INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The Caenorhabditis elegans exoskeleton (or cuticle) is a true extracellular matrix (ECM) (21) that is predominantly composed of highly cross-linked collagens (8). This exoskeleton, which is synthesized from the ectoderm (hypodermis) five times during nematode development, is responsible for the maintenance of postembryonic body shape, protection from the environment, and locomotion via opposed muscles (21). Approximately 1% of the C. elegans genome encodes cuticle collagens, representing over 150 small collagen genes (7), which encode short interrupted collagens most like vertebrate FACIT type IX cartilage collagens (30). This complex mixture of collagens constitutes >80% of the proteins in this resilient matrix (17). Mutations in individual cuticle collagen genes can result in dramatic morphological defects in this nematode, as seen for the dumpy, blister, squat, and roller mutations (21).

Prolyl 4-hydroxylase (EC 1.14.11.2) is an endoplasmic reticulum (ER) enzyme responsible for the co- and posttranslational hydroxylation of proline in the Xaa-Pro-Gly repeats of procollagen. In vitro studies have demonstrated that 4-hydroxyproline is required for the thermal stability of the folded triple helix at physiological temperatures (19). An additional function of this enzyme is to act as a chaperone by retaining unfolded procollagen chains in the ER, releasing them for secretion only when they have folded correctly (37). In humans and other vertebrates, two isoforms of prolyl 4-hydroxylase exist (type I and type II) (19); these associate with a single  subunit to form a catalytically active [(I)]₂₂ or [(II)]₂₂ tetramer (1), with catalytic activity residing in the  subunits of the complex. The  subunit is identical to protein disulfide isomerase (PDI; EC 5.3.4.1) (28). The role of PDI in the complex is not related to its disulfide isomerase activity but is hypothesized to retain the  subunits in the ER (36) in a catalytically active, nonaggregated form (14). On its own, PDI plays additional roles in procollagen biosynthesis, including disulfide bond formation and molecular chaperone functions (9).

Two conserved genes for prolyl 4-hydroxylase  subunits, referred to as phy-1 and phy-2, are expressed in the model organism C. elegans. Two potential -subunit-encoding genes, called pdi-1 and pdi-2 (for protein disulfide isomerase), are also present. Since determination of the genome sequence for this free-living nematode is essentially complete (7), these genes represent the full complement of conserved prolyl 4-hydroxylase complex genes. Coexpression of the recombinant C. elegans PHY-1 subunit with C. elegans PDI-2 in insect cells revealed that the active enzyme forms an dimer (34, 35), rather than the more common ₂₂ tetramer of vertebrates (1) and Drosophila (2). The catalytic properties of the C. elegans dimer are similar to those of the vertebrate type II tetramer, both being relatively insensitive to inhibition by poly(L-proline) (34). PHY-1 also forms an active recombinant enzyme when coexpressed with human PDI polypeptide, but again the enzyme is an dimer (35). In addition, an active type I prolyl 4-hydroxylase complex is formed from the coexpression of C. elegans PDI-2 and the human (I) subunit, the resulting enzyme being an ₂₂ tetramer. This finding demonstrates that the formation of a tetramer or dimer is dependent on the properties of the PHY-1  subunit. The second PDI isoform from C. elegans, PDI-1, homodimerizes and does not form an active enzyme complex with either the PHY-1 or the human (I) subunit (34). The pdi-1 gene is not considered in this analysis. Temporal and spatial expression patterns for pdi-1 are consistent with a role in collagen biosynthesis (24). However, based on coexpression studies and the genomic organization of this gene in a functionally conserved operon (24, 25), a prolyl 4-hydroxylase-independent role is suggested for the PDI-1 isoform.

