This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLeod, M.
Right arrow Articles by Hu, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLeod, M.
Right arrow Articles by Hu, L.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2000, p. 4016-4027, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Cpc2, a Fission Yeast Homologue of Mammalian RACK1 Protein, Interacts with Ran1 (Pat1) Kinase To Regulate Cell Cycle Progression and Meiotic Development

Maureen McLeod,* Boris Shor, Anthony Caporaso, Wei Wang,dagger Hua Chen,Dagger and Lin Hu

State University of New York Health Science Center at Brooklyn, Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, Brooklyn, New York 11203

Received 28 December 1999/Returned for modification 16 February 2000/Accepted 19 March 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The Schizosaccharomyces pombe ran1/pat1 gene regulates the transition between mitosis and meiosis. Inactivation of Ran1 (Pat1) kinase is necessary and sufficient for cells to exit the cell cycle and undergo meiosis. The yeast two-hybrid interaction trap was used to identify protein partners for Ran1/Pat1. Here we report the identification of one of these, Cpc2. Cpc2 encodes a homologue of RACK1, a WD protein with homology to the beta  subunit of heterotrimeric G proteins. RACK1 is a highly conserved protein, although its function remains undefined. In mammalian cells, RACK1 physically associates with some signal transduction proteins, including Src and protein kinase C. Fission yeast cells containing a cpc2 null allele are viable but cell cycle delayed. cpc2Delta cells fail to accumulate in G1 when starved of nitrogen. This leads to defects in conjugation and meiosis. Copurification studies show that although Cpc2 and Ran1 (Pat1) physically associate, Cpc2 does not alter Ran1 (Pat1) kinase activity in vitro. Using a Ran1 (Pat1) fusion to green fluorescent protein, we show that localization of the kinase is impaired in cpc2Delta cells. Thus, in parallel with the proposed role of RACK1 in mammalian cells, fission yeast cpc2 may function as an anchoring protein for Ran1 (Pat1) kinase. All defects associated with loss of cpc2 are reversed in cells expressing mammalian RACK1, demonstrating that the fission yeast and mammalian gene products are indeed functional homologues.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

All living cells integrate signals from the environment to modify the activity of genes required for mitotic division, differentiation, or stationary phase. For the fission yeast Schizosaccharomyces pombe, nutritional signals direct life cycle choices. As key nutrients become limited, cells exit the mitotic cycle and enter either G0 stationary phase or a program of sexual differentiation (6, 10). The choice between G0 and differentiation is governed by the presence of mating-specific pheromones. Starved cells respond to pheromones produced by cells of the opposite mating type by undergoing transient G1 arrest, followed by conjugation and meiosis (8, 18, 33, 49). As expected from the need for both nutrient limitation and pheromone signaling, many signal transduction pathways converge to regulate differentiation. These include pathways regulated by cyclic AMP (cAMP), the ras1-regulated mitogen-activated protein (MAP) kinase pathway and the stress-activated MAP kinase pathway (see reference 51 for a review). However, a variety of studies indicate that each phase of the fission yeast life cycle can be governed by the activity of Ran1 (Pat1) kinase (referred to as Ran1 hereafter) and its substrates.

Inactivation of Ran1 is necessary and sufficient to divert cells from the mitotic cell cycle into the meiotic developmental program (16, 17, 32). Experiments examining the phenotype of cells carrying a ran1 temperature-sensitive allele suggest that Ran1 is regulated by stepwise inactivation of the kinase (3, 23). Limiting nutritional conditions trigger partial inactivation of Ran1. This allows cells to accumulate in G1 (3, 8), the only cell cycle stage permissive for conjugation (10). Following conjugation, continued starvation of the diploid zygote and activation of the mating pheromone pathway lead to full inactivation of Ran1 (24, 49). This promotes meiosis. The complex phenotypes attributed to loss of Ran1 indicate that its activity is likely regulated by a variety of mechanisms.

Attenuation of Ran1 activity provokes expression of genes that function during sexual differentiation as elements of a cascading circuit (31). The most upstream is the product of the ste11 gene, which encodes a transcription factor required for expression of most meiosis-specific genes (43). Ste11 is an in vitro substrate for Ran1 and a likely physiological target for the kinase. Ran1 phosphorylation negatively regulates the transcription factor, perhaps by hindering its nuclear localization (20). Ste11 binds a specific DNA sequence, the TR box, found upstream of genes it regulates. Ste11 is required for expression of the mating type genes (43), and these regulate meiotic commitment. The mating type locus is not a single genetic entity but includes four genes. matPc and matPm are functional in plus cells, and matMc and matMm are functional in minus cells. matPc and matMc control production of pheromones and pheromone receptors essential for conjugation (see reference 7 for a review). Pheromone signaling is also required for expression of matMm and matPm, both of which are necessary for meiosis (19, 49). matPm and matMm directly provoke transcription of mei3 (24, 45, 49). As described below, the product of the mei3 gene is a critical meiotic activator.

mei3 is expressed only in diploid cells competent to undergo meiosis (24). All available data are consistent with the hypothesis that Mei3 activates meiosis by inhibition of Ran1 kinase. The inhibitor contains a region, RKD, which resembles two regions in the Ste11 substrate for Ran1 (20). Structure-function studies indicate that the Mei3 RKD region is critical for association with Ran1. Cells containing mei3 alleles with Mei3 RKD mutations conjugate well but sporulate inefficiently (47). It is hypothesized that during meiosis, inactivation of Ran1 by Mei3 leads to accumulation of hypophosphorylated, and hence active, forms of Ste11. This leads to induction of meiosis-specific genes. One of these, Mei2, is an RNA-binding protein required for premeiotic DNA synthesis (3, 48). Like Ste11, Mei2 is negatively regulated by Ran1 phosphorylation. It has been suggested that the phosphorylation state of Ste11 readies cells for meiosis, while that of Mei2 determines meiotic commitment (48).

As described above, Mei3 does not regulate conjugation but functions only during meiosis to inactivate Ran. The mechanisms used to partially inactivate Ran1 so that G1 arrest and conjugation can proceed have not been described. To identify other components of the Ran1 signal transduction pathway, we searched for protein partners of Ran1. A fission yeast cDNA library was screened using the two-hybrid interaction trap. We identified RACK1 (Cpc2) as a Ran1-interacting protein. RACK1 functions in mammalian cells to regulate at least two unrelated kinases, protein kinase C (PKC) (27) and Src (5). The fission yeast version of RACK1, named Cpc2 to conform to the Neurospora crassa designation (28), is 77% homologous to the human protein. In spite of its strong conservation in many organisms, cpc2 is not an essential gene in fission yeast. Cells containing a cpc2 null allele are highly elongated due to a G2 cell cycle delay. The cells accumulate inefficiently in G1 when deprived of nitrogen, and conjugation and meiosis are impaired. These phenotypes argue that cpc2 acts in opposition to ran1, perhaps to regulate the activity of the kinase. In support of this hypothesis, cpc2 functions upstream of ran1 and a physical association between the two proteins is observed. Fluorescence microscopy using a Ran1-green fluorescent protein (GFP) fusion indicates that Cpc2 may function to alter the cellular localization of Ran1. Consistent with the high level of homology observed between RACK1 and Cpc2, rat RACK1 is capable of functionally complementing a cpc2 null allele.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Strains and media. The genotypes of the S. pombe strains used in this study are as follows: SP66, h90 leu1-32 ade6-M216; SP712, h+N leu1-32 ura4-D18 ade6-M210 ran1+ OP (OP refers to genes expressed at high levels under the control of the constitutive adh promoter); SP713, h+N leu1-32 ura4-D18 ade6-M210 ran1K47R+ OP; SP870, h90 leu1-32 ura4-D18 ade6-M210 cpc2::pCPC2-24; SPB5, h90 leu1-32 ade6-M210; SPB67, h+N leu1-32 ura4-D18 ade6-M210/h leu1-32 ura4-D18 ade6-M216; SPB68, h90 mei2::LacZ; SPB76, h+N leu1-32 ura4-D18 ade6-M216 cgs1::ura4; SPB90, h-S leu1-32 ura4::fbp-lacZ fbp1::ura4 ade6-M216; SPB93, h-S leu1-32 cgs1.1 ura4::fbp-lacZ fbp1::ura4 ade6-M210; SPB173, h+N; SPB182, h+N ura4-D18 cpc2::ura4; SPB188, h90 leu1-32 ura4-D18 ade6-M210 cpc2::ura4; SPB190, h90 leu1-32 ura4-D18 cpc2::pCPC2-24; SPB191, h90 leu1-32 ura4-D18 ade6-M210 mei2ts ran1::pRAN1-90 (ura+); SPB214, h90 leu1-32 ura4-D18 ade6-M216 ran1-114 cpc2::ura4; SPB217, h90 leu1-32 ade6-M216 ran1-114; SPB273, h90; SPB307, h90 ura4-D18 cpc2::ura4 mei2-lacZ; SPB317, h90 ura4-D18 cpc2::ura4; SPB318, h90 leu1-32 git2-1; SPB319, h90 ura4-D18 leu1-32 cpc2::ura4 git2::LEU2; SPB320, h-S leu1-32 ura4::fbp-lacZ fbp1::ura4 cpc2::ura4 ade6-M216.

