Previous Article | Next Article ![]()
Molecular and Cellular Biology, June 2000, p. 4016-4027, Vol. 20, No. 11
State University of New York Health Science
Center at Brooklyn, Department of Microbiology and Immunology,
Morse Institute for Molecular Biology and Genetics, Brooklyn, New York
11203
Received 28 December 1999/Returned for modification 16 February
2000/Accepted 19 March 2000
The Schizosaccharomyces pombe ran1/pat1 gene regulates
the transition between mitosis and meiosis. Inactivation of Ran1 (Pat1) kinase is necessary and sufficient for cells to exit the cell cycle and
undergo meiosis. The yeast two-hybrid interaction trap was used to
identify protein partners for Ran1/Pat1. Here we report the
identification of one of these, Cpc2. Cpc2 encodes a homologue of
RACK1, a WD protein with homology to the All living cells integrate signals
from the environment to modify the activity of genes required for
mitotic division, differentiation, or stationary phase. For the fission
yeast Schizosaccharomyces pombe, nutritional signals direct
life cycle choices. As key nutrients become limited, cells exit the
mitotic cycle and enter either G0 stationary phase or a
program of sexual differentiation (6, 10). The choice
between G0 and differentiation is governed by the presence
of mating-specific pheromones. Starved cells respond to pheromones
produced by cells of the opposite mating type by undergoing transient
G1 arrest, followed by conjugation and meiosis (8, 18,
33, 49). As expected from the need for both nutrient limitation
and pheromone signaling, many signal transduction pathways converge to
regulate differentiation. These include pathways regulated by cyclic
AMP (cAMP), the ras1-regulated mitogen-activated protein (MAP) kinase pathway and the stress-activated MAP kinase pathway (see
reference 51 for a review). However, a variety of
studies indicate that each phase of the fission yeast life cycle can be governed by the activity of Ran1 (Pat1) kinase (referred to as Ran1
hereafter) and its substrates.
Inactivation of Ran1 is necessary and sufficient to divert cells from
the mitotic cell cycle into the meiotic developmental program (16,
17, 32). Experiments examining the phenotype of cells carrying a
ran1 temperature-sensitive allele suggest that Ran1 is
regulated by stepwise inactivation of the kinase (3, 23).
Limiting nutritional conditions trigger partial inactivation of Ran1.
This allows cells to accumulate in G1 (3, 8),
the only cell cycle stage permissive for conjugation (10). Following conjugation, continued starvation of the diploid zygote and
activation of the mating pheromone pathway lead to full inactivation of
Ran1 (24, 49). This promotes meiosis. The complex phenotypes attributed to loss of Ran1 indicate that its activity is likely regulated by a variety of mechanisms.
Attenuation of Ran1 activity provokes expression of genes that function
during sexual differentiation as elements of a cascading circuit
(31). The most upstream is the product of the
ste11 gene, which encodes a transcription factor required
for expression of most meiosis-specific genes (43). Ste11 is
an in vitro substrate for Ran1 and a likely physiological target for
the kinase. Ran1 phosphorylation negatively regulates the transcription
factor, perhaps by hindering its nuclear localization (20).
Ste11 binds a specific DNA sequence, the TR box, found upstream of
genes it regulates. Ste11 is required for expression of the mating type genes (43), and these regulate meiotic commitment. The
mating type locus is not a single genetic entity but includes four
genes. matPc and matPm
are functional in plus cells, and matMc and
matMm are functional in minus cells.
matPc and matMc control
production of pheromones and pheromone receptors essential for
conjugation (see reference 7 for a review).
Pheromone signaling is also required for expression of
matMm and matPm, both of
which are necessary for meiosis (19, 49).
matPm and matMm directly
provoke transcription of mei3 (24, 45, 49). As
described below, the product of the mei3 gene is a critical
meiotic activator.
mei3 is expressed only in diploid cells competent to undergo
meiosis (24). All available data are consistent with the
hypothesis that Mei3 activates meiosis by inhibition of Ran1 kinase.
The inhibitor contains a region, RKD, which resembles two regions in
the Ste11 substrate for Ran1 (20). Structure-function
studies indicate that the Mei3 RKD region is critical for association with Ran1. Cells containing mei3 alleles with Mei3 RKD
mutations conjugate well but sporulate inefficiently (47).
It is hypothesized that during meiosis, inactivation of Ran1 by Mei3
leads to accumulation of hypophosphorylated, and hence active, forms of
Ste11. This leads to induction of meiosis-specific genes. One of these,
Mei2, is an RNA-binding protein required for premeiotic DNA synthesis (3, 48). Like Ste11, Mei2 is negatively regulated by Ran1 phosphorylation. It has been suggested that the phosphorylation state
of Ste11 readies cells for meiosis, while that of Mei2 determines meiotic commitment (48).
As described above, Mei3 does not regulate conjugation but functions
only during meiosis to inactivate Ran. The mechanisms used to partially
inactivate Ran1 so that G1 arrest and conjugation can
proceed have not been described. To identify other components of the
Ran1 signal transduction pathway, we searched for protein partners of
Ran1. A fission yeast cDNA library was screened using the two-hybrid
interaction trap. We identified RACK1 (Cpc2) as a Ran1-interacting
protein. RACK1 functions in mammalian cells to regulate at least two
unrelated kinases, protein kinase C (PKC) (27) and Src
(5). The fission yeast version of RACK1, named Cpc2 to
conform to the Neurospora crassa designation
(28), is 77% homologous to the human protein. In spite of
its strong conservation in many organisms, cpc2 is not an
essential gene in fission yeast. Cells containing a cpc2
null allele are highly elongated due to a G2 cell cycle
delay. The cells accumulate inefficiently in G1 when
deprived of nitrogen, and conjugation and meiosis are impaired. These
phenotypes argue that cpc2 acts in opposition to
ran1, perhaps to regulate the activity of the kinase. In
support of this hypothesis, cpc2 functions upstream of
ran1 and a physical association between the two proteins is
observed. Fluorescence microscopy using a Ran1-green fluorescent
protein (GFP) fusion indicates that Cpc2 may function to alter the
cellular localization of Ran1. Consistent with the high level of
homology observed between RACK1 and Cpc2, rat RACK1 is capable of
functionally complementing a cpc2 null allele.
Strains and media.
