Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 4522-4531, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Processing of Intron-Encoded Box C/D Small
Nucleolar RNAs Lacking a 5',3'-Terminal Stem Structure
Xavier
Darzacq and
Tamás
Kiss*
Laboratoire de Biologie Moléculaire
Eucaryote du CNRS, 31062 Toulouse, France
Received 16 February 2000/Returned for modification 31 March
2000/Accepted 6 April 2000
 |
ABSTRACT |
The C and D box-containing (box C/D) small nucleolar RNAs (snoRNAs)
function in the nucleolytic processing and
2'-O-methylation of precursor rRNA. In vertebrates, most
box C/D snoRNAs are processed from debranched pre-mRNA introns by
exonucleolytic activities. Elements directing accurate snoRNA excision
are located within the snoRNA itself; they comprise the conserved
C and D boxes and an adjoining 5',3'-terminal stem. Although the
terminal stem has been demonstrated to be essential for snoRNA
accumulation, many snoRNAs lack a terminal helix. To identify the
cis-acting elements supporting the accumulation of
intron-encoded box C/D snoRNAs devoid of a terminal stem, we
have investigated the in vivo processing of the human U46 snoRNA and an
artificial snoRNA from the human
-globin pre-mRNA. We demonstrate
that internal and/or external stem structures located within
the snoRNA or in the intronic flanking sequences support the
accumulation of mammalian box C/D snoRNAs lacking a canonical terminal
stem. In the intronic precursor RNA, transiently formed external and/or
stable internal base-pairing interactions fold the C and D boxes
together and therefore facilitate the binding of snoRNP proteins. Since
the external intronic stems are degraded during snoRNA processing, we
propose that the C and D boxes alone can provide metabolic stability
for the mature snoRNA.
 |
INTRODUCTION |
The nucleolus contains a large
number of small nucleolar RNAs (snoRNAs), which function in the
nucleolytic processing and nucleotide modification of precursor rRNAs
(pre-rRNAs) (reviewed in references 34, 48,
and 49). The vast majority of snoRNAs fall into two
families, which can be distinguished on the basis of common sequence
boxes. Many snoRNAs share the conserved C (consensus sequence: RUGAUGA)
and D (CUGA) boxes (50; reviewed in reference 34), and the rest of the snoRNAs possess the H
(AnAnnA) and ACA motifs (4, 16). A few C and D
box-containing (box C/D) snoRNAs (U3, U8, U14, and U22) and an H and
ACA motif-containing (box H/ACA) snoRNA (snR30) are required for the
production of mature-sized rRNAs (21, 22, 30, 35, 40, 46,
53). However, the majority of box C/D and box H/ACA snoRNAs
direct site-specific 2'-O-ribose methylation (10, 26,
32, 51) and pseudouridylation (17, 37) of rRNAs, respectively.
Genes coding for snoRNAs have been found in diverse genomic
contexts (reviewed in references 34, 49, and
59). While the majority of vertebrate snoRNAs
are synthesized as parts of pre-mRNA introns, most yeast and plant
snoRNAs are transcribed as monocistronic or polycistronic
precursor snoRNAs (pre-snoRNAs) from independent
transcription units. In each case, mature snoRNAs are released from
the primary transcript by nucleolytic processing. The intronic
snoRNAs are processed from the removed and debranched host introns
(23, 25, 39, 41) or, less frequently, from endonucleolytically released intronic fragments (7, 15, 42, 55) by exonucleolytic activities (2, 9, 11, 23-25, 41, 52). From yeast polycistronic pre-snoRNA transcripts, the
RNase III (Rnt1p) endoribonuclease releases individual
pre-snoRNA fragments and, again, exonucleolytic trimming forms the
correct 5' and 3' termini of the snoRNA (12, 13, 43).
The yeast Rat1p and Xrn1p 5'
3' exonucleases play an essential role
in the 5'-end formation of both intronic and polycistronic snoRNAs
(41, 43, 55). Maturation of some yeast snoRNAs by
trimming of short 3'-terminal trailer sequences specifically requires
the Rrp6p 3'
5' exonuclease that is a component of the yeast exosome
(1, 2).
The exonucleolytic processing of intronic and polycistronic snoRNAs
is directed by cis-acting elements which have been found within the snoRNA itself. Consistent with this finding, snoRNAs placed into nonnatural sequence contexts are accurately processed both
in vitro and in vivo (5, 16, 17, 25-27, 44, 57, 60). The
conserved sequence boxes and the neighboring stem structures constitute
the signal elements directing the correct snoRNA formation (4,
6, 9, 16, 20, 44, 57, 60). Processing and accumulation of
the intron-encoded and polycistronic box C/D snoRNAs depend on
the C and D boxes and an adjacent 4- or 5-bp helix that folds together
the 5' and 3' ends of the snoRNAs. This terminal structure, called
the box C/D core motif (57, 60), functions as a
binding site for snoRNP core proteins (8, 28, 33, 58).
