Previous Article | Next Article 
Molecular and Cellular Biology, June 2000, p. 4381-4392, Vol. 20, No. 12
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The CaaX Proteases, Afc1p and Rce1p, Have
Overlapping but Distinct Substrate Specificities
Cynthia Evans
Trueblood,1
Victor L.
Boyartchuk,1,
Elizabeth A.
Picologlou,1
David
Rozema,2
C. Dale
Poulter,2 and
Jasper
Rine1,*
Molecular and Cell Biology Department,
University of California, Berkeley, California
94720,1 and Department of Chemistry,
University of Utah, Salt Lake City, Utah 841122
Received 24 November 1999/Returned for modification 10 January
2000/Accepted 6 March 2000
 |
ABSTRACT |
Many proteins that contain a carboxyl-terminal CaaX sequence
motif, including Ras and yeast a-factor, undergo a series of sequential
posttranslational processing steps. Following the initial prenylation
of the cysteine, the three C-terminal amino acids are proteolytically
removed, and the newly formed prenylcysteine is carboxymethylated. The
specific amino acids that comprise the CaaX sequence influence whether
the protein can be prenylated and proteolyzed. In this study, we
evaluated processing of a-factor variants with all possible single
amino acid substitutions at either the a1, the
a2, or the X position of the a-factor
Ca1a2X sequence, CVIA. The substrate
specificity of the two known yeast CaaX proteases, Afc1p and Rce1p, was
investigated in vivo. Both Afc1p and Rce1p were able to proteolyze
a-factor with A, V, L, I, C, or M at the a1 position, V, L,
I, C, or M at the a2 position, or any amino acid at the X
position that was acceptable for prenylation of the cysteine. Eight
additional a-factor variants with a1 substitutions were
proteolyzed by Rce1p but not by Afc1p. In contrast, Afc1p was able to
proteolyze additional a-factor variants that Rce1p may not be able to
proteolyze. In vitro assays indicated that farnesylation was
compromised or undetectable for 11 a-factor variants that produced no
detectable halo in the wild-type AFC1 RCE1 strain. The
isolation of mutations in RCE1 that improved proteolysis of
a-factor-CAMQ, indicated that amino acid substitutions E139K, F189L,
and Q201R in Rce1p affected its substrate specificity.
 |
INTRODUCTION |
Traditionally, the CaaX sequence
motif has been defined as a cysteine (C) four amino acids from the C
terminus, followed by two amino acids that are often aliphatic (aa),
and a C-terminal amino acid (X). Proteins containing a CaaX sequence
motif undergo a series of sequential posttranslational
modifications that are important for their localization and
function. Processing of most CaaX proteins, including Ras,
Rho, G protein gamma subunit, and yeast a-factor,
involves prenylation of the cysteine four amino acids from the C
terminus, endoproteolytic removal of the three C-terminal amino acids,
and carboxymethylation of the newly formed prenyl cysteine. The
specific amino acids that comprise the CaaX sequence influence whether
the 15-carbon farnesyl group or the 20-carbon geranylgeranyl group is
attached to the cysteine and whether the aaX sequence is
proteolytically removed. Considerable effort has been made to define
the sequence features that influence prenylation by the
farnesyltransferase and the geranylgeranyltransferase I (7, 8, 30,
35). More recently, two CaaX proteases, Afc1p and Rce1p, have
been identified in yeast (4), and homologs of these enzymes
have been found in mammals (12, 23, 32, 40; D. H. Wong, C. E. Trueblood, D. Dimster-Denk, J. W. Phillips, P. M. Lagaay, J. Rine, and M. N. Ashby, unpublished data).
Since activated Ras function in yeast is attenuated when the aaX
sequence is not removed (4), the CaaX proteases that process
Ras may be targets for anticancer drug discovery. A number of CaaX
protease inhibitors are currently being developed (10, 27).
There is relatively little information about substrate sequence
requirements for the CaaX proteases. Even though the aaX sequence is
removed from most CaaX proteins, including Ras and Rho proteins (11, 15, 16), some CaaX proteins, such as the alpha and beta subunits of phosphorylase kinase from rabbit muscle
(17), retain the aaX sequence after farnesylation. For most
CaaX proteins, the identity of the CaaX proteases responsible for
cleavage has not been determined. Despite great interest in biochemical
characterization of the CaaX proteolytic activity, only partial
purification has been achieved (2, 10, 20, 31), presumably
because the CaaX proteases are integral membrane proteins. A recent
in vitro study examined the ability of a mammalian membrane fraction to proteolyze a large set of CaaX peptide substrates (20). Yet, it is not clear which CaaX protease was being assayed or whether more
than one CaaX protease was present in the membrane fraction.
The isolation of the Saccharomyces cerevisiae AFC1 and
RCE1 genes (4) clarified the identity of the
various yeast CaaX protease activities that had been reported (3,
11, 18) and demonstrated that Afc1p and Rce1p have distinct but
overlapping CaaX sequence specificities. Despite a lack of sequence
similarity, both Afc1p and Rce1p process the a-factor CaaX
sequence, CVIA. However, the CaaX sequences CAMQ and CTLM, when
substituted into a-factor, can be processed only by Afc1p
and Rce1p, respectively (4). Rce1p also proteolyzes the CaaX
sequence of yeast Ras2 protein, CIIS, but apparently Afc1p does not
(4).
In our study, a-factor variants with all possible single
amino acids substitutions at either the a1, a2,
or X position of the Ca1a2X sequence were
expressed in MATa yeast strains that lacked one, both,
or neither of the CaaX protease genes, AFC1 and
RCE1. The processing of a-factor was measured by
halo assay, a biological readout in which secretion of fully processed
a-factor leads to growth arrest of a lawn of MAT
cells. Halo data, together with in vitro
farnesylation information, were used to determine which CaaX sequences
were farnesylated and which were proteolyzed by Acf1p and Rce1p. In
addition, a region of the Rce1p CaaX protease that affects substrate
recognition was identified.
 |
MATERIALS AND METHODS |
Plasmids.
A series of plasmids encoding a-factor
variants with single amino acid substitutions at either the
a1, a2, or X position of the CaaX sequence were
generated by insertion of PCR products (encoding the last seven amino
acids of the a-factor precursor and the 3' flanking
sequence) between the BamHI and EcoRI sites of
YCpL-MFA1', a CEN LEU2 plasmid that carries the
MFA1 promoter and coding sequence for the first 29 amino
acids of the a-factor precursor (43). The
BamHI site in the MFA1 gene of YCpL-MFA1' was
created by site-directed mutagenesis of nucleotide 90 from C to T. The
5' oligonucleotides used in PCR with Perkin-Elmer Taq
polymerase were derivatives of
C-TGG-GAT-CCA-GCA-TGT-GTT-ATT-GCT-TAG-TTT-C that differ in the nucleotides present in the a1,
a2, or X codon (in boldface). For the a1,
a2, and X substitution series, the oligonucleotide
synthesis included a mixture of all four nucleotides at the
a1, a2, and X codons, respectively. The
BamHI site that was used to clone the PCR products is
underlined. The 3' oligonucleotide used in the PCR
(TCA-CTG-TAT-ACG-GAA-TTC-TCA-TCA-GC)
contained an EcoRI site (underlined) and was
complementary to the 3' flanking sequence of the MFA1 gene,
except for the C in boldface. After ligation into the YCpL-MFA1'
BamHI-EcoRI vector fragment and transformation of
Escherichia coli, individual plasmids were sequenced.