In this study, we examined the function and expression of prolyl 4-hydroxylase and associated PDI class of procollagen-modifying enzymes in C. elegans and assessed their role in the formation of the cuticular ECM. Disruption of prolyl 4-hydroxylase activity via RNA interference (RNAi) resulted in embryonic lethality, a direct result of the cuticle being unable to maintain normal worm morphology. Single disruption of phy-1 yielded viable nematodes with altered body morphology, consistent with cuticle collagen defects. This study reveals that these enzymes are essential for development and morphology. phy-1 was shown to correspond to the uncharacterized dpy-18 locus (dumpy, short fat phenotype). This represents the first reported example of a prolyl 4-hydroxylase mutant and firmly establishes an essential role for this class of enzymes in the formation of ECMs.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

C. elegans strains and culture conditions. C. elegans strains were cultured as described elsewhere (6). Strains used in this study were the wild-type Bristol N2 strain, dpy-10 mutant strain CB128 (e128 II), unc-76 mutant strain DR96 (unc-76 e911 V), and dpy-18 mutant strains CB364 (dpy-18 e364 III) and CB2590 (tra-1 e1099/dpy-18 e1096 III). The Caenorhabditis Genetics Center provided these strains. Cloning of dumpy nematodes from strain CB2590 gave dpy-18 (e1096).

Genomic DNA isolation and generation of cDNA. Genomic DNA was prepared as described previously (26). Total RNA was isolated from C. elegans N2 mixed-stage cultures with TRIzol reagent (Gibco BRL) by following the manufacturer's recommendations. A Poly(A)quik mRNA isolation kit (Stratagene) was used to prepare mRNA from which cDNA was produced with a 1st strand cDNA synthesis kit (Amersham) by following the manufacturer's instructions.

dsRNA-mediated interference. The RNAi procedure followed is described by Fire and coworkers (11). cDNA clones for the in vitro transcription of phy-1 (Z81134), phy-2 (Z69637), and pdi-2 (U41542) were generated by PCR on mixed-stage cDNA with Taq polymerase (Applied Biosystems). Full-length clones for each gene (minus the signal peptide-encoding regions) were produced using the following primer combinations (artificial restriction enzyme sites are in lowercase and underlined): phy-1, Phy-1F (EcoRI), sense, 5' ggcgaattcGATCTGTTCACCTCGATTGC 3', and Phy-1R (PstI), antisense, 5' ggcctgcagTTAGAGGGTCTCCCAGACGT 3'; phy-2, Phy-2F (XbaI), sense, 5' ggctctagaGATTTGTTCACTGCAATTGC 3', and Phy-2R (PstI), antisense, 5' ggcctgcagCTATGGATCATTGGCATATG 3'; and pdi-2, Pdi-2F (XmnI), sense, 5' ggcgaaggatttcGCCGTCATTGAAGAAGAAGAG 3', and Pdi-2R (PstI), antisense, 5' ggcctgcagTTAGAGCTCGGTGTGTCCCT 3'. Products were ligated into the pPCR Script cloning vector (Stratagene). Clones were linearized with appropriate restriction enzymes (NotI for T7 reactions and SmaI for T3 reactions), and T7 or T3 Ribomax kits (Promega) were used to generate sense and antisense RNAs from each gene by following the manufacturer's protocols. RNA mixtures (sense plus antisense) were annealed for 30 min at 37°C, and the presence of double-stranded RNA (dsRNA) was confirmed by agarose gel electrophoresis.

Construction and expression of promoter-reporter gene fusions. Promoter-reporter gene fusions were constructed using the C. elegans nucleus-localized lacZ reporter gene vectors pPD95-03 (with expression-enhancing multi-intron sequences) and pPD21-28 (without multi-intron sequences) (10). PCR was performed on C. elegans N2 genomic DNA with Taq polymerase and primer combinations spanning the putative promoter region for each gene: phy-1, Phy-1PF (PstI), sense, 5' gcgctgcagGGTCTGCTGGCCGTTTCGTCAG 3', and Phy-1PR (BamHI), antisense, 5' gcaggatccCGCATTCTGAAAAATTGAGAG 3'; phy-2, Phy-2PF2 (PstI), sense, 5' ggcgctgcagAGACTATAGTCTATAGCTGAAAACG 3'; and Phy-2PR2 (BamHI), antisense, 5' gcgggatccACTGCTCTCATTCTGAAAGACAAATC 3'; and pdi-2, Pdi-2PF (SphI), sense, 5' GATGGAGAGCATGCATGTTTTG 3', and Pdi-2PR (BamHI), antisense, 5' cgcgggatccAACATCACGATGAATAGCGAATGG 3'. PCR products were initially cloned into either pPCR Script or pTAg (R&D Systems), digested with PstI and BamHI for phy-1 and phy-2, and ligated with similarly digested pPD95-03 vector; for pdi-2, they were digested with SphI and BamHI and ligated with similarly digested pPD21-28 and pPD95-03 vectors. For phy-1, sequences from 2755 to +5 relative to ATG were incorporated to generate a translational fusion with lacZ. For phy-2, sequences from 1715 to +11 relative to ATG were analyzed. For pdi-2, sequences from 2620 to +5 relative to ATG were included. For all promoter fragments, the nearest predicted genes are transcribed in the opposite orientation and do not overlap.