S. pombe cells were cultured in rich medium (YEA) or minimal medium (PMA) with the required amino acids (1). Strains were constructed using tetrad analysis. Double mutants were identified in a nonparental ditype tetrad, and genotypes were confirmed using PCR. Escherichia coli cells were grown in Luria broth supplemented with antibiotics. Saccharomyces cerevisiae Y190 (MATa leu2-3 ura3-52 trp1-1901 his3-200 ade2-101 gal4Delta gal80Delta URA3::GAL1-LacZ LYS::GAL1-HIS3 cyhr) was used for two-hybrid assays (12).

Yeast two-hybrid screen. Plasmids and details of the library screen were essentially as previously described (12). The ran1 gene was fused in frame to the GAL4 DNA-binding domain (DBD) in pAS2. Following transformation of this plasmid into Y190, a Western blot using Ran1 antibodies (23) was used to verify that the fusion protein was produced intact. A fission yeast cDNA library fused to the activation domain of GAL4 in the vector pACT2 (provided by Steve Elledge) was transformed into the Y190/ran1-DBD strain. The transformants were selected on plates containing 3-amino triazole (3-AT) at 30°C for 3 to 4 days. Approximately 106 transformants were obtained. To eliminate one class of false positives, each library plasmid was tested to identify those capable of activating the LacZ reporter gene in the absence of ran1-DBD. ran1-DBD was reintroduced into those candidate strains and tested for activation of LacZ. Measurement of beta -galactosidase activity was accomplished using a permeabilized-cell assay. A total of 53 colonies were obtained, and DNA was isolated from each. Limited DNA sequence analysis of each identified 30 clones representing nine unique open reading frames.

Oligonucleotides. The sequences of the oligonucleotides used in this study are as follows: GB-RKDI, 5'CTTCTTTCCGGTTCTGCAGACGCGTCCATCATTTTGTG3'; GB-RKDII, 5'GGTTGTTTCTGGTTCCGCGGACGCGACCATTAAGATTTG3'; CPC2-Xma, 5'TCTTGTCCCGGGAACCAGAAA3'; CPC2-HIII, 5'CGGTACCTTGAAGCTTTGGGA3'; CPC2-35, 5'CTCGAAGGTCACTCTGGATG3'; CPC2-927C, 5'TACTTGGTAACTTGCCAGACAC3'; CPC2-Nde, 5'TACCATATGACCGATGGTGGTCACTC3'; CPC2-Bam, 5'AGAGGATCCACCATCGGTGATAGTGT3'.

Construction of a Cpc2 null allele. Oligonucleotides CPC2-Nde and CPC2-Bam were used in a PCR to obtain the entire cpc2 cDNA. The linear fragment was cloned into the commercially obtained TA vector (InVitrogen). Inverse PCR of this plasmid using primers CPC2-Xma and CPC2-HIII was used to insert HindIII and XmaI restriction sites into cpc2. A HindIII-to-XmaI fragment of ura4 was cloned into the inverse PCR product. A linear DNA fragment containing cpc2 disrupted with ura4 was obtained using primers CPC2-35 and CPC2-927C in a PCR. The linear fragment was purified using a Qiagen column and used to transform SPB67. Stable URA+ transformants were identified, and a Southern blot verified the correct replacement. Sporulation of the diploid produced the haploid strain SPB188, which contains cpc2::ura4 (also referred to as cpc2Delta ).

Oligonucleotide mutagenesis. The Cpc2 RKD motifs were mutagenized using oligonucleotides GB-RKDI and GBRKDII. All oligonucleotides were designed with the assistance of the OLIGO software package (National Biosciences Inc., Plymouth, Minn.). The identities of the mutations were confirmed using restriction enzyme analysis.

Expression and purification of recombinant proteins. The plasmids used for expression of recombinant proteins were pRAN1.83 (His-hemagglutinin [HA]-Ran1), pRAN1.87 (His-HA-Ran1K47R), and pSTE11.27 (His-p39ste11). The construction of each and expression in bacteria have been described previously (20). pCPC2.2 was used for expression of His-HA-Cpc2. The soluble portion of bacterial whole-cell extract was incubated with 1.0 ml of Ni2+-nitrilotriacetic acid agarose. The mixture was packed into a column and washed sequentially with 10 column volumes each of wash buffer I (300 mM NaCl, 20 mM HEPES [pH 7.5], 5 mM MgCl2, 10% glycerol), wash buffer II (wash buffer I with 100 mM NaCl), and wash buffer III (wash buffer II plus 20 mM imidazole). Proteins were eluted from the column in wash buffer III containing 100 mM imidazole. Imidazole was removed by dialysis of the purified protein against wash buffer I.

Copurification of GST-tagged proteins from yeast. Plasmids pALT4-GST and pCPC2-24 were constructed to produce HA epitope-tagged glutathione S-transferase (GST) and HA-GST-tagged Cpc2, respectively. The plasmids were transformed into SP66 (wild type) or SPB191. SPB191 contains an integrated plasmid which produces HA-tagged ran1 under control of the nmt1 promoter from plasmid pREP41 (2). The four strains were grown in thiamine-free medium to allow induction of ran1. Pelleted cells were washed in HE buffer (50 mM Tris HCl [pH 8.0], 5 mM EDTA, 1 mM dithiothreitol) and resuspended in 0.5 ml of HE buffer containing 1 mM phenylmethylsulfonyl fluoride. Following addition of sterile glass beads, the cells were broken by vortexing for 15 min at 4°C. Lysates were removed to a fresh tube, and the glass beads were washed in 2.0 ml of RIPA buffer (HE plus 0.1% sodium dodecyl sulfate SDS, 1% Triton X-100, 0.5% deoxycholate). Clarified lysate was obtained by centrifugation at 12,000 × g for 10 min. Protein concentrations were determined using bovine serum albumin as the standard in the Bio-Rad system. Lysate (5 mg) was purified using glutathione-agarose (Sigma). The beads were resuspended in Laemmli sample buffer prior to separation by SDS-7.5 to 15% polyacrylamide gel electrophoresis (PAGE). Western blotting was performed as previously described (20). The primary antibody used for detection of Ran1 was a mixture of R30, R48, and R99 monoclonal antibodies (23) diluted 1:1,000 in 5% dry milk. For detection of HA fusion proteins, a commercially available antibody was used (12CA5; Boehringer Mannheim Biochemicals, Indianapolis, Ind.). Immunoreactive proteins were visualized using the Dupont NEN Research Products chemiluminescence assay kit. Alternatively, the purified proteins were used for a kinase assay. In that case, proteins bound to the agarose beads were washed in RIPA buffer as described above. The beads were resuspended in 50 µl of 1×KAB (50 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 1 mM EDTA, 0.2 mM dithiothreitol) in the final step. Kinase assays utilized 25 µl of bead-bound protein and p39Ste11 as the substrate (20).

Plasmids. Steve Elledge provided hybrid plasmids pAS2 and pACT2 and the fission yeast cDNA library. The entire coding region of ran1 was fused in frame to the DBD of GAL4 as an NdeI-to-BamHI fragment. cpc2 or cpc2 RKD was fused to pACT2 as an NheI-to-BamHI fragment obtained from a pALT4 vector.

The fission yeast expression plasmids used were pALT4 (contains S. pombe ars1, S. cerevisiae LEU2 as a selectable marker, and the adh promoter fused to HA1 sequences), pALT2 (described in reference 24), pALT4GST (to express HA-GST; GST was inserted into pALT4 as an NdeI-to-BamHI fragment), pCPC2.10 (contains cpc2 as an NdeI-to-BamHI fragment in pALT2), HA-GST-Ran1 (The GST coding sequence was cloned into a yeast expression vector as an NdeI-to-NheI fragment. This allows the insertion of any gene in frame into GST as an NdeI-to-BamHI fragment), pRAN1.81 (expression of ran1 using the adh1 promoter [41]), pRAN1.90 (integrative plasmid constructed to express HA-tagged Ran1 from an inducible nmt promoter derived from pREP41 [2]), pRAN1.95 (expression of GST-HA1-Ran1 from the nmt promoter derived from pREP42 [2]), pCPC2.24 (expression of GST-HA1-Cpc2 using the adh promoter), and pCPC2.2 (expression of HA-CPC2 in bacterial expression vector pET15B [NovoLabs]). Exact details of plasmid constructions are available on request.