Approximately 75% of the a1, a2, and X
substitutions were obtained by sequencing about 60 plasmids from each
of the three transformant pools. The remaining a-factor
variants were constructed by a similar strategy using specific
oligonucleotides. a-factor variants with G, A, V, L, I, S,
T, D, N, E, Q, K, R, H, W, F, Y, P, C, and M at the a1
position are encoded by plasmids pJR2047 to pJR2066, respectively.
a-factor variants with G, A, V, L, I, S, T, D, N, E, Q, K,
R, H, W, F, Y, P, C, and M at the a2 position are encoded
by plasmids pJR2067 to pJR2086, respectively. a-factor variants with G, A, V, L, I, S, T, D, N, E, Q, K, R, H, W, F, Y, P, C,
and M at the X position are encoded by plasmids pJR2087 to pJR2106, respectively.
a-factor variants with the CaaX sequences CASQ (pJR2111),
CTVM (pJR2112), and CSVM (pJR2113) were made using the same strategy
with 5' oligonucleotides encoding these specific CaaX sequences. A gene
encoding an a-factor variant with the CaaX sequence CAMQ was
constructed using oligonucleotide-directed mutagenesis to change the
CaaX sequence of the MFA1 gene in pJR1457, a plasmid with
the 1.57-kb EcoRI-XbaI MFA1 fragment
inserted at the BamHI site of pRS426. The resulting plasmid,
pJR1561, was used as a source of the gene encoding
a-factor-CAMQ, which was cloned into the polylinker regions
of pRS416 and pRS415 to yield pJR1556 and pJR2114, respectively.
MFA1 plasmids that encoded variants of a-factor
that lack amino acids 2 through 5 were created by PCR using two
oligonucleotides (5-M-5E [GAAATGCAGAATTCTATGGCTACCGCCGCTCCAAAAG]
and 3-MFA1S [GAATGGACAGTCGACAATTAACTGG]) annealed to
the 5' coding region and 3' flanking sequence of the MFA1
genes, respectively. To make the desired constructs, plasmids with
different CaaX sequences were used as templates for PCR. The PCR
fragments were inserted between the EcoRI and
SalI sites of pJR1133, a 2µm URA3 expression
vector that has the TDH3 promoter and PGK1
terminator. pJR1133 was constructed by deleting the
BamHI-EcoRI region of YEplac195 (14)
and inserting, between the HindIII and XbaI
sites, a ~3.4-kb HindIII-XbaI fragment
from pG-3 (37) that has the TDH3 promoter and
PGK terminator, separated by multiple cloning sites that
flank a 1.7-kb HindII fragment from the lac operon. MFA1 plasmids that encode a-factor
variants lacking amino acids 2 through 5 were constructed with the
following CaaX sequences: CVIA (pJR1995), CVAA (pJR1980),
CVLA (pJR1981), CVSA (pJR1982), CVTA (pJR1983), CVQA (pJR1984),
CVHA (pJR1985), CVWA (pJR1986), CVFA (pJR1987), CVYA (pJR1988), CVCA
(pJR1989), CVIG (pJR1990), CVID (pJR1991), CVIE (pJR1992), and CVIK (pJR1993).
Strains.
Strains used in these studies were constructed by
standard genetic manipulations and grown on standard media
(1). The AFC1 RCE1 (JRY5460), afc1
RCE1 (JRY5461), AFC1 rce1
(JRY5462), and afc1
rce1
(JRY5463) strains used for these studies are
closely related to W303-1a (41) and have the following
alleles: MATa his3 leu2 trp1 ura3
ram1H83Y mfa1::hisG mfa2
::hisG. The
construction of these strains is described below. The
mfa2
::hisG::URA3::hisG and
mfa1::hisG::URA3::hisG alleles were constructed
and transformed sequentially into JRY2640 to create a
mata1 mfa1::hisG mfa2
::hisG ade2 leu2 lys2 ura3 can1 strain, JRY4276 (4). JRY4276 was transformed
with MAT
plasmid pJR157 to create strain JRY5390, which
was then crossed to a MATa his3 leu2 trp1 ura3
afc1
::HIS3 strain (JRY5315) (4). The resulting
diploid was sporulated to obtain a MATa his3 leu2
trp1 ura3 afc1
::HIS3 mfa1::hisG mfa2
::hisG
segregant that was then crossed to a W303 strain that had the
MATa promoter deleted (mata
p) and
had a MAT
plasmid. This diploid yielded a
mata
p his3 leu2 trp1 ura3 afc1
::HIS3 mfa1::hisG mfa2
::hisG segregant, JRY5459, which was
transformed with a MAT
plasmid and then crossed to
JRY5316 (MATa his3 leu2 trp1 ura3
rce1
::TRP1) (4). The AFC1 RCE1
(JRY5460), afc1
RCE1 (JRY5461), AFC1 rce1
(JRY5462), and afc1
rce1
(JRY5463) strains were
segregants from the resulting diploid strain. These four strains were
transformed with MFA1 plasmids (pJR2047 to pJR2106) that
encode the a-factor variants with all possible single amino
acids substitutions at either the a1, a2, or X position.
During the course of these studies, we discovered that the
RAM1 gene in strain W303 had a mutation that changes codon
83 from a histidine codon to a tyrosine codon. This mutant form of
Ram1p (the beta subunit of farnesyltransferase) reduced
farnesyltransferase activity in crude extracts approximately 10-fold
(W. Schafer and J. Rine, unpublished results). Since
farnesyltransferase plays a central role in a-factor
processing, it was important to determine whether the AFC1
RCE1 (JRY5460), afc1
RCE1 (JRY5461), AFC1
rce1
(JRY5462), and afc1
rce1
(JRY5463)
strains, which are closely related to W303, carried the same allele of
RAM1. Strains JRY5460, JRY5461, JRY5462, and JRY5463 were
all found to have the allele of RAM1 from W303, which we
designated ram1H83Y. Thus, differences in halo
sizes seen between these four strains were not due to differences in
farnesyltransferase activity.
To generate strains that overproduced wild-type Ram1p and thereby
minimize the limiting effect of farnesyltransferase on
a-factor production, the series of AFC1 RCE1
(JRY5460) strains carrying the CaaX variants of MFA1
(pJR2047 to pJR2106) was transformed with a high-copy-number
RAM1 plasmid, pJR856. An afc1
::HIS3
derivative of JRY5460 was created by transformation of JRY5460 with a
StuI-EcoRI fragment of pVB38 that carries the
afc1
::HIS3 allele. The resulting strain, JRY6095, was
transformed with a high-copy-number RAM1 plasmid, pJR856, to
generate strain JRY6529. JRY6095 and JRY6529 were transformed with
plasmids carrying the CaaX variants of MFA1 (pJR2047 to pJR2106).
AFC1 RCE1 (JRY5460), afc1
RCE1 (JRY6095),
AFC1 rce1
(JRY5462), and afc1
rce1
(JRY5463) strains were transformed with the series of MFA1
plasmids, pJR1980 to pJR1993 and pJR1995, which encode variants of
a-factor that lack amino acids 2 through 5.
The afc1
rce1
strain JRY5463 was transformed with
plasmids pJR1968, pJR1969, pJR1970, and pJR1971, which encode wild-type Rce1p and three mutant forms of Rce1p that alter substrate recognition: F189L, E139K F189L, and Q201R. The resulting strains (JRY6811, JRY6812,
JRY6813, and JRY6814) were transformed with MFA1 plasmids (pJR2047 to pJR2106) that encode the a-factor variants with
all possible single amino acids substitutions either at the a1, a2, or X position.
Halo assays.
The relative levels of a-factor
produced by various MATa strains were evaluated by
pheromone diffusion (halo) assay. One microliter of a yeast cell pellet
(approximately 106 cells) was spotted onto a solid rich
medium (YPD) plate containing 0.04% Triton X-100 that had been spread
with a lawn (approximately 2 × 106 cells) of the
MAT
sst2 strain, JRY3443. After 2 to 3 days of growth at
30°C, the relative amounts of a-factor produced by each
MATa strain were evident from the size of the zone of
growth inhibition (or halo) surrounding the MATa
cells. The sst2 mutation facilitates measurement of
a-factor production by making MAT
cells more sensitive to
a-factor-induced arrest (9). For the hydrophilic
-factor peptide, halo diameter is directly proportional to the log
of pheromone concentration (35). This simple relationship
between halo size and pheromone concentration is not observed for
a-factor because it is hydrophobic and does not diffuse
freely through the medium. The addition of Triton X-100 increases the
rate of diffusion of a-factor, thereby increasing the
sensitivity range of the halo assay. The relative halo sizes are
reflective of the amount of a-factor exported from the
MATa cells.
Farnesyltransferase enzyme assays.
The assay used for
farnesylation of peptides was described previously (36).