Semiquantitative reverse transcriptase PCR. The staged cDNA samples used in this procedure were kindly supplied by Iain Johnstone (Wellcome Centre for Molecular Parasitology [WCMP], Glasgow, United Kingdom). Detailed descriptions of methods used to generate synchronous C. elegans cultures and to synthesize cDNA are given elsewhere (15). For each gene tested (phy-1, phy-2, and pdi-2), PCR was used to amplify cDNA samples from synchronized nematode populations, representing 2-h intervals throughout the postembryonic life cycle at 25°C. Primers corresponding to the test gene and the control gene ama-1 (for the constitutively expressed large subunit of RNA polymerase II) were simultaneously used. ama-1 primer pairs were as follows: Ama-1F, sense, 5' TTCCAAGCGCCGCTGCGCATTGTCTC 3', and Ama-1R, antisense, 5' CAGAATTTCCAGCACTCGAGGAGCG 3'. phy-1 primers were Phy-1F and Phy-1R; phy-2 primers were Phy-2F and Phy-2R; and for pdi-2, primers Pdi-2F and Pdi-2R were used. PCR conditions permitted reactants to remain in excess, and primer combinations were engineered to span introns, thereby distinguishing transcript signals from possible genomic DNA amplification. The products were electrophoresed, Southern blotted, and probed with the appropriate oligonucleotides end labeled with [-³²P]ATP. Following autoradiography, bands corresponding to the respective genes were excised and counted by scintillation. The relative abundance of test gene transcripts was calculated from the ratio of test gene signal to ama-1 signal and plotted in arbitrary units. This value is not a true measure of real expression levels but does permit the fluctuations of transcript levels to be measured within a single experiment; thus, abundance values cannot be compared directly between individual experiments.

Rescue of the dpy-18 phenotype. PCR was performed on N2 genomic DNA with a mixture (10:1) of Taq plus Pfu (Stratagene) polymerases and the following primer combination: Phy-1NotIF, sense, 5' gcggcggccgcTTGGCTCTCCTAAGTTTCAGC 3', and Phy-1SalIR, antisense, 5' gcgtcgacGGCTTGCAGCCATCACTTCACAGG 3'. The product was ligated in vector pGEM-T (Promega) to generate a clone containing the phy-1 genomic region extending from position 2006 relative to the ATG translational start site to position 227 after the TAA translational stop signal and including the predicted polyadenylation site. This phy-1 genomic rescue clone (5 µg/ml) was microinjected into the dpy-18 e364 and e1096 strains together with a green fluorescent protein (GFP) transformation marker construct (10 µg/ml) and pBluescript SK (Stratagene) at 100 µg/ml. The GFP marker plasmid is a dpy-7 cuticle collagen promoter in the GFP fusion vector pPD95-67 (a gift from J. Muriel and I. Johnstone, WCMP). This marker was also injected with pBluescript SK in the absence of a rescue plasmid to ensure that the effects seen on body morphology were not conferred by the marker and pBluescript SK plasmids. The F₁ progeny from rescue injections were selected for GFP expression and repair of the dumpy phenotype. Lines in which the F₂ and subsequent generations continued to display this phenotype were viewed as live specimens using a Zeiss Axioskop 2 microscope with the filter set for GFP fluorescence, and images were captured as described above by use of Openlab software.

