice site of cTNT exon 17 contains the
sequence GGUGCUG located at
10 to
4 with respect to the
3' splice site, suggesting that in the natural context, SF1 could bind
to sequences immediately flanking both the 3' and 5' splice sites of
the exon. This upstream copy must not be required for SF1 activation,
however, because the three heterologous exons used in this study, the
7-nt sTNI exon 3, the 30-nt exon 5 from cTNT, and the artificial 33-nt
exon from the
-globin-derived DUP33, are all enhanced by the ISE
despite the absence of GGGGCUG sequences within their 3'
splice site regions. All of the utilized and responsive exons have long
U-poor, C-rich polypyrimidine tracts (Fig. 1 and Materials and
Methods). The four 3' splice sites have an average pyrimidine tract
length of 32 nt with 50% C's. More importantly, the longest
uninterrupted U tract within the four 3' splice sites is only 4 nt.
Therefore, each would be predicted to be a poor binding site for U2AF.
It will be interesting to see if SF1-mediated exon definition of small
exons such as these is accompanied by variations in the constellation
of proteins that bind the branchpoint-polypyrimidine tract during early
spliceosome assembly.
We would also suggest that recognition of 5' splice site-proximal
G-rich sequences by SF1 may be a common mechanism in vertebrate splicing. Statistical analysis of sequence composition downstream of 5'
splice sites has indicated an unusually high concentration of G-rich
sequences (19, 31). In addition, other small exons appear to
have GGGGCUG elements located in adjacent introns. Examples include the alternatively spliced 18-nt murine src N1 exon,
which contains two copies of this repeat located near other intronic accessory sequences (10), and the human p53 gene, containing multiple copies of the repeat located downstream of 22-nt exon 3. In
addition, alternatively splicing within the chicken
-tropomyosin gene is dependent on a G-rich repeat (consensus
[A/U]GGG) found six times immediately downstream of the second
mutually exclusive exon 6B (38). Although this latter
element does not have the complete sequence of the cTNT ISE
GGGGCUG repeat, it is similar and could be recognized by a
bridging protein.
The binding of SF1 to sequences downstream of the 5' splice site
naturally raises questions about the role of U1 snRNPs in recognizing
the 5' splice site terminating the microexon. Experimentation to
address this question indicated the need for U1 snRNP in exon recognition. When U1 snRNPs were depleted from extract, assembly of the
3' splice site of the exon did not occur (data not shown), indicating a
general requirement for U1 snRNPs. Interestingly, cleavage of the 5'
terminus of U1 RNA actually increased formation of the ATP-dependent
complex A, suggesting a different mode of recognition by U1 snRNPs than
the standard base pairing to 5' splice sites. In a different study
using a precursor RNA containing multiple GGG triplets downstream of
the 5' splice site but no copies of GGGGCUG, we have
discovered that U1 RNA can effectively base pair to GGG triplets and
this base pairing is resistant to RNase cleavage of the 5' end of U1
RNA because of the presence of CCU at nt 8 to 10 of U1 RNA (A. McCullough and S. M. Berget, submitted for publication). Coupled
with the observation that yeast SF1 (BBP) interacts with U1 snRNP
proteins an attractive model emerges in which U1 snRNPs and SF1 bind to
enhancer sequences downstream of the exon, thereby extending the domain
of the microexon (Fig. 8).
The observation of SF1 binding to sequences adjacent to the 5' splice
site raises the possibility that SF1 could participate in alternative
5' splice site or exon recognition. In mammals, SF1 comes in a variety
of forms that are expressed differentially in different cell types
(4). These different forms are distinguished by different
C-terminal proline-rich domains that presumably contain protein-protein
interaction motifs. Thus, the finding here may hint at other activities
of SF1 yet to be discovered.