Flow cytometry. Either wild-type (SPB173) or cpc2Delta (SPB182) cells were grown to 107/ml and then shifted to medium lacking nitrogen for the designated times. Cells were fixed and stained with propidium iodide as previously described (1). DNA fluorescence was measured using a FACScan (Becton Dickinson).

Measurement of beta -galactosidase activity. Total cell extract was prepared from cells containing a mei2-lacZ gene after they attained a density of 107/ml. A 20-µg protein sample was used to assay beta -galactosidase activity (1). Activity is expressed as A420 × 1.7/0.0045 × protein (micrograms) × volume × time. fbp1-lacZ activity was measured in 107 permeabilized cells.

Measurement of viability in stationary phase. Cells were grown to 108/ml at 30°C. At this time (day 0) and each day thereafter (days 1 to 4), a portion of the cells was removed and stained with FUN-1 (Molecular Probes, Eugene, Oreg.) as previously described (25, 53). Cells were immediately examined under a microscope. Viable cells contained red intravacuolar structures, and nonviable cells stained yellow-green.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Isolation of cpc2 using a two-hybrid library screen. A fission yeast cDNA library was screened by two-hybrid analysis using ran1-DBD) as bait. Approximately 106 colonies were obtained following cotransformation of ran1-DBD and the library plasmids into yeast. Plasmid inserts from LacZ-positive transformants were sequenced, and one of these, cpc2, is the subject of this paper. cpc2 was chosen for analysis because the predicted protein has regions of homology with other proteins known to directly interact with Ran1 (see below). The interaction between Ran1 and Cpc2 was quantitatively assessed in the two-hybrid system using S. cerevisiae strain Y190. This strain contains a LacZ reporter gene controlled by the upstream activating sequence of GAL4. We observed that Cpc2 paired with Ran1 produced sixfold higher beta -galactosidase activity than Ran1 paired with the ACT2 vector. This interaction is comparable to, but not quite as strong as, the interaction between Ran1 and Ste11, a transcription factor that directly associates with Ran1 (Fig. 1A and reference 20).


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 1.   Ran1 interacts with the highly conserved RACK1 (Cpc2) protein. (A) Two-hybrid analysis of the interaction between Ran1 and Cpc2. The reporter strain (Y190) permits detection of protein-protein interaction through transcriptional activation of a GAL1-LacZ gene. Y190 cells were transformed with the indicated plasmids. Ran1 was fused to the GAL4 DBD. Ste11, Cpc2, and the Cpc2 RKD were each fused to GAL4 activation domain. Cpc2 RKD contains defined mutations in both Cpc2 RKD domains (see below). A permeabilized-cell assay was used to measure beta -galactosidase activity. The results represent the mean values obtained using three independent transformants. (B) Amino acid sequence comparison of regions within Ste11, Cpc2, and Mei3. The arrow marks the phosphoacceptor position occupied by serine or threonine residues in the Ste11 substrate for Ran1 (20). The asterisks over Mei3 residues indicate those required for Mei3 function (47). The amino acids R36, K38, R125, and K127 in Cpc2 were each changed to alanine in Cpc2 RKD (indicated with asterisks). The superscript numbers correspond to amino acid positions. (C) Amino acid comparison of Homo sapiens (Hs) and Rattus norvegicus (Rn; reference 36) RACK1, S. pombe (Sp) Cpc2, and S. cerevisiae (Sc) Cpc2 (15). Identical amino acids are indicated using a dark box.

The entire nucleotide sequence of the cpc2 cDNA insert was determined. This analysis showed that the cDNA sequence was deposited under GenBank accession no. gi598437. The predicted protein is 314 amino acids with a molecular mass of 34.85 kDa. Inspection of the sequence revealed that the polypeptide contains two repeated regions (referred to as RKD) which resemble sequences observed in proteins known to directly interact with Ran1 (Fig. 1B). RKD sequences are proposed to function as substrate specificity determinants. They have been identified in Ste11, an in vitro substrate for Ran1, and in Mei3, a pseudosubstrate-like inhibitor of Ran1 (20, 47). Cpc2 contains two regions with spatially conserved basic residues (36R plus 38K and 125R plus 127K; Fig. 1B), followed by a serine or threonine residue (39S and 128T). The basic residues are required for Mei3 RKD function both in vivo and in vitro. 39S and 128T of Cpc2 correspond to the phosphoacceptor residues in the Ste11 substrate. To examine the importance of the putative Cpc2 RKD repeats for association with Ran1, two basic amino acids in each motif (36R plus 38K and 125R plus 127K; Fig. 1B) were mutagenized to alanine residues. The ability of the altered protein (Cpc2 RKD) to bind Ran1 was examined in a two-hybrid assay. We observed that Cpc2 RKD paired with Ran1 reduced expression of the LacZ reporter gene to the same level as that measured using Ran1 paired with a control vector (Fig. 1A).

The Cpc2 polypeptide was also compared to sequences deposited in the commonly used databases. Cpc2 is highly homologous to a family of WD repeat proteins. WD repeat proteins have been classified into four subfamilies (29, 30). Cpc2 is a member of the subfamily that includes the heterotrimeric G protein beta  subunit (41), mammalian RACK1 (37), S. cerevisiae Cpc2p (15), and N. crassa Cpc2 (28). The fission yeast protein is 64% identical to the mammalian RACK1 protein. The overall level of homology between the two proteins is 77% (Fig. 1C). In spite of the high level of conservation between members of this family, the function of RACK1 proteins is not well understood. Rat RACK1 was initially isolated as a PKC-binding protein (37). Recent reports indicate that RACK1 associates with other signal transduction proteins, including cAMP phosphodiesterase 4D5 (52), Src (5), and beta -integrin (21).

Ran1 and Cpc2 associate in cell lysates. The presence of RKD sequences in Cpc2 indicates that if, in fact, Ran1 and Cpc2 are associated, the interaction may be direct. To determine if the two polypeptides are physically connected, we assayed cell lysates for copurification of Ran1 and Cpc2. To accomplish this, cells were transformed with plasmids expressing GST, Cpc2 fused to GST (GST-Cpc2), or Ran1. To permit immunological detection, all proteins were also tagged with HA1 sequences. Soluble proteins were prepared from cells expressing the fusion proteins either individually or in pairs. An immunoblot developed with anti-HA1 antibodies was used to examine the steady-state level of each fusion protein (Fig. 2A). Since Ran1 and GST-Cpc2 migrate close to one another, the immunoblot was also developed using anti-Ran1 antibodies (Fig. 2B). These experiments allowed unequivocal identification of Ran1 and GST-Cpc2 and verified that the proteins were intact. Partial purification of GST fusion proteins was accomplished on glutathione beads. Bead-bound proteins were separated by SDS-PAGE and analyzed in an immunoblot using anti-HA1 antibodies (Fig. 2C) or anti-Ran1 antibodies (Fig. 2D). This experiment showed that Ran1 does not inherently bind glutathione beads or copurify with GST (Fig. 2C and D, lane 3). In contrast, Ran1 was present in partially purified complexes containing GST-Cpc2 (Fig. 2C and D, lane 4).


View larger version (52K):
[in this window]
[in a new window]
 
FIG. 2.   Ran1 and Cpc2 physically interact. Wild-type cells (SP66, lanes 1 and 2) or cells producing high levels of Ran1 (SPB191, lanes 3 and 4) were transformed with a plasmid expressing either GST (lanes 1 and 3) or GST-Cpc2 (lanes 2 and 4). All expressed proteins were epitope tagged with HA1 sequences. Cells were grown to 107/ml in complete medium and shifted to thiamine-free medium for protein induction. Soluble extract was prepared after 18 h of growth. Proteins were separated by SDS-7.5 to 15.0% PAGE and immunoblotted with anti-HA (A) or anti-Ran1 (B) antibody. A portion (2 mg) of each soluble extract was applied to glutathione-agarose beads. Bead-bound material was examined in an immunoblot assay using anti-HA (C) or anti-Ran1 (D) antibody. The positions of HA-Ran1, HA-GST-Cpc2, and HA-GST are marked.