The genotypes of the S. pombe
strains used in this study are as follows: SP66, h90
leu1-32 ade6-M216; SP712, h+N leu1-32 ura4-D18
ade6-M210 ran1+ OP (OP refers to genes expressed
at high levels under the control of the constitutive adh
promoter); SP713, h+N leu1-32 ura4-D18 ade6-M210
ran1K47R+ OP; SP870, h90 leu1-32
ura4-D18 ade6-M210 cpc2::pCPC2-24; SPB5,
h90 leu1-32 ade6-M210; SPB67,
h+N leu1-32 ura4-D18 ade6-M210/h leu1-32 ura4-D18
ade6-M216; SPB68, h90 mei2::LacZ;
SPB76, h+N leu1-32 ura4-D18 ade6-M216
cgs1::ura4; SPB90, h
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cpc2, a Fission Yeast Homologue of Mammalian RACK1 Protein,
Interacts with Ran1 (Pat1) Kinase To Regulate Cell Cycle
Progression and Meiotic Development

and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
subunit of heterotrimeric G proteins. RACK1 is a highly conserved protein, although its function
remains undefined. In mammalian cells, RACK1 physically associates with
some signal transduction proteins, including Src and protein kinase C. Fission yeast cells containing a cpc2 null allele are
viable but cell cycle delayed. cpc2
cells fail to accumulate in G1 when starved of nitrogen. This leads to
defects in conjugation and meiosis. Copurification studies show that
although Cpc2 and Ran1 (Pat1) physically associate, Cpc2
does not alter Ran1 (Pat1) kinase activity in vitro. Using a Ran1
(Pat1) fusion to green fluorescent protein, we show that localization
of the kinase is impaired in cpc2
cells. Thus, in
parallel with the proposed role of RACK1 in mammalian cells, fission
yeast cpc2 may function as an anchoring protein for Ran1
(Pat1) kinase. All defects associated with loss of cpc2 are
reversed in cells expressing mammalian RACK1, demonstrating that the
fission yeast and mammalian gene products are indeed functional homologues.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
S leu1-32
ura4::fbp-lacZ fbp1::ura4 ade6-M216; SPB93,
h
S leu1-32 cgs1.1 ura4::fbp-lacZ
fbp1::ura4 ade6-M210; SPB173,
h+N; SPB182, h+N ura4-D18
cpc2::ura4; SPB188, h90 leu1-32
ura4-D18 ade6-M210 cpc2::ura4; SPB190,
h90 leu1-32 ura4-D18 cpc2::pCPC2-24;
SPB191, h90 leu1-32 ura4-D18 ade6-M210
mei2ts ran1::pRAN1-90
(ura+); SPB214, h90 leu1-32
ura4-D18 ade6-M216 ran1-114 cpc2::ura4; SPB217,
h90 leu1-32 ade6-M216 ran1-114; SPB273,
h90; SPB307, h90 ura4-D18
cpc2::ura4 mei2-lacZ; SPB317, h90
ura4-D18 cpc2::ura4; SPB318, h90
leu1-32 git2-1; SPB319, h90 ura4-D18 leu1-32
cpc2::ura4 git2::LEU2; SPB320,
h
S leu1-32 ura4::fbp-lacZ
fbp1::ura4 cpc2::ura4 ade6-M216.
gal80
URA3::GAL1-LacZ LYS::GAL1-HIS3
cyhr) was used for two-hybrid assays (12).
Yeast two-hybrid screen.
Plasmids and details of the library
screen were essentially as previously described (12). The
ran1 gene was fused in frame to the GAL4
DNA-binding domain (DBD) in pAS2. Following transformation of this
plasmid into Y190, a Western blot using Ran1 antibodies (23)
was used to verify that the fusion protein was produced intact. A
fission yeast cDNA library fused to the activation domain of
GAL4 in the vector pACT2 (provided by Steve Elledge) was
transformed into the Y190/ran1-DBD strain. The transformants
were selected on plates containing 3-amino triazole (3-AT) at 30°C
for 3 to 4 days. Approximately 106 transformants were
obtained. To eliminate one class of false positives, each library
plasmid was tested to identify those capable of activating the
LacZ reporter gene in the absence of ran1-DBD. ran1-DBD was reintroduced into those candidate strains and
tested for activation of LacZ. Measurement of
-galactosidase activity was accomplished using a permeabilized-cell
assay. A total of 53 colonies were obtained, and DNA was isolated from
each. Limited DNA sequence analysis of each identified 30 clones
representing nine unique open reading frames.
Oligonucleotides. The sequences of the oligonucleotides used in this study are as follows: GB-RKDI, 5'CTTCTTTCCGGTTCTGCAGACGCGTCCATCATTTTGTG3'; GB-RKDII, 5'GGTTGTTTCTGGTTCCGCGGACGCGACCATTAAGATTTG3'; CPC2-Xma, 5'TCTTGTCCCGGGAACCAGAAA3'; CPC2-HIII, 5'CGGTACCTTGAAGCTTTGGGA3'; CPC2-35, 5'CTCGAAGGTCACTCTGGATG3'; CPC2-927C, 5'TACTTGGTAACTTGCCAGACAC3'; CPC2-Nde, 5'TACCATATGACCGATGGTGGTCACTC3'; CPC2-Bam, 5'AGAGGATCCACCATCGGTGATAGTGT3'.
Construction of a Cpc2 null allele.
Oligonucleotides
CPC2-Nde and CPC2-Bam were used in a PCR to obtain the entire
cpc2 cDNA. The linear fragment was cloned into the
commercially obtained TA vector (InVitrogen). Inverse PCR of this
plasmid using primers CPC2-Xma and CPC2-HIII was used to insert
HindIII and XmaI restriction sites into
cpc2. A HindIII-to-XmaI fragment
of ura4 was cloned into the inverse PCR product. A linear DNA fragment containing cpc2 disrupted with ura4
was obtained using primers CPC2-35 and CPC2-927C in a PCR. The linear
fragment was purified using a Qiagen column and used to transform
SPB67. Stable URA+ transformants were identified, and a
Southern blot verified the correct replacement. Sporulation of the
diploid produced the haploid strain SPB188, which contains
cpc2::ura4 (also referred to as cpc2
).
Oligonucleotide mutagenesis. The Cpc2 RKD motifs were mutagenized using oligonucleotides GB-RKDI and GBRKDII. All oligonucleotides were designed with the assistance of the OLIGO software package (National Biosciences Inc., Plymouth, Minn.). The identities of the mutations were confirmed using restriction enzyme analysis.
Expression and purification of recombinant proteins. The plasmids used for expression of recombinant proteins were pRAN1.83 (His-hemagglutinin [HA]-Ran1), pRAN1.87 (His-HA-Ran1K47R), and pSTE11.27 (His-p39ste11). The construction of each and expression in bacteria have been described previously (20). pCPC2.2 was used for expression of His-HA-Cpc2. The soluble portion of bacterial whole-cell extract was incubated with 1.0 ml of Ni2+-nitrilotriacetic acid agarose. The mixture was packed into a column and washed sequentially with 10 column volumes each of wash buffer I (300 mM NaCl, 20 mM HEPES [pH 7.5], 5 mM MgCl2, 10% glycerol), wash buffer II (wash buffer I with 100 mM NaCl), and wash buffer III (wash buffer II plus 20 mM imidazole). Proteins were eluted from the column in wash buffer III containing 100 mM imidazole. Imidazole was removed by dialysis of the purified protein against wash buffer I.
