Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 4295-4308, Vol. 20, No. 12
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Yeast Ran-Binding Protein 1 (Yrb1) Shuttles between the Nucleus
and Cytoplasm and Is Exported from the Nucleus via a CRM1
(XPO1)-Dependent Pathway
Markus
Künzler,1
Thomas
Gerstberger,1
Françoise
Stutz,2
F. Ralf
Bischoff,3 and
Ed
Hurt1,*
Ruprecht-Karls-Universität Heidelberg,
Biochemie-Zentrum Heidelberg (BZH),1 and
Abteilung Molekulare Biologie der Mitose, Deutsches
Krebsforschungszentrum,3 D-69120 Heidelberg,
Germany, and Centre Hospitalier Universitaire Vaudois,
Microbiologie, CH-1011 Lausanne, Switzerland2
Received 1 November 1999/Returned for modification 8 December
1999/Accepted 29 March 2000
 |
ABSTRACT |
The RanGTP-binding protein RanBP1, which is located in
the cytoplasm, has been implicated in release of nuclear export
complexes from the cytoplasmic side of the nuclear pore complex. Here
we show that Yrb1 (the yeast homolog of RanBP1) shuttles between the
nucleus and the cytoplasm. Nuclear import of Yrb1 is a facilitated process that requires a short basic sequence within the Ran-binding domain (RBD). By contrast, nuclear export of Yrb1 requires an intact
RBD, which forms a ternary complex with the Xpo1 (Crm1) NES receptor in
the presence of RanGTP. Nuclear export of Yrb1, however, is
insensitive towards leptomycin B, suggesting a novel type of substrate
recognition between Yrb1 and Xpo1. Taken together, these data suggest
that ongoing nuclear import and export is an important feature of Yrb1
function in vivo.
 |
INTRODUCTION |
Exchange of macromolecules between
the cytoplasmic and nuclear compartments is a hallmark of eukaryotic
cells. This nucleocytoplasmic transport occurs through the nuclear
pores (for reviews, see references 24, 58, and
76) and is generally a signal-mediated and
energy-dependent process (for reviews, see references 25,
31, and 81). Only ions and smaller
molecules seem to be able to traverse the pores by passive diffusion.
The small Ras-like GTPase Ran plays a crucial role in nucleocytoplasmic
transport in that it provides the identity of the two compartments and
thus ensures directionality of transport (for reviews, see references
20, 50, and 51). In the
nucleoplasm, this small Ras-like GTPase is thought to exist mainly in
the GTP-bound form, due to the exclusive nuclear localization of
the only known guanine nucleotide exchange factor (GEF) for Ran, RCC1,
or Prp20 in Saccharomyces cerevisiae (2). By
contrast, the RanGTP concentration in the cytoplasm is
supposed to be low since the only known GTPase-activating protein (GAP)
for Ran, Rna1 in yeast, is a cytoplasmic protein (5, 21).
This would create a steep gradient of RanGTP across the
nuclear envelope.
Like in other processes governed by small Ras-like GTPases, effector
proteins, which bind specifically to the GTP-bound form of Ran,
play a key role in nucleocytoplasmic transport. An important group of
Ran effectors is represented by the importin
-type nuclear transport
receptors (karyopherin
) (for reviews, see references 1,
63, 86, and 89). Members of this protein
family are characterized by a conserved RanGTP-binding
domain at the N terminus. The effects of RanGTP on the
binding of cargo determine whether a given importin or karyopherin
is an import or export receptor. In the case of import receptors or
importins, the receptor-cargo complex is dissociated (in the nucleus)
upon binding of RanGTP, whereas in the case of export
receptors or exportins, a ternary complex between cargo, receptor, and
RanGTP is formed and exported as an entity into the
cytoplasm. In S. cerevisiae, 14 members of the karyopherin
family have been proposed to exist, and for many of them, cargoes
were already identified. So far, two exportins, Cse1 and Xpo1, were
found to be indispensable for yeast cell viability; Cse1 is the yeast
homolog of CAS that exports importin
(Srp1) from the nucleus
(38, 46, 74) and Xpo1, the yeast homolog of CRM1, is the
export receptor for leucine-rich nuclear export signals (NES) (54,
75). In contrast to CRM1 of higher eukaryotes, Xpo1 is not
sensitive towards the Streptomyces metabolite leptomycin B
(LMB), which interferes directly with substrate recognition by CRM1
(4, 28). Recently, an LMB-sensitive variant of Xpo1 was
engineered by a single amino acid substitution (53).
A second family of RanGTP-binding proteins is
characterized by a conserved RanGTP-binding motif, also
called a Ran-binding domain (RBD) (6, 15, 32). All members
of this protein family have been implicated in nucleocytoplasmic
transport, but their exact role in this process remains to be
clarified. A prominent member of this protein family is the giant
mammalian nucleoporin NUP358 (RanBP2), which contains four of these
domains (90, 93) and was localized to the cytoplasmic
filaments protruding from the nuclear pore complex (NPC) into the
cytoplasm (60, 87, 90). Another member of this family is
RanBP3 and its Schizosaccharomyces pombe homolog, Hba1,
which were localized to the nucleoplasm, suggesting that proteins of
this family exist on both sides of the nuclear envelope (52,
84). Besides the RanBP1-homolog Yrb1 (see below), S. cerevisiae contains two RBD-containing proteins, Yrb2 and
Nup2 (23, 32). Whereas Yrb1 is essential for cell viability,
null mutants of YRB2 and NUP2 exhibit only a cold
sensitivity or no apparent growth defect, respectively (48, 55,
59, 70, 83). In agreement with its structural similarity to
RanBP3 and Hba1, Yrb2 was localized to the nucleoplasm (55,
82), whereas Nup2 was localized to the NPC (48). All
three RBD-containing proteins of yeast have been implicated in
nucleocytoplasmic transport. Nup2 was found to interact genetically and
physically with Nup1 and Srp1 (7), suggesting that it might
participate in nuclear import of proteins with classical nuclear
localization signals (NLSs). More recently, Nup2 was shown to play a
role in the reexport of Srp1 from the nucleus (13).
Consistent with this role, Nup2 was found in a two-hybrid screen
with the nuclear tRNA export receptor, Los1, indicating a
possible function in nuclear export of tRNA (36).
Similarly, Yrb2 was recently shown to be a cofactor of Xpo1-mediated
protein export (26, 56, 82).
The founding member of the protein family of RBD-containing proteins is
RanBP1 (Yrb1). The protein has been implicated in both nuclear protein
import and export in vivo (70) and in vitro (19,
44). Mechanistically, RanBP1 and other members of this protein
family increase, via their conserved RBDs, the rate of RanGAP1-mediated GTP hydrolysis on Ran (6, 10, 55)
and overcome the inhibition of this reaction by members of the
karyopherin
family (9, 27, 49). Consistent with the
cytoplasmic steady-state localization of RanBP1 and RanGAP1
(Rna1) (39, 66, 70, 95), it was proposed that these proteins
are required for the release of karyopherin
from RanGTP
and thus for the recycling of import receptors and for terminal steps
of nuclear export (3, 26, 44). Such an exclusive cytoplasmic
function of RanBP1, however, was recently questioned by the
identification of nuclear pools of RanBP1 both in higher eukaryotes and
in yeast (62, 66, 69, 95). RanBP1 from higher organisms
differs from the S. cerevisiae and S. pombe
counterparts in the sequence and the location of an extension outside
of the conserved RBD. The C-terminal extension of metazoan RanBP1
harbors a sequence resembling that of a leucine-rich NES. This sequence
was shown to be necessary but not sufficient for the cytoplasmic
localization of a functional RBD (66, 95) and to function as
an export signal in a heterologous context (65, 66). In
agreement with these results, RanBP1 was shown to accumulate in the
nucleus upon injection of peptides containing NES sequences from
protein kinase A inhibitor protein or human immunodeficiency virus
(HIV) Rev protein into Xenopus oocyte nuclei, suggesting
that RanBP1 shuttles between the nucleus and cytoplasm and is exported
via the pathway for leucine-rich NES (62). Yeast RanBP1
sequences exhibit an N-terminal extension outside of the RBD which
shares no sequence similarity to the C-terminal extension of metazoan
RanBP1 and also lacks the leucine-rich NES. Nevertheless, recent
reports of nuclear pools of RanBP1 in yeast (36, 57, 69)
indicated that the dynamic localization of RanBP1 might be conserved
throughout the eukaryotic kingdom.
Here, we present evidence that Yrb1 shuttles between the nucleus and
cytoplasm. The conserved RBD is necessary and sufficient for the
essential function and nucleocytoplasmic shuttling of Yrb1. Yrb1
follows a facilitated transport route into the nucleus which requires a
small basic sequence within the RBD. Despite the absence of an
apparent leucine-rich NES, nuclear export of Yrb1 depends on Crm1
(Xpo1). Accordingly, a ternary complex between Yrb1, Xpo1,
and RanGTP could be isolated, which forms both in vitro
and in vivo. These data suggest that Yrb1 shuttles continuously between
the cytoplasm and nucleus.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
Yeast strains used in this
study are listed in Table 1. Most of the
strains were derived from laboratory strain W303 by standard yeast
genetic techniques (42). The CSE1 and
XPO1 shuffle strains were derived from strains M1702
(91) and LDY880 (92), respectively. DNA-mediated
transformation of yeast cells was performed using a modified version of
the lithium acetate method (29). Unless indicated otherwise,
yeast cells were propagated at 30°C. YP (rich medium) and SC
(synthetic complete medium) were prepared as previously described
(42). Dextrose (D) or raffinose (R) was added as a carbon
source at a final concentration of 2% (wt/vol) after autoclaving; induction with galactose (G) was performed by adding galactose (final
concentration, 2%) to raffinose-grown cells. LMB treatment of
CRM1T539C cultures was done as previously described (53). Drop-out media (SC lacking the appropriate nutrients) were used to
maintain selection for plasmids. Agar plates containing 5-fluoroorotic acid were prepared as described by Boeke et al. (12).
Escherichia coli DH5
(34) was used for
propagation of all plasmid DNAs. Bacteria were cultivated using
standard methods (68).
Construction of plasmids.
Standard techniques were used for
the manipulation of recombinant DNA (68). Plasmid DNA from
E. coli was isolated as described previously
(22). Unless specified otherwise, PCR amplifications were
performed using standard conditions (67) and Vent DNA
polymerase (New England Biolabs, Beverly, Mass.). The correct sequence
of PCR-generated constructs was verified by nucleotide sequence
analysis (80). Plasmids used in this study are listed in
Table 2.