Loss of cpc2 causes pleiotropic cell cycle defects. Because two independent assays indicate that Ran1 and Cpc2 physically associate, we examined cells for a functional connection between the two proteins. To accomplish this, a cpc2 null allele was constructed. A portion of the predicted cpc2 open reading frame was deleted and replaced with the ura4 gene to form cpc2::ura4. A linear DNA fragment containing cpc2::ura4 was transformed into diploid cells (SPB67). Stable URA4+ transformants were analyzed using a Southern blot to identify a simple replacement of cpc2 (data not shown). One representative diploid was chosen for further analysis. The cells were allowed to undergo meiosis, and spores were collected. Random spore analysis showed that URA+ and URA- cells were equally represented. This result indicates that cpc2 is not an essential gene. During this analysis, it was noted that cpc2Delta cells formed small colonies compared to wild-type cells (Fig. 3A). Microscopic examination of the cells showed that they were elongated, a phenotype observed in cells producing activated Ran1 and a hallmark of mitotic delay (Fig. 3B). To examine the role of cpc2 in division, cell growth was monitored. This experiment revealed that cpc2Delta doubled in 3.0 h, as did wild-type cells (Fig. 3C). Thus, loss of cpc2 allows cells to grow normally but delays cell division. In this and other experiments, it was noted that cpc2Delta cells consistently ceased dividing at a two- to fourfold lower density than wild-type cells. These phenotypes are associated with loss of cpc2 because expression of cpc2 cDNA completely restores the wild-type phenotype (Fig. 3A and data not shown). Next, we examined the fate of cells exiting the cell cycle.


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 3.   Loss of cpc2 causes pleiotropic defects. (A) cpc2+ (SPB173), cpc2Delta (SPB182) (left side), or cpc2Delta (SPB188) (right side) cells transformed with the indicated plasmids, spread on minimal medium plates, and incubated for 60 h at 30°C. (B) Photomicrographs of cpc2+ (SPB173), cpc2Delta (SPB182), and ran1OP (SP712) cells. (C) Growth curve constructed by growing cells (cpc2+ [SPB173] or cpc2Delta [SPB182]) to stationary phase and inoculating them at a density of 105/ml into fresh YEA medium. A portion of each culture was removed at the indicated times, and cells were counted using a hemocytometer. (D) cpc2+ (SPB173) or cpc2Delta (SPB182) cells patched onto minimal-medium plates and incubated at 30°C. At the indicated times, a portion of the cells was resuspended in water and the cells were counted and scored as either a vegetative cell, a zygote, or an ascus-containing spores. Differentiated cells include diploid zygotes plus asci. (E) Flow cytometry of cpc2+ (SPB173) or cpc2Delta (SPB182) cells shifted to nitrogen-free medium for the indicated times prior to fluorescence-activated cell sorter analysis. (F) cpc2+ (SPB173), cpc2Delta (SPB182), ran1OP (SP712), and ranK47ROP (SP713) cells were streaked on minimal-medium plates and incubated at either 30 or 37°C.

The presence of mating pheromones and the absence of nitrogen cause fission yeast cells to undergo transient arrest in G1 (8, 18, 33), the only phase of the cell cycle permissive for conjugation. The ability of cpc2Delta cells to conjugate and sporulate was compared to that of wild-type cells. Following 3 days of growth on minimal medium, nearly 55% of the wild-type cells had either conjugated or sporulated. In contrast, only 10.7% of the cpc2Delta cells had undergone sexual differentiation. After 4 days, 89% of the wild-type cells had differentiated, compared to 53.4% of the cpc2Delta cells (Fig. 3D). Thus, loss of cpc2 does not prevent conjugation and sporulation but substantially delays these events. Next, we examined cells for the ability to accumulate in G1 in response to nitrogen limitation. Cells were transferred to nitrogen-free medium, and the DNA content of individual cells was monitored using flow cytometry. At 6 h following the nutritional shift, 60% of the wild-type cells had a G1 DNA content and at 8 h, 90% of the cells were in G1. In contrast, most (95%) cpc2Delta cells exhibited a G2 DNA content after incubation in nitrogen-free medium for 6 h. At 8 h, only 20% of the cpc2Delta cells were observed to be in G1 (Fig. 3E). The wild-type cell number increased 2.5-fold 6 h following the nutritional shift. In contrast, the cpc2Delta cell number increased 1.5-fold. Thus, the failure of cpc2Delta cells to accumulate in G1 is most likely due to an inability to advance into mitosis when nitrogen is limiting.

The exact phenotypes observed in cpc2Delta cells have not, to the best of our knowledge, been described for any other mutant. However, some (such as mitotic delay and decreased conjugation and sporulation) are observed in cells with defects in the stress-activated MAP kinase pathway (see references 41, 42, and 44, for example). However, unlike loss of the spc1 MAP kinase, loss of cpc2 does not prevent growth on medium containing 1.4 M sorbitol or 0.9 M KCl. Nor are cpc2 cells sensitive to hydrogen peroxide, cycloheximide, or staurosporine (data not shown). Thus, cpc2Delta cells display only a limited subset of phenotypes associated with the stress-activated MAP kinase pathway. We did observe that cpc2Delta cells are more sensitive to high temperature compared with wild-type cells (Fig. 3F). In view of this observation, we tested cells producing high levels of Ran1 for the ability to grow at 37°C. Like cpc2Delta , ran1OP cells exhibit temperature-dependent synthetic lethality. In contrast, cells producing high levels of an inactive version of the kinase, ran1K47ROP cells, grow as well as wild-type cells at 37°C (Fig. 3F).

cpc2 functions independently of the PKA pathway. Cell cycle delay, failure to differentiate, and stationary-phase defects are phenotypes associated with activation of the cAMP-dependent protein kinase (PKA) pathway (3, 8, 9, 26). This, and the observation that RACK1 interacts with cAMP phosphodiesterase in mammalian cells (52), led us to test the hypothesis that cpc2 downregulates cAMP levels. In fission yeast, alteration of cAMP levels or of PKA activity causes pleiotropic defects. Transcription of genes regulated by nitrogen or glucose availability is impaired when cAMP levels are altered. The fructose-1,6-bisphosphatase gene (fbp1) is repressed in glucose-grown cells. Shifting the cells to glycerol-containing medium leads to derepression of fbp1 (14, 17). Addition of cAMP to cells (13) or mutations that increase PKA activity repress fbp1 transcription, even following a shift to glycerol medium. We used cells containing an fbp1-lacZ reporter gene to examine glucose repression in cpc2Delta cells. Either wild-type, cgs1Delta (cgs1 encodes the regulatory subunit of PKA), or cpc2Delta cells were shifted from glucose- to glycerol-containing medium. cgs1 cells fail to derepress the fusion gene immediately following the shift to glycerol (Fig. 4A and reference 50). In contrast, fbp1-lacZ expression in both wild-type and cpc2Delta cells increased to the same extent within 3 h of the nutritional shift and reached maximal expression at 6 h (Fig. 4A). Thus, cpc2 does not perform a major function in cAMP-regulated transcription of glucose-sensitive genes.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 4.   Interactions between cpc2 and the cAMP pathway. (A) Induction of the fbp1-lacZ fusion gene. Cells with the indicated relevant genotype and the ura4::fbp-lacZ reporter gene were shifted from glucose (filled symbols) to glycerol (empty symbols) medium. beta -Galactosidase activity was measured at the indicated times using a permeabilized-cell assay. Each point represents three samples (standard error of the mean, <2.0%). Wild-type (wt; SPB90), cgs1 mutant (SPB93), and cpc2 mutant (SPB320) cells were used. (B) Induction of the mei2-lacZ fusion gene. Cells were grown to 5 × 106/ml and washed in medium devoid of a nitrogen source. The culture was divided between two flasks. NH4Cl was added to one sample (closed symbols); the other represents nitrogen-depleted medium (open symbols). beta -Galactosidase activity was measured at the indicated times using 20 µg of soluble cell protein. Wild-type (SPB68) and cpc2 mutant (SPB307) cells were used. (C) Survival in stationary phase. Cells were grown to saturation (2 × 108/ml; day 0) and incubated for an additional 4 days (days 1 to 4). A portion of the culture was removed each day and stained with FUN-1. Wild-type (SPB173) cgs1 mutant (SPB76), and cpc2 mutant (SBP182) cells were used. (D) Sexual differentiation of cells grown on phorbol myristate acetate for 3 days at 30°C. Asci and zygotes in a portion of each sample were measured using a hemocytometer. Wild-type (SPB273), git2 mutant (SPB318), cpc2 mutant (SPB317), and git2 cpc2 mutant (SPB319) cells were used.