Copurification of GST-tagged proteins from yeast. Plasmids pALT4-GST and pCPC2-24 were constructed to produce HA epitope-tagged glutathione S-transferase (GST) and HA-GST-tagged Cpc2, respectively. The plasmids were transformed into SP66 (wild type) or SPB191. SPB191 contains an integrated plasmid which produces HA-tagged ran1 under control of the nmt1 promoter from plasmid pREP41 (2). The four strains were grown in thiamine-free medium to allow induction of ran1. Pelleted cells were washed in HE buffer (50 mM Tris HCl [pH 8.0], 5 mM EDTA, 1 mM dithiothreitol) and resuspended in 0.5 ml of HE buffer containing 1 mM phenylmethylsulfonyl fluoride. Following addition of sterile glass beads, the cells were broken by vortexing for 15 min at 4°C. Lysates were removed to a fresh tube, and the glass beads were washed in 2.0 ml of RIPA buffer (HE plus 0.1% sodium dodecyl sulfate SDS, 1% Triton X-100, 0.5% deoxycholate). Clarified lysate was obtained by centrifugation at 12,000 × g for 10 min. Protein concentrations were determined using bovine serum albumin as the standard in the Bio-Rad system. Lysate (5 mg) was purified using glutathione-agarose (Sigma). The beads were resuspended in Laemmli sample buffer prior to separation by SDS-7.5 to 15% polyacrylamide gel electrophoresis (PAGE). Western blotting was performed as previously described (20). The primary antibody used for detection of Ran1 was a mixture of R30, R48, and R99 monoclonal antibodies (23) diluted 1:1,000 in 5% dry milk. For detection of HA fusion proteins, a commercially available antibody was used (12CA5; Boehringer Mannheim Biochemicals, Indianapolis, Ind.). Immunoreactive proteins were visualized using the Dupont NEN Research Products chemiluminescence assay kit. Alternatively, the purified proteins were used for a kinase assay. In that case, proteins bound to the agarose beads were washed in RIPA buffer as described above. The beads were resuspended in 50 µl of 1×KAB (50 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 1 mM EDTA, 0.2 mM dithiothreitol) in the final step. Kinase assays utilized 25 µl of bead-bound protein and p39Ste11 as the substrate (20).
Plasmids. Steve Elledge provided hybrid plasmids pAS2 and pACT2 and the fission yeast cDNA library. The entire coding region of ran1 was fused in frame to the DBD of GAL4 as an NdeI-to-BamHI fragment. cpc2 or cpc2 RKD was fused to pACT2 as an NheI-to-BamHI fragment obtained from a pALT4 vector.
The fission yeast expression plasmids used were pALT4 (contains S. pombe ars1, S. cerevisiae LEU2 as a selectable marker, and the adh promoter fused to HA1 sequences), pALT2 (described in reference 24), pALT4GST (to express HA-GST; GST was inserted into pALT4 as an NdeI-to-BamHI fragment), pCPC2.10 (contains cpc2 as an NdeI-to-BamHI fragment in pALT2), HA-GST-Ran1 (The GST coding sequence was cloned into a yeast expression vector as an NdeI-to-NheI fragment. This allows the insertion of any gene in frame into GST as an NdeI-to-BamHI fragment), pRAN1.81 (expression of ran1 using the adh1 promoter [41]), pRAN1.90 (integrative plasmid constructed to express HA-tagged Ran1 from an inducible nmt promoter derived from pREP41 [2]), pRAN1.95 (expression of GST-HA1-Ran1 from the nmt promoter derived from pREP42 [2]), pCPC2.24 (expression of GST-HA1-Cpc2 using the adh promoter), and pCPC2.2 (expression of HA-CPC2 in bacterial expression vector pET15B [NovoLabs]). Exact details of plasmid constructions are available on request.Flow cytometry.
Either wild-type (SPB173) or
cpc2
(SPB182) cells were grown to 107/ml and
then shifted to medium lacking nitrogen for the designated times. Cells
were fixed and stained with propidium iodide as previously described
(1). DNA fluorescence was measured using a FACScan (Becton Dickinson).
Measurement of
-galactosidase activity.
Total cell
extract was prepared from cells containing a mei2-lacZ gene
after they attained a density of 107/ml. A 20-µg protein
sample was used to assay
-galactosidase activity (1).
Activity is expressed as A420 × 1.7/0.0045 × protein (micrograms) × volume × time.
fbp1-lacZ activity was measured in 107
permeabilized cells.
Measurement of viability in stationary phase. Cells were grown to 108/ml at 30°C. At this time (day 0) and each day thereafter (days 1 to 4), a portion of the cells was removed and stained with FUN-1 (Molecular Probes, Eugene, Oreg.) as previously described (25, 53). Cells were immediately examined under a microscope. Viable cells contained red intravacuolar structures, and nonviable cells stained yellow-green.
| |
RESULTS |
|---|
|
|
|---|
Isolation of cpc2 using a two-hybrid library
screen.
A fission yeast cDNA library was screened by two-hybrid
analysis using ran1-DBD) as bait. Approximately
106 colonies were obtained following cotransformation of
ran1-DBD and the library plasmids into yeast. Plasmid
inserts from LacZ-positive transformants were sequenced, and
one of these, cpc2, is the subject of this paper.
cpc2 was chosen for analysis because the predicted protein
has regions of homology with other proteins known to directly interact
with Ran1 (see below). The interaction between Ran1 and Cpc2 was
quantitatively assessed in the two-hybrid system using S. cerevisiae strain Y190. This strain contains a LacZ
reporter gene controlled by the upstream activating sequence of
GAL4. We observed that Cpc2 paired with Ran1 produced
sixfold higher
-galactosidase activity than Ran1 paired with the
ACT2 vector. This interaction is comparable to, but not quite as strong
as, the interaction between Ran1 and Ste11, a transcription factor that
directly associates with Ran1 (Fig. 1A
and reference 20).
|
subunit (41),
mammalian RACK1 (37), S. cerevisiae Cpc2p
(15), and N. crassa Cpc2 (28). The
fission yeast protein is 64% identical to the mammalian RACK1 protein.
The overall level of homology between the two proteins is 77% (Fig.
1C). In spite of the high level of conservation between members of this
family, the function of RACK1 proteins is not well understood. Rat
RACK1 was initially isolated as a PKC-binding protein (37).
Recent reports indicate that RACK1 associates with other signal
transduction proteins, including cAMP phosphodiesterase 4D5
(52), Src (5), and
-integrin (21).
Ran1 and Cpc2 associate in cell lysates.
The presence of RKD
sequences in Cpc2 indicates that if, in fact, Ran1 and Cpc2 are
associated, the interaction may be direct. To determine if the two
polypeptides are physically connected, we assayed cell lysates for
copurification of Ran1 and Cpc2. To accomplish this, cells were
transformed with plasmids expressing GST, Cpc2 fused to GST (GST-Cpc2),
or Ran1. To permit immunological detection, all proteins were also
tagged with HA1 sequences. Soluble proteins were prepared from cells
expressing the fusion proteins either individually or in pairs. An
immunoblot developed with anti-HA1 antibodies was used to examine the
steady-state level of each fusion protein (Fig.