The mechanism of exon recognition suggested by our experiments is a
variation of the basic theme of initial complex formation thought to
occur on constitutive exons and introns in vertebrates. It suggests
that individual constitutively recognized exons or introns may utilize
either slightly different proteins or binding arrangements of standard
proteins. We have recently observed another nonstandard arrangement in
a short Drosophila intron that uses SRp54 instead of SF1 to
bridge the intron (24). In both this case and the exon
studied here, the 3' splice site polypyrimidine tract that is being
stimulated is a sequence that does not resemble a preferred binding
site for U2AF65 (37), suggesting that accessory
proteins may function to maximize U2AF association with constitutive
exons as well as with alternative exons. In vertebrates, there are
multiple genes resembling the major form of both subunits of U2AF
(42, 46, 48; P. S. McCaw and P. A. Sharp,
personal communication), suggesting even further permutations on the
set of factors used during initial recognition of splice sites. Thus,
there may be considerable variation in the ways in which interactions
between factors binding to 3' and 5' splice sites can occur in
constitutive exons and introns.
 |
ACKNOWLEDGMENTS |
We thank Angela Kramer for providing the anti-SF1 antibody and
for helpful comments and critical review of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Verna and Marrs
McLean Department of Biochemistry and Program in Cell and Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX
77030. Phone: (713) 798-5758. Fax: (713) 795-5487. E-mail: sberget{at}bcm.tmc.edu.
Present address: Department of Biology, Brandeis University,
Waltham, MA 02254-9110.
 |
REFERENCES |
| 1.
|
Abovich, N.,
X. C. Liao, and M. Rosbash.
1994.
The yeast MUD2 protein: an interaction with PRP11 defines a bridge between commitment complexes and U2 snRNP addition.
Genes Dev.
8:843-854[Abstract/Free Full Text].
|
| 2.
|
Abovich, N., and M. Rosbash.
1997.
Cross-intron bridging interactions in the yeast commitment complex are conserved in mammals.
Cell
89:403-412[CrossRef][Medline].
|
| 3.
|
Adams, M. D.,
D. Z. Rudner, and D. C. Rio.
1996.
Biochemistry and regulation of pre-mRNA splicing.
Curr. Opin. Cell Biol.
8:331-339[CrossRef][Medline].
|
| 4.
|
Arning, S.,
P. Gruter,
G. Bilbe, and A. Krämer.
1996.
Mammalian splicing factor SF1 is encoded by variant cDNAs and binds to RNA.
RNA
2:794-810[Abstract].
|
| 5.
|
Berget, S. M.
1995.
Exon recognition in vertebrate splicing.
J. Biol. Chem.
2:2411-2414.
|
| 6.
|
Berglund, J. A.,
K. Chua,
N. Abovich,
R. Reed, and M. Rosbash.
1997.
The splicing factor BBP interacts specifically with the pre-mRNA branchpoint sequence UACUAAC.
Cell
89:781-787[CrossRef][Medline].
|
| 7.
|
Berglund, J. A.,
N. Abovich, and M. Rosbash.
1998.
A cooperative interaction between U2AF65 and mBBP/SF1 facilitates branchpoint region recognition.
Genes Dev.
12:858-867[Abstract/Free Full Text].
|
| 8.
|
Berglund, J. A.,
M. L. Fleming, and M. Rosbash.
1998.
The KH domain of the branchpoint sequence binding protein determines specificity for the pre-mRNA branchpoint sequence.
RNA
4:998-1006[Abstract].
|
| 9.
|
Black, D. L.
1991.
Does steric interference between splice sites block the splicing of a short c-src neuron-specific exon in non-neuronal cells?
Genes Dev.
5:389-402[Abstract/Free Full Text].
|
| 10.
|
Black, D. L.
1992.
Activation of the c-src neuron-specific splicing by an unusual RNA element in vivo and in vitro.
Cell
69:795-807[CrossRef][Medline].
|
| 11.
|
Black, D. L.
1995.
Finding splice sites in a wilderness of RNA.
RNA
1:763-771[Medline].
|
| 12.
|
Carlo, T.,
D. A. Sterner, and S. M. Berget.
1996.
An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon.
RNA
2:342-353[Abstract].
|
| 13.
|
Chiara, M. D.,
O. Gozani,
M. Bennett,
P. Champion-Arnaud,
L. Palandjian, and R. Reed.
1996.
Identification of proteins that interact with exon sequences, splice sites, and the branchpoint sequence during each stage of spliceosome assembly.
Mol. Cell. Biol.
16:3317-3326[Abstract].
|
| 14.
|
Crispino, J. D.,
J. E. Mermoud,
A. I. Lamond, and P. A. Sharp.
1996.
Cis-acting elements distinct from the 5' splice site promote U1-independent pre-mRNA splicing.