Nitrogen limitation leads to a 50% decrease in the level of intracellular cAMP (26) and promotes expression of differentiation genes, most notably, ste11 and mei2. In contrast, high cAMP levels prevent expression of ste11 (43) and mei2 (9). To test the involvement of cpc2 in nitrogen-regulated transcription, we used cells containing a mei2-lacZ reporter gene. cgs1Delta cells express no detectable mei2-lacZ following nitrogen starvation (9). In contrast, an increase in mei2-lacZ expression was observed 3 h following the shift of either wild-type or cpc2Delta cells to nitrogen-free medium. Accumulation of beta -galactosidase activity continued in both samples until the experiment was terminated at 9 h. beta -Galactosidase activity was lower in cpc2Delta cells than in wild-type cells. This decrease may reflect a difference in cAMP levels. Alternatively, it may be due to the inability to inactivate Ran1 in cpc2Delta cells. Recently, we determined that mei2 expression is regulated by Ran1 activity, as well as by cAMP levels (J. Qin and M. McLeod, unpublished data).

cAMP levels also regulate sexual differentiation and survival in stationary phase (9). Formally, the possibility remains that cpc2 functions to repress cAMP levels, but only to the extent that cell cycle events, and not nutrient-regulated transcription, are altered. The ability of cpc2Delta cells to survive stationary-phase conditions was examined. As shown previously (9) and in Fig. 4C, cgs1Delta cells die after 3 days at G0. At day 4, less than 0.3% of the cells are viable. Conversely, cpc2Delta and wild-type cells survived equally well at G0. Next, we determined if the sexual differentiation defect observed in cpc2Delta cells results from a failure to downregulate cAMP levels. The git2 (cyr1) gene encodes adenylate cyclase, and cells containing a loss-of-function git2 allele have no measurable cAMP (14, 22). Conjugation and sporulation of H90 git2 cells are accelerated relative to those of wild-type cells. If conjugation and meiosis are delayed in cpc2Delta cells because cAMP levels cannot be downregulated, then git2 cells ought to be insensitive to cpc2 function. The ability of git2 cells to conjugate and sporulate was compared with that of git2 cpc2 cells. This experiment revealed that conditions permitting 60% of the git2 cells to conjugate or sporulate allowed only 8.0% of the git2 cpc2 cells to differentiate (Fig. 4D). Taken together, the above-described experiments indicate that cpc2 is not a central regulator of cAMP levels.

Genetic interactions between Ran1 and Cpc2. If cpc2 and ran1 function on the same genetic pathway, cpc2 could potentially function as an upstream regulator or a downstream effector for the kinase. An epistasis test was used to discriminate between these possibilities. Cells containing the ran1-114 allele undergo haploid sporulation when the cells are incubated under restrictive conditions. Loss of cpc2 does not abolish conjugation and meiosis but retards the process (Fig. 3D). Conditions that partially inactivate ran1-114 were used to determine if the sporulation rate of ran1 cells is dependent on cpc2. We observed that neither wild-type cells nor cpc2Delta cells sporulated to a significant level after 20 h on malt extract medium at 30°C. At that time, 80% of the ran1-114 cells contained spores. Importantly, ran1-114 sporulation was only partially independent of cpc2. Inactivation of ran1 reversed the differentiation defect caused by loss of cpc2, but sporulation was accelerated if cells contained a functional cpc2 allele (Fig. 5A). We infer from this result that loss of cpc2 enhances ran1 residual activity. Since inactivation of ran1 allows cpc2Delta cells to regain a function, then cpc2 is most likely upstream of ran1 if, in fact, they are on the same pathway.


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5.   Genetic interactions between ran1 and cpc2. (A) Wild-type (SP66), ran1 mutant (SPB217) cpc2 mutant (SPB188), or ran1 and cpc2 mutant (SPB214) cells were patched onto malt extract plates and incubated at 32°C for the indicated periods of time. A portion of the patches was resuspended in water, and the cells were counted and scored as a vegetative cell, a zygote, or an ascus containing spores. A differentiated cell includes zygotes and cells with spores. (B) Either wild-type (SP66) or cpc2 mutant (SPB182) cells were transformed with a control plasmid (pALT2) or a plasmid containing adh-ran1 (pRAN1-81).

Inactivation of Ran1 causes cells to accumulate in G1 (3), but activated Ran1 (ran1OP) leads to a G2 delay (23). Considering that loss of cpc2 also causes a G2 delay (Fig. 2B and E), the effect of producing high levels of cpc2 was examined. Expression of cpc2 using the adh promoter had no observable effect in either wild-type or ran1OP cells (data not shown). However, the inverse experiment, expression of Ran1 in cpc2Delta cells, caused an additive phenotype (Fig. 5B). Specifically, growth of ranOP cpc2Delta cells was retarded compared to that of cpc2 cells transformed with an empty vector (Fig. 5B). Microscopic examination of the cells revealed that they were highly elongated (data not shown). In comparison, expression of Ran1 in wild-type cells caused far less severe defects in colony formation and cell length. Similar results were obtained if ran1 was expressed using either the adh or the nmt1 promoter. One interpretation of these data is that Ran1 and Cpc2 act in opposition on independent pathways. However, since the epistasis test indicates a role for cpc2 as a regulator of ran1, we favor the hypothesis that the exaggerated Ran1 phenotypes observed when Ran1 is expressed in cpc2Delta cells result from increased Ran1 activity that would be constrained by Cpc2 if it were present. With regard to the experiments showing that high-level production of cpc2 causes no observable phenotypes, we suggest the presence of an as yet unidentified activator for Cpc2 or perhaps a structural role for the protein.

Cpc2 allows nuclear accumulation of Ran1. Mammalian RACK1 is believed to regulate PKC function by serving as an anchoring protein for the activated kinase (37). Thus, the cellular localization of Ran1 in wild-type and cpc2Delta cells was examined. For these experiments, Ran1 was fused to GFP and expressed under control of the nmt1 promoter. Induction of the fusion protein was accomplished by removal of thiamine from the medium. A detectable GFP signal was first noted 7 h following induction, and the signal was concentrated in the nucleus (Fig. 6A and reference 47). Early nuclear concentration of Ran1 was independent of cpc2. At 12 h following induction, a striking difference in the cellular distribution of Ran1-GFP became evident. Ran1-GFP displayed a prominent, punctate cytoplasmic staining in cpc2Delta cells that was not observed in wild-type cells. In addition, the fusion protein did not accumulate to high levels in the nucleus in the absence of cpc2 (Fig. 6A and data not shown). The pattern is specific for Ran1-GFP because it was not observed for the other nuclear proteins tested, such as Ste11-GFP and Mei3-GFP, or for GFP alone (data not shown). The level of Ran1-GFP in the cells was examined in an immunoblot. This experiment showed that the fusion protein had the predicted molecular weight and that the steady-state level of Ran1-GFP in cpc2Delta cells was comparable to that in wild-type cells (Fig. 6B).


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6.   Localization of the Ran1-GFP fusion protein. (A) cpc2+ (SPB5) or cpc2Delta (SPB188) cells were transformed with a plasmid (pRAN1-GFP) expressing Ran1-GFP under control of the nmt promoter. Transformants were grown to 5 × 106 cells/ml in minimal medium containing thiamine (Thia). The cells were washed thoroughly in thiamine-free medium, and incubation was continued in the absence of thiamine for 7 or 12 h. The cells were then examined using a microscope. (B) The above cells were used to prepare whole-cell extract. A portion of the extract was separated by SDS-PAGE and used in a Western blot assay. The proteins were detected using anti-Ran1 antibody.

Cpc2 does not alter Ran1 activity in vitro. One hypothesis consistent with the results obtained to this point is that cpc2 functions upstream of ran1 and negatively regulates its activity. The mechanism employed by Cpc2 to inactivate Ran1 was further investigated. An in vitro kinase assay was used to measure Ran1 activity in partially purified yeast lysates to determine if Cpc2 inhibits Ran1 substrate phosphorylation. Ran1 was expressed as a GST fusion protein in wild-type cells, cpc2Delta cells, or cells expressing high levels of cpc2. Affinity-purified Ran1 was incubated with p39ste11 as the substrate and radioactive ATP (Fig. 7A). This experiment revealed that Ran1 substrate phosphorylation was unaltered by Cpc2. To more accurately quantitate the effect of Cpc2 on Ran1, both proteins were expressed in and purified from bacteria. (HIS)6-tagged Cpc2 was purified by Ni2+ affinity chromatography, and increasing amounts of Cpc2 were added to (HIS)6-Ran1 in an in vitro kinase assay (Fig. 7B). This analysis showed that addition of Cpc2 had no effect on Ran1 substrate phosphorylation. Thus, Cpc2 does not inhibit Ran1 activity under these conditions. As shown in Fig. 1B, Cpc2 contains serine and threonine residues (Ser-39 and Thr-128) at positions corresponding to the phosphoacceptor serine and threonine residues in Ste11 (20). However, the in vitro kinase assays also demonstrate that Cpc2 is not likely to function as a substrate for Ran1 (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 7.   Cpc2 does not alter Ran1 substrate phosphorylation in vitro. (A) Western blot (top) and in vitro kinase (bottom) assays of extracts obtained from cpc2+ (SP66), cpc2Delta (SPB188), or cpc2OP (SPB870::CPC2-24) cells transformed with a plasmid (pRAN1-95) producing Ran1 under control of the nmt promoter. Ran1 is tagged at the amino terminus with GST-HA1 sequences. Twenty hours following induction of Ran1, cell lysate was prepared. Ran1 was affinity purified from the lysates and incubated in the in vitro kinase reaction. p39ste11 was used as the substrate (20). (B) Recombinant p52ran1 and recombinant p39ste11 were incubated with [32P]ATP in the absence (lane 1) or the presence (lanes 2 to 6) of increasing concentrations of recombinant Cpc2. Phosphorylation of p39ste11 was monitored using SDS-PAGE and autoradiography.