2A). Since Ran1 and GST-Cpc2 migrate close to one another, the immunoblot was also developed using anti-Ran1
antibodies (Fig. 2B). These experiments allowed unequivocal identification of Ran1 and GST-Cpc2 and verified that the proteins were
intact. Partial purification of GST fusion proteins was accomplished on
glutathione beads. Bead-bound proteins were separated by SDS-PAGE and
analyzed in an immunoblot using anti-HA1 antibodies (Fig. 2C) or
anti-Ran1 antibodies (Fig. 2D). This experiment showed that Ran1 does
not inherently bind glutathione beads or copurify with GST (Fig. 2C and
D, lane 3). In contrast, Ran1 was present in partially purified
complexes containing GST-Cpc2 (Fig. 2C and D, lane 4).
|
Loss of cpc2 causes pleiotropic cell cycle defects.
Because
two independent assays indicate that Ran1 and Cpc2 physically
associate, we examined cells for a functional connection between the
two proteins. To accomplish this, a cpc2 null allele was
constructed. A portion of the predicted cpc2 open reading frame was deleted and replaced with the ura4 gene to form
cpc2::ura4. A linear DNA fragment containing
cpc2::ura4 was transformed into diploid cells
(SPB67). Stable URA4+ transformants were analyzed using a
Southern blot to identify a simple replacement of cpc2 (data
not shown). One representative diploid was chosen for further analysis.
The cells were allowed to undergo meiosis, and spores were collected.
Random spore analysis showed that URA+ and
URA
cells were equally represented. This result indicates
that cpc2 is not an essential gene. During this analysis, it
was noted that cpc2
cells formed small colonies compared
to wild-type cells (Fig. 3A). Microscopic
examination of the cells showed that they were elongated, a phenotype
observed in cells producing activated Ran1 and a hallmark of mitotic
delay (Fig. 3B). To examine the role of cpc2 in division,
cell growth was monitored. This experiment revealed that
cpc2
doubled in 3.0 h, as did wild-type cells (Fig. 3C). Thus, loss of cpc2 allows cells to grow normally but
delays cell division. In this and other experiments, it was noted that cpc2
cells consistently ceased dividing at a two- to
fourfold lower density than wild-type cells. These phenotypes are
associated with loss of cpc2 because expression of
cpc2 cDNA completely restores the wild-type phenotype (Fig.
3A and data not shown). Next, we examined the fate of cells exiting the
cell cycle.
|
cells to conjugate and
sporulate was compared to that of wild-type cells. Following 3 days of
growth on minimal medium, nearly 55% of the wild-type cells had either conjugated or sporulated. In contrast, only 10.7% of the
cpc2
cells had undergone sexual differentiation. After 4 days, 89% of the wild-type cells had differentiated, compared to
53.4% of the cpc2
cells (Fig. 3D). Thus, loss of
cpc2 does not prevent conjugation and sporulation but
substantially delays these events. Next, we examined cells for the
ability to accumulate in G1 in response to nitrogen
limitation. Cells were transferred to nitrogen-free medium, and the DNA
content of individual cells was monitored using flow cytometry. At
6 h following the nutritional shift, 60% of the wild-type cells
had a G1 DNA content and at 8 h, 90% of the cells
were in G1. In contrast, most (95%) cpc2
cells exhibited a G2 DNA content after incubation in
nitrogen-free medium for 6 h. At 8 h, only 20% of the
cpc2
cells were observed to be in G1 (Fig.
3E). The wild-type cell number increased 2.5-fold 6 h following
the nutritional shift. In contrast, the cpc2
cell number increased 1.5-fold. Thus, the failure of cpc2
cells to
accumulate in G1 is most likely due to an inability to
advance into mitosis when nitrogen is limiting.
The exact phenotypes observed in cpc2
cells have not, to
the best of our knowledge, been described for any other mutant. However, some (such as mitotic delay and decreased conjugation and
sporulation) are observed in cells with defects in the stress-activated MAP kinase pathway (see references 41, 42, and
44, for example). However, unlike loss of the
spc1 MAP kinase, loss of cpc2 does not prevent
growth on medium containing 1.4 M sorbitol or 0.9 M KCl. Nor are
cpc2 cells sensitive to hydrogen peroxide, cycloheximide, or
staurosporine (data not shown). Thus, cpc2
cells display
only a limited subset of phenotypes associated with the
stress-activated MAP kinase pathway. We did observe that
cpc2
cells are more sensitive to high temperature
compared with wild-type cells (Fig. 3F). In view of this observation,
we tested cells producing high levels of Ran1 for the ability to grow
at 37°C. Like cpc2
, ran1OP cells exhibit
temperature-dependent synthetic lethality. In contrast, cells producing
high levels of an inactive version of the kinase, ran1K47ROP cells, grow as well as wild-type
cells at 37°C (Fig. 3F).
cpc2 functions independently of the PKA pathway.
Cell cycle delay, failure to differentiate, and stationary-phase
defects are phenotypes associated with activation of the cAMP-dependent
protein kinase (PKA) pathway (3, 8, 9, 26). This, and the
observation that RACK1 interacts with cAMP phosphodiesterase in
mammalian cells (52), led us to test the hypothesis that
cpc2 downregulates cAMP levels. In fission yeast, alteration
of cAMP levels or of PKA activity causes pleiotropic defects.
Transcription of genes regulated by nitrogen or glucose availability is
impaired when cAMP levels are altered. The fructose-1,6-bisphosphatase gene (fbp1) is repressed in glucose-grown cells. Shifting
the cells to glycerol-containing medium leads to derepression of
fbp1 (14, 17). Addition of cAMP to cells
(13) or mutations that increase PKA activity repress
fbp1 transcription, even following a shift to glycerol
medium. We used cells containing an fbp1-lacZ reporter gene
to examine glucose repression in cpc2
cells. Either wild-type, cgs1
(cgs1 encodes the regulatory
subunit of PKA), or cpc2
cells were shifted from glucose-
to glycerol-containing medium. cgs1 cells fail to derepress
the fusion gene immediately following the shift to glycerol (Fig.
4A and reference 50). In contrast, fbp1-lacZ expression in both wild-type and
cpc2
cells increased to the same extent within 3 h
of the nutritional shift and reached maximal expression at 6 h
(Fig. 4A). Thus, cpc2 does not perform a major function in
cAMP-regulated transcription of glucose-sensitive genes.
|
cells express no detectable
mei2-lacZ following nitrogen starvation (9). In
contrast, an increase in mei2-lacZ expression was observed 3 h following the shift of either wild-type or cpc2
cells to nitrogen-free medium. Accumulation of
-galactosidase
activity continued in both samples until the experiment was terminated at 9 h.