Most probably, snoRNA proteins bound to the pre-snoRNA protect
the snoRNA sequences from the processing exonucleases and therefore
delineate the correct snoRNA termini and provide metabolic
stability for the mature snoRNA.
Several laboratories have demonstrated that a base-paired
5',3'-terminal stem is absolutely required for the processing and accumulation of box C/D snoRNAs (6, 9, 20, 31, 57, 60).
However, mysteriously enough, many intron-encoded box C/D snoRNAs
expressed in mammalian cells (26, 54) or polycistronic snoRNAs accumulating in yeast (32) lack the canonical
5',3'-terminal helix. Elements supporting the processing and
accumulation of this large group of box C/D snoRNAs remain largely
speculative. In this study, we demonstrate that processing of mammalian
box C/D snoRNAs lacking a 5',3'-terminal stem is supported by
external intronic stem structures that are fully or partially degraded during the exonucleolytic processing of these snoRNAs.
 |
MATERIALS AND METHODS |
General procedures and oligos.
Unless stated otherwise, all
techniques used for manipulating DNA, RNA, and oligodeoxynucleotides
(oligos) were performed according to standard laboratory protocols
(45). The following oligos were used in this study: 1, ATAATCGATGTAGGGTGATGAAAAAGAATCCTTAGGCG; 2, ATAACGCGTAGTCAGTGTAACTATGACAAG; 3, ATAATCGATGGAGGCAAGTAGGGTGATGAAAAAGAATCC; 4, ATAACGCGTGGAGGCAACAGTCAGTGTAAC; 5, ATAATCGATGGCGCCTCGCGTC ATAGTCAG; 6, ATACTCGAGACCAAGGAGAGCAAGGCAAGTGAG GG; 7, ATAATCGATCTCTATTCGTAGGGTGATGAAAAAGAATCC; 8, ATAACGCGTCTCTATTCCAGTCAGTGTAACTATG; 9, CGATGCAACAGCATGATGATCGACCGC; 10, GGTAAGATCTCTGATCAATGATGACATATGGTCAAG; 11, TCCATTTACCTGACTGTTGCA; 12, TTGATCAGAGATCTTACCGCGGTCGATCATCATGCTGTTGCAT; 13, CGCGTGCAACAGTCAGGTAAATGGACTTGACCATATGTCATCA; 14, ATAATCGATTCGAGACATGATGATCGACCGCGG; 15, ATAACGCGTGCAACAGTCAGATAAATGG; 16, ATAATCGATCAAGAGACATGATGATCG; 17, ATAATCGATTGCAAGAGACATGATGATGCG; 18, ATAATCGATCGTGCAAGAGACATGATGATCG; 19, ATAATCGATCGCGTGCAAGAGACATGATGATCGACCGCGG; 20, ATAATCGATTCGACACATGATGATCGACCGCGG; 21, CGCGTGCAACAGTCAGGTAAATGACCGCGGTCA; 22, TATGACCGCGGTCATTTACCTGACTGTTGCA; and 23, GGCCACAACCACGCCTAAGG.
Construction of plasmids for transfection of COS7 cells.
Construction of the pGLCXM mammalian expression vector has
been described elsewhere (25). In brief, the human
-globin gene carrying three novel restriction sites
(ClaI, XhoI, and MluI) in its second
intron was placed under the control of the cytomegalovirus (CMV)
promoter. To generate pGL-U46(0/0), the coding region of human U46
snoRNA was PCR amplified using oligos 1 and 2 as 5'- and
3'-end-specific primers, respectively. The amplified DNA fragment was
digested with ClaI and MluI and inserted into the
same sites of the pGLCXM expression construct. A similar
approach was used to generate pGL-U46(8/9) and pGL-U46(93/54).
Fragments of the human S8 ribosomal protein gene carrying the U46
gene and its 8- or 93-nucleotide upstream and 9- or 54-nucleotide
downstream flanking sequences were amplified using oligos 3 and 5 and
oligos 4 and 6, respectively. The amplified (8-U46-9) and (93-U46-54) fragments were inserted into the ClaI/MluI and
ClaI/XhoI sites of pGLCXM,
respectively. To obtain pGL-U46(8/9) and
pGL-U46(8/9) (underlining indicates the destroyed part of
the construct [see Results]), the U46 gene was PCR amplified using
oligos 7 and 4 and oligos 3 and 8 as primers, respectively. The
amplified fragments were cloned into the
ClaI/MluI sites of pGLCXM. The same
strategy was used to generate pGL-U46(8/9),
except that oligos 7 and 8 were used as 5'- and 3'-end-specific PCR
primers, respectively.