Characterization of dpy-18 alleles. A genomic clone of phy-1 from the dpy-18 (e364) strain was amplified by PCR from genomic DNA with a 10:1 mixture of Taq and Pfu polymerases and the following primer pair: Phy-1HSCF, sense, 5' gcggatatcATGCGCCTGGCACTCCTTGTAC 3', and Phy-1HSCR, antisense, 5' gcggatatcTTAGAGGGTCTCCCAGACGTC 3'. cDNA clones were generated with Taq polymerase and with the same combinations of primers from dpy-18 (e364) mixed-stage cDNA. PCR products were cloned into vector pGEM-T, and two independent cDNA clones were sequenced to identify the mutation and exclude PCR-generated changes. The genomic clone was sequenced on both strands over the area of the mutation. A genomic clone of phy-1 from the dpy-18 (e1096) strain was produced by PCR from genomic DNA with primers Phy-1NotIF and Phy-1SalIR and a cloning strategy like that used for the dpy-18 (e364) strain. The presence of a deletion in strain e1096 was demonstrated by PCR and restriction analysis, and sequencing was applied to confirm the extent of the deletion.

Hydroxyproline analysis. Nematode N2 (wild type), dpy-18 (e364), dpy-18 (e1096), and dpy-10 (e128) strains were cultured and allowed to starve. The resulting dauer-stage larvae were induced to develop in a semisynchronous fashion by feeding; a mixture of late L4 and early adult stages was collected by gentle centrifugation. After extensive washes, the nematode cuticle collagens were purified by previously published methods (8). Briefly, cellular noncollagenous material was solubilized by sonication in S buffer (10 mM Tris [pH 7.4], 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride) and discarded following centrifugation. This step was followed by similar extractions in S buffer supplemented with 1% sodium dodecyl sulfate. After extensive washes, the cuticle collagens were solubilized by boiling in S buffer plus 1% sodium dodecyl sulfate and 5% 2-mercaptoethanol, separated from the insoluble noncollagenous material by centrifugation, and concentrated by acetone precipitation at 20°C. The purified cuticle collagens were dissolved in 50% acetic acid and hydrolyzed with 6 M HCl in the vapor phase under argon at 160°C for 35 min. The amino acid derivatization was carried out by Ian Davidson (Aberdeen University) using an Applied Biosystems 420A amino acid analyzer.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Two PHY -subunit-encoding genes and an associated PDI -subunit-encoding gene are expressed by C. elegans. The free-living nematode C. elegans is the first metazoan for which the genome has been completely sequenced (7). Analysis of the sequence data identified two conserved PHY- and two conserved PDI-encoding genes. The two C. elegans PHY  subunits have a domain structure similar to those of the human (I) and (II) isoforms (Fig. 1), the highest conservation being found in the catalytic domains (23). Major differences exist at the extreme C-terminal domains of the proteins. In PHY-1, this region is directly associated with dimer formation, as its deletion prevents complex formation (35). At the protein level, PHY-1 is 44% identical to the human (I) subunit and 43% identical to the human (II) subunit over a 484-amino-acid region. Catalytically, PHY-1 most closely resembles (II), both being insensitive to inhibition by poly(L-proline) (35). PHY-2 remains to be biochemically characterized but is 46% identical to (I) and 45% identical to (II) over a 515-amino-acid region. Similar 482-amino-acid regions of the two C. elegans proteins are 57% identical to each other. Although these represent the only highly conserved phy genes from C. elegans, an additional three genes encoding proteins with low homology to the PHY catalytic domains are present in the genome (7). The most similar of these predicted gene products are 25 and 30% identical over a 200-amino-acid C-terminal region to PHY-1 and PHY-2, respectively. Likewise, additional genes expressing thioredoxin-like PDI domains are found in the genome, encoding related ER proteins and thioredoxin proteins.

View larger version (101K): [in this window] [in a new window]   FIG. 1.   Alignment of the C. elegans (C prefix) prolyl 4-hydroxylase  subunits PHY-1 (GenBank no. Z81134) and PHY-2 (GenBank no. Z69637) to the human (H prefix) (I) (M24487) and (II) (U90441) subunits using ClustalW. Gaps (dashes) were introduced for maximal alignment, and signal peptides were removed. Highly conserved cysteine and active-site histidine, aspartic acid, and lysine residues (23) are indicated by an asterisk. The conserved tryptophan76, converted to a stop codon in the phy-1 gene of the dpy-18 (e364) allele, is indicated by a dollar sign.