[3H] farnesyl diphosphate (9 µM, 80 µCi/µmol),
various peptides of the sequence RTRCxxx (0 to 2.0 mM), and protein
farnesyltransferase (116 nM) in buffer containing 50 mM Tris-HCl (pH
7.0), 5 mM MgCl2, 5 mM dithiothreitol, and 0.04% (wt/vol)
dodecyl-
-D-maltoside with a total volume of 50 µl were
incubated for 4 to 20 min at 25°C. Background levels were determined
by reactions containing no peptide. The reaction mixtures were then
spotted on a 1- by 3-cm strip of phosphocellulose P81 filter paper
(Whatman). The filter papers were immersed in a solution of 1:1 75 mM
H3PO4-95% ethanol (10 ml/strip) and gently
swirled on a rotary platform for 10 min, followed by two additional
10-min wash cycles with fresh wash solution. The individual wet strips
were transferred to scintillation vials containing 10 ml of Cytoscint
(ICN) and 0.5 ml of 6 M HCl. The concentration of farnesylated peptide
for each RTRCxxx peptide was then calculated by subtraction of
background radioactivity from the radioactivity for each peptide.
In vitro PCR mutagenesis.
A DNA fragment containing the
RCE1 open reading frame cloned into pRS315 LEU2
CEN vector was used as a template for PCR-based random mutagenesis
of RCE1. The mutagenesis was performed in the PCR by
increasing the final concentration of three of the four nucleotides to
1 mM, while maintaining the final concentration of the fourth dropout
nucleotide at 0.1 mM. The dropout reaction mixtures were set up
separately for all four nucleotide combinations. The final
concentration of magnesium used in mutagenic PCR reactions was 7 mM.
Commercially available M13 forward and reverse sequencing primers (New
England Biolabs) were used at the final concentration of 1 µM in a
100 µl of RCE1 amplification reaction mixture. PCR products obtained with each dropout nucleotide mix were purified and pooled.
Identification of Rce1p variants with altered substrate
specificity.
The pRS315 LEU2 CEN vector (5 µg) was
digested with restriction enzymes PstI and
HindIII to generate a linear backbone. The pooled PCR
product (10 µl) obtained in the mutagenic PCR was cotransformed with
0.5 µg of the linearized backbone into the afc1
rce1
mfa1 mfa2
yeast strain, JRY5463, which had been transformed with the CAMQ version of MFA1 on a CEN URA3 pRS316 plasmid
(pJR1556). Each of six independent transformation reactions was
subdivided and plated on five plates. After incubation at 30°C for 3 days, transformants (approximately 250/plate) were replica plated
directly onto a lawn of
sst2 cells to identify strains
containing the versions of RCE1 displaying improved
processing of the a-factor-CAMQ substrate. Halos were
visible after 36 h of incubation at 30°C. The second round of
selection was performed in a similar fashion using the F189L
RCE1 mutant as a template for mutagenesis.
 |
RESULTS |
Substrate specificities of Afc1p and Rce1p CaaX proteases.
To investigate the protein substrate specificities of the Afc1p and
Rce1p CaaX proteases, we examined the posttranslational processing
of a-factor variants that had all possible single amino acid
substitutions at either the a1, a2, or X
position of the a-factor CaaX sequence, CVIA. Plasmids
encoding all 57 single amino acid CaaX variants and wild-type
a-factor were transformed into four MATa
yeast strains that differ in their CaaX protease genes: AFC1
RCE1 (JRY5460), afc1 RCE1 (JRY5461), AFC1
rce1 (JRY5462), and afc1 rce1 (JRY5463). The relative
levels of a-factor produced by these strains were evaluated
by a-factor pheromone diffusion (halo) assay (Fig.
1). In this assay, secretion of fully
processed a-factor leads to growth arrest of a lawn of
MAT
cells. The size of the a-factor halo, a
zone of growth inhibition of MAT
cells, reflects the amount of functional a-factor exported from the
MATa cells. To be exported and functional, the
36-amino-acid a-factor precursor undergoes farnesylation of
the cysteine four amino acids from the C terminus, followed by
proteolytic removal of the aaX sequence, carboxylmethylation of the
newly formed C terminus, and two N-terminal proteolytic cleavage
events. Mature a-factor is a 12-amino-acid protein that
is farnesylated and carboxylmethylated. As discussed below, the in vivo
halo results provided valuable information about the specificities of
the Afc1p and Rce1p CaaX proteases. Note that for
a-factor CaaX sequence variants that produced no halos,
interpretation of the a-factor halo results requires
knowledge about the extent of farnesylation, since production of mature
a-factor requires multiple processing steps and
farnesylation must occur prior to the other steps. In vitro
farnesylation data, presented below, aided in the interpretation of
a-factor halo data for the CaaX sequence that produced no halos.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 1.
a-factor CaaX variants expressed in
strains with and without AFC1 and RCE1 produce
different amounts of mature a-factor. Plasmids encoding
a-factor variants with all possible single amino acid
substitutions at either the a1 (A), a2 (B), or
X (C) position of the wild-type a-factor CaaX sequence,
CVIA, were transformed into four MATa yeast strains
that differ in their CaaX protease genes: AFC1 RCE1
(JRY5460), afc1 RCE1 (JRY5461), AFC1 rce1
(JRY5462), and afc1 rce1 (JRY5463). The relative levels of
a-factor produced by these strains were evaluated by
a-factor pheromone diffusion (halo) assay, a biological
assay in which secretion of fully processed a-factor leads
to growth arrest of MAT cells (see Materials and
Methods). Biologically active a-factor exported from the
MATa strains arrested growth of the MAT
sst2 cells, forming a zone of growth inhibition (halo) that
reflects the amount of a-factor produced.
|
|
Amino acid substitutions at the a1 position of the
a-factor CaaX sequence (Fig. 1A) revealed that both
CaaX proteases were able to accept a common set of amino acids at
this position. Rce1p was also able to accept additional amino acids at
the a1 position. Specifically, a-factor variants
with A, V, L, I, C, or M at the a1 position were substrates
of both Afc1p and Rce1p CaaX proteases, as shown by the presence of
halos in strains that had either AFC1 or RCE1 and
the absence of halos in strains lacking both AFC1 and
RCE1. The a-factor variant with F at the
a1 position appeared to be a substrate of Afc1p but not Rce1p, since no halo was observed in the afc1
strain. In
contrast, substitutions of S, T, N, E, Q, K, R, and H at the
a1 position created substrates that could be processed by
Rce1p but not by Afc1p. It should be noted that the Rce1p-dependent
halos in the afc1
strain were smaller than the halos
produced by the same substrates in wild-type cells (Fig. 1A). At first
glance, one might wonder why these halo sizes were smaller in the
absence of Afc1p, if these CaaX sequences are not processed by
Afc1p. The explanation for this apparent discrepancy is that Afc1p has two roles in a-factor processing: it cleaves the CaaX
sequence at the carboxyl terminus and also contributes to N-terminal
processing (5, 40). Thus, in afc1
strains, the
size of all Rce1p-dependent halos was reduced due to loss of the Afc1p
N-terminal contribution.
Substitutions of G, D, W, Y, and P at the a1 position
created substrates that produced either very small halos (G, D, Y) or no halos (W, P). These deficiencies in a-factor production could result from poor proteolytic processing and/or poor prenylation. The halo data alone did not allow us to distinguish between these possibilities, but in vivo and in vitro results, described below, indicate that poor prenylation is at least partially responsible for
the decreased a-factor production of these variants. Introduction of W, Y, and P at the a1 position caused a
decrease in the efficiency of farnesylation of synthetic peptides in
vitro, suggesting that inefficient prenylation was partially
responsible for poor a-factor production in vivo. However, a
comparison of halo sizes and in vitro farnesylation data with findings
for other peptides indicates that W, Y, and P at the a1
position must also decrease the efficiency of CaaX proteolysis. No
in vitro farnesylation assays have been performed on yeast
farnesyltransferase with peptides with G or D at the a1
position, and there are conflicting data about whether mammalian
farnesyltransferase can effectively farnesylate CaaX substrates
with G or D at the a1 position (22, 29, 30, 34).