Vector pGALPATG carrying a
GAL1p-ProtA-TEV-GAL4t cassette
was constructed based on pNOPPATA
(pUN100-
NOP1p-ProtA-TEV-ADH1t)
(
36) by replacing
the
ADH1 terminator by the
GAL4 terminator
and
the
NOP1 promoter by the
GAL1 promoter. Plasmid
pNOPPATA-
TRP1-GSP2 was derived by recloning the
NOP1p-ProtA-TEV-GSP2-ADH1t cassette
from
pNOPPATA-
GSP2 (
47) as a
SacI-
HindIII fragment into YCplac22
and
subsequently destroying the
BamHI restriction site (i.e.,
by
cutting, filling in, and religating) in the polylinker of YCplac22.
This plasmid served as the basis for plasmids
pNOPPATA-
TRP1-XPO1 and -
CSE1. Plasmids
pNOPPATA-
TRP1-XPO1, pGALPATG-
XPO1, and
pET9d-His6-TEV-
XPO1 all contain a PCR-generated
NcoI-
BamHI fragment comprising the
entire coding
region of
XPO1 derived from pRS313-
XPO1
(
75).
Plasmids pNOPPATA-
TRP1-CSE1 and
pET9d-His6-TEV-
CSE1 were constructed
analogously using a
PCR-generated
NcoI-
BamHI fragment comprising
the
entire coding region of
CSE1 derived from pMK330
(
46). Plasmid
pASZ11-
xpo1-1 was made by recloning
a
SalI-
BamHI fragment from
pRS313-
xpo1-1 (
75; H. Santos-Rosa,
unpublished data). Analogously,
the
XPO1 gene was recloned
into pRS316 as a
SalI-
BamHI fragment
from
pRS313-
XPO1 (
75). A plasmid for galactose-induced
overexpression
of
NUP2 was constructed by inserting a
PCR-generated
BamHI-
HindIII
NUP2
fragment comprising the entire coding region into pEMBLyex4
(
17). Plasmid pMK375 was derived from plasmid pLDB419
(
92)
by recloning the
SalI-
SacI
YAP1-sGFP fragment into
YEplac112.
The various plasmids containing internally deleted
YRB1
genes were constructed by synthesizing by PCR, in a first step, various
5' and 3' portions of the gene as
EcoRI-
BamHI and
BamHI-
NotI fragments,
respectively. The PCRs were
performed using pMK275 as a template,
T7 and T3 universal primers, and
sequence-specific primers within
the
YRB1 open reading frame
(ORF) which carried a
BamHI site at
their 5' ends. In a
second step, the PCR-generated 5' and 3' fragments
were combined by
cloning them sequentially into pRS314. The resulting
deletion
constructs were tagged with GFP(S65T) by exchanging the
full-length ORF
on pMK284n by the various internally deleted ORFs
and recloning of the
entire fusion genes on the multicopy vector
pRS424 as
EcoRI-
NotI cassettes. The NLS of simian virus 40 (SV40)
large T antigen was introduced into
YRB1 by inserting
a synthetic
DNA fragment (coding strand,
5'-
TCGAGCCACCAAAGAAGAAGCGTAAGGTTGAA
C-3';
noncoding strand,
5'-
TCGAGTTCAACCTTACGCTTCTTCTTTGGTGG
C-3';
introduced
cloning sites are underlined) into the
SalI
site at the 5' end
of the
YRB1 ORF. Plasmids containing
fusions of
YRB1 to double
and triple green fluorescent
protein (GFP) were constructed by
exchanging the
BamHI
single GFP cassette in pMK291-wt against
tandem arrays of a
PCR-generated
BamHI-
BglII GFP cassette (O.
Gadal,
unpublished
data).
Plasmids pMK346STOP-wt and pMK346STOP-

C containing a
GAL1-driven cDNA encoding full-length (amino acids 1 to 203)
or C-terminally
truncated (amino acids 1 to 160) GFP fusions of mouse
RanBP1 (muRanBP1)
were constructed by synthesizing respective fragments
of the muRanBP1
ORF by PCR. The PCRs were performed using plasmid p12.6
lacking
the first 12 amino acids (
14) as template and
5'-CG
GGATCCATGGCTGCAGCCAAGGACAG
TCACGCTGACCATGATACTTCCACAGAGAATGCAGATGAGTCC-3' combined
with 5'-CCCC
GGATCCGCGGCCGCCTTGTTTCTCCTCAGACTTCTCTTC-3'
(full length) or
5'-CCCC
GGATCCGCGGCCGCCTTTCCTGCATTCTTCAAACTTT-3'
(

C), respectively, as primers. The PCR-generated fragments
were
digested with
BamHI and inserted into the
BamHI site of YEp351GAL
(
8). Finally, a
PCR-generated GFP(S65T)-STOP
NotI cassette
was inserted into
the
NotI site at the C terminus of the above
fragments.
Plasmids for expressing wild-type and various mutant forms of Yrb1 as
glutathione
S-transferase (GST) fusion proteins in
E. coli cells were constructed by synthesizing respective fragments
as
EcoRI-
NotI,
BamHI-
NotI,
and
BamHI by PCR and ligating them
into pGEX4T3 (Pharmacia,
Uppsala, Sweden). pGEX-GSP1 for expression
of GST-Gsp1 in
E. coli was made by recloning a
BamHI-
HindIII (
HindIII
5'
overhang filled in using T4 DNA polymerase) fragment from plasmid
pGPCNR1 (
41) comprising the entire coding region of
GSP1 into
the
BamHI-
SmaI sites of
vector pGEX4T3 (B. Senger, unpublished
data). pMK450-wt was
constructed from plasmid pLDB450 (
92) by
PCR amplification
of the wild-type
GSP1 ORF as an
NheI-
HindIII
fragment and cloning it into
pTrcHisA (Invitrogen, Carlsbad, Calif.).
Plasmid pMK263, expressing a
His
6-tagged version of Rna1 in
E. coli, contains
the entire
RNA1 ORF as a PCR-amplified
BglII-
PstI
fragment.
Fusions of full-length HIV Rev protein to the B42 transcriptional
activation domain (TAD) and full-length Mtr10 and Xpo1 to
the
E. coli LexA DNA-binding domain (DBD) were described previously
(
54,
79). A fusion of full-length Cse1 to the LexA DBD
was
generated by cloning a PCR-generated
BamHI-
SalI fragment comprising
the
entire
CSE1 coding region into pEG202+PL (
33).
Fusions of
the entire coding region of Yrb1 to the B42 TAD were
obtained
by insertion of respective PCR-generated
EcoRI-
XhoI fragments
into vector pJG4-5
(
33). Plasmids encoding fusions of full-length
Gsp1 and Srp1
to the B42 TAD were constructed by inserting PCR-generated
XhoI fragments comprising the entire coding regions of
GSP1 and
SRP1 into pJG4-5.
Preparation of rabbit polyclonal anti-Gsp1 antiserum.
A
rabbit polyclonal antiserum against Gsp1 was raised using an
affinity-purified maltose-binding protein fusion of the Gsp1(G21V) variant. A plasmid expressing the MBP-Gsp1(G21V) fusion protein was constructed in two steps. First, the
BamHI-HindIII (HindIII 5'
overhang filled in using T4 DNA polymerase) fragment from
YEp352GAL-GSP1(G21V) (36) comprising the entire ORF was
introduced into the BamHI-SmaI sites of
expression vector pGEX4T3 (Pharmacia). In a second step, the
GSP1(G21V) ORF was released from this plasmid as
a BamHI-SalI fragment and cloned into pMAL-c2
(New England Biolabs) opened with BamHI and SalI
(B. Senger, unpublished data). The protein was expressed in
BL21(DE3) cells (78) and affinity purified over amylose
resin according to the manufacturer's recommendations (New England
Biolabs). Immunization of two rabbits with this material was performed
by a commercial antibody service (J. Pineda, Berlin, Germany). For
detection of Gsp1 by immunoblotting, the resulting antisera were used
as primary antibodies at a dilution of 1:3,000.
Two-hybrid assay.
Interactions between LexA(DBD) and
B42(TAD) fusion proteins were assessed as described previously
(54).
-Galactosidase activities were determined as
described previously (46). Diploids were pregrown overnight
in selective medium with 2% raffinose as the sole carbon source to
mid-logarithmic phase (A600 = 0.5) and
induced for 3 h by addition of 2% galactose before assaying.
Purification of ProtA fusion proteins from yeast.
Strains
expressing ProtA-Xpo1 and ProtA-Cse1 in a null background for
XPO1 and CSE1, respectively, were grown in yeast
extract-peptone-dextrose (YPD) at 23°C to an
A600 of ~2.0. Purification of ProtA fusion proteins from these cells was performed as previously described (46) with the modification that cell lysis and washing of
the immunoglobulin G (IgG)-Sepharose beads were done in Universal buffer without glycerol.
In vitro protein interaction assay (pull-down assay).
In
vitro interaction between recombinant proteins was assayed as described
previously (46). All proteins were expressed in
BL21(DE3) (78) and purified as described previously
(46). As a modification, His6-tagged proteins
were purified over Talon beads (Clontech, Palo Alto, Calif.). The
proteins were bound to this resin in the presence of 5 mM imidazole and
eluted with 100 mM imidazole. Epitope-tagged (with GST or
His6) Gsp1 from E. coli was purified accordingly
except that, before ultracentrifugation, the lysate was incubated on
ice for 30 min after addition of 1% Triton X-100 and 1% Tween 20. Affinity-purified Gsp1 was immediately loaded with GTP by adding 30 mM
KPi (pH 7.5), 1 mM GTP, and 10 mM EDTA (pH 8), incubating
at room temperature for 1 h, adding 20 mM Mg(OAc)2,
incubating on ice for 30 min, and snap-freezing in liquid nitrogen.
Purification and GTP loading of recombinant human Ran was described
previously (11). Rna1-mediated GTP hydrolysis on Gsp1 was
performed by incubating free Gsp1GTP or a GST-Yrb1-Xpo1-Gsp1GTP complex on glutathione-Sepharose beads in Universal buffer for 30 min
at 30°C.
Quantification of RCC-mediated GTP exchange on Gsp1GTP.