Mammalian RACK1 is a functional homologue of the fission yeast gene. We wished to determine if Cpc2 and mammalian RACK1 are functional, as well as structural, homologues. Recently, it was shown that N. crassa cpc-2 is a functional homologue of the S. cerevisiae CPC2 gene (15). To investigate this, rat RACK1 (which is identical to the human protein) was expressed in yeast under control of the adh promoter. This plasmid was introduced into a cpc2Delta strain. As controls, the cells were transformed with the vector alone or with a plasmid expressing fission yeast cpc2. Individual transformants were examined in several assays (Fig. 8). As previously observed, loss of cpc2 caused temperature-sensitive growth. Additionally, cpc2Delta cells formed small colonies compared to wild-type cells. Expression of mammalian RACK1 reversed both defects as efficiently as yeast cpc2. The transformants were also examined to determine if the mammalian gene was able to reverse the cpc2Delta sexual differentiation defect. For this assay, cells were plated on minimal medium for 2 days and stained with iodine vapor to observe spore-containing cells. Both yeast cpc2 and mammalian RACK1 restored the ability of cpc2Delta cells to sporulate. This experiment provides evidence that mammalian RACK1 is a structural and functional homologue of fission yeast cpc2.


View larger version (85K):
[in this window]
[in a new window]
 
FIG. 8.   Functional complementation of cpc2Delta by expression of the mammalian gene. Either cpc2+ (SP66) or cpc2Delta (SPB190) cells were transformed with a control plasmid (pIRT2), the fission yeast cpc2 gene (pCPC2.10), or the gene for rat RACK1 (pRACK1.1). (A) The transformants were spread on minimal-medium plates and incubated at 30°C to observe colony morphology (left side of panel). In addition, a representative colony was streaked for single colonies and incubated at 37°C to examine viability (right side of panel). (B) The morphology of the cells was examined using Nomarski optics. (C) Patches of cells were incubated at 30°C for 2 days and stained using iodine vapor to observe spore-containing cells. The patched cells were examined under a microscope to count vegetative cells, zygotes, and spore-containing cells. The bar graph represents the percentages of cells that have conjugated or formed spores. Three independent samples were measured.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Ran1 is a key regulator of the developmental switch between mitotic cell growth and meiosis. Activation of Ran1 inhibits sexual differentiation (23), while inactivation of the kinase initiates G1 arrest, conjugation, and meiosis (3, 16, 17, 32). We screened a fission yeast library using a two-hybrid interaction assay to identify protein partners for Ran1. Here, we describe one of these, the product of the cpc2 gene. Fission yeast Cpc2 is a structural and functional homologue of mammalian RACK1 proteins. RACK1 was initially isolated as a beta PKC-binding protein. It is hypothesized to function as an anchoring protein for activated beta PKC to enable access of the kinase to physiologically important substrates. Evidence is presented that Cpc2 interacts with Ran1. Analysis of cells containing the cpc2 null allele indicates that it is important for cell cycle progression, as well as efficient conjugation and meiosis. Cpc2 may regulate Ran1 activity by controlling cellular localization of the kinase.

The interaction between Ran1 and Cpc2 is specific and may be direct. Three lines of evidence obtained using different experimental approaches indicate that Ran1 and Cpc2 interact. Firstly, Cpc2 was identified as a Ran1-interacting protein in a two-hybrid library screen. In support of this finding, we found Ran1 and Cpc2 physically associated in cell extracts. Cpc2 contains two regions that resemble a motif (known as RKD) previously identified in both the Ste11 substrate and the Mei3 inhibitor of Ran1. Thus, the interaction between Ran1 and Cpc2 may be mediated by the RKD-like sequences of Cpc2. Mutagenesis of specific residues in both Cpc2 RKD regions diminishes the interaction observed in the two-hybrid assay. One interpretation of this observation is that the RKD regions mediate Cpc2 interaction with Ran1. However, it can be argued that the mutations, which are in conserved regions of the protein, are required for functional folding of the protein. In that case, failure of the polypeptide to interact with Ran1 could be a general consequence of misfolding. We favor the former interpretation. Expression of Cpc2 RKD on a plasmid in cpc2Delta cells causes partial suppression of cpc2-associated defects (data not shown). This suggests that cpc2 RKD is a weak but functional, allele, perhaps producing a product with reduced affinity for Ran1. High-level expression of the altered protein may compensate for an affinity defect but is less likely to restore a function lost because of incorrect folding.

Genetic assays indicate that the association between Ran1 and Cpc2 is specific and provide a functional link between the two proteins. Ran1 controls the transition between mitosis and meiosis in response to nutritional (and perhaps other) signals. In cells unable to inactivate Ran1, conjugation and sporulation are blocked and the cells are highly elongated. Loss of cpc2 leads to similar phenotypes. The differentiation defect of cpc2Delta is reversed by inactivation of ran1. These observations are consistent with the hypothesis that Cpc2 negatively regulates Ran1 activity.

What, then, is the function of Cpc2? Ran1 associated with Cpc2 does not exhibit altered kinase activity in vitro, even though a wide range of Cpc2 concentrations was tested. If, as suggested by the two-hybrid results presented in Fig. 1, the Cpc2 RKD regions contribute to its association with the kinase, then Cpc2 is expected to be a competitive inhibitor of Ran1 substrate phosphorylation. Further biochemical experiments are required to examine the role of Cpc2 as an inhibitor. However, in vivo data suggest that Cpc2 does not function simply as a competitive inhibitor of Ran1. Cells producing high levels of Ran1 are sterile, and this defect can be reversed by expression of Ste11 (20) but not by expression of Cpc2. Moreover, the differentiation defect of cpc2Delta cells is not reversed by expression of Ste11 (B. Shor and M. McLeod, unpublished data). These results suggest either that Cpc2 has a more extensive role in meiosis than as a competitive inhibitor of Ran1 or that another component is required for Cpc2 to function.

The interaction between RACK1 and PKC regulates the cellular localization of activated PKC. Our data suggest that Cpc2 may regulate Ran1, not by altering the catalytic activity of the kinase but by influencing its subcellular localization. As shown in Fig. 6, cpc2Delta cells accumulate Ran1-GFP as bright dots in the cytoplasm with little nuclear concentration of the fusion protein. Both phenomena are absent in cells containing functional Cpc2. This result is specific to Ran1-GFP and is unlikely to be an insignificant artifact of the expression system. No other genetic backgrounds tested alter Ran1 localization. The mechanism used to localize Ran1 is not clear. Cpc2 could function as an anchoring protein to dock the kinase to a site proximal to substrates or regulators. In favor of this hypothesis, Cpc2 structurally resembles the beta  subunit of heterotrimeric G proteins. The beta gamma subunits of heterotrimeric G proteins have recently been shown to function as anchoring molecules for protein kinases (4, 34). Alternatively, it is possible that Cpc2 participates in a posttranslational processing event required to control the regional concentration of Ran1. There is evidence that, in addition to a RACK1-binding site, PKC contains a pseudoanchoring site that resembles sequences in RACK1. The binding site and the pseudoanchoring site associate in an intramolecular reaction. In this conformation, beta PKC must be activated by phosphatidylserine, diacylglycerol, and calcium to function as a kinase. Upon activation, the RACK1-binding region is liberated from the pseudoanchoring site and becomes available to bind RACK1. In this conformation, the kinase becomes independent of its normal activators and translocates to membranes (38). We have not identified a pseudo-Cpc2 region in the Ran1 polypeptide, although one may exist. However, the phenotype of cells devoid of Cpc2 is intriguing in light of the RACK1 model. cpc2 is not absolutely required for development but determines both the timing and extent of meiotic differentiation. If Cpc2, like RACK1, can stabilize Ran1 in an intermediate state of activation, the kinase may no longer be responsive to minor signal fluctuations. Loss of a stabilizer ought not to prevent the execution of an event but may influence its progression.