If a-factor with G or D at the a1 position was
not farnesylated efficiently, it would not be proteolyzed by Afc1p or
Rce1p, due to the absence of a farnesylated cysteine. Alternatively, if
we assume that the yeast farnesyltransferase was able to farnesylate
a-factor-CDIA or a-factor-CGIA, then neither
Afc1p nor Rce1p could proteolyze these proteins efficiently.
Substitutions at the a2 position (Fig. 1B) revealed that
there was a restricted set of amino acids that allowed efficient prenylation and subsequent proteolysis by both CaaX proteases. Moreover, Afc1p tolerated a wider range of amino acids at the a2 position than at the a1 position.
a-factor variants with V, L, I, C, or M at the
a2 position produced medium-sized to large halos in the
AFC1 RCE1 strain and were substrates for both Afc1p and
Rce1p, as shown by the presence of halos in strains that had either
AFC1 or RCE1, but not in a strain that lacked both AFC1 and RCE1. The remaining a2
variants of a-factor produced small halos (T, Q, H, W, F),
very small halos (A, S, Y), or no halos (G, D, N, E, K, R, P) in the
AFC1 RCE1 strain. Note that the halos produced by
a-factor variants with A, S, and Y at the a2
position were marginally detectable and were not always visible in the
photographs. Overproduction of the farnesyltransferase beta subunit,
Ram1p, increased the size of these halos such that they were
consistently detectable, though still quite small (see below). Clearly,
inefficient farnesylation of these a-factor variants, and
for a-factor variants with T, Q, H, W, and F at the
a2 position, contributed to the low production of mature
a-factor. As discussed below, the a2 variants
that produced no detectable halo, and at least some of the
a2 variants that produced very small halos, were defective for farnesylation in vitro. a-factor variants with A, S, T,
Q, H, W, F, or Y at the a2 position produced detectable
halos in strains that had Afc1p (AFC1 RCE1 and AFC1
rce1
) but produced no detectable halos in strains that lacked
Afc1p (afc1
and afc1
rce1
), indicating
that these a-factor variants were substrates of Afc1p. The
absence of a halo in the afc1
strains expressing a-factor variants with A, S, T, Q, H, W, F, or Y at
a2 may be due to a lack of Rce1p-mediated CaaX
proteolysis but could be due to the combined effect of a reduction in
prenylation and a lack of Afc1p-mediated N-terminal a-factor
processing, resulting from the deletion of AFC1
(40; see below).
Amino acid substitutions at the X position revealed that the
farnesyltransferase and both Afc1p and Rce1p CaaX proteases were able to accept a wide range of amino acids at this position.
a-factor variants with G, A, V, L, I, S, T, N, E, Q, H, W,
F, Y, C, or M at the X position were substrates of both Afc1p and
Rce1p, as shown by the presence of halos in strains that have either
AFC1 or RCE1 but not in a strain that lacks both
AFC1 and RCE1. a-factor variants with
R or P at the X position produced no detectable halo in the wild-type
strain, indicating that these substrates were not adequately prenylated
and/or proteolyzed. The a-factor variants with D or K at the
X position produced small halos in strains that have AFC1
(wild type and rce1
) and no detectable halo in strains
that lack AFC1 (afc1
and afc1
rce1
), indicating that a-factor-CVID and
a-factor-CVIK were substrates of the Afc1p CaaX
protease. It was not clear whether or not Rce1p could cleave
a-factor-CVID or a-factor-CVIK, since the absence
of a halo in the afc1
strain could be due to a combined effect of a partial loss of CaaX proteolysis, a loss of
Afc1p-mediated N-terminal a-factor processing
(40; see below), and a decrease in farnesylation efficiency.
N-terminal role of Afc1p in a-factor processing accounted for the
absence a halo in afc1
strains carrying certain a-factor
variants.
In addition to its role in C-terminal proteolysis, Afc1p
also plays an important role in maturation of a-factor
(40). Afc1p appears to be directly involved in the
N-terminal cleavage which removes the first seven amino acids of the
a-factor precursor (40), although the precise
nature of its N-terminal role is unknown. Both Afc1p and the N-terminal
seven amino acids of the a-factor precursor are required for
efficient processing of a-factor, even for
a-factor variants with CaaX sequences, such as CTLM,
that cannot be proteolyzed by Afc1p (5). Deletion of the
N-terminal region of the a-factor-CTLM precursor reduces the
halo observed in a wild-type strain to a small size, similar to the
halo observed in an afc1
strain (5).
To estimate the impact of the loss of the N-terminal function of Afc1p
on the efficiency of a-factor production from particular
a-factor variants, we deleted amino acids 2 to 5 of the
a-factor precursors that had A, L, S, T, Q, H, W, F, Y, and
C at the a2 position or G, D, E, and K at the X position
(see Materials and Methods). The halos produced in the wild-type strain
expressing truncated variants of a-factor-CVIA, a-factor-CVLA, a-factor-CVCA,
a-factor-CVIG, and a-factor-CVIE were reduced to
a size similar to that of halos produced in the afc1
strain expressing the same a-factor variants (data not
shown). No halos were detected in either the wild-type or the
afc1
strains expressing truncated a-factor with A, S, T, Q, H, W, F, or Y at the a2 position or with D
or K at the X position (data not shown). These observations indicated that loss of the N-terminal Afc1p function alone reduced
a-factor production from these variants below a detectable
limit. Therefore, the absence of a detectable halo in
afc1
strains expressing these a-factor
variants could not be attributed unambiguously to lack of
Rce1p-mediated proteolysis. Whether or not Rce1p can cleave these
substrates remains unresolved.
Farnesylation was limiting for some a-factor variants.
A
number of a-factor CaaX sequence variants produced no
halo or a very small halo in the wild-type strain. Since farnesylation is required for production of mature a-factor and
farnesylation is a prerequisite for CaaX proteolysis, two
approaches were taken to determine whether farnesylation was limiting
for a-factor production for these CaaX sequence
variants: (i) the farnesyltransferase beta subunit was overproduced in
strains carrying the a-factor variants and (ii) in vitro
farnesylation assays were performed on a selected set of peptides.
The levels of farnesyltransferase in each of the 58 AFC1
RCE1 strains carrying a-factor variants were increased
by introduction of a high-copy-number RAM1 plasmid (encoding
the farnesyltransferase beta subunit). Overproduction of the
farnesyltransferase beta subunit, Ram1p, increased the halo size in
nearly all of the strains that started with a small or medium-sized
halo (Fig. 2A). Several
a-factor variants that produced marginally detectable halos
in the AFC1 RCE1 strain (D and Y at a1; A, S, and Y at a2) were able to produce small but easily detected
halos when the wild-type Ram1p was overexpressed. In two cases, CVNA and CVIR, small halos were detected in the strains carrying the high-copy-number RAM1 plasmid, whereas no halo was detected
before the introduction of the RAM1 plasmid. Thus,
inefficient prenylation contributed to the decreased
a-factor production observed for many of the
a-factor CaaX variants. Note that for these a-factor variants, inefficient prenylation was presumably due in part to the presence of a hypomorphic RAM1 allele
(ram1H83Y) in these yeast strains, which were
derived from W303 (see Materials and Methods).

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 2.
Overexpression of the beta subunit of
farnesyltransferase increased production of many a-factor
CaaX variants expressed in AFC1 RCE1 and afc1
RCE1 strains. The AFC1 RCE1 strain (JRY5460) and an
isogenic afc1 RCE1 strain (JRY6095) carrying plasmids
encoding a-factor variants with all possible single amino
acid substitutions at either the a1, a2, or X
position of the wild-type a-factor CaaX sequence, CVIA,
were assayed for a-factor production in the absence (no
plasmid) and the presence (high-copy-number RAM1 plasmid) of
overexpression of the wild-type farnesyltransferase beta subunit. The
relative levels of a-factor produced by these strains were
evaluated by a-factor pheromone diffusion (halo) assay.
|
|
Inefficient prenylation, caused either by limiting amounts of Ram1p or
by the ram1H83Y mutation, did not alter any
conclusions about substrate specificities of the CaaX proteases.