Labeling of Gsp1 with [
-32P]GTP and GTP exchange
assays were performed as described for Ran (10). Briefly, 3 µM Gsp1GDP in 500 mM phosphate (pH 7.5), 1 mM 2-mercaptoethanol, and
10% glycerol was incubated for 30 min on ice with 20 mM EDTA and 6.7 µM [
-32P]GTP (15 Ci/mmol; Du Pont, Wilmington,
Del.). The buffer was changed in 20 mM HEPES-NaOH (pH 7.2), 50 mM
NaOAc, 1 mM MgCl2, 0.5% hydrolyzed gelatin, and 0.4%
NaN3 (incubation buffer) on a NAP 5 column (Pharmacia). A
volume of 50 pM Gsp1-[
-32P]GTP was incubated with
indicated final concentrations of GST-Yrb1 in incubation buffer. After
30 min at 15°C, nucleotide exchange was induced for 30 s by
addition of 20 nM human RCC1 and 200 µM GDP. Gsp1-bound radioactivity
was determined after filtration of the samples through nitrocellulose.
The dose dependence of GTP-exchange inhibition can be used to
estimate the constant for dissociation of the Yrb1-Gsp1GTP complex.
Fluorescence microscopy.
Fluorescence microscopy of living
yeast cells expressing GFP(S65T) fusion proteins was done as described
previously (36). Cells were concentrated by a short spin and
resuspended in the residual growth medium without any washing steps.
Miscellaneous.
Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and immunoblotting were conducted as
described previously (46).
 |
RESULTS |
Yrb1 is exported from the nucleus via a Crm1 (Xpo1)-dependent
pathway.
We reported previously that Yrb1-GFP accumulates in the
nucleus when the N-terminally truncated nuclear tRNA export receptor Los1 is overexpressed (36). Since this observation indicated that Yrb1 may shuttle between the nucleus and cytoplasm, we studied the
nuclear export of Yrb1 in various nucleocytoplasmic transport mutants.
Strikingly, a dramatic and rapid nuclear accumulation of Yrb1-GFP was
observed in the xpo1-1 mutant when shifted for only a few
minutes to the restrictive temperature (Fig.
1A). Nuclear accumulation of Yrb1-GFP was
also observed in mutants harboring the less severe alleles
(crm1-1, crm1-2, and crm1-3) of
XPO1 (92), albeit to a lesser extent (data not
shown). In contrast, Yrb1-GFP remained cytoplasmic in the
cse1-1 mutant, which is defective for nuclear export of
another shuttling protein, Srp1-GFP (46). Conversely,
shuttling of Srp1-GFP was not affected in the xpo1-1 mutant
(data not shown). Yrb1-GFP also strongly accumulated inside the nucleus
when XPO1 expression was repressed by using the regulatable GAL1 promoter (Fig. 1B; see also Table 1). As specificity
controls, (i) Yrb1-GFP did not accumulate in an analogous strain
harboring a glucose-repressible CSE1 gene and (ii)
Srp1-GFP did not accumulate upon depletion of Xpo1 (data not shown).
Finally, we examined the subcellular localization of Yrb1-GFP in cells
overexpressing Yrb2 or Nup2, the two other yeast RBD-containing
proteins, since it had been reported that overproduction of Yrb2
leads to nuclear accumulation of Xpo1 and NES-containing reporter
proteins (82). Strikingly, Yrb2 overexpression, but not Nup2
overexpression, induces a strong nuclear accumulation of Yrb1-GFP (Fig.
1C). Consistent with a recently reported role of Nup2 in the nuclear
export of Srp1 (13), we observed a strong nuclear
accumulation of Srp1-GFP upon overexpression of Nup2, demonstrating the
efficacy of our NUP2 construct (data not shown). This all
shows that Yrb1 enters the nucleus and is exported from the nucleus by
a mechanism that requires a functional Xpo1 and normal levels of Yrb2.
Interestingly, nuclear export of Yrb1 was not inhibited by the
fungicide LMB in an LMB-sensitive yeast strain (53) (Fig.
1D). This drug has been shown to interfere with the nuclear export and
recognition of canonical leucine-rich NES by CRM1 (4, 28,
88). Accordingly, two established substrates of Xpo1 containing
such canonical NES, the yeast transcription factor Yap1
(92), and an artificial reporter protein containing the NES
of the cyclic AMP-dependent protein kinase inhibitor
(75) revealed a rapid and efficient nuclear accumulation
under the same conditions (Fig. 1D). This result suggests that
recognition of Yrb1 by Xpo1 might be different from the recognition of
a canonical NES (see Discussion).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
Inhibition of nuclear export of Yrb1-GFP. (A) Yrb1-GFP
accumulates in the nucleus of xpo1-1 cells. The double
disruption xpo1 ::LEU2
yrb1 ::HIS3 strain complemented by
xpo1-1 and YRB1-GFP on single-copy plasmids was
transformed with either XPO1 on plasmid (XPO1) or
empty vector (xpo1-1). Transformants were grown at 23°C
and shifted for 10 min to 37°C. Shown are fluorescence micrographs
depicting the localization of Yrb1-GFP. (B) Depletion of Xpo1 causes
nuclear accumulation of Yrb1-GFP. A strain carrying a
xpo1::KANR disruption
complemented by GAL1-driven ProtA-XPO1 was
transformed with YRB1-GFP on a single-copy plasmid.
Transformants were grown in galactose-containing medium before transfer
into dextrose-containing medium and repression for 18 h. (C)
Overexpression of YRB2 causes nuclear accumulation of
Yrb1-GFP. A strain harboring a
yrb1 ::HIS3 disruption complemented
by single-copy YRB1-GFP was transformed with a multicopy
plasmid carrying a galactose-inducible YRB2 or
NUP2 gene. Transformants were grown in raffinose-containing
medium before a 6-h induction by addition of 2% galactose. Shown is
the fluorescence signal of Yrb1-GFP. (D) LMB has no effect on Yrb1
export. Transformants of LMB-sensitive yeast strain CRM1T539C
containing plasmids encoding GFP fusion proteins of Yap1 or Yrb1 or an
artificial NLS-NES-GFP reporter protein were cultivated in selective
medium to mid-logarithmic phase. LMB was added to the cultures, and the
cells were examined by fluorescence microscopy at the indicated time
points.
|
|
Yrb1 interacts with Xpo1 in vivo.
Since Xpo1 is required for
the nuclear export of Yrb1, Yrb1 and Xpo1 may directly interact. To
test for this, a two-hybrid analysis was performed. Indeed, an
interaction was found between Yrb1 and Xpo1 (Fig.
2A). Yrb1 did not interact, however, with other members of the karyopherin
family, such as Mtr10 and Cse1. Conversely, Srp1 interacted strongly with Cse1 and weakly with Mtr10,
but not with Xpo1, in this system. The strength of the two-hybrid
interaction (as measured by the
-galactosidase activity) between
Yrb1 and Xpo1 was as high as that of HIV Rev protein or Ran (Gsp1) with
Xpo1. In addition to the two-hybrid assay, ProtA-tagged Xpo1 was
affinity purified from yeast cells from both a wild-type and an
rna1-1 mutant strain (Fig. 2B). We anticipated that a
putative Yrb1-Xpo1-RanGTP complex would be stabilized in the
rna1-1 strain, in which GTP hydrolysis is inhibited
(47, 71). Indeed, Yrb1 and Gsp1 coisolate with ProtA-Xpo1,
when purified from the rna1-1 strain (Fig. 2B, lane 6). In
contrast, Srp1 is clearly enriched together with Gsp1 when ProtA-Cse1
is purified from the rna1-1 strain (Fig. 2B, lane 8).
However, Srp1 is also seen, albeit weakly, associated with Cse1 in an
RNA1 strain and with Xpo1 in both rna1-1 and
RNA1 strains (Fig. 2B, lanes 5 to 7). This may be due to
unspecific binding of Srp1 under our purification conditions, which was
also observed with other, unrelated ProtA-fusion proteins (M. Künzler and E. Hurt, unpublished data). Overexpression of Yrb2 or
Nup2 did not result in copurification of the export receptors with their respective cargoes and Gsp1, suggesting that the export complexes
are not stable under these conditions (data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Yrb1 and Xpo1 interact in vivo. (A) Two-hybrid
interaction. Full-length Yrb1 fused to the B42-TAD (Prey) was tested
for interaction with full-length Xpo1, Mtr10, and Cse1 fused to the
LexA DBD (Bait). B42-TAD fusion constructs of full-length HIV Rev,
importin (Srp1), and Gsp1 served as controls. -Galactosidase
activities are given in arbitrary units on top of the error bars. (B)
Affinity purification of ProtA-Xpo1 from rna1-1 cells.
xpo1::HIS3 cells complemented by a
plasmid containing ProtA-XPO1 were grown in YPD at 23°C.
As a control, cells deleted for CSE1 and rescued by
ProtA-CSE1 were cultivated accordingly. The ProtA-fusion
proteins were affinity purified on IgG-Sepharose and eluted using the
TEV protease. The homogenate supernatants (Load) and TEV eluates were
analyzed by SDS-PAGE, Coomassie blue staining, and immunoblotting using
the indicated antibodies. In the case of the anti-Srp1 immunoblotting,
both the enhanced chemiluminescence (upper panel) and the less-strong
color reaction (4-chloro-1-naphthol, lower panel) are shown. The
relative mobilities of Srp1, Yrb1, and Gsp1 in the Coomassie gel are
also shown. Asterisks indicate the purified ProtA fusion proteins.
|
|
Taken together, the results of the two-hybrid and biochemical analyses
suggest that Yrb1, Xpo1, and RanGTP can be found in
complex
in
vivo.
Yrb1 forms a complex with Xpo1 and RanGTP in vitro.
To test whether Yrb1 can form a complex with Xpo1 and RanGTP
in vitro, we performed pull-down assays using recombinant
proteins. First, we immobilized GST-Gsp1GTP on
glutathione-Sepharose beads and analyzed binding of
His6-tagged Xpo1 and Yrb1, separately or in combination, to
these beads as described previously (46) (Fig.
3A). As expected for an exportin-type
receptor, Xpo1 alone did not reveal a significant affinity for Gsp1GTP
in this assay (Fig. 3A, lane 8), whereas Yrb1 readily associated with
Gsp1GTP in the absence of Xpo1 due to its RBD (Fig. 3A, lane 7). In
contrast, Xpo1 bound to the GST-Gsp1GTP beads in the presence of Yrb1
(Fig. 3A, lane 9). In a second experiment, we tested under the same conditions immobilized GST-Yrb1 for binding to His6-tagged
Xpo1 and human RanGTP (Fig. 3B). As anticipated, Yrb1 formed
a complex with RanGTP alone (Fig. 3B, lane 6), whereas no
complex formation was observed with Xpo1 alone (Fig. 3B, lane 5). In
the presence of RanGTP, however, Xpo1 can be significantly
bound to Yrb1 (Fig. 3B, lane 7). The same result was obtained using
His6-tagged Gsp1GTP instead of RanGTP (data
not shown and Fig. 3C). These experiments suggest that a ternary
complex between Yrb1, Xpo1, and RanGTP is formed in a
cooperative way in vitro. This complex (like the dimeric complex
between Yrb1 and RanGTP) requires the GTP-bound state of
Ran, since conversion of Gsp1GTP to Gsp1-GDP by His6-tagged Rna1 (RanGAP) prior to the binding assay abolished its
formation (Fig. 3C). A similar result was obtained by incubation of a
preformed GST-Yrb1-Xpo1-Gsp1GTP complex with Rna1, demonstrating that
the complex can be disassembled by RanGAP-mediated GTP
hydrolysis on Gsp1 (data not shown). To test whether Yrb1 forms a
complex with other members of the karyopherin
family, the nuclear
import receptor Mtr10, which has a low affinity to RanGTP
alone (72), and the nuclear export receptor Cse1 were tested
in the GST-Yrb1 in vitro binding assay. No significant binding of Yrb1
to these proteins, even in the presence of RanGTP, could be
detected (Fig. 3D). Taken together, these data suggest that a specific
complex forms between Xpo1, Yrb1, and RanGTP, which could
represent the nuclear export complex of Yrb1.