RNA
2:664-673[Abstract].
|
| 15.
|
De Guzman, R. N.,
Z. R. Wu,
C. C. Stalling,
L. Pappalardo,
P. N. Borer, and M. F. Summers.
1998.
Structure of the HIV-1 nucleocapsid protein bound to the SL3 p-RNA recognition element.
Science
279:384-388[Abstract/Free Full Text].
|
| 16.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1490[Abstract/Free Full Text].
|
| 17.
|
Dominski, Z., and R. Kole.
1991.
Selection of splice sites in pre-mRNAs with short internal exons.
Mol. Cell. Biol.
11:6075-6083[Abstract/Free Full Text].
|
| 18.
|
Dominski, Z., and R. Kole.
1992.
Cooperation of pre-mRNA sequence elements in splice site selection.
Mol. Cell. Biol.
12:2108-2114[Abstract/Free Full Text].
|
| 19.
|
Engelbrecht, J.,
S. Knudsen, and S. Brunak.
1992.
G + C-rich tracts in 5' end of human introns.
J. Mol. Biol.
227:108-113[CrossRef][Medline].
|
| 20.
|
Gottschalk,
A. J. Tang,
O. Puig,
J. Salgado,
G. Neubauer,
H. V. Colot,
M. Mann,
B. Seraphin,
M. Rosbash,
R. Luhrmann, and P. Fabrizio.
1998.
A comprehensive biochemical and genetic analysis of the yeast U1 snRNP reveals five novel proteins.
RNA
4:374-393[Abstract].
|
| 21.
|
Hawkins, J. D.
1988.
A survey on intron and exon lengths.
Nucleic Acids Res.
16:9893-9908[Abstract/Free Full Text].
|
| 22.
|
Hoffman, B. E., and P. J. Grabowski.
1992.
U1 snRNP targets an essential splicing factor, U2AF65 to the 3' splice site by a network of interactions spanning the exon.
Genes Dev.
6:2554-2568[Abstract/Free Full Text].
|
| 23.
|
Kao, H.-Y., and P. G. Siliciano.
1996.
Identification of Prp-40, a novel essential yeast splicing factor associated with the U1 small nuclear ribonucleoprotein particle.
Mol. Cell. Biol.
16:960-967[Abstract].
|
| 24.
|
Kennedy, C. F.,
A. Angela Krämer, and S. M. Berget.
1998.
A role for SRp54 during intron bridging of small introns with pyrimidine tracts upstream of the branch point.
Mol. Cell. Biol.
18:5425-5434[Abstract/Free Full Text].
|
| 25.
|
Krämer, A.
1992.
Purification of splicing factor SF1, a heat-stable protein that functions in the assembly of a presplicing complex.
Mol. Cell. Biol.
12:4545-4552[Abstract/Free Full Text].
|
| 26.
|
Krämer, A.
1996.
The structure and function of proteins involved in mammalian pre-mRNA splicing.
Annu. Rev. Biochem.
65:367-409[CrossRef][Medline].
|
| 27.
|
Lockhart, S. R., and B. C. Rymond.
1994.
Commitment of yeast pre-mRNA to the splicing pathway requires a novel U1 small nuclear ribonucleoprotein polypeptide, Prp39.
Mol. Cell. Biol.
14:3623-3633[Abstract/Free Full Text].
|
| 28.
|
MacMillan, A. M.,
P. S. McCaw,
J. D. Crispino, and P. A. Sharp.
1997.
SC35-mediated reconstitution of splicing in U2AF-depleted nuclear extract.
Proc. Natl. Acad. Sci. USA
94:133-136[Abstract/Free Full Text].
|
| 29.
|
Manley, J. L., and R. Tacke.
1996.
SR proteins and splicing control.
Genes Dev.
10:1569-1579[Free Full Text].
|
| 30.
|
Matunis, M. J.,
J. Xing, and G. Dreyfuss.
1994.
The hnRNP F protein: unique primary structure, nucleic acid-binding properties, and subcellular localization.
Nucleic Acids Res.
22:1059-1067[Abstract/Free Full Text].
|
| 31.
|
McCullough, A., and S. M. Berget.
1997.
G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection.
Mol. Cell. Biol.
17:4562-4571[Abstract].
|
| 32.
|
Modafferi, E. F., and D. L. Black.
1997.
A complex intronic splicing enhancer from the c-src pre-mRNA activates inclusion of a heterologous exon.