Structural and functional conservation of Cpc2. One of the most significant findings presented here is the identification of a structurally and functionally conserved RACK1 homologue as a partner for a kinase. It is somewhat surprising to identify the highly conserved RACK1 protein interacting with a protein that does not appear to have a structural counterpart in other organisms. The closest relative to Ran1 in budding yeast is Sks1p. The two proteins share 52% homology, and this is limited to their kinase domains. Conversely, the PKA pathway is conserved from yeast to mammals. As reported here, the phenotypes of cells containing cpcDelta resemble those caused by high cAMP levels. These observations, and the finding that RACK1 interacts with a mammalian phosphodiesterase, provide a rationale for the hypothesis that Cpc2 regulates cAMP levels in yeast. However, our studies failed to identify a connection between Cpc2 and the PKA pathway. We also investigated phenotypes associated with loss of the two identified fission yeast PKC genes to search for PKC interaction with Cpc2 (Shor and McLeod, unpublished data). To date, no interaction has been demonstrated in yeast. The interaction between RACK1 proteins and specific signal transduction pathways may vary depending on the particular cell type examined or the signal to which the cell is responding. However, one common theme emerging from studies of Cpc2 (RACK1) in diverse systems is that Cpc2 (RACK1) alters cell cycle progression and, in particular, may augment exit from the mitotic cell cycle into either G0 or a differentiation pathway. S. pombe cpc2Delta cells are cell cycle delayed and slow to respond to signals that induce G1 arrest. In NIH 3T3 cells, expression of RACK1 causes a G1/G0 delay, as well as a reduced growth rate (5). Budding yeast cells devoid of CPC2 enter G0 prematurely (15). Both S. pombe and N. crassa devoid of cpc-2 exhibit fertility defects (28). On the other hand, RACK1 specifically associates with the integrin beta  subunit in lymphoblastoid cells (21), suggesting that some integrin signaling pathways function through a RACK1-PKC pathway. Notably, yeast cells appear to lack integrins. Recent evidence indicates that RACK1 binds pleckstrin homology domains from some proteins. The authors speculate that RACK1 scaffolding proteins are multivalent organizers that coordinate complex signaling systems (35). With this intriguing observation in mind, further genetic analysis is under way to identify other potential partners for Cpc2.


    ACKNOWLEDGMENTS

We thank Daria Mochly-Rosen for her gift of the rat RACK1-encoding gene. We are grateful to Steve Elledge for his generous gift of plasmids and a fission yeast cDNA library constructed in pACT2. We thank Kinsey Maundrell and Susan Forsburg for supplying plasmids containing the nmt1 promoter. Charles Hoffman, Takashi Toda, and Dallan Young generously supplied strains used for this study. We are grateful to Betty Leung for technical expertise supplied at many stages of the work.

A National Science Foundation Career Advancement Award to M.M.; the American Heart Association, NYC; and National Institutes of Health grant NIH-R01 GM565875 supported this work.


    FOOTNOTES

* Corresponding author. Mailing address: State University of New York Health Science Center at Brooklyn, Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, Brooklyn, NY 11203. Phone: (718) 270-3321. Fax: (718) 270-2656. E-mail: mmcleod{at}netmail.hscbklyn.edu.

dagger Present address: Department of Obstetrics and Gynecology, New York University School of Medicine, New York, NY 10012.