The combined phy genes and single pdi gene are essential for embryonic development and the maintenance of nematode body shape. Disruption of activity encoded by the phy and pdi genes was achieved using the specific reverse-genetics method of double-stranded RNAi (11). This is a potent technique that temporarily mimics loss-of-function defects. The disruption of the phy-1 gene was carried out by microinjection of dsRNA corresponding to the phy-1 coding sequence. This resulted in a dumpy (dpy, short and fat) phenotype visible in the L4 and adult stages of the F₁ progeny of injected nematodes (Fig. 2A). Dumpy animals were observed in approximately 90% of the F₁ progeny and were characteristically 40 to 60% shorter and fatter than wild-type worms. This phenotype is strikingly similar to that of the medium dumpy mutants in C. elegans (6), which predominantly result from mutations in cuticle collagen genes (21). phy-1 was subsequently shown to correspond to the uncloned dpy-18 locus (see below). RNAi of the second -subunit-encoding gene, phy-2, consistently produced no visible phenotype (Table 1). Our observations imply that nonspecific disruption of the less conserved prolyl 4-hydroxylase -subunit-related genes would be unlikely, since phy-2 is most similar to phy-1 and failed to phenocopy the phy-1 RNAi effect. The difference in phenotype between phy-1 and phy-2 single disruptions perhaps indicates variations in the substrate and/or cosubstrate specificity of the enzymes.

View larger version (126K): [in this window] [in a new window]   FIG. 2.   Double-stranded RNAi of phy-1, phy-2, and pdi-2. (A) Medium dumpy phy-1 RNAi in wild-type N2 background (arrow) compared to wild-type N2. Adults are depicted. Bar, 100 µm. (B) phy-1-phy-2 combined RNAi in wild-type N2 background. A range of severe dumpy phenotypes is represented by coiled larva (left) and adult nematode (right). Bar, 100 µm. (C to F) phy-2 RNAi in dpy-18 (e364) background. The same individual embryo is depicted in all images. Bars, 10 µm. (C) Beginning of elongation (1.5-fold, 440 min). (D) Elongated embryo (3-fold, 570 min). Head and tail of coiled embryo are out of the focal plane. (E) Retracting embryo (710 min). Head and tail of uncoiled embryo are now visible in the same focal plane. (F) Terminal phenotype (approximately 1,800 min), a fully retracted dying embryo with visible vacuoles. (G to J) pdi-2 RNAi in wild-type N2 background. The same individual embryo is depicted in all images. Bars, 10 µm. (G) Beginning of elongation (1.5-fold, 430 min). (H) Elongated embryo (3-fold, 560 min). Head and tail of coiled embryo are out of the focal plane. (I) Retracting embryo (700 min). Head and tail of uncoiled embryo are now visible in the same focal plane. (J) Terminal phenotype (approximately 960 min), a retracted dying embryo with evident small vacuoles.

Both phy genes and the single pdi gene are expressed in oscillating waves of abundance in the cuticle-synthesizing hypodermis. To examine further the function of the prolyl 4-hydroxylase complex, the detailed spatial expression patterns of the phy and pdi-2 genes were studied via reporter transgene analysis (Fig. 3). The promoter regions of the three genes were fused in frame to a lacZ reporter plasmid construct containing a nuclear localization signal. Constructs were transformed into the C. elegans germ line via microinjection, and transformants were selected via the expression of phenotypic markers, fixed, and stained for -galactosidase activity. The injection of plasmid DNA into the hermaphrodite gonad results in the formation of extrachromosomal arrays. These semistable arrays are then transmitted at 10 to 90% to subsequent generations. Individual nematodes do, however, display mosaicism; therefore, at least three independent lines were selected for each construct and marker combination. Many individual nematodes encompassing all the different life cycle stages were examined to establish which individual nuclei were reproducibly expressing the reporter gene constructs. Both hypodermally and nonhypodermally expressed transformation markers were used, thereby excluding the possibility of reporter gene expression being driven by the transcriptional regulatory units of the marker plasmid. No differences were noted in expression patterns between transformants generated with either marker, and no significant differences were observed between the independent lines generated in this study.