The overexpression of Ram1p in the afc1
RCE1 strain
resulted in modest increases in halo size for many of the
a-factor CaaX variants, particularly those with substitutions at the X position (Fig. 2B). However, there were no cases
in which Ram1p overexpression in the afc1
RCE1 strain changed a-factor production qualitatively, from undetectable to detectable. Note that the increases in halo size resulting from
Ram1p overexpression were much more dramatic in the AFC1 RCE1 strain (Fig. 2A) than in the isogenic afc1
RCE1
strain (Fig. 2B). Thus, farnesylation was not rate limiting for
a-factor production in the afc1
RCE1 strain,
presumably because lack of the Afc1p N-terminal function limited
a-factor production.
a-factor CaaX variants with severe halo defects were poor
substrates for in vitro farnesylation.
To determine directly
whether the primary defect in processing of certain CaaX variants
was in farnesylation, in vitro farnesylation assays were performed. A
selected set of peptides was synthesized that had CaaX sequences
identical to each of the a-factor variants that produced no
halo and to some of the a-factor variants that produced very
small halos. Relative to the natural a-factor CaaX
sequence, CVIA, each of the peptides tested was poorly farnesylated in
vitro (Table 1); the
km values were 8- to 800-fold higher, and the
kcat values were 5- to 300-fold lower, than for
the wild-type CVIA. Thus, poor farnesylation of these
a-factor CaaX variants was at least partially
responsible for the low levels of mature a-factor in the in
vivo halo assay. Peptides with D, K, or R at the a2
position and the peptide with P at the X position were unreactive, even
at peptide concentrations of 50 mM. A 10-fold increase in the
concentration of the enzyme did not result in detectable farnesylation
of these peptides. Clearly, for a-factor with D, K, and R at
the a2 position or P at the X position, the farnesylation
defects were sufficient to account for the lack of a halo in vivo.
Whether or not these substrates could be recognized by either CaaX
protease is irrelevant since CaaX proteolysis is dependent on
prenylation. The peptides with substitutions G, N, or E at the
a2 position and R at the X position were very poor
farnesylation substrates, exhibiting 100- to 700-fold increases in
Km, 90- to 300-fold decreases in kcat, and catalytic efficiencies
(kcat/Km) between
10
5 and 4 × 10
5, compared to 0.8 for
CVIA. Peptides with substitution of Y or P at the a2
position exhibited 80- and 30-fold increases in
Km, 20- and 40-fold decreases in
kcat, and catalytic efficiencies of
10
3 and 3 × 10
3, respectively.
Peptides with W, Y, or P at the a1 position exhibited 8- to
10-fold increases in Km, 5- to 10-fold decreases
in kcat, and catalytic efficiencies that ranged
from 8 × 10
3 to 2 × 10
2.
Some a-factor variants are poorly farnesylated and poorly
proteolyzed.
A more detailed comparison of the in vitro
farnesylation data and the in vivo halo data suggested that
certain a-factor CaaX variants that were
inefficiently farnesylated were also poorly proteolyzed in vivo. The
ability of CVNA and CVIR to produce detectable halos in the AFC1
RCE1 strain carrying high-copy-number RAM1 (Fig. 2) was
remarkable given the very low catalytic efficiencies for farnesylation of CVNA and CVIR in vitro: 100- to 200-fold-higher Km values and 100- to 300-fold-lower
kcat values, resulting in catalytic efficiencies
more than 10,000-fold lower than for CVIA. Presumably, any substrates
that were farnesylated more effectively than CVNA and CVIR in vitro and
had comparable or smaller halos in vivo were poor substrates for
CaaX proteolysis in vivo. Three a-factor CaaX
variants (CWIA, CPIA, and CVPA) had lower Km
values and higher kcat values than CVNA and
CVIR, yet failed to produce a detectable halo. By deduction, these
variants had a CaaX proteolysis defect in addition to their
farnesylation defect. The catalytic efficiency for farnesylation of
CVPA was about 10-fold higher than for CVNA and CVIR, suggesting
that CVPA was proteolyzed somewhat less efficiently than CVNA and
CVIR. The catalytic efficiencies for CWIA and CPIA farnesylation
were 400- to 1,000-fold higher than for CVNA, strongly suggesting that
the latter two sequences were at least partially farnesylated in vivo
but were not proteolyzed by either CaaX protease. Two
a-factor CaaX variants (CYIA and CVYA) produced halos
that were comparable in size to CVNA and CVIR (Fig. 2), yet they had
catalytic efficiencies that were 30- to 300-fold higher than for CVNA
and CVIR. From this analysis, we deduce that CaaX proteolysis of
CYIA and CVYA was partially defective. It is quite possible that, in
addition to the established defects in farnesylation, CVGA and CVEA
have a defect in CaaX proteolysis, since these CaaX sequences
produced no halo and exhibited catalytic efficiencies that are only
twofold lower than for CVNA.
Other a-factor variants (G, D, or E at the a1
position; A, S, T, Q, H, W, or F at the a2 position; D, E,
K, or W at the X position) also have farnesylation defects, based on
their small halo size and the increase in halo size that results from overexpression of the farnesyltransferase beta subunit (Fig. 2). However, because we did not assay in vitro farnesylation of these CaaX sequences, we could not determine whether these substitutions also decrease the efficiency of CaaX proteolysis.
a-factor variants were not substrates for geranylgeranyltransferase
I.
We considered the possibility that changes in the CaaX
sequence would make a-factor variants substrates of the
geranylgeranyltransferase I. In fact, previously published studies show
that a-factor-CVIL is both farnesylated and
geranylgeranylated in vivo, with both forms being exported and
functional (6). However, a-factor-CVIL did not
produce a halo in a ram1
strain, which lacks the
subunit of the farnesyltransferase (C. Trueblood, unpublished results). Taken together, these data suggest that farnesyltransferase is able to
farnesylate and geranylgeranylate a-factor-CVIL to a
physiologically significant extent and that a-factor is not
accessible to geranylgeranyltransferase I in vivo. It is notable that
CVIL and CVII halo sizes increased significantly when Ram1p was
overproduced (Fig. 2A). Ram1p overproduction would be expected to
increase farnesyltransferase activity and decrease geranylgeranyltransferase I activity due to competition for the
subunit, which is shared by the two prenyltransferases. These data were
consistent with the supposition that the farnesyltransferase, rather
than the geranylgeranyltransferase I, was responsible for functional
prenylation of a-factor-CVIL and a-factor-CVII.
Predictive value of specificity data.
There are 98 proteins encoded in the S. cerevisiae genome that have a
cysteine as the fourth amino acid from the C terminus (http://genome-www.stanford.edu/cgi-bin/SGD/search). To test whether the single amino acid substitution series in a-factor had predictive value for determining which of the 98 potential yeast CaaX proteins can serve as substrates of Afc1p and Rce1p,
several additional a-factor variants were constructed. Based
on our results, substrates with serine or threonine at the
a1 position would be predicted to be proteolyzed by Rce1p
but not by Afc1p, whereas substrates with serine or threonine at the
a2 position would be predicted to be proteolyzed by Afc1p.
The yeast genome encodes 18 proteins with serine or threonine at
the a1 position. Nine of these proteins have an amino
acid at the a2 position (G, D, N, E, K, or R) that resulted
in no halo in our substitution series (Fig. 1) and in very poor or no
farnesylation in vitro (Table 1). These proteins are unlikely to be
adequately prenylated in vivo and therefore were not considered
candidates for further study. The nine remaining proteins were
considered likely to be Rce1p-specific substrates. One of these
CaaX sequences, CTLM from Ste18p (the gamma subunit of the
heterotrimeric G protein), was previously placed on
a-factor and found to be proteolyzed by Rce1p but not Afc1p
(5), in agreement with our predictions. Similarly,
a-factor variants with CSVM and CTVM were tested and found
to be proteolyzed by Rce1p but not Afc1p, as predicted (Fig.