-Galactosidase activity was lower in cpc2
cells than in wild-type cells. This decrease may reflect a difference
in cAMP levels. Alternatively, it may be due to the inability to inactivate Ran1 in cpc2
cells. Recently, we determined
that mei2 expression is regulated by Ran1 activity, as well
as by cAMP levels (J. Qin and M. McLeod, unpublished data).
cAMP levels also regulate sexual differentiation and survival in
stationary phase (9). Formally, the possibility remains that
cpc2 functions to repress cAMP levels, but only to the
extent that cell cycle events, and not nutrient-regulated
transcription, are altered. The ability of cpc2
cells to
survive stationary-phase conditions was examined. As shown previously
(9) and in Fig. 4C, cgs1
cells die after 3 days at G0. At day 4, less than 0.3% of the cells are
viable. Conversely, cpc2
and wild-type cells survived
equally well at G0. Next, we determined if the sexual differentiation defect observed in cpc2
cells results
from a failure to downregulate cAMP levels. The git2
(cyr1) gene encodes adenylate cyclase, and cells containing
a loss-of-function git2 allele have no measurable cAMP
(14, 22). Conjugation and sporulation of
H90 git2 cells are accelerated relative to those
of wild-type cells. If conjugation and meiosis are delayed in
cpc2
cells because cAMP levels cannot be downregulated,
then git2 cells ought to be insensitive to cpc2
function. The ability of git2 cells to conjugate and
sporulate was compared with that of git2 cpc2 cells. This
experiment revealed that conditions permitting 60% of the git2 cells to conjugate or sporulate allowed only 8.0% of
the git2 cpc2 cells to differentiate (Fig. 4D). Taken
together, the above-described experiments indicate that cpc2
is not a central regulator of cAMP levels.
Genetic interactions between Ran1 and Cpc2.
If cpc2
and ran1 function on the same genetic pathway,
cpc2 could potentially function as an upstream regulator or
a downstream effector for the kinase. An epistasis test was used to
discriminate between these possibilities. Cells containing the
ran1-114 allele undergo haploid sporulation when the cells
are incubated under restrictive conditions. Loss of cpc2
does not abolish conjugation and meiosis but retards the process (Fig.
3D). Conditions that partially inactivate ran1-114 were used
to determine if the sporulation rate of ran1 cells is
dependent on cpc2. We observed that neither wild-type cells
nor cpc2
cells sporulated to a significant level after
20 h on malt extract medium at 30°C. At that time, 80% of the
ran1-114 cells contained spores. Importantly,
ran1-114 sporulation was only partially independent of
cpc2. Inactivation of ran1 reversed the
differentiation defect caused by loss of cpc2, but
sporulation was accelerated if cells contained a functional
cpc2 allele (Fig. 5A). We
infer from this result that loss of cpc2 enhances
ran1 residual activity. Since inactivation of
ran1 allows cpc2
cells to regain a function,
then cpc2 is most likely upstream of ran1 if, in
fact, they are on the same pathway.
|
cells, caused an additive phenotype (Fig. 5B).
Specifically, growth of ranOP cpc2
cells was retarded
compared to that of cpc2 cells transformed with an empty
vector (Fig. 5B). Microscopic examination of the cells revealed that
they were highly elongated (data not shown). In comparison, expression
of Ran1 in wild-type cells caused far less severe defects in colony
formation and cell length. Similar results were obtained if
ran1 was expressed using either the adh or the
nmt1 promoter. One interpretation of these data is that Ran1
and Cpc2 act in opposition on independent pathways. However, since the
epistasis test indicates a role for cpc2 as a regulator of
ran1, we favor the hypothesis that the exaggerated Ran1
phenotypes observed when Ran1 is expressed in cpc2
cells
result from increased Ran1 activity that would be constrained by Cpc2
if it were present. With regard to the experiments showing that
high-level production of cpc2 causes no observable
phenotypes, we suggest the presence of an as yet unidentified activator
for Cpc2 or perhaps a structural role for the protein.
Cpc2 allows nuclear accumulation of Ran1.
Mammalian RACK1 is
believed to regulate PKC function by serving as an anchoring protein
for the activated kinase (37). Thus, the cellular
localization of Ran1 in wild-type and cpc2
cells was
examined. For these experiments, Ran1 was fused to GFP and expressed
under control of the nmt1 promoter. Induction of the fusion
protein was accomplished by removal of thiamine from the medium. A
detectable GFP signal was first noted 7 h following induction, and
the signal was concentrated in the nucleus (Fig. 6A and reference 47).
Early nuclear concentration of Ran1 was independent of cpc2.
At 12 h following induction, a striking difference in the cellular
distribution of Ran1-GFP became evident. Ran1-GFP displayed a
prominent, punctate cytoplasmic staining in cpc2
cells
that was not observed in wild-type cells. In addition, the fusion
protein did not accumulate to high levels in the nucleus in the absence
of cpc2 (Fig. 6A and data not shown). The pattern is
specific for Ran1-GFP because it was not observed for the other nuclear
proteins tested, such as Ste11-GFP and Mei3-GFP, or for GFP alone (data
not shown). The level of Ran1-GFP in the cells was examined in an
immunoblot. This experiment showed that the fusion protein had the
predicted molecular weight and that the steady-state level of Ran1-GFP
in cpc2
cells was comparable to that in wild-type cells
(Fig. 6B).
|
Cpc2 does not alter Ran1 activity in vitro.
One hypothesis
consistent with the results obtained to this point is that
cpc2 functions upstream of ran1 and negatively
regulates its activity. The mechanism employed by Cpc2 to inactivate
Ran1 was further investigated. An in vitro kinase assay was used to measure Ran1 activity in partially purified yeast lysates to determine if Cpc2 inhibits Ran1 substrate phosphorylation. Ran1 was expressed as
a GST fusion protein in wild-type cells, cpc2
cells, or
cells expressing high levels of cpc2. Affinity-purified Ran1
was incubated with p39ste11 as the substrate and
radioactive ATP (Fig. 7A). This
experiment revealed that Ran1 substrate phosphorylation was unaltered
by Cpc2. To more accurately quantitate the effect of Cpc2 on Ran1, both
proteins were expressed in and purified from bacteria.
(HIS)6-tagged Cpc2 was purified by Ni2+
affinity chromatography, and increasing amounts of Cpc2 were added to
(HIS)6-Ran1 in an in vitro kinase assay (Fig. 7B). This analysis showed that addition of Cpc2 had no effect on Ran1 substrate phosphorylation. Thus, Cpc2 does not inhibit Ran1 activity under these
conditions. As shown in Fig. 1B, Cpc2 contains serine and threonine
residues (Ser-39 and Thr-128) at positions corresponding to the
phosphoacceptor serine and threonine residues in Ste11 (20).
However, the in vitro kinase assays also demonstrate that Cpc2 is not
likely to function as a substrate for Ran1 (data not shown).
|
Mammalian RACK1 is a functional homologue of the fission yeast
gene.
We wished to determine if Cpc2 and mammalian RACK1 are
functional, as well as structural, homologues. Recently, it was shown that N. crassa cpc-2 is a functional homologue of the
S. cerevisiae CPC2 gene (15). To investigate
this, rat RACK1 (which is identical to the human protein) was expressed
in yeast under control of the adh promoter. This plasmid was
introduced into a cpc2
strain. As controls, the cells
were transformed with the vector alone or with a plasmid expressing
fission yeast cpc2. Individual transformants were examined
in several assays (Fig. 8). As previously
observed, loss of cpc2 caused temperature-sensitive growth.