View larger version (3236K):
[in this window]
[in a new window]
|
FIG. 3.
In vitro complex formation between Yrb1, Xpo1, and
RanGTP (Gsp1GTP). (A) Cooperative binding of Yrb1 and Xpo1 to
GST-Gsp1GTP. Recombinant GST-Gsp1GTP was bound to glutathione-Sepharose
and incubated with recombinant His6-Xpo1 and
His6-Yrb1 as indicated. Unbound and bound fractions were
analyzed by SDS-PAGE and Coomassie blue staining. (B) Cooperative
binding of Xpo1 and RanGTP to GST-Yrb1. Recombinant GST-Yrb1
was bound to glutathione-Sepharose and incubated with recombinant
His6-Xpo1 and RanGTP as indicated. (C) Complex
formation is dependent on the GTP-bound form of Gsp1. GST-Yrb1 was
bound to glutathione-Sepharose and incubated with His6-Xpo1
together with His6-Gsp1GTP or His6-Gsp1GDP that
had been produced by preincubation of His6-Gsp1GTP with
recombinant RanGAP (His6-Rna1) (see Materials and Methods).
(D) Yrb1 does not interact with other importins or exportins in the
presence of RanGTP. Recombinant His6-tagged
karyopherins, Cse1 and Mtr10, were tested, in comparison with
His6-Xpo1, for interaction with GST-Yrb1 in the presence of
RanGTP as described above for panel B. (E and F)
RanGTP binding by the RBD of Yrb1 is necessary and sufficient
for in vitro formation of the Yrb1-Xpo1-RanGTP complex.
Indicated GST-Yrb1 fusion proteins were affinity purified and analyzed
for binding to His6-Xpo1 in the presence of
RanGTP as described above for panel B. The boundaries of the
Yrb1-N, -RBD, -RBDN, and -RBDC fragments are
amino acids 3 to 58, 59 to 201, 59 to 131, and 132 to 201, respectively. (E) For the pull-down assays, only the bound fractions
are shown.
|
|
In order to identify the sequence within Yrb1 responsible for the
formation of this ternary complex, various mutant forms
of Yrb1 were
expressed as GST fusion proteins in
E. coli and examined
in
pull-down assays for interaction with RanGTP alone (data not
shown) and with Xpo1 in the presence of RanGTP (Fig.
3E and
F).
This revealed that an intact RBD comprising residues 59 to 201
of
Yrb1 is necessary and sufficient both for RanGTP binding
(data
not shown) and for the formation of the
Yrb1-Xpo1-RanGTP ternary
complex. Any deletion of the RBD,
either truncations from the
N terminus (RBD
C, comprising
residues 132 to 201) or the C terminus
(RBD
N, comprising
residues 59 to 131) or small internal deletions
which led to distinct
changes in the localization of Yrb1 in vivo
(see Fig.
5), abolished
binding of RanGTP or Gsp1GTP (data not
shown; Fig.
4) and formation of the ternary complex
(Fig.
3E and
F). The N-terminal extension outside of the RBD, however,
can
be deleted without significant loss of RanGTP binding and
complex
formation and, conversely, did not reveal any significant
binding
activity on its own (Yrb1-N, comprising residues 3 to 58) (Fig.
3E). In the pull-down assay, since two point mutations within
the RBD,
A91D and R127K (which lead to temperature-sensitive growth
and
differential localization of Yrb1 in vivo) (M. Künzler et
al.,
submitted for publication) did not detectably affect complex
formation,
we quantified their affinity to Gsp1GTP by determining
their inhibitory
effect on RCC1-mediated nucleotide exchange on
Gsp1GTP (Fig.
4). The
small internal deletions in the Yrb1 RBD
were included as controls in
this assay. In agreement with the
results of the pull-down assay, the
two point mutations, although
located in conserved residues of the RBD,
reduced the affinity
of Yrb1 for Gsp1GTP only moderately, from
approximately 2 nM for
the wild-type protein to 4 nM (R127K) and 10 nM
(A91D) for the
altered proteins. The determined affinity of the A91D
mutant might
even be underestimated because of reduced stability of the
altered
protein both in vivo (Künzler et al., submitted) and in
vitro.
An affinity of 10 nM is thereby sufficient for a stable
interaction
in the pull-down assay, as could be confirmed by another
RanGTP-binding
protein (A. Braunwarth, E. Hurt, and M. Künzler, unpublished
data).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of RCC1-mediated GTP exchange on Gsp1GTP. The
graph shows the affinity of the indicated GST-Yrb1 fusion proteins for
Gsp1GTP as measured by the inhibition of RCC1-induced GTP exchange (see
Materials and Methods for details).
|
|
Taken together, these results show that the formation of the
Yrb1-Xpo1-RanGTP complex requires the functional RBD of
Yrb1.
The RBD of Yrb1 harbors both nuclear export and import
signals.
In order to determine the domains required for proper
function and subcellular localization of Yrb1, we performed a
mutational analysis of YRB1, including a comprehensive set
of deletions and two previously isolated point mutations,
yrb1-51 (A91D) and yrb1-52 (R127K) (Künzler
et al., submitted) (Fig. 5A).
These mutants were examined (i) for
their ability to complement the otherwise nonviable
yrb1::HIS3 mutant and (ii) for their
localization in wild-type and xpo1-1 mutant strains (Fig.
5B). This series of experiments reconfirmed the finding that the
integrity of the RBD of Yrb1 is essential for Yrb1 function and
location, whereas the N-terminal extension is dispensable (Fig. 5A).
Accordingly, full-length and
(3-58) Yrb1 behave very similarly
except that the nuclear accumulation of Yrb1
(3-58) in the
xpo1-1 strain occurs already at permissive temperature (data
not shown; Fig. 5Aa). Different truncations of the RBD, i.e.,
(167-201),
(132-201),
(59-101),
(102-120), and
(102-111), were made, all of which abolish recognition by Xpo1 and
lead to a nuclear accumulation of the respective GFP fusion proteins
(Fig. 5Ab). Strikingly, even a single amino acid substitution
(yrb1-51; A91D) in a conserved residue of this domain caused
nuclear accumulation in a yrb1
::HIS3 strain (Künzler et al., submitted; Fig. 5C). This accumulation was evident already at the semipermissive temperature (30°C). In
summary, mutations and/or deletions scattered throughout the Yrb1 RBD
sequence cause nuclear accumulation.


View larger version (3273K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of nuclear export and import signals within
Yrb1. (A) YRB1 and muRanBP1 deletion constructs with
indicated complementation of the otherwise nonviable
yrb1 ::HIS3 strain (nd, not
determined) and subcellular localization of derived GFP-tagged
fusion proteins in XPO1 wild-type and xpo1-1
cells. For complementing constructs whose localization in a genetic
YRB1 wild-type background differs from the one in a genetic
yrb1 null background, the latter localization is indicated
in brackets. Complementation tests were performed using untagged
constructs in low-copy-number plasmids, except for the Yrb1-3xGFP
construct (c), which was tested in a high-copy-number plasmid
(indicated by an asterisk). The two single amino acid changes (A91D and
R127K) both lead to thermosensitive (ts) growth. For the subcellular
localization studies, corresponding fusion genes to single
GFP(S65T) were cloned in a multicopy plasmid. (B)
Subcellular localization of GFP-tagged Yrb1 mutant constructs in
yeast. The constructs described for panel A were transformed in
xpo1-1 and isogenic wild-type strains. Transformants were
grown at 23°C and examined by fluorescence microscopy upon shift for
2 h to 37°C. Representatives of each category are shown. (C)
Localization of Yrb1(A91D)-GFP and NLSSV40-Yrb1-GFP in
yrb1 ::HIS3 cells. YRB1
shuffle strain HMK21 was transformed with multicopy plasmids encoding
the respective Yrb1-GFP fusions. Upon shuffling out of the
YRB1 wild-type plasmid, the strains were cultivated in YPD
at 30°C to mid-logarithmic phase and examined by fluorescence
microscopy.
|
|
Nuclear accumulation of Yrb1 could, in principle, due to the small size
of protein, occur by passive diffusion and nuclear
retention. To
exclude this possibility, fusion constructs of Yrb1
to double or triple
GFP were made and tested for nuclear accumulation
in the
xpo1-1 mutant strain (Fig.
5Ac). Even the Yrb1-3xGFP
construct,
which has a calculated molecular mass of 100 kDa and an
apparent
molecular mass of 120 kDa (data not shown) (which is clearly
above
the exclusion limit for passive diffusion), accumulated to the
same extent and with the same kinetics as Yrb1-GFP in
xpo1-1
cells
when shifted to 37°C (Fig.
5Bc). This suggests that nuclear
import
of Yrb1 is not due to passive diffusion and may be a facilitated
process. In searching for an NLS in Yrb1, we noticed that another
yrb1 allele (
yrb1-52; R127K) affected
nucleocytoplasmic transport
of Yrb1 in a different way. GFP-tagged
Yrb1(R127K) remained cytoplasmic
even in the
xpo1-1
mutant, suggesting that it cannot be imported
into the nucleus (Fig.
5Ad). This observation prompted us to test
whether the region around
residue 127 represents a nuclear import
signal. Despite the fact that
any deletion in the RBD tested so
far abolished complementation and
nuclear export by Xpo1, we found
that any deletion that removed
residues 121 to 131 of the RBD
prevented nuclear import in the
xpo1-1 mutant (Fig.
5Ad). Consistent
with these results,
both the deletion mutants and Yrb1(R127K)
remained cytoplasmic in
cells overproducing Yrb2 (data not shown).