3). The yeast genome encodes three
proteins with serine or threonine at the a2 position
that would be predicted to be proteolyzed by Afc1p. One of these three
C-terminal sequences, CASQ, which is derived from Ydj1p (YNL064C), was
tested in the context of a-factor and found to be
proteolyzed by Afc1p but not Rce1p (Fig. 3), as predicted. Thus, to a
first approximation, the information from the a-factor
single amino acid substitution series appeared to be valuable in
predicting which CaaX protease could proteolyze a-factor
variants with CaaX sequences derived from bona fide proteins.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Afc1p and Rce1p CaaX proteases differ in the ability
to proteolyze CaaX sequences with serine and threonine at the
a1 and a2 positions. Plasmids encoding
wild-type a-factor (CVIA) and a-factor variants
with the CaaX sequences CSVM, CTVM, and CASQ were transformed into
four MATa yeast strains that differ in their CaaX
protease genes: AFC1 RCE1 (JRY5460), afc1 RCE1
(JRY6095), AFC1 rce1 (JRY5462), and afc1 rce1
(JRY5463). The relative levels of a-factor produced by these
strains were evaluated by a-factor pheromone diffusion
(halo) assay.
|
|
Mutations that alter Rce1p substrate specificity.
The lack of
obvious sequence similarity of Rce1p to known proteases has precluded
predictions of the position of the Rce1p active site or substrate
binding site. A genetic screen was performed to identify mutations in
RCE1 that would alter Rce1p substrate specificity and allow
proteolysis of a-factor-CAMQ, a substrate that was very
poorly recognized by the wild-type Rce1p (4, 5). The logic
behind the screen was that mutations altering the substrate recognition
properties of the enzyme would identify key regions involved in
substrate recognition and/or binding. RCE1 PCR products,
generated by PCR-based random mutagenesis, and a linearized CEN
LEU2 plasmid were cotransformed into a afc1
rce1
yeast strain that expressed a-factor-CAMQ as the only form
of a-factor precursor (JRY5463 transformed with pJR1556).
Transformants were obtained as a result of recombination between the
ends of the RCE1 PCR product and the homologous ends of the
linear plasmid. Mutant forms of Rce1p capable of cleaving a-factor-CAMQ were identified by their ability to produce mature a-factor and thereby form halos on a lawn of
sst2 cells. Two different single amino acid changes in Rce1p
led to small but reproducible increases in the halo size (Fig.
4): a phenylalanine-to-leucine
substitution at position 189 (F189L) and a glutamine-to-arginine
substitution at position 201 (Q201R). The mutated RCE1 gene
encoding F189L-Rce1p was subjected to a second round of PCR mutagenesis
to search for an additional mutation that could further increase the
a-factor-CAMQ processing. A change of the glutamic acid
codon at position 139 to a lysine codon (E139K) led to a notable
increase in halo size (Fig. 4).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Amino acid substitutions in Rce1p that increased
proteolysis of a-factor-CAMQ but did not alter proteolysis
of other a-factor CaaX variants. Plasmids encoding
a-factor variants with the indicated CaaX sequences
(CAMQ, CASQ, CAIA, CVMA, CVSA, and CVIQ) or wild-type
a-factor (CVIA) were transformed into MATa
afc1 rce1 yeast strains that differ in the RCE1
allele carried on a second plasmid: wild-type RCE1 (wild
type) or a mutant allele with the indicated amino acid substitution
(F189L, E139K F189L, or Q210R). The relative levels of
a-factor produced by these strains were evaluated by
a-factor pheromone diffusion (halo) assay.
|
|
To assess whether the mutant forms of Rce1p had altered specificity for
other a-factor variants, afc1
rce1
strains expressing either the E139K F189L mutant form of Rce1p or wild-type Rce1p were transformed with plasmids encoding wild-type
a-factor and the 57 a-factor variants that have
all possible substitutions at either the a1,
a2, or X position. Halo assays on the resulting strains
revealed no differences in the ability of the wild-type and mutant
Rce1p enzymes to process these a-factor variants (data not
shown). The failure of the mutant Rce1p enzymes to increase halo sizes
for these a-factor variants ruled out the possibility that a
general increase in Rce1p activity was responsible for the increased
halo observed for a-factor-CAMQ. These data also indicated
that the Rce1p mutations broadened the substrate specificity of the
enzyme but did not result in any loss in the range of substrates it
could process. In addition, afc1
rce1
strains
expressing either wild-type Rce1p, the F189L mutant form of Rce1p, the
E139K F189L mutant form of Rce1p, or the Q210R mutant form of
Rce1p were transformed with plasmids encoding a-factor variants with the following CaaX sequences: CAMQ, CASQ, CAIA, CVMA, CVSA, CVIQ, and CVIA. Among these a-factor substrates, only a-factor-CAMQ was processed more effectively by
the mutant forms of Rce1p (Fig. 4). Clearly the mutant forms of Rce1p did not exhibit an enhanced ability to proteolyze an
a-factor variant sequence closely related to CAMQ (CASQ),
nor a-factor variants with individual substitutions of A, M,
or Q at the a1, a2, or X position,
respectively. These observations indicate that the combination of amino
acids in the CaaX sequence can sometimes influence Rce1p
recognition in a way that cannot be predicted from the individual amino
acid substitutions.
 |
DISCUSSION |
The goal of this work was to provide a comprehensive evaluation of
the substrate specificities for the S. cerevisiae CaaX proteases, Afc1p and Rce1p, and to identify amino acids in Rce1p that
affect substrate specificity. Part of the interest in CaaX proteases stems from their potential utility in modulating the activity
of Ras proteins and other prenylated proteins that contribute to the growth and division of cancer cells. There is considerable interest in developing inhibitors against the human CaaX
protease(s) that proteolyze the human N-, Ki-, and Ha-Ras proteins.
Like farnesyltransferase inhibitors, which are currently being
developed (13, 45), CaaX protease inhibitors could
modulate Ras activity and thereby potentially function as anticancer
agents. Even in cancer cells that do not carry activated Ras, Ras and
other prenylated proteins, including RhoB, contribute to cell
propagation and are potential targets for therapeutic intervention
(24, 26, 39). Previously, there has been little information
about the substrates and substrate specificities of the yeast and
mammalian CaaX proteases.
Single amino acid substitution data serve as a predictive guide for
which yeast CaaX sequences are prenylated and which are substrates
of Afc1p and/or Rce1p.
The in vivo halo and in vitro farnesylation
data from single amino acid substitutions in the a-factor
CaaX sequence are summarized in Table
2. Afc1p and Rce1p exhibited substantial overlap in specificity at the a1, a2, and X
positions (Table 2, row 1). However, Rce1p was able to accept
additional amino acids at the a1 position that Afc1p was
unable to accept (Table 2, row 2), and Afc1p was able to accept
additional amino acids that Rce1p may not accept (Table 2, row 3). It
was not possible to determine whether or not Rce1p was able to act on
these latter a-factor variants, since the loss of the
N-terminal role of Afc1p in a-factor processing, in
combination with a partial defect in prenylation, reduced
a-factor production below a detectable level. Both Afc1p and
Rce1p accepted all amino acids at the X position that allowed efficient
farnesylation. These results are in agreement with the observation that
partially purified CaaX proteases can accept D-amino
acids at the X position, but not at the a1 or
a2 position (27), and can proteolyze
farnesylated tripeptides nearly as well as farnesylated tetrapeptides
(20, 27).
Our single amino acid substitution data tested 57 a-factor
CaaX sequence variants, which are a small fraction of the 203 possible CaaX sequences. Nevertheless, rules
emerged that had predictive power. For example, the data suggested that
CaaX sequences with serine or threonine at the a1
position would be substrates of Rce1p, but not Afc1p, and that CaaX
sequences with serine or threonine at the a2 position would
be substrates of Afc1p. In agreement with these predictions,
a-factor variants with the sequences CTVM, CSVM, and CTLM
were found to be proteolyzed by Rce1p, but not Afc1p, whereas
a-factor with CASQ was proteolyzed by Afc1p (Fig. 3)
(4).