Mol. Cell. Biol.
17:6537-6545[Abstract].
|
| 33.
|
Rain, J. C.,
Z. Rafi,
Z. Rhani,
P. Legrain, and A. Kramer.
1998.
Conservation of functional domains involved in RNA binding and protein-protein interactions in human and Saccharomyces cerevisiae pre-mRNA splicing factor SF1.
RNA
4:551-565[Abstract].
|
| 34.
|
Reed, R.
1996.
Initial splice site recognition and pairing during pre-mRNA splicing.
Curr. Opin. Genet. Dev.
6:215-220[CrossRef][Medline].
|
| 35.
|
Rio, D. C.
1993.
Splicing of pre-mRNA: mechanism, regulation and role in development.
Curr. Opin. Genet. Dev.
3:574-584[CrossRef][Medline].
|
| 36.
|
Ryan, K. J., and T. A. Cooper.
1996.
Muscle-specific enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle.
Mol. Cell. Biol.
16:4014-4023[Abstract].
|
| 37.
|
Singh, R.,
J. Valcárcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine-tract binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 38.
|
Sirand-Pugnet, P.,
P. Durosay,
E. Brody, and J. Marie.
1995.
An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken -tropomyosin gene.
Nucleic Acids Res.
23:3501-3507[Abstract/Free Full Text].
|
| 39.
|
Soulard, M.,
V. D. Valle,
M. C. Siomi,
S. Pinol-Roma,
P. Codogno,
C. Bauvy,
M. Bellini,
J.-C. Lacroix,
G. Monod,
G. Dreyfuss, and C.-J. Larsen.
1993.
HnRNP G: sequence and characterization of a glycosylated RNA-binding proteins.
Nucleic Acids Res.
21:4210-4217[Abstract/Free Full Text].
|
| 40.
|
Sterner, D. A., and S. M. Berget.
1993.
In vivo recognition of a vertebrate mini-exon as an exon-intron unit.
Mol. Cell. Biol.
13:2677-2687[Abstract/Free Full Text].
|
| 41.
|
Tarn, W. Y., and J. A. Steitz.
1995.
Modulation of 5' splice site choice in pre-messenger RNA by two distinct steps.
Proc. Natl. Acad. Sci. USA
92:2504-2508[Abstract/Free Full Text].
|
| 42.
|
Tronchere, H.,
J. Wang, and X.-D. Fu.
1997.
A protein related to splicing factor U2AF35 that interacts with U2AF65 and SR proteins in splicing of pre-mRNA.
Nature
388:397-400[CrossRef][Medline].
|
| 43.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 44.
|
Wei, N.,
C. Q. Lin,
E. F. Modafferi,
W. A. Gomes, and D. L. Black.
1997.
A unique intronic splicing enhancer controls the inclusion of the agrin Y exon.
RNA
3:1275-1288[Abstract].
|
| 45.
|
Wu, J. Y., and T. Maniatis.
1993.
Specific interactions between proteins implicated in splice site selection and regulated alternative splicing.
Cell
75:1061-1070[CrossRef][Medline].
|
| 46.
|
Zamore, P. D., and M. R. Green.
1989.
Identification, purification and characterization of U2 small nuclear ribonucleoprotein auxiliary factor.
Proc. Natl. Acad. Sci. USA
86:9243-9247[Abstract/Free Full Text].
|
| 47.
|
Zhang, L.,
M. Ashiya,
T. S. Sherman, and P. J. Grabowski.
1996.
Essential nucleotides direct neuron-specific splicing of g2 mRNA.
RNA
2:682-698[Abstract].
|
| 48.
|
Zhang, M.,
P. D. Zamore,
M. Carmo-Fonseca,
A. I. Lamond, and M. R. Green.
1992.
Cloning and intracellular localization of the U2 small nuclear ribonucleoprotein auxiliary factor small subunit.
Proc. Natl. Acad. Sci. USA
89:8769-8773[Abstract/Free Full Text].
|
| 49.
|
Zuo, P., and T. Maniatis.
1996.
The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing.
Genes Dev.
10:1356-1368[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 2000, p. 3988-3995, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Krauss, V., Thummler, C., Georgi, F., Lehmann, J., Stadler, P. F., Eisenhardt, C.