Additionally, cpc2
cells formed small colonies compared
to wild-type cells. Expression of mammalian RACK1 reversed both defects
as efficiently as yeast cpc2. The transformants were also
examined to determine if the mammalian gene was able to reverse the
cpc2
sexual differentiation defect. For this assay, cells
were plated on minimal medium for 2 days and stained with iodine vapor
to observe spore-containing cells. Both yeast cpc2 and
mammalian RACK1 restored the ability of cpc2
cells to
sporulate. This experiment provides evidence that mammalian RACK1 is a
structural and functional homologue of fission yeast cpc2.
|
| |
DISCUSSION |
|---|
|
|
|---|
Ran1 is a key regulator of the developmental switch between
mitotic cell growth and meiosis. Activation of Ran1 inhibits sexual differentiation (23), while inactivation of the kinase
initiates G1 arrest, conjugation, and meiosis (3, 16,
17, 32). We screened a fission yeast library using a two-hybrid
interaction assay to identify protein partners for Ran1. Here, we
describe one of these, the product of the cpc2 gene. Fission
yeast Cpc2 is a structural and functional homologue of mammalian RACK1
proteins. RACK1 was initially isolated as a
PKC-binding protein. It
is hypothesized to function as an anchoring protein for activated
PKC to enable access of the kinase to physiologically important substrates. Evidence is presented that Cpc2 interacts with Ran1. Analysis of cells containing the cpc2 null allele indicates
that it is important for cell cycle progression, as well as efficient conjugation and meiosis. Cpc2 may regulate Ran1 activity by controlling cellular localization of the kinase.
The interaction between Ran1 and Cpc2 is specific and may be
direct.
Three lines of evidence obtained using different
experimental approaches indicate that Ran1 and Cpc2 interact. Firstly,
Cpc2 was identified as a Ran1-interacting protein in a two-hybrid
library screen. In support of this finding, we found Ran1 and Cpc2
physically associated in cell extracts. Cpc2 contains two regions that
resemble a motif (known as RKD) previously identified in both the Ste11 substrate and the Mei3 inhibitor of Ran1. Thus, the interaction between
Ran1 and Cpc2 may be mediated by the RKD-like sequences of
Cpc2. Mutagenesis of specific residues in both Cpc2 RKD
regions diminishes the interaction observed in the two-hybrid assay.
One interpretation of this observation is that the RKD regions mediate Cpc2 interaction with Ran1. However, it can be argued that the mutations, which are in conserved regions of the protein, are required
for functional folding of the protein. In that case, failure of the
polypeptide to interact with Ran1 could be a general consequence of
misfolding. We favor the former interpretation. Expression of Cpc2 RKD
on a plasmid in cpc2
cells causes partial suppression of
cpc2-associated defects (data not shown). This suggests that
cpc2 RKD is a weak but functional, allele, perhaps producing
a product with reduced affinity for Ran1. High-level expression of the
altered protein may compensate for an affinity defect but is less
likely to restore a function lost because of incorrect folding.
is reversed by inactivation of ran1. These observations are consistent with
the hypothesis that Cpc2 negatively regulates Ran1 activity.
What, then, is the function of Cpc2? Ran1 associated with Cpc2 does not
exhibit altered kinase activity in vitro, even though a wide range of
Cpc2 concentrations was tested. If, as suggested by the two-hybrid
results presented in Fig. 1, the Cpc2 RKD regions contribute to its
association with the kinase, then Cpc2 is expected to be a competitive
inhibitor of Ran1 substrate phosphorylation. Further biochemical
experiments are required to examine the role of Cpc2 as an inhibitor.
However, in vivo data suggest that Cpc2 does not function simply as a
competitive inhibitor of Ran1. Cells producing high levels of Ran1 are
sterile, and this defect can be reversed by expression of Ste11
(20) but not by expression of Cpc2. Moreover, the
differentiation defect of cpc2
cells is not reversed by
expression of Ste11 (B. Shor and M. McLeod, unpublished data). These
results suggest either that Cpc2 has a more extensive role in meiosis
than as a competitive inhibitor of Ran1 or that another component is
required for Cpc2 to function.
The interaction between RACK1 and PKC regulates the cellular
localization of activated PKC. Our data suggest that Cpc2 may regulate
Ran1, not by altering the catalytic activity of the kinase but by
influencing its subcellular localization. As shown in Fig. 6,
cpc2
cells accumulate Ran1-GFP as bright dots in the
cytoplasm with little nuclear concentration of the fusion protein. Both phenomena are absent in cells containing functional Cpc2. This result
is specific to Ran1-GFP and is unlikely to be an insignificant artifact
of the expression system. No other genetic backgrounds tested alter
Ran1 localization. The mechanism used to localize Ran1 is not clear.
Cpc2 could function as an anchoring protein to dock the kinase to a
site proximal to substrates or regulators. In favor of this hypothesis,
Cpc2 structurally resembles the
subunit of heterotrimeric G
proteins. The 
subunits of heterotrimeric G proteins have
recently been shown to function as anchoring molecules for protein
kinases (4, 34). Alternatively, it is possible that Cpc2
participates in a posttranslational processing event required to
control the regional concentration of Ran1. There is evidence that, in
addition to a RACK1-binding site, PKC contains a pseudoanchoring site
that resembles sequences in RACK1. The binding site and the
pseudoanchoring site associate in an intramolecular reaction. In this
conformation,
PKC must be activated by phosphatidylserine, diacylglycerol, and calcium to function as a kinase. Upon activation, the RACK1-binding region is liberated from the pseudoanchoring site and
becomes available to bind RACK1. In this conformation, the kinase
becomes independent of its normal activators and translocates to
membranes (38). We have not identified a pseudo-Cpc2 region in the Ran1 polypeptide, although one may exist. However, the phenotype
of cells devoid of Cpc2 is intriguing in light of the RACK1 model.
cpc2 is not absolutely required for development but determines both the timing and extent of meiotic differentiation. If
Cpc2, like RACK1, can stabilize Ran1 in an intermediate state of
activation, the kinase may no longer be responsive to minor signal
fluctuations. Loss of a stabilizer ought not to prevent the execution
of an event but may influence its progression.
Structural and functional conservation of Cpc2.
One of the
most significant findings presented here is the identification of a
structurally and functionally conserved RACK1 homologue as a partner
for a kinase. It is somewhat surprising to identify the highly
conserved RACK1 protein interacting with a protein that does not appear
to have a structural counterpart in other organisms. The closest
relative to Ran1 in budding yeast is Sks1p. The two proteins share 52%
homology, and this is limited to their kinase domains. Conversely, the
PKA pathway is conserved from yeast to mammals. As reported here, the
phenotypes of cells containing cpc
resemble those caused
by high cAMP levels. These observations, and the finding that RACK1
interacts with a mammalian phosphodiesterase, provide a rationale for
the hypothesis that Cpc2 regulates cAMP levels in yeast. However, our
studies failed to identify a connection between Cpc2 and the PKA
pathway. We also investigated phenotypes associated with loss of the
two identified fission yeast PKC genes to search for PKC interaction
with Cpc2 (Shor and McLeod, unpublished data). To date, no interaction
has been demonstrated in yeast. The interaction between RACK1 proteins and specific signal transduction pathways may vary depending on the
particular cell type examined or the signal to which the cell is
responding. However, one common theme emerging from studies of Cpc2
(RACK1) in diverse systems is that Cpc2 (RACK1) alters cell cycle
progression and, in particular, may augment exit from the mitotic cell
cycle into either G0 or a differentiation pathway. S. pombe cpc2
cells are cell cycle delayed and slow to respond to
signals that induce G1 arrest. In NIH 3T3 cells, expression of RACK1 causes a G1/G0 delay, as well as a
reduced growth rate (5). Budding yeast cells devoid of
CPC2 enter G0 prematurely (15). Both
S. pombe and N. crassa devoid of cpc-2
exhibit fertility defects (28). On the other hand, RACK1
specifically associates with the integrin
subunit in lymphoblastoid
cells (21), suggesting that some integrin signaling pathways
function through a RACK1-PKC pathway. Notably, yeast cells appear to
lack integrins. Recent evidence indicates that RACK1 binds pleckstrin
homology domains from some proteins. The authors speculate that RACK1
scaffolding proteins are multivalent organizers that coordinate complex
signaling systems (35). With this intriguing observation in
mind, further genetic analysis is under way to identify other potential
partners for Cpc2.