Although caveats concerning the accessibility of substrates and the
potential influence of sequences outside the CaaX motif must be
kept in mind, the a-factor single amino acid substitution data, together with in vitro farnesylation data, can help guide predictions of which yeast proteins are substrates of Afc1p and/or Rce1p. There are 98 yeast proteins that have a cysteine as the fourth amino acid from the C terminus. Predictions concerning prenylation and proteolysis of these proteins are presented in Table 3. According to our data, 24 of the
98 proteins would be predicted to be adequately prenylated and
proteolyzed by both Afc1p and Rce1p, and 14 proteins would be
predicted to be adequately prenylated and proteolyzed by Rce1p but not
Afc1p. Nine proteins would be predicted to have a partial defect in
prenylation, as well as a defect in proteolysis by both Afc1p and
Rce1p. Twenty-two proteins would be predicted to have deficiencies
in prenylation and/or proteolysis. Each of these 22 proteins has at
least one amino acid at the a1, a2, or X
position that caused inefficient a-factor production in the
a-factor single amino acid substitution series. The
available data do not allow a clear determination of the relative
deficits in prenylation versus proteolysis for these amino acids. These
proteins each have an amino acid that did not allow detectable
Rce1p cleavage in the a-factor substitution series (Table 2,
row 4). Our data cannot predict whether or not Rce1p could process
these proteins, since loss of the N-terminal role of Afc1p in
a-factor processing, in combination with decreased
prenylation, reduced a-factor production below a detectable
threshold in afc1
strains. Half of these 22 proteins
have an amino acid at the a1 position that was accepted by
Afc1p, whereas the other half have an amino acid at the a1
position that precludes Afc1p proteolysis in the a-factor series.
Deductions about which potential CaaX proteins in yeast are
unlikely to be farnesylated.
In vitro farnesylation data, together
with the in vivo a-factor production (halo assay) data,
suggest that at least 29 out of 98 yeast proteins with a cysteine
four amino acids from the C terminus are unlikely to be farnesylated
(Table 3). These 29 proteins have an amino acid at the
a2 position that resulted in very poor farnesylation (G, N,
or E) or no farnesylation (D, K, or R) in vitro. Note that even among
the remaining 69 proteins, some may be poorly prenylated due to the
presence of W, Y, or P at the a1 position and Y or P at the
a2 position, which exhibited a partial in vitro
farnesylation defect. In addition, G or D at the a1
position, A, S, T, Q, H, W, or F at the a2 position, or D,
E, K, or W at the X position may decrease farnesylation efficiency. In
the a-factor substitution series, a-factor
variants with these substitutions produced small halos that increased
in size when the beta subunit of farnesyltransferase was overexpressed, supporting the idea that inefficient farnesylation is at least partially responsible for the low level of a-factor
production from these variants (Fig. 2).
Note that 17 of the 98 potential CaaX proteins have leucine or
isoleucine at the X position and therefore are likely to be preferred
substrates of geranylgeranyltransferase I, although farnesyltransferase
can also act on substrates with a C-terminal leucine (7,
44). However, this fact does not change our predictive analysis
with respect to CaaX proteolysis, since both yeast (10a) and human (32) Rce1p CaaX proteases are able to cleave
both farnesylated and geranylgeranylated peptides in vitro. Since the CaaX sequence requirements for geranylgeranyltransferse I are not
as well defined as those of the farnesyltransferase, it is more
difficult to predict which of these sequences would be prenylated. From
the studies that have been done, this enzyme appears to accept fewer
amino acids at the a1 and a2 positions than
farnesyltransferase (29). Based on known
geranylgeranyltransferase I substrates (28, 29), 7 of these
17 C termini (CTIL, CAIL, CIIL, CVIL, CIIL, CVLL, and CIII) are
expected to be substrates of geranylgeranyltransferase I. Five of
the C termini (CASL, CKCI, CDMI, CMMI, and CKYI) have amino acids at
the a1 and a2 positions that allow
farnesylation but may not allow geranylgeranylation. Five of the C
termini were included in the set of 29 proteins that are unlikely
to be substrates of the farnesyltransferase. Due to suboptimal amino
acids at the a1 and/or a2 position, it is
unlikely that these sequences (CSGL, CIDL, CSDL, CWLI, and CSEI) are
efficiently prenylated by either farnesyltransferase or
geranylgeranyltransferase I.
Note that these predictions of whether the farnesyltransferase and/or
the geranylgeranyltransferase I can prenylate a given CaaX sequence
on a particular protein are tentative. Although both of these
enzymes are able to prenylate four amino acid CaaX peptides and
therefore do not require additional sequences, the efficiency of
prenylation can be influenced by sequences outside the CaaX
sequence (19, 21, 22).
Yeast CaaX protease specificity information aids in the
interpretation of mammalian CaaX protease observations.
The
yeast and mammalian CaaX proteases have proven extremely difficult
to purify, and consequently in vitro studies of substrate specificity
on purified proteases have not been done. A partially purified prenyl
protein-specific endoprotease (PPEP) activity, which may include
one or more CaaX proteases of unknown identity, was used in a
recent specificity study (20). By comparing the in vitro
specificity of the partially purified activity to the in vivo
specificities of yeast Afc1p (Fig. 1), yeast Rce1p (Fig. 1), and human
Rce1p expressed in yeast (Wong et al., unpublished), we deduce that the
activity is likely to be that of a mammalian Afc1p homolog. One of the
key results that led to this deduction was that yeast Rce1p (Fig. 1)
and human Rce1p (Wong et al., unpublished) were able to cleave the
a-factor variant with R at the a1 position,
whereas neither yeast Afc1p (Fig. 1) nor the PPEP activity
(20) could cleave substrates with R at the a1
position. Specificity studies have not been performed with the other
partially purified enzymes (2, 10, 31), but one enzyme
activity (31) is inhibited by o-phenanthroline,
as has been observed for yeast Afc1p (4, 10a),
whereas the other enzyme activity (10) is not sensitive to
o-phenanthroline and has properties expected for Rce1p.
Further studies will be necessary to clarify which of these activities
are Afc1p, Rce1p, or other CaaX proteases.
In vivo cleavage of Ras proteins by Rce1p, but not Afc1p, is
not explained by Afc1p CaaX sequence specificity constraints.
Studies of human Rce1p protein in insect cells establish its
ability to cleave farnesyl-Ki-Ras, geranylgeranyl-Ki-Ras,
farnesyl-Ha-Ras, farnesyl-N-Ras, farnesyl-G
1, and
geranylgeranyl-Rap1 (32), which have the CaaX sequences
CVIM, CVLS, CVLM, CVIS, and CQLL, respectively. In a complementary
study, mouse fibroblasts that are homozygous for an
rce1 deletion are unable to process farnesyl-Ki-Ras, geranylgeranyl-Ki-Ras, farnesyl-Ha-Ras, farnesyl-N-Ras,
farnesyl-G
1, or geranylgeranyl-Rap1 (23). By
deduction, the mouse Afc1p homolog appears not to proteolyze these substrates.
The substrate specificity data for yeast Rce1p (Fig. 1) and for human
Rce1p (Wong et al., unpublished results) are consistent with the
ability of Rce1p to cleave these substrates. Human Rce1p expressed in
yeast is able to process a-factor (CVIA) and Ras2 (CIIS) and
exhibits a substrate specificity profile remarkably similar to that
shown here for yeast Rce1p (Wong et al., unpublished). However, the
failure of Afc1p to cleave Ki-Ras, Ha-Ras, N-Ras, or G
1 cannot be
explained by the available substrate specificity data on yeast Afc1p
(Fig. 1), the partially purified PPEP activity (20) (which
we deduced is likely to be rat Afc1p), or human Afc1p expressed in
yeast, which is able to process a-factor (40) but
has not been assayed with any other substrates. A trivial explanation
would be that mammalian Afc1p is not expressed in fibroblasts. However,
a similar discrepancy in yeast suggests a different interpretation.
Specifically, the single amino acid substitution data suggest that the
Ras2 CaaX sequence, CIIS, would be cleaved by both Afc1p and Rce1p.
However, the genetic data indicate that Ras2p (CIIS) is processed
primarily by Rce1p, not by Afc1p (4). Moreover, there are
other farnesylated mammalian CaaX proteins that, despite having
CaaX sequences that appear acceptable for Afc1p, are not
proteolyzed in vivo. The alpha and beta subunits of phosphorylase
kinase in rabbit reticulocytes are farnesylated, but the aaX sequences,
AMQ and LVS, respectively, are not removed (17). Together,
these observations point out that the CaaX sequence alone may not
be the only factor that influences the ability of a CaaX protease
to cleave a potential substrate. For example, the substrate and the
enzyme may reside in different cellular compartments. Alternatively,
the CaaX sequence may be masked, either by being folded into the
interior of the protein or by being bound to another protein.