(2008). Near Intron Positions Are Reliable Phylogenetic Markers: An Application to Holometabolous Insects. Mol Biol Evol
25: 821-830
[Abstract]
[Full Text]
-
Casas, F., Busson, M., Grandemange, S., Seyer, P., Carazo, A., Pessemesse, L., Wrutniak-Cabello, C., Cabello, G.
(2006). Characterization of a Novel Thyroid Hormone Receptor {alpha} Variant Involved in the Regulation of Myoblast Differentiation. Mol. Endocrinol.
20: 749-763
[Abstract]
[Full Text]
-
Kralovicova, J., Vorechovsky, I.
(2006). Position-Dependent Repression and Promotion of DQB1 Intron 3 Splicing by GGGG Motifs. J. Immunol.
176: 2381-2388
[Abstract]
[Full Text]
-
Baek, D., Green, P.
(2005). Sequence conservation, relative isoform frequencies, and nonsense-mediated decay in evolutionarily conserved alternative splicing. Proc. Natl. Acad. Sci. USA
102: 12813-12818
[Abstract]
[Full Text]
-
Wu, T. D., Watanabe, C. K.
(2005). GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics
21: 1859-1875
[Abstract]
[Full Text]
-
Krauss, V., Pecyna, M., Kurz, K., Sass, H.
(2005). Phylogenetic Mapping of Intron Positions: A Case Study of Translation Initiation Factor eIF2{gamma}. Mol Biol Evol
22: 74-84
[Abstract]
[Full Text]
-
Expert-Bezancon, A., Sureau, A., Durosay, P., Salesse, R., Groeneveld, H., Lecaer, J. P., Marie, J.
(2004). hnRNP A1 and the SR Proteins ASF/SF2 and SC35 Have Antagonistic Functions in Splicing of {beta}-Tropomyosin Exon 6B. J. Biol. Chem.
279: 38249-38259
[Abstract]
[Full Text]
-
Zhang, X. H-F., Heller, K. A., Hefter, I., Leslie, C. S., Chasin, L. A.
(2003). Sequence Information for the Splicing of Human Pre-mRNA Identified by Support Vector Machine Classification. Genome Res
13: 2637-2650
[Abstract]
[Full Text]
-
HOWE, K. J., KANE, C. M., ARES, M. JR.
(2003). Perturbation of transcription elongation influences the fidelity of internal exon inclusion in Saccharomyces cerevisiae. RNA
9: 993-1006
[Abstract]
[Full Text]
-
Guil, S., Gattoni, R., Carrascal, M., Abian, J., Stevenin, J., Bach-Elias, M.
(2003). Roles of hnRNP A1, SR Proteins, and p68 Helicase in c-H-ras Alternative Splicing Regulation. Mol. Cell. Biol.
23: 2927-2941
[Abstract]
[Full Text]
-
Miriami, E., Margalit, H., Sperling, R.
(2003). Conserved sequence elements associated with exon skipping. Nucleic Acids Res
31: 1974-1983
[Abstract]
[Full Text]
-
Majewski, J., Ott, J.
(2002). Distribution and Characterization of Regulatory Elements in the Human Genome. Genome Res
12: 1827-1836
[Abstract]
[Full Text]
-
Expert-Bezancon, A., Le Caer, J. P., Marie, J.
(2002). Heterogeneous Nuclear Ribonucleoprotein (hnRNP) K Is a Component of an Intronic Splicing Enhancer Complex That Activates the Splicing of the Alternative Exon 6A from Chicken beta -Tropomyosin Pre-mRNA. J. Biol. Chem.
277: 16614-16623
[Abstract]
[Full Text]
-
Peled-Zehavi, H., Berglund, J. A., Rosbash, M., Frankel, A. D.
(2001). Recognition of RNA Branch Point Sequences by the KH Domain of Splicing Factor 1 (Mammalian Branch Point Binding Protein) in a Splicing Factor Complex. Mol. Cell. Biol.
21: 5232-5241
[Abstract]
[Full Text]
-
Genetta, T., Morisaki, H., Morisaki, T., Holmes, E. W.
(2001). A Novel Bipartite Intronic Splicing Enhancer Promotes the Inclusion of a Mini-exon in the AMP Deaminase 1 Gene. J. Biol. Chem.
276: 25589-25597
[Abstract]
[Full Text]