In order to exclude the
possibility that these mutants were defective
in nuclear accumulation
rather than nuclear import, we inserted
the NLS of SV40 large T antigen
near the N terminus of Yrb1, Yrb1(R127K),
Yrb1(A91D), and
Yrb1

(121-131) and their respective GFP fusion
proteins and examined
the subcellular localization of the resulting
fusion proteins
(Fig.
5Ae). The heterologous NLS is active within
the context
of Yrb1, as shown by nuclear accumulation of
NLS
SV40-Yrb1-GFP
in
yrb1
::
HIS3 cells (Fig.
5C) and
NLS
SV40-Yrb1(A91D)-GFP in wild-type
cells (Fig.
5Be).
Consistent with a nuclear import defect rather
than a problem in
nuclear accumulation of Yrb1(R127K) and Yrb1

(121-131),
these
mutant forms of Yrb1 accumulated in
xpo1-1 cells, or even
in
XPO1 cells, respectively, when fused to the NLS (Fig.
5Be).
The steady-state localization of these fusion proteins is thereby
in
agreement with the in vitro binding experiments (Fig.
3E and
F) in
which, in contrast to the

(121-131) mutant, both point
mutants of
Yrb1 are still able to form a ternary complex with
Xpo1 and
RanGTP. The R127K mutant, which has the highest affinity
for
RanGTP among the mutants, is thereby exported most
efficiently
and accumulated least efficiently. Therefore, the nuclear
import
of Yrb1 depends on a short sequence (121 KVRILM
RRDKT 131) within
the RBD surrounding R127
(underlined). However, neither this sequence
alone or bigger parts of
the RBD comprising this sequence (residues
102 to 166) were able to
target GFP into the nucleus (data not
shown; see also Discussion),
suggesting that the NLS might be
more complex. Since the growth defect
of the
yrb1-52 mutant (R127K)
(Künzler et al.,
submitted) could have been (partly) due to impaired
nuclear import of
Yrb1, we tested complementation of the otherwise
lethal
yrb1
::
HIS3 deletion by the
NLS
SV40-fusion proteins of
Yrb1, Yrb1(A91D), and
Yrb1(R127K). In contrast to the untagged
alleles, however, neither
NLSSV40-yrb1-51 nor
NLSSV40-yrb1-52 was able to complement (data not
shown). Interestingly, however,
NLSSV40-YRB1 (as
well as
NLSSV40-YRB1-GFP) was functional and
did
not show any obvious growth defect, suggesting that yeast
can live even
if Yrb1 is largely nuclear at steady state (data
not shown; see Fig.
5C
for steady-state distribution of NLS
SV40-Yrb1-GFP).
All this shows that the RBD of Yrb1 mediates both nuclear import and
export of this RanGTP-binding
protein.
Nuclear export of mouse RanBP1 in yeast does not require the
leucine-rich NES.
To test whether the import and export signals
identified within Yrb1 are also present in higher eukaryotic homologs,
we analyzed RanBP1 from mouse and its derived RBD in yeast
(lacking the carboxy-terminally located leucine-rich NES) (Fig.
6A). Interestingly, both RanBP1-GFP and
the RBD-GFP driven from the galactose-inducible GAL1
promoter complement the yrb1
::HIS3
null strain, indicating that the RBD of muRanBP1 is functional in yeast
(data not shown). In addition, the constructs complement the same
mutation also in a xpo1-1 background and accumulate, like
Yrb1-GFP, in the nucleus of these mutant cells (Fig. 6B). This suggests
that the RBD is sufficient for the essential function and the dynamic
subcellular localization of mouse RanBP1 in yeast.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 6.
Mouse RanBP1 complements the
yrb1 ::HIS3 mutant and exhibits a
shuttling behavior like that of Yrb1. (A) Schematic representation of
the muRanBP1 constructs. Expression was under the control of the
galactose-inducible GAL1 promoter from a multicopy plasmid.
(B) Localization of muRanBP1-GFP and muRanBP1 C-GFP. Double
disruption xpo1 ::KAN
yrb1 ::HIS3 strain complemented by
pADE2-xpo1-1 and muRanBP1-GFP or
muRanBP1- C-GFP were transformed with a single-copy
plasmid harboring XPO1 or empty vector, respectively.
Transformants were grown at 23°C and examined by fluorescence
microscopy before and after a 5-min shift to 37°C.
|
|
 |
DISCUSSION |
Nucleocytoplasmic transport factors of the karyopherin
family
and Ran require for their function continuous shuttling between the
nucleus and cytoplasm. In contrast, other factors appear to be resident
and restricted to either the nuclear or the cytoplasmic compartment,
e.g., RanGAP in the cytoplasm and RanGEF in the nucleus.
The data presented here suggest that the RanGTP-binding
protein RanBP1(Yrb1) is efficiently shuttling between the nucleus and cytoplasm in yeast. It is imported into the nucleus by a yet unknown mechanism and exported via the CRM1 (Xpo1)-dependent nuclear export pathway. Our data also show that Yrb1 does not enter the nucleus
simply by passive diffusion but rather by a facilitated transport
mechanism. This finding is surprising in view of its suggested role in
the cytoplasm, where it should release RanGTP from
karyopherin
-type receptors in conjunction with Rna1
(RanGAP) (see the introduction). The identification of Xpo1
as the nuclear export receptor for Yrb1 raises the question of the
nature of the NES in Yrb1. The absence of a leucine-rich sequence in
Yrb1 suggested that the signals recognized by Xpo1 are different from a
canonical NES. Interestingly, the entire and intact RBD of both Yrb1
and muRanBP1 is necessary and sufficient for Xpo1-mediated nuclear export in yeast. Accordingly, RanGTP binding by Yrb1
is necessary for interaction with Xpo1 in vitro. Based on the low affinity of Xpo1 to RanGTP in the absence of export cargo, we interpret the in vitro-isolated Yrb1-Xpo1-RanGTP
ternary complex as a true export complex. Thus, the domain of Yrb1
recognized by Xpo1 appears to be complex and not short and continuous
like the canonical leucine-rich NES. Recently, it was shown that
snurportin, another shuttling nucleocytoplasmic transport factor, is
exported from the nucleus by CRM1 and requires an extended NES
(61). This suggests that CRM1 may be able to recognize
different types of NES. The insensitivity of Yrb1 export to LMB in an
engineered S. cerevisiae strain which is sensitive to this
drug might indicate that the residues on CRM1 involved in the
recognition of noncanonical NES are different from the ones responsible
for the binding of canonical NES.
The aspects of nuclear import of Yrb1 in respect to shuttling are less
clear. Our results suggest that Yrb1 import is a facilitated process
dependent on cis- and trans-acting factors. By
deletion analysis, we identified a short sequence of 11 amino acid
residues within the RBD which is necessary for nuclear import of Yrb1. The sequence is relatively rich in basic residues, but does not seem to
be a classical NLS (see below). Consistent with the result of the
deletion analysis, a point mutation, which leads to an import-defective Yrb1, was mapped to a conserved Arg residue within this sequence. Interestingly, this residue makes direct contact with
the C terminus of RanGTP according to the crystal structure of a complex between the first RBD of RanBP2 and Ran bound to a GTP
analogue (85). This finding suggests that the putative nuclear import mediator and RanGTP use the same binding site
on Yrb1. If so, this would offer a possible release mechanism of Yrb1
from its import mediator in the nucleus by binding to RanGTP. Despite this knowledge, we were not yet able to delineate the minimal
NLS sufficient for nuclear import of Yrb1. This suggests that the NLS
of Yrb1 may be more complex than anticipated or is only formed within
the folded Yrb1.
With regard to trans-acting factors involved in Yrb1 nuclear
import, we found that the prp20-1 mutation in
RanGEF, which affects a number of different nuclear import
pathways (45), also inhibits nuclear import of Yrb1 (M. Künzler and E. Hurt, unpublished data). In contrast, no
inhibition of Yrb1 import was observed in the karyopherin mutants that
were tested so far (pse1-1,
yrb4
::HIS3, nmd5
::HIS3,
kap104
::HIS3,
mtr10
::HIS3,
pdr6
::HIS3, and
sxm1
::HIS3) (M. Künzler and E. Hurt, unpublished data). The classical import pathway involving
importin
and
is also unlikely to be used, since Yrb1 did not
show any affinity for Srp1 or Kap95, either alone or in combination, in
vitro (M. Künzler and E. Hurt, unpublished data). Therefore, it
is possible that Yrb1 uses a nonconventional route to enter the
nucleus. A possible candidate for such a nonconventional import complex
is a previously reported ternary complex between RanBP1, importin
,
and RanGDP (18, 19), whose physiological role is
still unclear (see also below). However, so far we have no experimental
evidence that this complex represents an import complex.
What could be the physiological significance of Yrb1 shuttling? Several
scenarios can be discussed. One possibility is that Yrb1 somehow gets
into the nucleus and has to be continuously exported into the cytoplasm
by Xpo1, because nuclear Yrb1 is not compatible with its assumed
function in dissociating nuclear export complexes on the cytoplasmic
side of the NPC. Indeed, it has been shown that high levels of RanBP1
microinjected into the nucleus are detrimental for nuclear export in
Xenopus oocytes (40). How, in this model, would
Yrb1 enter the nucleus? It may do so as a result of its proposed role
during nuclear import (18, 19). In agreement with such a
role, mutations in YRB1 inhibit nuclear protein import in
vivo (70) (Künzler et al., submitted). However, this
inhibition could also be the consequence of the impaired recycling of
nuclear import receptors. Alternatively, it was proposed in higher
eukaryotic cells that a nuclear export mechanism for RanBP1 might be
necessary to reestablish the "normal" subcellular distribution of
RanBP1 following nuclear envelope assembly after mitosis. However, in
yeast, no nuclear envelope breakdown occurs during mitosis. As an
alternative explanation for the shuttling of Yrb1, our finding that
yeast tolerates a significant pool of Yrb1 in the nucleus at steady
state (when Yrb1 is targeted to the nucleus by the NLS of SV40 large T
antigen) could mean that Yrb1, in principle, could fulfill a function
in the nucleus. As one possibility for such a nuclear function, it may
play a role in the early steps of Xpo1-mediated nuclear export. Such a
role was suggested for the nuclear RBD-containing Yrb2 protein
(82). Alternatively, a nuclear pool of Yrb1 may be required for nuclear processes different from nucleocytoplasmic transport. In
this regard, it has recently been demonstrated that RanBP1 affects
(Ran-dependent) microtubule organization in vitro (16, 43,
94). Such a nuclear function of RanBP1 would provide
physiological significance to the described in vitro activity of
RanBP1 as a guanine nucleotide dissociation inhibitor of guanine
nucleotide exchange by nuclear RanGEF (RCC1) (10)
and a reported physical interaction between RanBP1 (Yrb1) and RCC1
(Prp20) (35, 64).
 |
ACKNOWLEDGMENTS |
Special thanks go to D. Lau for technical support, D. Zenklusen
(Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland) for
sharing unpublished results, B. Wolff (Novartis Research Institute, Vienna, Austria) for leptomycin B, and J. Thorner (University of
California, Berkeley), for generous support. We thank K. Weis (University of California, Berkeley), I. Macara (Markey Center for Cell
Signaling, Charlottesville, Va.), M. Rosbash (M. Neville) and L. Davis
(Brandeis University, Waltham, Mass.), M. Nomura (University of
California, Irvine), M. Fitzgerald-Hayes (University of Massachusetts,
Amherst), and G. Stier and S. Labeit (EMBL, Heidelberg, Germany) for
providing us with strains and plasmids. We are grateful to G. Simos and
O. Gadal for critical reading of the manuscript.
M.K. is a recipient of grants from the Deutsche Forschungsgemeinschaft
(Ku 1235/1-1) and is supported by a fellowship provided by the Swiss
National Research Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Biochemie-Zentrum Heidelberg (BZH), Im Neuenheimer Feld 328, 4. OG,
D-69120 Heidelberg, Germany. Phone: 49-6221-544173. Fax:
49-6221-544369. E-mail:
cg5{at}ix.urz.uni-heidelberg.de.
 |
REFERENCES |
| 1.
|
Adam, S. A.