In addition to the phosphorylase kinase subunits described above, two
other proteins have been identified as being farnesylated but not
proteolyzed. CaaX variants of Ki-Ras4B that have CVGM and CVYM are
farnesylated less efficiently than Ki-Ras4B (CVIM), and the small
amount of Ras protein that is farnesylated remains unproteolyzed
(22). Similarly, our combined in vivo halo and in vitro
farnesylation results with a-factor-CVGA and
a-factor-CVYA demonstrated a significant decrease in
farnesylation, as well as a deduced deficit in CaaX proteolysis
(Fig. 1; Table 1).
A substrate recognition domain in Rce1p.
Amino acid
substitutions in Rce1p that improved its ability to process
a-factor-CAMQ, without affecting processing of other
a-factor variants, provided information about the region of
Rce1p likely to be involved in substrate recognition. The F189L and
Q201R amino acid substitutions in Rce1p each independently increased
Rce1p processing of a-factor-CAMQ. F189 is conserved in both
the human and Schizosaccharomyces pombe homologs of Rce1p, which share amino acid identity of only 32% with each other (Fig. 5). A conserved histidine that residues
between F189 and Q201 (H194 in yeast Rce1p and H208 in human Rce1p) is
required for proteolytic activity of yeast (10a) and human
(Wong et al., unpublished) Rce1p. Together, these data strongly suggest
that this region of Rce1p is involved in substrate binding. This same
region contains a conserved HxxE motif which has been proposed to be a
Zn binding site (12), by analogy to a previously described
class of metalloproteases (33). However, the HxxE sequence
is not critical to Rce1p function because human Rce1p remains
functional when either histidine 211 or glutamate 214 is replaced with
alanine (Wong et al., unpublished). Substitution of the analogous
histidine of yeast Rce1p reduced the specific activity about 10-fold
(10a). Note also that zinc chelators, such as
o-phenanthroline, do not appear to inhibit Rce1p, raising
doubt about the role of zinc in Rce1p function (5, 10a).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
Alignment of Rce1p homologs from S. cerevisiae (4), human (32), and S. pombe (accession numbers: Swiss-Prot Q10071 and GenBank
AL035064.1) sequences were aligned with the ClustalW 1.7 program
(42), accessed through the BCM sequence launcher
(http://www.hgsc.bcm.tmc.edu/SearchLauncher/). Identities between
homologs are shaded in black, and similarities are shaded in gray. The
region spanning amino acids 147 to 257 of S. cerevisiae is
most highly conserved region among the three homologs, with pairwise
percent identities of 41% (S. cerevisiae-human), 44%
(human-S. pombe), and 35% (S. cerevisiae-S.
pombe) and percent similarities of 50 to 58%. The figure was
prepared using BOXSHADE
(http://www.isrec.isb-sib.ch:8080/software/BOX_form.html).
|
|
Processing of a-factor-CAMQ by the F189L mutant form of
Rce1p was improved further by an E139K substitution. Although E139 is
not conserved in human or S. pombe Rce1p, it is near a conserved region: RNxxxAPxTEE (amino acids 147 to 157 in yeast Rce1p).
The penultimate glutamate in this conserved sequence is required for
yeast (10a) and human (Wong et al., unpublished) Rce1p function.
Both Afc1p and Rce1p are polytopic membrane proteins of the
endoplasmic reticulum (5, 38). Unfortunately, there is no direct information regarding the topology of any portion of the proteins, and so the experimental findings must be interpreted in
light of predicted structures rather than established ones. A
comparison of the transmembrane domain predictions of Rce1p with
homologs from human and S. pombe reveals that although all three proteins are predicted to span a membrane multiple times, there are substantial differences in the structures predicted for the
three proteins. Even in the region of strongest homology (corresponding to amino acids 147 to 257 of yeast Rce1p), where one
would expect that the structure and topology of the three Rce1p
homologs would be best conserved, there was a high degree of
variability in both the number and the position of the transmembrane helices predicted for each of the three proteins with different programs.
Perhaps the conflicting models reflect the ability of some of the
hydrophobic regions to penetrate into, but not span, the membrane. If
so, the active site of the Rce1p proteases may be partially buried in
the membrane or at the membrane-cytoplasm interface. Considering that
the substrates of the CaaX proteases are prenylated at the cysteine
adjacent to the cleavage site and that farnesylation or
geranylgeranylation of these CaaX protein substrates is
required for proteolysis, perhaps the prenyl lipid helps present the
critical peptide bond to the active site close to, or within, the membrane.
It is interesting that S2P, a membrane-associated metalloprotease, has
been proposed to have two classical transmembrane helices and three
longer hydrophobic regions (30, 37, and 118 amino acids) that reside
within the membrane, but not as transmembrane helices (46).
This model, which is supported by protease protection and glycosylation
site mapping data, contrasts dramatically with the predicted structure
(25). The new model, which posits that the active site is
within the membrane, is attractive in that the S2P metalloprotease is
thought to directly cleave the sterol response element binding
protein at a site that is buried within a transmembrane domain
(25). Clearly, enzymes that catalyze reactions in a
hydrophobic environment offer considerable challenges to structural
predictions, as well as novel opportunities for the design of inhibitors.
 |
ACKNOWLEDGMENTS |
We thank Ashild Vik, Qun Shan, Sara Okamura, and other members of
the Rine lab for valuable discussions. We thank Matt Ashby for pJR1561
and JRY4276.
This work was supported by an NSF postdoctoral fellowship (to D.R.) and
by NIH grants GM35827 (to J.R.) and GM 21328 (to C.D.P.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular and
Cell Biology Department, University of California, Berkeley, CA 94720. Phone: (510) 642-7047. Fax: (510) 642-6420. E-mail:
jrine{at}uclink4.berkeley.edu.
Present address: Department of Genetics, Harvard Medical School,
Boston, MA 22115.
 |
REFERENCES |
| 1.
|
Adams, A.,
D. E. Gottschling,
C. A. Kaiser, and T. Stearns.
1997.
Methods in yeast genetics: a Cold Spring Harbor laboratory course manual.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 2.
|
Akopyan, T. N.,
Y. Couedel,
M. Orlowski,
M. C. Fournie-Zaluski, and B. P. Roques.
1994.
Proteolytic processing of farnesylated peptides: assay and partial purification from pig brain membranes of an endopeptidase which has the characteristics of E.C. 3.4.24.15.
Biochem. Biophys. Res. Commun.
198:787-794[CrossRef][Medline].
|
| 3.
|
Ashby, M. N.,
D. S. King, and J. Rine.
1992.
Endoproteolytic processing of a farnesylated peptide in vitro.
Proc. Natl. Acad. Sci. USA
89:4613-4617[Abstract/Free Full Text].
|
| 4.
|
Boyartchuk, V. L.,
M. N. Ashby, and J. Rine.
1997.
Modulation of Ras and a-factor function by carboxyl-terminal proteolysis.
Science
275:1796-1800[Abstract/Free Full Text].
|
| 5.
|
Boyartchuk, V. L., and J. Rine.
1998.
Roles of prenyl protein proteases in maturation of Saccharomyces cerevisiae a-factor.
Genetics
150:95-101[Abstract/Free Full Text].
|
| 6.
|
Caldwell, G. A.,
S. H. Wang,
F. Naider, and J. M. Becker.
1994.
Consequences of altered isoprenylation targets on a-factor export and bioactivity.
Proc. Natl. Acad. Sci. USA
91:1275-1279[Abstract/Free Full Text].
|
| 7.
|
Caplin, B. E.,
L. A. Hettich, and M. S. Marshall.
1994.
Substrate characterization of the Saccharomyces cerevisiae protein farnesyltransferase and type-I protein geranylgeranyltransferase.
Biochim. Biophys. Acta
1205:39-48[CrossRef][Medline].
|
| 8.
|
Caplin, B. E.,
Y. Ohya, and M. S. Marshall.
1998.
Amino acid residues that define both the isoprenoid and CAAX preferences of the Saccharomyces cerevisiae protein farnesyltransferase. Creating the perfect farnesyltransferase.
J. Biol. Ch |