View larger version (79K): [in this window] [in a new window]   FIG. 3.   Tissue-specific localization of phy-1, phy-2, and pdi-2. L1 staining patterns correspond to the positions of labeled hypodermal nuclei in panel J, which are particularly apparent at the anterior and posterior ends of the nematode. Staining patterns may be complicated by the corresponding nuclei on the opposite lateral focal plane of the depicted nematode. (A) 5-Bromo-4-chloro-3-indolyl--D-galactopyranoside (X-Gal) staining of L1 larvae showing phy-1 (pPD95-03, with a nuclear localization signal [NLS])-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, dorsal is at the top, and focus is in the lateral plane. All anterior, posterior, and midbody hyp cells are evident. The lateral seam (H, T, and V) and P cells are stained. Bar, 10 µm. (B) X-Gal staining of L1 larvae showing phy-1 (pPD95-03, with an NLS)-driven lacZ expression using the unc-76 marker plasmid. The anterior is to the left, dorsal is at the top, and focus is in the lateral plane. Most anterior hyp cells (hyp5 to hyp7) are evident; only hyp7 nuclei are visible in the posterior. Some of the lateral seam (H, T, and V) and P cells are visible. Bar, 10 µm. (C) X-Gal staining of adult nematode showing phy-1 (pPD95-03, with an NLS)-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, and the body is twisted due to expression of the rol-6 phenotype. Many anterior and posterior hyp cells and lateral hypodermal cells are visible. Bar, 100 µm. (D) X-Gal staining of L1 larvae showing phy-2 (pPD95-03, with an NLS)-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, ventral is at the top, and focus is in the lateral plane. All anterior hyp cells are evident; only hyp7 nuclei are present in the tail. The midbody lateral seam cells, P cells, and hyp cells are visible. Additional midbody nonhypodermal cells are also evident. Bar, 10 µm. (E) X-Gal staining of L1 larvae showing phy-2 (pPD95-03, with an NLS)-driven lacZ expression using the unc-76 marker plasmid. The anterior is to the left, dorsal is at the top, and focus is in the lateral plane. Most anterior hyp cells are evident, with weak, incomplete staining of posterior hyp cells. Midbody hyp7 cells, lateral seam cells, and P cells are conspicuous. Additional midbody nonhypodermal cells are present. Bar, 10 µm. (F) X-Gal staining of adult nematode revealing phy-2 (pPD95-03, with an NLS)-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, and the body is helically twisted due to expression of the rol-6 phenotype. Anterior, posterior, and lateral hypodermal cells are discernible. Vulval cell nuclear staining is indicated by an arrow. Additional nonhypodermal cell nuclei are also conspicuous. Bar, 100 µm. (G) X-Gal staining of L1 larvae showing pdi-2 (pPD21-28, with an NLS)-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, dorsal is at the top, and focus is in the lateral plane. Some of the anterior hyp cells are evident; hyp7 nuclei are present in the tail. Some of the midbody lateral seam cells, P cells, and hyp cells are visible. Bar, 10 µm. (H) X-Gal staining of L1 larvae showing pdi-2 (pPD95-03, with an NLS)-driven lacZ expression using the unc-76 marker plasmid. The anterior is to the left, dorsal is at the top, and focus is in the lateral plane. Most anterior hyp cells are evident (hyp3, hyp6, and hyp7); only hyp7 nuclei are evident in the posterior (partially out of focus). Some of the lateral seam (H, T, and V) and P cells are stained. Bar, 10 µm. (I) X-Gal staining of immature adult nematode showing pdi-2 (pPD21-28, with an NLS)-driven lacZ expression using the rol-6 marker plasmid. The anterior is to the left, and the body is twisted due to expression of the rol-6 phenotype. Anterior and posterior hyp cells and lateral hypodermal cells are visible. Bar, 100 µm. (J) Diagrammatic representation of the L1 left lateral aspect depicting the hypodermal cell nuclei. An identical pattern is present on the right lateral view, with additional hyp7 nuclei dorsal to H2R nuclei. ex, excretory. Panel J is based on the original L1 hypodermal cell nucleus designation (31).