| |
ACKNOWLEDGMENTS |
|---|
We thank Daria Mochly-Rosen for her gift of the rat RACK1-encoding gene. We are grateful to Steve Elledge for his generous gift of plasmids and a fission yeast cDNA library constructed in pACT2. We thank Kinsey Maundrell and Susan Forsburg for supplying plasmids containing the nmt1 promoter. Charles Hoffman, Takashi Toda, and Dallan Young generously supplied strains used for this study. We are grateful to Betty Leung for technical expertise supplied at many stages of the work.
A National Science Foundation Career Advancement Award to M.M.; the American Heart Association, NYC; and National Institutes of Health grant NIH-R01 GM565875 supported this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: State University of New York Health Science Center at Brooklyn, Department of Microbiology and Immunology, Morse Institute for Molecular Biology and Genetics, Brooklyn, NY 11203. Phone: (718) 270-3321. Fax: (718) 270-2656. E-mail: mmcleod{at}netmail.hscbklyn.edu.
Present address: Department of Obstetrics and Gynecology, New York
University School of Medicine, New York, NY 10012.
Present address: Department of Biological Sciences, The Johns
Hopkins University School of Medicine, Baltimore, MD 21205.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alfa, C., P. Fantes, J. Hyams, M. McLeod, and E. Warbrick. 1993. Experiments with fission yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 2. | Basi, G., E. Schmid, and K. Maundrell. 1993. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123:131-136[CrossRef][Medline]. |
| 3. | Beach, D., L. Rodgers, and J. Gould. 1985. ran1+ controls the transition from mitotic division to meiosis in fission yeast. Curr. Genet. 10:297-311[CrossRef][Medline]. |
| 4. |
Bell, B.,
H. Xing,
K. Yan,
N. Gautam, and A. J. Muslin.
1999.
KSR-1 binds to G-protein ![]() subunits and inhibits ![]() -induced mitogen-activated protein kinase activation.
J. Biol. Chem.
274:7982-7986 |
| 5. |
Chang, B. Y.,
K. B. Conroy,
E. M. Machleder, and C. A. Cartwright.
1998.
RACK1, a receptor for activated C kinase and a homolog of the subunit of G proteins, inhibits activity of Src tyrosine kinases and growth of NIH 3T3 cells.
Mol. Cell. Biol.
18:3245-3256 |
| 6. | Costello, G., L. Rodgers, and D. Beach. 1986. Fission yeast enters the stationary phase G0 state from either mitotic G1 or G2. Curr. Genet. 11:119-125. |
| 7. | Davey, J. 1998. Fusion of a fission yeast. Yeast 14:1529-1566[CrossRef][Medline]. |
| 8. | Davey, J., and O. Nielsen. 1994. Mutations in cyr1 and pat1 reveal pheromone-induced G1 arrest in the fission yeast Schizosaccharomyces pombe. Curr. Genet. 26:105-112[CrossRef][Medline]. |
| 9. | DeVoti, J., G. Seydoux, D. Beach, and M. McLeod. 1991. Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline]. |
| 10. | Egel, R. 1973. Commitment to meiosis in fission yeast. Mol. Gen. Genet. 121:277-284[CrossRef]. |
| 11. | Egel, R., and M. Egel-Mitani. 1974. Premeiotic DNA synthesis in fission yeast. Exp. Cell Res. 88:127-134[CrossRef][Medline]. |
| 12. | Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[CrossRef][Medline]. |
| 13. |
Hoffman, C. S., and F. Winston.
1991.
Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway.
Genes Dev.
5:561-571 |
| 14. | Hoffman, C. S., and F. Winston. 1989. A transcriptionally regulated expression vector for the fission yeast Schizosaccharomyces pombe. Gene 84:473-479[CrossRef][Medline]. |
| 15. | Hoffmann, B., H. U. Mosch, E. Sattlegger, I. B. Barthelmess, A. Hinnebusch, and G. H. Braus. 1999. The WD protein Cpc2p is required for repression of Gcn4 protein activity in yeast in the absence of amino-acid starvation. Mol. Microbiol. 31:807-822[CrossRef][Medline]. |
| 16. | Iino, Y., and M. Yamamoto. 1985. Mutants of Schizosaccharomyces pombe which sporulate in the haploid state. Mol. Gen. Genet. 198:416-421[CrossRef]. |
| 17. |
Iino, Y., and M. Yamamoto.
1985.
Negative control for the initiation of meisois in Schizosaccharomyces pombe.
Proc. Natl. Acad. Sci. USA
82:2447-2451 |
| 18. |
Imai, Y., and M. Yamamoto.
1994.
The fission yeast mating pheromone P-factor: its molecular structure, gene structure, and ability to induce gene expression and G1 arrest in the mating partner.
Genes Dev.
8:328-338 |
| 19. | Kelly, M., J. Burke, M. Smith, A. Klar, and D. Beach. 1988. Four mating-type genes control sexual differentiation in the fission yeast. EMBO J. 7:1537-1547[Medline]. |
| 20. | Li, P., and M. McLeod. 1996. Molecular mimicry in development: identification of ste11+ as a substrate and mei3+ as a pseudosubstrate inhibitor of ran1+ kinase. Cell 87:869-880[CrossRef][Medline]. |
| 21. |
Liliental, J., and D. D. Chang.
1998.
Rack1, a receptor for activated protein kinase C, interacts with integrin subunit.
J. Biol. Chem.
273:2379-2383 |
| 22. |
Maeda, T.,
N. Mochizuki, and M. Yamamoto.
1990.
Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.
Proc. Natl. Acad. Sci. USA
87:7814-7818 |
| 23. | McLeod, M., and D. Beach. 1988. A specific inhibitor of the ran1+ protein kinase regulates entry into meiosis in Schizosaccharomyces pombe. Nature 332:509-514[CrossRef][Medline]. |
| 24. | McLeod, M., M. Stein, and D. Beach. 1987. The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline]. |
| 25. | Millard, P. J., B. L. Roth, H. P. Thi, S. T. Yue, and R. P. Haugland. 1997. Development of the FUN-1 family of fluorescent probes for vacuole labeling and viability testing of yeasts. Appl. Environ. Microbiol. 63:2897-2905[Abstract]. |
| 26. | Mochizuki, N., and M. Yamamoto. 1992. Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24[CrossRef][Medline]. |
| 27. |
Mochly-Rosen, D.,
H. Khaner,
J. Lopez, and B. L. Smith.
1991.