1999.
Transport pathways of macromolecules between the nucleus and the cytoplasm.
Curr. Opin. Cell Biol.
11:402-406[CrossRef][Medline].
|
| 2.
|
Amberg, D. C.,
M. Fleischmann,
I. Stagljar,
C. N. Cole, and M. Aebi.
1993.
Nuclear PRP20 protein is required for mRNA export.
EMBO J.
12:233-241[Medline].
|
| 3.
|
Askjaer, P.,
A. Bachi,
M. Wilm,
F. R. Bischoff,
D. L. Weeks,
V. Ogniewski,
M. Ohno,
C. Niehrs,
J. Kjems,
I. W. Mattaj, and M. Fornerod.
1999.
RanGTP-regulated interactions of CRM1 with nucleoporins and a shuttling DEAD-box helicase.
Mol. Cell. Biol.
19:6276-6285[Abstract/Free Full Text].
|
| 4.
|
Askjaer, P.,
T. H. Jensen,
J. Nilsson,
L. Englmeier, and J. Kjems.
1998.
The specificity of the CRM1-Rev nuclear export signal interaction is mediated by RanGTP.
J. Biol. Chem.
273:33414-33422[Abstract/Free Full Text].
|
| 5.
|
Becker, J.,
F. Melchior,
V. Gerke,
F. R. Bischoff,
H. Ponstingl, and A. Wittinghofer.
1995.
RNA1 encodes a GTPase-activating protein specific for Gsp1p, the Ran/TC4 homologue of Saccharomyces cerevisiae.
J. Biol. Chem.
270:11860-11865[Abstract/Free Full Text].
|
| 6.
|
Beddow, A. L.,
S. A. Richards,
N. R. Orem, and I. G. Macara.
1995.
The Ran/TC4 GTPase-binding domain: identification by expression cloning and characterization of a conserved sequence motif.
Proc. Natl. Acad. Sci. USA
92:3328-3332[Abstract/Free Full Text].
|
| 7.
|
Belanger, K. D.,
M. A. Kenna,
S. Wei, and L. I. Davis.
1994.
Genetic and physical interactions between Srp1p and nuclear pore complex proteins Nup1p and Nup2p.
J. Cell Biol.
126:619-630[Abstract/Free Full Text].
|
| 8.
|
Benton, B.,
J. H. Zang, and J. Thorner.
1994.
A novel FK506- and rapamycin-binding protein (FPR3 gene product) in the yeast Saccharomyces cerevisiae as a proline rotamase localized to the nucleolus.
J. Cell Biol.
127:623-639[Abstract/Free Full Text].
|
| 9.
|
Bischoff, F. R., and D. Görlich.
1997.
RanBP1 is crucial for the release of RanGTP from importin b-related nuclear transport factors.
FEBS Lett.
419:249-254[CrossRef][Medline].
|
| 10.
|
Bischoff, F. R.,
H. Krebber,
E. Smirnova,
W. Dong, and H. Ponstingl.
1995.
Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.
EMBO J.
14:705-715[Medline].
|
| 11.
|
Bischoff, F. R., and H. Ponstingl.
1995.
Catalysis of guanine nucleotide exchange of Ran by RCC1 and stimulation of hydrolysis of Ran-bound GTP by Ran-GAP1.
Methods Enzymol.
257:135-144[Medline].
|
| 12.
|
Boeke, J. D.,
J. Trueheart,
G. Natsoulis, and G. R. Fink.
1987.
5-Fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol.
154:164-175[Medline].
|
| 13.
|
Booth, J. W.,
K. D. Belanger,
M. I. Sannella, and L. I. Davis.
1999.
The yeast nucleoporin Nup2p is involved in nuclear export of importin /Srp1p.
J. Biol. Chem.
274:32360-32367[Abstract/Free Full Text].
|
| 14.
|
Bressan, G.,
M. P. Somma,
J. Lewis,
C. Santolamezza,
N. G. Copeland,
D. J. Gilbert,
N. A. Jenkins, and P. Lavia.
1991.
Characterization of the opposite-strand genes from the mouse bidirectionally transcribed HTF9 locus.
Gene
103:201-209[CrossRef][Medline].
|
| 15.
|
Butler, G., and K. H. Wolfe.
1994.
Yeast homologue of mammalian Ran binding protein 1.
Biochim. Biophys. Acta
1219:711-712[Medline].
|
| 16.
|
Carazo-Salas, R. E.,
G. Guarguaglini,
O. J. Gruss,
A. Segref,
E. Karsenti, and I. W. Mattaj.
1999.
Generation of GTP-bound Ran by RCC1 is required for chromatin-induced mitotic spindle formation.
Nature
400:178-181[CrossRef][Medline].
|
| 17.
|
Cesareni, G., and J. A. H. Murray.
1987.
Plasmid vectors carrying the replication origin of filamentous single-stranded phages in genetic engineering.
Genet. Eng.
9:135-154.
|
| 18.
|
Chi, N. C.,
E. J. H. Adam, and S. A. Adam.
1997.
Different binding domains for Ran-GTP and Ran-GDP/RanBP1 on nuclear import factor p97.
J. Biol. Chem.
272:6818-6822[Abstract/Free Full Text].
|
| 19.
|
Chi, N. C.,
E. J. H. Adam,
G. D. Visser, and S. A. Adam.
1996.
RanBP1 stabilizes the interaction of Ran with p97 in nuclear protein import.
J. Cell Biol.
135:559-569[Abstract/Free Full Text].
|
| 20.
|
Cole, C. N., and M. Hammell.
1998.
Driving and directing transport.
Curr. Biol.
8:368-372.
|
| 21.
|
Corbett, A. H.,
D. M. Koepp,
G. Schlenstedt,
M. S. Lee,
A. K. Hopper, and P. A. Silver.
1995.
Rna1p, a Ran/TC4 GTPase activating protein, is required for nuclear import.
J. Cell Biol.
130:1017-1026[Abstract/Free Full Text].
|
| 22.
|
Del Sal, G.,
G. Manfioletti, and C. Schneider.
1988.
A one-tube plasmid DNA mini-preparation suitable for sequencing.
Nucleic Acids Res.
16:9878[Free Full Text].
|
| 23.
|
Dingwall, C.,
S. Kandels-Lewis, and B. Séraphin.
1995.
Targeting Ran to the nuclear pore: a family of Ran binding proteins that includes nucleoporins.
Proc. Natl. Acad. Sci. USA
92:7525-7529[Abstract/Free Full Text].
|
| 24.
|
Doye, V., and E. C. Hurt.
1997.
From nucleoporins to nuclear pore complexes.
Curr. Opin. Cell Biol.
9:401-411[CrossRef][Medline].
|
| 25.
|
Englmeier, L., and I. Mattaj.
1998.
Nucleocytoplasmic transport: the soluble phase.
Annu. Rev. Biochem.
67:265-306[CrossRef][Medline].
|
| 26.
|
Floer, M., and G. Blobel.
1999.
Putative reaction intermediates in Crm1-mediated nuclear protein export.
J. Biol. Chem.
274:16279-16286[Abstract/Free Full Text].
|
| 27.
|
Floer, M.,
G. Blobel, and M. Rexach.
1997.
Disassembly of RanGTP-karyopherin beta complex, an intermediate in nuclear protein import.
J. Biol. Chem.
272:19538-19546[Abstract/Free Full Text].
|
| 28.
|
Fornerod, M.,
M. Ohno,
M. Yoshida, and I. W. Mattaj.
1997.
CRM1 is an export receptor for leucine-rich nuclear export signals.
Cell
90:1051-1060[CrossRef][Medline].
|
| 29.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 30.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base-pair restriction sites.
Gene
74:527-534[CrossRef][Medline].
|
| 31.
|
Görlich, D.
1998.
Transport into and out of the cell nucleus.
EMBO J.
17:2721-2727[CrossRef][Medline].
|
| 32.
|
Görlich, D., and E. Hartmann.
1995.
A Ran-binding motif in nuclear pore proteins.
Trends Cell Biol.
5:192-193.
|
| 33.
|
Gyuris, J.,
E. Golemis,
H. Chertkov, and R. Brent.
1993.
Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2.
Cell
75:791-803[CrossRef][Medline].
|
| 34.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 35.
|
Hayashi, N.,
N. Yokoyama,
T. Seki,
Y. Azuma,
T. Ohba, and T. Nishimoto.
1995.
RanBP1, a Ras-like nuclear G protein binding to Ran/TC4, inhibits RCC1 via Ran/TC4.
Mol. Gen. Genet.
247:661-669[CrossRef][Medline].
|
| 36.
|
Hellmuth, K.,
D. Lau,
R. Bischoff,
M. Künzler,
G. Simos, and E. Hurt.
1998.
Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA.
Mol. Cell. Biol.
18:6374-6386[Abstract/Free Full Text].
|
| 37.
|
Hill, J. E.,
A. M. Myers,
T. J. Koerner, and A. Tzagoloff.
1986.
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast
2:163-167[CrossRef][Medline].
|
| 38.
|
Hood, J. K., and P. A. Silver.
1998.
Cse1p is required for export of Srp1p/importin- from the nucleus in Saccharomyces cerevisiae.