View larger version (23K): [in this window] [in a new window]   FIG. 4.   Temporal expression pattern of the phy-1 (), phy-2 (), and pdi-2 () transcripts during postembryonic development. A semiquantitative reverse transcriptase PCR approach was applied to examine the ratio of expression (y axes) of the individual enzyme-encoding genes to that of the constitutively expressed gene ama-1. The arbitrary values for phy-1 and phy-2 were plotted together for comparison. All values were obtained from mRNA of synchronously maintained larval and early adult stages at 25°C. L1 to L4, first to fourth larval stages.

The dpy-18 mutant phenotype is rescued by the -subunit-encoding gene phy-1. Single gene RNAi of phy-1 resulted in a medium dumpy phenotype (Fig. 2A), and the approximate physical map position of the phy-1-encoding cosmid T28D6 (chromosome III, map position 7.8) was in the vicinity of the genetic locus dpy-18 (chromosome III, map position 8.62). Mutant dpy-18 alleles were originally derived from ethyl methanesulfonate-mutagenized nematodes (6) and exhibited medium dumpy phenotypes and associated temperature-sensitive male tail abnormalities (3). To date, these alleles remain to be molecularly defined. To examine the possible correlation between phy-1 and dpy-18, two strains of dpy-18 (e1096 and e364) were obtained from the Caenorhabditis Genetics Center, and attempts were made to rescue the phenotypes of the alleles. A wild-type copy of the phy-1 gene which included the 5' promoter, the genomic coding sequence, and the 3' untranslated region (incorporating the polyadenylation signal) was cloned by PCR from wild-type (N2) genomic template DNA. The cloned phy-1 fragment was then coinjected into dpy-18 strains with a visible marker, namely, the dpy-7 cuticle collagen (16) promoter fused to GFP. This step allowed transformants to be selected on the basis of fluorescence using a UV dissecting microscope. These experiments revealed that the dpy-18 phenotype was rescued by phy-1, since transformed fluorescent progeny were restored to the wild-type phenotype (Fig. 5). The repair to wild-type body shape and the corresponding fluorescence of the dpy-18 e364 strain are shown in Fig. 5. Identical rescue results were obtained with the second mutant allele, dpy-18 (e1096) (data not shown). A control injection of the dpy-7 promoter-GFP construct eliminated the involvement of this marker in phenotype repair (data not shown).

View larger version (79K): [in this window] [in a new window]   FIG. 5.   Rescue of medium dumpy phenotype of a dpy-18 strain by coinjection of a wild-type copy of phy-1 and the selectable marker dpy-7-GFP. (A) Rescued progeny (arrow) and nonrescued progeny of a dpy-18 strain (e364) viewed by Nomarski optics. (B) Corresponding fluorescence in the rescued dpy-18 strain (e364) (arrow) viewed under a UV filter. Adult stages are depicted.

Mutations in phy-1 result in the dpy-18 phenotype. The correlation between dpy-18 alleles and the -subunit-encoding gene phy-1 was confirmed by sequencing the phy-1 gene from the dpy-18 mutant alleles e364 and e1096. Cloning was achieved by PCR of both mRNA and genomic DNA for e364 and of genomic DNA for e1096. These experiments were repeated on two independent occasions to confirm that changes from the wild-type copy of the gene were not PCR-induced artifacts. Sequencing of e364 allele revealed the presence of a single point mutation in the 5' coding sequence of exon 2 in phy-1, cloned from both mRNA and genomic DNA. This mutation was a TGG-TAG (tryptophan₇₆-amber stop codon) (Fig. 1 and 6) and probably represented a null mutant, as translation is predicted to terminate before the functional peptide-, cosubstrate-, and PDI-binding domains of the encoded enzyme (Fig. 6). Cloning of phy-1 from strain e1096 was achieved only from genomic DNA, with the resulting product being notably smaller than the wild-type copy. Sequencing revealed a 776-bp 5' deletion from positions 688 to +88 relative to the initiation methionine (Fig. 6). This deletion removed part of the promoter region, signal peptide, and N-terminal coding region of PHY-1 and therefore represented a true null mutation.