Dagger Present address: Department of Biological Sciences, The Johns Hopkins University School of Medicine, Baltimore, MD 21205.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alfa, C., P. Fantes, J. Hyams, M. McLeod, and E. Warbrick. 1993. Experiments with fission yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
2. Basi, G., E. Schmid, and K. Maundrell. 1993. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123:131-136[CrossRef][Medline].
3. Beach, D., L. Rodgers, and J. Gould. 1985. ran1+ controls the transition from mitotic division to meiosis in fission yeast. Curr. Genet. 10:297-311[CrossRef][Medline].
4. Bell, B., H. Xing, K. Yan, N. Gautam, and A. J. Muslin. 1999. KSR-1 binds to G-protein beta gamma subunits and inhibits beta gamma -induced mitogen-activated protein kinase activation. J. Biol. Chem. 274:7982-7986[Abstract/Free Full Text].
5. Chang, B. Y., K. B. Conroy, E. M. Machleder, and C. A. Cartwright. 1998. RACK1, a receptor for activated C kinase and a homolog of the beta  subunit of G proteins, inhibits activity of Src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18:3245-3256[Abstract/Free Full Text].
6. Costello, G., L. Rodgers, and D. Beach. 1986. Fission yeast enters the stationary phase G0 state from either mitotic G1 or G2. Curr. Genet. 11:119-125.
7. Davey, J. 1998. Fusion of a fission yeast. Yeast 14:1529-1566[CrossRef][Medline].
8. Davey, J., and O. Nielsen. 1994. Mutations in cyr1 and pat1 reveal pheromone-induced G1 arrest in the fission yeast Schizosaccharomyces pombe. Curr. Genet. 26:105-112[CrossRef][Medline].
9. DeVoti, J., G. Seydoux, D. Beach, and M. McLeod. 1991. Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline].
10. Egel, R. 1973. Commitment to meiosis in fission yeast. Mol. Gen. Genet. 121:277-284[CrossRef].
11. Egel, R., and M. Egel-Mitani. 1974. Premeiotic DNA synthesis in fission yeast. Exp. Cell Res. 88:127-134[CrossRef][Medline].
12. Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[CrossRef][Medline].
13. Hoffman, C. S., and F. Winston. 1991. Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway. Genes Dev. 5:561-571[Abstract/Free Full Text].
14. Hoffman, C. S., and F. Winston. 1989. A transcriptionally regulated expression vector for the fission yeast Schizosaccharomyces pombe. Gene 84:473-479[CrossRef][Medline].
15. Hoffmann, B., H. U. Mosch, E. Sattlegger, I. B. Barthelmess, A. Hinnebusch, and G. H. Braus. 1999. The WD protein Cpc2p is required for repression of Gcn4 protein activity in yeast in the absence of amino-acid starvation. Mol. Microbiol. 31:807-822[CrossRef][Medline].
16. Iino, Y., and M. Yamamoto. 1985. Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. 198:416-421[CrossRef].
17. Iino, Y., and M. Yamamoto. 1985. Negative control for the initiation of meisois in Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. USA 82:2447-2451[Abstract/Free Full Text].
18. Imai, Y., and M. Yamamoto. 1994. The fission yeast mating pheromone P-factor: its molecular structure, gene structure, and ability to induce gene expression and G1 arrest in the mating partner. Genes Dev. 8:328-338[Abstract/Free Full Text].
19. Kelly, M., J. Burke, M. Smith, A. Klar, and D. Beach. 1988. Four mating-type genes control sexual differentiation in the fission yeast. EMBO J. 7:1537-1547[Medline].
20. Li, P., and M. McLeod. 1996. Molecular mimicry in development: identification of ste11+ as a substrate and mei3+ as a pseudosubstrate inhibitor of ran1+ kinase. Cell 87:869-880[CrossRef][Medline].
21. Liliental, J., and D. D. Chang. 1998. Rack1, a receptor for activated protein kinase C, interacts with integrin beta  subunit. J. Biol. Chem. 273:2379-2383[Abstract/Free Full Text].
22. Maeda, T., N. Mochizuki, and M. Yamamoto. 1990. Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. USA 87:7814-7818[Abstract/Free Full Text].
23. McLeod, M., and D. Beach. 1988. A specific inhibitor of the ran1+ protein kinase regulates entry into meiosis in Schizosaccharomyces pombe. Nature 332:509-514[CrossRef][Medline].
24. McLeod, M., M. Stein, and D. Beach. 1987. The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline].
25. Millard, P. J., B. L. Roth, H. P. Thi, S. T. Yue, and R. P. Haugland. 1997. Development of the FUN-1 family of fluorescent probes for vacuole labeling and viability testing of yeasts. Appl. Environ. Microbiol. 63:2897-2905[Abstract].
26. Mochizuki, N., and M. Yamamoto. 1992. Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24[CrossRef][Medline].
27. Mochly-Rosen, D., H. Khaner, J. Lopez, and B. L. Smith. 1991. Intracellular receptors for activated protein kinase C. Identification of a binding site for the enzyme. J. Biol. Chem. 266:14866-14868[Abstract/Free Full Text].
28. Muller, F., D. Kruger, E. Sattlegger, B. Hoffmann, P. Ballario, M. Kanaan, and I. B. Barthelmess. 1995. The cpc-2 gene of Neurospora crassa encodes a protein entirely composed of WD-repeat segments that is involved in general amino acid control and female fertility. Mol. Gen. Genet. 248:162-173[CrossRef][Medline].
29. Neer, E. J., C. J. Schmidt, R. Nambudripad, and T. F. Smith. 1994. The ancient regulatory-protein family of WD-repeat proteins. Nature 371:297-300[CrossRef][Medline].
30. Neer, E. J., T. F. Smith, E. J. Neer, and T. F. Smith. 1996. G protein heterodimers: new structures propel new questions. Cell 84:175-178[CrossRef][Medline].
31. Nielsen, O., J. Davey, and R. Egel. 1992. The ras1 function of Schizosaccharomyces pombe mediates pheromone-induced transcription. EMBO J. 11:1391-1395[Medline].
32. Nurse, P. 1985. Mutants of the fission yeast Schizosaccharomyces pombe which alter the shift between cell proliferation and sporulation. Mol. Gen. Genet. 198:497-502[CrossRef].
33. Nurse, P., and Y. Bissett. 1981. Gene required in G1 for commitment to cell cycle and in G2 for control of mitosis in fission yeast. Nature 292:558-560[CrossRef][Medline].
34. Pitcher, J. A., J. Inglese, J. B. Higgins, J. L. Arriza, P. J. Casey, C. Kim, J. L. Benovic, M. M. Kwatra, M. G. Caron, and R. J. Lefkowitz. 1992. Role of beta gamma subunits of G proteins in targeting the beta -adrenergic receptor kinase to membrane-bound receptors. Science 257:1264-1267[Abstract/Free Full Text].
35. Rodriguez, M. M., C. H. Chen, B. L. Smith, and D. Mochly-Rosen. 1999. Characterization of the binding and phosphorylation of cardiac calsequestrin by epsilon protein kinase C. FEBS Lett. 454:240-246[CrossRef][Medline].
36. Ron, D., C. H. Chen, J. Caldwell, L. Jamieson, E. Orr, and D. Mochly-Rosen. 1994. Cloning of an intracellular receptor for protein kinase C: a homolog of the beta  subunit of G proteins. Proc. Natl. Acad. Sci. USA 91:839-843[Abstract/Free Full Text].
37. Ron, D., and D. Mochly-Rosen. 1994. Agonists and antagonists of protein kinase C function, derived from its binding proteins. J. Biol. Chem. 269:21395-21398[Abstract/Free Full Text].
38. Ron, D., and D. Mochly-Rosen. 1995. An autoregulatory region in protein kinase C: the pseudoanchoring site. Proc. Natl. Acad. Sci. USA 92:492-496[Abstract/Free Full Text].
39. Russell, P. R., and B. D. Hall. 1983. The primary structure of the alcohol dehydrogenase gene from the fission yeast Schizosaccharomyces pombe. J. Biol. Chem. 258:143-149[Abstract/Free Full Text].
40. Shan, X., H. Luo, B. Houle, and J. Wu. 1994. Expression of a G-protein beta subunit-related gene during lymphocyte activation. Int. Immunol. 6:739-749[Abstract/Free Full Text].
41. Shiozaki, K., and P. Russell. 1996. Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 10:2276-2288[Abstract/Free Full Text].
42. Stettler, S., E. Warbrick, S. Prochnik, S. Mackie, and P. Fantes. 1996. The wis1 signal transduction pathway is required for expression of cAMP-repressed genes in fission yeast. J. Cell Sci. 109:1927-1935[Abstract].
43. Sugimoto, A., Y. Iino, T. Maeda, Y. Watanabe, and M. Yamamoto. 1991. Schizosaccharomyces pombe ste11+ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 5:1990-1999[Abstract/Free Full Text].
44. Toone, W. M., S. Kuge, M. Samuels, B. A. Morgan, T. Toda, and N. Jones. 1998. Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (exportin) and the stress-activated MAP kinase Sty1/Spc1. Genes Dev. 12:1453-1463[Abstract/Free Full Text].
45. Van Heeckeren, W. J., D. R. Dorris, and K. Struhl. 1998. The mating-type proteins of fission yeast induce meiosis by directly activating mei3 transcription. Mol. Cell. Biol. 18:7317-7326[Abstract/Free Full Text].
46. Vassarotti, A., and J. D. Friesen. 1985. Isolation of the fructose-1,6-bisphosphatase gene of the yeast Schizosaccharomyces pombe. Evidence for transcriptional regulation. J. Biol. Chem. 260:6348-6353[Abstract/Free Full Text].
47. Wang, W., P. Li, A. Schettino, Z. Peng, and M. McLeod. 1998. Characterization of functional regions in the Schizosaccharomyces pombe mei3 developmental activator. Genetics 150:1007-1018[Abstract/Free Full Text].
48. Watanabe, Y., S. Shinozaki-Yabana, Y. Chikashige, Y. Hiraoka, and M. Yamamoto. 1997. Phosphorylation of RNA-binding protein controls cell cycle switch from mitotic to meiotic in fission yeast. Nature 386:187-190[CrossRef][Medline].
49. Willer, M., L. Hoffmann, U. Styrkársdóttir, R. Egel, J. Davey, and O. Nielsen. 1995. Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe. Mol. Cell. Biol. 15:4964-4970[Abstract].
50. Wu, S.-Y., and M. McLeod. 1995. The sak1+ gene of Schizosaccharomyces pombe encodes an RFX family DNA-binding protein that positively regulates cyclic AMP-dependent protein kinase-mediated exit from the mitotic cell cycle. Mol. Cell. Biol. 15:1479-1488[Abstract].
51. Yamamoto, M., Y. Imai, and Y. Watanabe (ed.). 1997. Mating and sporulation in Schizosaccharomyces pombe. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
52. Yarwood, S. J., M. R. Steele, G. Scotland, M. D. Houslay, and G. B. Bolger. 1999. The RACK1 signaling scaffold protein selectively interacts with the cAMP-specific phosphodiesterase PDE4D5 isoform. J. Biol. Chem. 274:14909-14917[Abstract/Free Full Text].
53. Zhao, Y., M. Yu, M. Chen, R. T. Elder, A. Yamamoto, and J. Cao. 1998. Pleiotropic effects of HIV-1 protein R (Vpr) on morphogenesis and cell survival in fission yeast and antagonism by pentoxifylline. Virology 246:266-276[CrossRef][Medline].


Molecular and Cellular Biology, June 2000, p. 4016-4027, Vol. 20, No. 11
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Coyle, S. M., Gilbert, W. V., Doudna, J. A. (2009). Direct Link between RACK1 Function and Localization at the Ribosome In Vivo. Mol. Cell. Biol. 29: 1626-1634 [Abstract] [Full Text]  
  • Palmer, D. A., Thompson, J. K., Li, L., Prat, A., Wang, P. (2006). Gib2, A Novel Gbeta-like/RACK1 Homolog, Functions as a Gbeta Subunit in cAMP Signaling and Is Essential in Cryptococcus neoformans. J. Biol. Chem. 281: 32596-32605 [Abstract] [Full Text]  
  • Rothberg, K. G., Burdette, D. L., Pfannstiel, J., Jetton, N., Singh, R., Ruben, L. (2006). The RACK1 Homologue from Trypanosoma brucei Is Required for the Onset and Progression of Cytokinesis. J. Biol. Chem. 281: 9781-9790 [Abstract] [Full Text]  
  • Shor, B., Calaycay, J., Rushbrook, J., McLeod, M. (2003). Cpc2/RACK1 Is a Ribosome-associated Protein That Promotes Efficient Translation in Schizosaccharomyces pombe. J. Biol. Chem. 278: 49119-49128 [Abstract] [Full Text]  
  • Honigberg, S. M., Purnapatre, K. (2003). Signal pathway integration in the switch from the mitotic cell cycle to meiosis in yeast. J. Cell Sci. 116: 2137-2147 [Abstract] [Full Text]  
  • McCahill, A., Warwicker, J., Bolger, G. B., Houslay, M. D., Yarwood, S. J. (2002). The RACK1 Scaffold Protein: A Dynamic Cog in Cell Response Mechanisms. Mol. Pharmacol. 62: 1261-1273 [Full Text]  
  • Hermanto, U., Zong, C. S., Li, W., Wang, L.-H. (2002). RACK1, an Insulin-Like Growth Factor I (IGF-I) Receptor-Interacting Protein, Modulates IGF-I-Dependent Integrin Signaling and Promotes Cell Spreading and Contact with Extracellular Matrix. Mol. Cell. Biol. 22: 2345-2365 [Abstract] [Full Text]  
  • Sang, N., Severino, A., Russo, P., Baldi, A., Giordano, A., Mileo, A. M., Paggi, M. G., De Luca, A. (2001). RACK1 Interacts with E1A and Rescues E1A-induced Yeast Growth Inhibition and Mammalian Cell Apoptosis. J. Biol. Chem. 276: 27026-27033 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLeod, M.
Right arrow Articles by Hu, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLeod, M.
Right arrow Articles by Hu, L.