Intracellular receptors for activated protein kinase C. Identification of a binding site for the enzyme.
J. Biol. Chem.
266:14866-14868 |
| 28. | Muller, F., D. Kruger, E. Sattlegger, B. Hoffmann, P. Ballario, M. Kanaan, and I. B. Barthelmess. 1995. The cpc-2 gene of Neurospora crassa encodes a protein entirely composed of WD-repeat segments that is involved in general amino acid control and female fertility. Mol. Gen. Genet. 248:162-173[CrossRef][Medline]. |
| 29. | Neer, E. J., C. J. Schmidt, R. Nambudripad, and T. F. Smith. 1994. The ancient regulatory-protein family of WD-repeat proteins. Nature 371:297-300[CrossRef][Medline]. |
| 30. | Neer, E. J., T. F. Smith, E. J. Neer, and T. F. Smith. 1996. G protein heterodimers: new structures propel new questions. Cell 84:175-178[CrossRef][Medline]. |
| 31. | Nielsen, O., J. Davey, and R. Egel. 1992. The ras1 function of Schizosaccharomyces pombe mediates pheromone-induced transcription. EMBO J. 11:1391-1395[Medline]. |
| 32. | Nurse, P. 1985. Mutants of the fission yeast Schizosaccharomyces pombe which alter the shift between cell proliferation and sporulation. Mol. Gen. Genet. 198:497-502[CrossRef]. |
| 33. | Nurse, P., and Y. Bissett. 1981. Gene required in G1 for commitment to cell cycle and in G2 for control of mitosis in fission yeast. Nature 292:558-560[CrossRef][Medline]. |
| 34. |
Pitcher, J. A.,
J. Inglese,
J. B. Higgins,
J. L. Arriza,
P. J. Casey,
C. Kim,
J. L. Benovic,
M. M. Kwatra,
M. G. Caron, and R. J. Lefkowitz.
1992.
Role of ![]() subunits of G proteins in targeting the -adrenergic receptor kinase to membrane-bound receptors.
Science
257:1264-1267 |
| 35. | Rodriguez, M. M., C. H. Chen, B. L. Smith, and D. Mochly-Rosen. 1999. Characterization of the binding and phosphorylation of cardiac calsequestrin by epsilon protein kinase C. FEBS Lett. 454:240-246[CrossRef][Medline]. |
| 36. |
Ron, D.,
C. H. Chen,
J. Caldwell,
L. Jamieson,
E. Orr, and D. Mochly-Rosen.
1994.
Cloning of an intracellular receptor for protein kinase C: a homolog of the subunit of G proteins.
Proc. Natl. Acad. Sci. USA
91:839-843 |
| 37. |
Ron, D., and D. Mochly-Rosen.
1994.
Agonists and antagonists of protein kinase C function, derived from its binding proteins.
J. Biol. Chem.
269:21395-21398 |
| 38. |
Ron, D., and D. Mochly-Rosen.
1995.
An autoregulatory region in protein kinase C: the pseudoanchoring site.
Proc. Natl. Acad. Sci. USA
92:492-496 |
| 39. |
Russell, P. R., and B. D. Hall.
1983.
The primary structure of the alcohol dehydrogenase gene from the fission yeast Schizosaccharomyces pombe.
J. Biol. Chem.
258:143-149 |
| 40. |
Shan, X.,
H. Luo,
B. Houle, and J. Wu.
1994.
Expression of a G-protein beta subunit-related gene during lymphocyte activation.
Int. Immunol.
6:739-749 |
| 41. |
Shiozaki, K., and P. Russell.
1996.
Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast.
Genes Dev.
10:2276-2288 |
| 42. | Stettler, S., E. Warbrick, S. Prochnik, S. Mackie, and P. Fantes. 1996. The wis1 signal transduction pathway is required for expression of cAMP-repressed genes in fission yeast. J. Cell Sci. 109:1927-1935[Abstract]. |
| 43. |
Sugimoto, A.,
Y. Iino,
T. Maeda,
Y. Watanabe, and M. Yamamoto.
1991.
Schizosaccharomyces pombe ste11+ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development.
Genes Dev.
5:1990-1999 |
| 44. |
Toone, W. M.,
S. Kuge,
M. Samuels,
B. A. Morgan,
T. Toda, and N. Jones.
1998.
Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (exportin) and the stress-activated MAP kinase Sty1/Spc1.
Genes Dev.
12:1453-1463 |
| 45. |
Van Heeckeren, W. J.,
D. R. Dorris, and K. Struhl.
1998.
The mating-type proteins of fission yeast induce meiosis by directly activating mei3 transcription.
Mol. Cell. Biol.
18:7317-7326 |
| 46. |
Vassarotti, A., and J. D. Friesen.
1985.
Isolation of the fructose-1,6-bisphosphatase gene of the yeast Schizosaccharomyces pombe. Evidence for transcriptional regulation.
J. Biol. Chem.
260:6348-6353 |
| 47. |
Wang, W.,
P. Li,
A. Schettino,
Z. Peng, and M. McLeod.
1998.
Characterization of functional regions in the Schizosaccharomyces pombe mei3 developmental activator.
Genetics
150:1007-1018 |
| 48. | Watanabe, Y., S. Shinozaki-Yabana, Y. Chikashige, Y. Hiraoka, and M. Yamamoto. 1997. Phosphorylation of RNA-binding protein controls cell cycle switch from mitotic to meiotic in fission yeast. Nature 386:187-190[CrossRef][Medline]. |
| 49. | Willer, M., L. Hoffmann, U. Styrkársdóttir, R. Egel, J. Davey, and O. Nielsen. 1995. Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe. Mol. Cell. Biol. 15:4964-4970[Abstract]. |
| 50. | Wu, S.-Y., and M. McLeod. 1995. The sak1+ gene of Schizosaccharomyces pombe encodes an RFX family DNA-binding protein that positively regulates cyclic AMP-dependent protein kinase-mediated exit from the mitotic cell cycle. Mol. Cell. Biol. 15:1479-1488[Abstract]. |
| 51. | Yamamoto, M., Y. Imai, and Y. Watanabe (ed.). 1997. Mating and sporulation in Schizosaccharomyces pombe. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 52. |
Yarwood, S. J.,
M. R. Steele,
G. Scotland,
M. D. Houslay, and G. B. Bolger.
1999.
The RACK1 signaling scaffold protein selectively interacts with the cAMP-specific phosphodiesterase PDE4D5 isoform.
J. Biol. Chem.
274:14909-14917 |
| 53. | Zhao, Y., M. Yu, M. Chen, R. T. Elder, A. Yamamoto, and J. Cao. 1998. Pleiotropic effects of HIV-1 protein R (Vpr) on morphogenesis and cell survival in fission yeast and antagonism by pentoxifylline. Virology 246:266-276[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»