J. Biol. Chem.
273:35142-35146[Abstract/Free Full Text].
|
| 39.
|
Hopper, A. K.,
H. M. Traglia, and R. W. Dunst.
1990.
The yeast RNA1 gene product necessary for RNA processing is located in the cytosol and apparently excluded from the nucleus.
J. Cell Biol.
111:309-321[Abstract/Free Full Text].
|
| 40.
|
Izaurralde, E.,
U. Kutay,
C. von Kobbe,
I. W. Mattaj, and D. Görlich.
1997.
The asymmetric distribution of the constituents of the Ran system is essential for transport into and out of the nucleus.
EMBO J.
16:6535-6547[CrossRef][Medline].
|
| 41.
|
Kadowaki, T.,
D. Goldfarb,
L. M. Spitz,
A. M. Tartakoff, and M. Ohno.
1993.
Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily.
EMBO J.
12:2929-2937[Medline].
|
| 42.
|
Kaiser, C.,
S. Michaelis, and A. Mitchell.
1994.
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Kalab, P.,
R. T. Pu, and M. Dasso.
1999.
The Ran GTPase regulates mitotic spindle assembly.
Curr. Biol.
9:481-484[CrossRef][Medline].
|
| 44.
|
Kehlenbach, R. H.,
A. Dickmanns,
A. Kehlenbach,
T. Guan, and L. Gerace.
1999.
A role for RanBP1 in the release of CRM1 from the nuclear pore complex in a terminal step of nuclear export.
J. Cell Biol.
145:645-657[Abstract/Free Full Text].
|
| 45.
|
Koepp, D. M.,
D. H. Wong,
A. H. Corbett, and P. A. Silver.
1996.
Dynamic localization nuclear import receptor and its interactions with transport factors.
J. Cell Biol.
133:1163-1176[Abstract/Free Full Text].
|
| 46.
|
Künzler, M., and E. C. Hurt.
1998.
Cse1p functions as the nuclear export receptor for importin a in yeast.
FEBS Lett.
433:185-190[CrossRef][Medline].
|
| 47.
|
Lau, D.,
M. Künzler,
A. Braunwarth,
K. Hellmuth,
A. Podtelejnikov,
M. Mann, and E. Hurt.
2000.
Purification of protein A-tagged yeast Ran reveals association with a novel karyopherin family member Pdr6p.
J. Biol. Chem.
274:467-471.
|
| 48.
|
Loeb, J. D. J.,
L. I. Davis, and G. R. Fink.
1993.
NUP2, a novel yeast nucleoporin, has functional overlap with other proteins of the nuclear pore complex.
Mol. Biol. Cell
4:209-222[Abstract].
|
| 49.
|
Lounsbury, K. M., and I. G. Macara.
1997.
Ran-binding protein 1 (RanBP1) forms a ternary complex with Ran and karyopherin beta and reduces Ran GTPase-activating protein (RanGAP) inhibition by karyopherin beta.
J. Biol. Chem.
272:551-555[Abstract/Free Full Text].
|
| 50.
|
Melchior, F., and L. Gerace.
1998.
Two-way trafficking with Ran.
Trends Cell Biol.
8:175-179[CrossRef][Medline].
|
| 51.
|
Moore, M. S.
1998.
Ran and nuclear transport.
J. Biol. Chem.
273:22857-22860[Free Full Text].
|
| 52.
|
Mueller, L.,
V. C. Cordes,
R. Bischoff, and H. Ponstingl.
1998.
Human RanBP3, a group of nuclear RanGTP binding proteins.
FEBS Lett.
427:330-336[CrossRef][Medline].
|
| 53.
|
Neville, M., and M. Rosbash.
1999.
The NES-Crm1p export pathway is not a major mRNA export route in Saccharomyces cerevisiae.
EMBO J.
18:3746-3756[CrossRef][Medline].
|
| 54.
|
Neville, M.,
F. Stutz,
L. Lee,
L. I. Davis, and M. Rosbash.
1997.
The importin-beta family member Crm1p bridges the interaction between Rev and the nuclear pore complex during nuclear export.
Curr. Biol.
7:767-775[CrossRef][Medline].
|
| 55.
|
Noguchi, E.,
N. Hayashi,
N. Nakashima, and T. Nishimoto.
1997.
Yrb2p, a Nup2p-related yeast protein, has a functional overlap with Rna1p, a yeast Ran-GTPase-activating protein.
Mol. Cell. Biol.
17:2235-2246[Abstract].
|
| 56.
|
Noguchi, E.,
Y.-h. Saitoh,
S. Sazer, and T. Nishimoto.
1999.
Disruption of the YRB2 gene retards nuclear protein export, causing a profound mitotic delay, and can be rescued by overexpression of XPO1/CRM1.
J. Biochem.
125:574-585[Abstract/Free Full Text].
|
| 57.
|
Novoa, I.,
M. G. Rush, and P. D'Eustachio.
1999.
Isolated mammalian and Schizosaccharomyces pombe Ran-binding domains rescue S. pombe spb1 (RanBP1) genomic mutants.
Mol. Biol. Cell
10:2175-2190[Abstract/Free Full Text].
|
| 58.
|
Ohno, M.,
M. Fornerod, and I. W. Mattaj.
1998.
Nucleocytoplasmic transport: the last 200 nanometers.
Cell
92:327-336[CrossRef][Medline].
|
| 59.
|
Ouspenski, I. I.,
U. W. Mueller,
A. Matynia,
S. Sazer,
S. J. Elledge, and B. R. Brinkley.
1995.
Ran-binding protein-1 is an essential component of the Ran/RCC1 molecular switch system in budding yeast.
J. Biol. Chem.
270:1975-1978[Abstract/Free Full Text].
|
| 60.
|
Panté, N., and U. Aebi.
1996.
Sequential binding of import ligands to distinct nucleopore regions during their nuclear import.
Science
273:1729-1732[Abstract/Free Full Text].
|
| 61.
|
Paraskeva, E.,
E. Izaurralde,
F. R. Bischoff,
J. Huber,
U. Kutay,
E. Hartmann,
R. Lührmann, and D. Görlich.
1999.
CRM1-mediated recycling of Snurportin 1 to the cytoplasm.
J. Cell Biol.
145:255-264[Abstract/Free Full Text].
|
| 62.
|
Pasquinelli, A. E.,
M. A. Powers,
E. Lund,
D. J. Forbes, and J. E. Dahlberg.
1997.
Inhibition of mRNA export in vertebrate cells by nuclear export signal conjugates.
Proc. Natl. Acad. Sci. USA
94:13394-14399.
|
| 63.
|
Pemberton, L. F.,
G. Blobel, and J. Rosenblum.
1998.
Transport routes through the nuclear pore complex.
Curr. Opin. Cell Biol.
10:392-399[CrossRef][Medline].
|
| 64.
|
Pu, R. T., and M. Dasso.
1997.
The balance of RanBP1 and RCC1 is critical for nuclear assembly and nuclear transport.
Mol. Biol. Cell
8:1955-1970[Abstract/Free Full Text].
|
| 65.
|
Richards, S. A.,
K. L. Carey, and I. G. Macara.
1997.
Requirement of guanosine triphosphate-bound Ran for signal-mediated nuclear protein export.
Science
276:1842-1844[Abstract/Free Full Text].
|
| 66.
|
Richards, S. A.,
K. M. Lounsbury,
K. L. Carey, and I. G. Macara.
1996.
A nuclear export signal is essential for the cytosolic localization of the ran binding protein, RanBP1.
J. Cell Biol.
134:1157-1168[Abstract/Free Full Text].
|
| 67.
|
Saiki, R. K.,
D. H. Gelfand,
S. Stoffel,
S. J. Scharf,
R. Higuchi,
G. T. Horn,
K. B. Mullis, and H. A. Erlich.
1988.
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science
239:487-494[Abstract/Free Full Text].
|
| 68.
|
Sambrook, J.,
E. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 69.
|
Schlenstedt, G.,
E. Smirnova,
R. Deane,
J. Solsbacher,
U. Kutay,
D. Görlich,
H. Ponstingl, and F. R. Bischoff.
1997.
Yrb4p, a yeast Ran-GTP-binding protein involved in import of ribosomal protein L25 into the nucleus.
EMBO J.
16:6237-6249[CrossRef][Medline].
|
| 70.
|
Schlenstedt, G.,
D. H. Wong,
D. M. Koepp, and P. A. Silver.
1995.
Mutants in a yeast Ran binding protein are defective in nuclear transport.
EMBO J.
14:5367-5378[Medline].
|
| 71.
|
Seedorf, M.,
M. Damelin,
J. Kahana,
T. Taura, and P. A. Silver.
1999.
Interactions between a nuclear transporter and a subset of nuclear pore complex proteins depend on Ran GTPase.
Mol. Cell. Biol.
19:1547-1557[Abstract/Free Full Text].
|
| 72.
|
Senger, B.,
G. Simos,
F. R. Bischoff,
A. V. Podtelejnikov,
M. Mann, and E. C. Hurt.
1998.
Mtr10p functions as a nuclear import receptor for the mRNA binding protein Np13p.
EMBO J.
17:2196-2207[CrossRef][Medline].
|
| 73.
|
Sikorski, R. S., and R. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 74.
|
Solsbacher, J.,
P. Maurer,
F. R. Bischoff, and G. Schlenstedt.
1998.
Cse1p is involved in export of yeast importin from the nucleus.
Mol. Cell. Biol.
18:6805-6815[Abstract/Free Full Text].
|
| 75.
|
Stade, K.,
C. S. Ford,
C. Guthrie, and K. Weis.
1997.
Exportin 1 (Crm1p) is an essential nuclear export factor.
Cell
90:1041-1050[CrossRef][Medline].
|
| 76.
|
Stoffler, D.,
B. Fahrenkrog, and U. Aebi.
1999.
The nuclear pore complex: from molecular architecture to functional dynamics.
Curr. Opin. Cell Biol.
11:391-401[CrossRef][Medline].
|
| 77.
|
Stotz, A., and P. Linder.
1990.
The ADE2 gene from Saccharomyces cerevisiae: sequence and new vectors.
Gene
95:91-98[CrossRef][Medline].
|
| 78.
|
Studier, F. W.,
H. A. Rosemberg,
J. J. Dunn, and J. W. Dubendorff.
1990.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:62-89.
|
| 79.
|
Stutz, F.,
M. Neville, and M. Rosbash.
1995.
Identification of a novel nuclear pore-associated protein as a functional target of the HIV-1 Rev protein in yeast.
Cell
82:495-506[CrossRef][Medline].
|
| 80.
|
Tabor, S., and C. Richardson.