View larger version (28K): [in this window] [in a new window]   FIG. 6.   Gene structure of phy-1 showing physical and genetic map locations. Exons are shown as filled boxes. Introns and promoter regions are represented by lines, and 3' untranslated regions are indicated by an open box. ATG and TAA indicate the positions of the translational start and stop signals, respectively. The 776-bp deletion in phy-1 from dpy-18 (e1096), extending from positions 688 to +88 (relative to the ATG), is depicted. The tryptophan76 (TGG)-to-amber stop codon (TAG) point mutation found in phy-1 from dpy-18 (e364) is also indicated. The domain structure for PHY-1 is shown along with the truncated protein predicted for dpy-18 (e364), revealing missing functional domains.

The cuticle collagens of two dpy-18 mutant strains have reduced hydroxyproline contents. In order to confirm biochemically the role that PHY-1 plays in proline hydroxylation of the cuticle collagens of C. elegans, the hydroxyproline contents of these proteins from the two dpy-18 strains were examined. For comparison, identical cuticle collagen extracts were prepared from wild-type strain N2 and a collagen dumpy mutant, namely, dpy-10 (e128). This analysis revealed a significant reduction in the hydroxyproline contents of cuticle collagens from the dpy-18 strains compared with wild-type cuticle extracts. dpy-18 (e364) (phy-1 amber) and dpy-18 (e1096) (phy-1 deletion) strains expressed mercaptoethanol-soluble cuticle extracts with 18 and 31% reductions, respectivelyhydroxyproline contents of 73 residues (standard error [SE], 3.5) and 61 residues (SE, 2.88) per 1,000 total residues, respectively. The unrelated dpy-10 dumpy mutant did not exhibit a similar reduction in hydroxyproline content compared with the wild-type strain (N2)hydroxyproline contents of 93 and 89 residues per 1,000 total residues, respectively. This biochemical analysis validates the findings from the genetic analysis of phy-1 in dpy-18 mutants.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The multienzyme complex prolyl 4-hydroxylase has been proposed to be an important collagen-specific catalyst (19) and chaperone (37) of multicellular organisms. In this study, we demonstrate conclusively in vivo that the conserved forms of the prolyl 4-hydroxylase complex from C. elegans are essential during development and play a critical role in the biosynthesis of the collagenous cuticular ECM in this nematode. Analysis of the expression pattern of each of the subunits supports this role for the complex. Expression was demonstrated in the cuticular collagen-synthesizing hypodermal tissue in a developmental pattern mirroring that of the cuticle collagen substrate. We have also characterized the dpy-18 locus, which corresponds to the -subunit-encoding gene phy-1.

ECM-modifying enzymes affect nematode development. In C. elegans, the cuticle collagens are arranged into an exoskeleton, which imparts structural integrity and maintains the worm shape after embryonic elongation (29). Abnormalities in this structure have dramatic effects on embryogenesis and nematode body morphology (22). Elongation of the spherical embryo to worm shape is initiated by the cytoskeletal organization of the outermost surrounding layer of embryonic cells, the hypodermis (29). While these cells determine the shape of the embryo during elongation, the cuticle performs this function after elongation is completed (29).

Inhibition of prolyl 4-hydroxylase. Multicellular organisms produce an array of ECMs. The model nematode C. elegans is an excellent experimental system for the study of the ECM due to the wide range of molecular genetic and biochemical techniques applicable to this organism. From this study we conclude that prolyl 4-hydroxylase is a critical modulator of ECM formation and morphogenesis and may have a similar essential function throughout the animal kingdom. A greater understanding of prolyl 4-hydroxylase function and design of specific inhibitors would have an impact on human health issues in two major ways. First, excessive accumulation of collagens in the ECM plays a critical role in fibrotic disease. Prolyl 4-hydroxylase activity represents the most suitable target for the inhibition of collagen biosynthesis and as such provides a direct means to control disease due to fibrotic alterations in the ECM and excessive collagen deposition (13), such as liver cirrhosis, lung fibrosis, and scleroderma. Second, the essential role of this enzyme complex in the formation of the nematode cuticular ECM, as evidenced by this study, may provide a selective drug target for the control of parasitic nematode species.