1987.
DNA sequence analysis with a modified T7 DNA polymerase.
Proc. Natl. Acad. Sci. USA
84:4767-4771[Abstract/Free Full Text].
|
| 81.
|
Talcott, B., and M. S. Moore.
1999.
Getting across the nuclear pore complex.
Trends Cell Biol.
9:312-318[CrossRef][Medline].
|
| 82.
|
Taura, T.,
H. Krebber, and P. A. Silver.
1998.
A member of the Ran-binding protein family, Yrb2p, is involved in nuclear protein export.
Proc. Natl. Acad. Sci. USA
95:7427-7432[Abstract/Free Full Text].
|
| 83.
|
Taura, T.,
G. Schlenstedt, and P. A. Silver.
1997.
Yrb2p is a nuclear protein that interacts with Prp20p, a yeast Rcc1 homologue.
J. Biol. Chem.
272:31877-31884[Abstract/Free Full Text].
|
| 84.
|
Turi, T. G.,
U. W. Mueller,
S. Sazer, and J. Rose.
1996.
Characterization of a nuclear protein conferring Brefeldin A resistance in Schizosaccharomyces pombe.
J. Biol. Chem.
271:9166-9171[Abstract/Free Full Text].
|
| 85.
|
Vetter, I.,
C. Nowak,
T. Nishimoto,
J. Kuhlmann, and A. Wittinghofer.
1999.
Structure of a Ran-binding domain complexed with Ran bound to a GTP analogue: implications for nuclear transport.
Nature
398:39-46[CrossRef][Medline].
|
| 86.
|
Weis, K.
1998.
Importins and exportins: how to get in and out of the nucleus.
Trends Biochem. Sci.
23:185-189[CrossRef][Medline].
|
| 87.
|
Wilken, N.,
J. L. Senécal,
U. Scheer, and M. C. Dabauvalle.
1995.
Localization of the Ran-GTP binding protein RanBP2 at the cytoplasmic side of the nuclear pore complex.
Eur. J. Cell Biol.
68:211-219[Medline].
|
| 88.
|
Wolff, B.,
J.-J. Sanglier, and Y. Wang.
1997.
Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent RNA.
Chem. Biol.
4:139-147[CrossRef][Medline].
|
| 89.
|
Wozniak, R. W.,
M. P. Rout, and J. D. Aitchison.
1998.
Karyopherins and kissing cousins.
Trends Cell Biol.
8:184-188[CrossRef][Medline].
|
| 90.
|
Wu, J.,
M. J. Matunis,
D. Kraemer,
G. Blobel, and E. Coutavas.
1995.
Nup358, a cytoplasmically exposed nucleoporin with peptide repeats, Ran-GTP binding sites, zinc fingers, a cyclophilin A homologous domain, and a leucine-rich region.
J. Biol. Chem.
270:14209-14213[Abstract/Free Full Text].
|
| 91.
|
Xiao, Z.,
J. T. McGrew,
A. J. Schroeder, and M. Fitzgerald-Hayes.
1993.
CSE1 and CSE2, two new genes required for accurate mitotic chromosome segregation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:4691-4702[Abstract/Free Full Text].
|
| 92.
|
Yan, C.,
L. H. Lee, and L. I. Davis.
1998.
Crm1p mediates regulated nuclear export of a yeast AP-1-like transcription factor.
EMBO J.
17:7416-7429[CrossRef][Medline].
|
| 93.
|
Yokoyama, N.,
N. Hayashi,
T. Seki,
N. Panté,
T. Ohba,
K. Nishii,
K. Kuma,
T. Hayashida,
T. Miyata,
U. Aebi,
M. Fukui, and T. Nishimoto.
1995.
A giant nucleopore protein that binds Ran/TC4.
Nature
376:184-188[CrossRef][Medline].
|
| 94.
|
Zhang, C.,
M. Hughes, and P. R. Clarke.
1999.
Ran-GTP stabilizes microtubule asters and inhibits nuclear assembly in Xenopus egg extracts.
J. Cell Sci.
112:2453-2461[Abstract].
|
| 95.
|
Zolotukhin, A. S., and B. K. Felber.
1997.
Mutations in the nuclear export signal of human Ran-binding protein RanBP1 block the Rev-mediated posttranscriptional regulation of human immunodeficiency virus type 1.
J. Biol. Chem.
272:11356-11360[Abstract/Free Full Text].
|
Molecular and Cellular Biology, June 2000, p. 4295-4308, Vol. 20, No. 12
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lonhienne, T. G., Forwood, J. K., Marfori, M., Robin, G., Kobe, B., Carroll, B. J.
(2009). Importin-{beta} Is a GDP-to-GTP Exchange Factor of Ran: IMPLICATIONS FOR THE MECHANISM OF NUCLEAR IMPORT. J. Biol. Chem.
284: 22549-22558
[Abstract]
[Full Text]
-
Pelaez, R., Herrero, P., Moreno, F.
(2009). Nuclear Export of the Yeast Hexokinase 2 Protein Requires the Xpo1 (Crm1)-dependent Pathway. J. Biol. Chem.
284: 20548-20555
[Abstract]
[Full Text]
-
Neuber, A., Franke, J., Wittstruck, A., Schlenstedt, G., Sommer, T., Stade, K.
(2008). Nuclear Export Receptor Xpo1/Crm1 Is Physically and Functionally Linked to the Spindle Pole Body in Budding Yeast. Mol. Cell. Biol.
28: 5348-5358
[Abstract]
[Full Text]
-
Gibney, P. A., Fries, T., Bailer, S. M., Morano, K. A.
(2008). Rtr1 Is the Saccharomyces cerevisiae Homolog of a Novel Family of RNA Polymerase II-Binding Proteins. Eukaryot Cell
7: 938-948
[Abstract]
[Full Text]
-
Fries, T., Betz, C., Sohn, K., Caesar, S., Schlenstedt, G., Bailer, S. M.
(2007). A Novel Conserved Nuclear Localization Signal Is Recognized by a Group of Yeast Importins. J. Biol. Chem.
282: 19292-19301
[Abstract]
[Full Text]
-
Nishijima, H., Nakayama, J.-i., Yoshioka, T., Kusano, A., Nishitani, H., Shibahara, K.-i., Nishimoto, T.
(2006). Nuclear RanGAP Is Required for the Heterochromatin Assembly and Is Reciprocally Regulated by Histone H3 and Clr4 Histone Methyltransferase in Schizosaccharomyces pombe. Mol. Biol. Cell
17: 2524-2536
[Abstract]
[Full Text]
-
BRUNE, C., MUNCHEL, S. E., FISCHER, N., PODTELEJNIKOV, A. V., WEIS, K.
(2005). Yeast poly(A)-binding protein Pab1 shuttles between the nucleus and the cytoplasm and functions in mRNA export. RNA
11: 517-531
[Abstract]
[Full Text]
-
Betz, C., Schlenstedt, G., Bailer, S. M.
(2004). Asr1p, a Novel Yeast Ring/PHD Finger Protein, Signals Alcohol Stress to the Nucleus. J. Biol. Chem.
279: 28174-28181
[Abstract]
[Full Text]
-
Miyaji-Yamaguchi, M., Kato, K., Nakano, R., Akashi, T., Kikuchi, A., Nagata, K.
(2003). Involvement of Nucleocytoplasmic Shuttling of Yeast Nap1 in Mitotic Progression. Mol. Cell. Biol.
23: 6672-6684
[Abstract]
[Full Text]
-
Braunwarth, A., Fromont-Racine, M., Legrain, P., Bischoff, F. R., Gerstberger, T., Hurt, E., Kunzler, M.
(2003). Identification and Characterization of a Novel RanGTP-binding Protein in the Yeast Saccharomyces cerevisiae. J. Biol. Chem.
278: 15397-15405
[Abstract]
[Full Text]
-
Kunzler, M., Hurt, E.
(2002). Targeting of Ran: variation on a common theme?. J. Cell Sci.
114: 3233-3241
[Abstract]
[Full Text]
-
Nicolas, F. J., Moore, W. J., Zhang, C., Clarke, P. R.
(2002). XMog1, a nuclear Ran-binding protein in Xenopus, is a functional homologue of Schizosaccharomyces pombe Mog1p that co-operates with RanBP1 to control generation of Ran-GTP. J. Cell Sci.
114: 3013-3023
[Abstract]
[Full Text]
-
Macara, I. G.
(2001). Transport into and out of the Nucleus. Microbiol. Mol. Biol. Rev.
65: 570-594
[Abstract]
[Full Text]
-
Jenkins, Y., Sanchez, P. V., Meyer, B. E., Malim, M. H.
(2001). Nuclear Export of Human Immunodeficiency Virus Type 1 Vpr Is Not Required for Virion Packaging. J. Virol.
75: 8348-8352
[Abstract]
[Full Text]
-
Dilworth, D. J., Suprapto, A., Padovan, J. C., Chait, B. T., Wozniak, R. W., Rout, M. P., Aitchison, J. D.
(2001). Nup2p Dynamically Associates with the Distal Regions of the Yeast Nuclear Pore Complex. JCB
153: 1465-1478
[Abstract]
[Full Text]
-
Grosshans, H., Deinert, K., Hurt, E., Simos, G.
(2001). Biogenesis of the Signal Recognition Particle (Srp) Involves Import of Srp Proteins into the Nucleolus, Assembly with the Srp-Rna, and Xpo1p-Mediated Export. JCB
153: 745-762
[Abstract]
[Full Text]
-
Künzler, M., Trueheart, J., Sette, C., Hurt, E., Thorner, J.
(2001). Mutations in the YRB1 Gene Encoding Yeast Ran-Binding-Protein-1 That Impair Nucleocytoplasmic Transport and Suppress Yeast Mating Defects. Genetics
157: 1089-1105
[Abstract]
[Full Text]
-
Maurer, P., Redd, M., Solsbacher, J., Bischoff, F. R., Greiner, M., Podtelejnikov, A. V., Mann, M., Stade, K., Weis, K., Schlenstedt, G.
(2001). The Nuclear Export Receptor Xpo1p Forms Distinct Complexes with NES Transport Substrates and the Yeast Ran Binding Protein 1 (Yrb1p). Mol. Biol. Cell
12: 539-549
[Abstract]
[Full Text]
-
Baumer, M., Kunzler, M., Steigemann, P., Braus, G. H., Irniger, S.
(2000). Yeast Ran-binding Protein Yrb1p Is Required for Efficient Proteolysis of Cell Cycle Regulatory Proteins Pds1p and Sic1p. J. Biol. Chem.
275: 38929-38937
[Abstract]
[Full Text]