To generate pGL-X1, five synthetic oligos (oligos 9 to 13) were
annealed, mixed with ClaI- and MluI-digested
plasmid pGLCXM, and treated with T4 DNA ligase. Prior to
annealing, oligos 10, 11, and 13 had been phosphorylated with T4
polynucleotide kinase. The resulting plasmid, pGL-X1, was used as a
template for PCR amplification with oligos 14 and 15 as 5'- and
3'-end-specific primers, respectively. The resulting DNA fragment was
inserted into the ClaI/MluI sites of
pGLCXM, yielding pGL-X1(0). The same approach was used to
construct pGL-X1(3), pGL-X1(5), pGL-X1(7), pGL-X1(9), and pGL-X1(5t),
except that in these PCRs pGL-X1(0) was used as a template and oligos
16, 17, 18, 19, and 20 were used as 5'-end-specific primers,
respectively. To generate pGL-X1(0)-(9) and pGL-X1(5t)-(9), the
NdeI-MluI fragments of pGL-X1(0) and pGL-X1(5t) encompassing the 3'-terminal regions of the X1(0) and X1(5t)
artificial snoRNAs, respectively, were replaced with a
synthetic DNA fragment obtained after annealing of oligos 21 and 22. The identity of all constructions was verified by sequence analyses.
RNA analyses.
RNase A/T1 mapping was
performed as described earlier (19, 25). Complementary RNA
probes were synthesized in vitro with T7 RNA polymerase. All probes
were purified on 5% denaturing polyacrylamide gels. To generate
templates for the preparation of antisense RNA probes, the
HindIII-EcoRI fragments of the pGL-U46,
pGL-U46(8/9), pGL-U46(93/54), pGL-U46(8/9),
pGL-U46(8/9), pGL-U46(8/9), pGL-X1, pGL-X1(0), pGL-X1(3), pGL-X1(5), pGL-X1(7), pGL-X1(9),
pGL-X1(5t), pGL-X1(0)-(9), and pGL-X1(5t)-(9) expression constructs
were cloned into the HindIII/EcoRI sites of
pBluescribe KS(
) (Stratagene). The resulting recombinant plasmids
were linearized with HindIII and used as templates for
T7 RNA polymerase transcription. The 5' terminus of the human U46
snoRNA was determined by primer extension analysis with 5 µg of
template RNA extracted from a nuclear fraction of human HeLa cells
(50) and 5 pmol of terminally labeled oligo 23 as a primer.
Computer folding of human and mouse intronic sequences was performed by
using the RNAdraw program (http://rnadraw.base8.se/).
 |
RESULTS |
Intronic flanking sequences are required for the accumulation of
U46 intron-encoded snoRNA.
Contrary to the fact that a short
5',3'-terminal helix structure has been demonstrated to be fundamental
to the accumulation of both intron-encoded and polycistronic box C/D
snoRNAs, a large number of naturally occurring box C/D snoRNAs
lack a terminal stem (see above). To solve this apparent contradiction,
we have set about identifying the cis-acting elements that
direct the processing of the human U46 box C/D snoRNA, which has
been reported to lack a canonical 5',3'-terminal stem (26).
Primer extension (Fig. 1A) and oligo
ligation-PCR amplification (Fig. 1B) experiments demonstrated that the
C and D boxes of the mature U46 snoRNA are preceded by five
5'-terminal and followed by two 3'-terminal nucleotides which are
apparently unable to form a canonical terminal stem. The human U46
snoRNA is encoded within the second intron of the S8 ribosomal
protein gene (26). To dissect elements essential for the
accumulation of U46 snoRNA, fragments of the human S8 gene
encompassing the coding region of U46 snoRNA with or without intronic flanking sequences were inserted into the second intron of the
human
-globin gene (Fig. 2A). The
resulting constructs were placed under the control of the CMV promoter
and transfected into simian COS7 cells (25). The
accumulation of U46 snoRNA and the spliced globin mRNA was
monitored by RNase A/T1 mapping using antisense RNA
probes specific for each expression construct (Fig. 2B). Control
mapping with RNAs obtained from human HeLa cells (Fig. 2B, lanes 2, 6, and 10) and nontransfected COS7 cells (lanes 3, 7, and 11) revealed
that the human and simian U46 snoRNAs can be readily distinguished
based on their different migration properties in a denaturing
polyacrylamide gel. RNA fragments protected by the simian U46
snoRNA migrated slightly faster than those protected by the human
U46 snoRNA.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of the 5' and 3' termini of human U46
snoRNA. (A) Primer extension analysis. A terminally labeled oligo
complementary to the human U46 snoRNA from positions 21 to 40 was
annealed to HeLa cell snoRNAs and extended by use of avian
myeloblastosis virus reverse transcriptase (lane R). Lanes G, A, T, and
C represent dideoxy sequencing reactions performed on a recombinant
plasmid carrying the human U46 gene. The extended DNA products were
fractionated on a 6% sequencing gel. (B) Determination of the 3' end
of the human U46 snoRNA by the T4 RNA ligase-PCR procedure.
Sequence analysis of three cDNA clones obtained from independent PCRs
resulted in the same 3'-terminal snoRNA sequences. Sequences of the
oligoribonucleotide ligated to the snoRNA are also indicated.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Processing of the U46 snoRNA from the second intron
of the human -globin pre-mRNA expressed in COS7 cells. (A) Schematic
representation of the expression constructs used for transfection of
simian COS7 cells. The CMV promoter, the exon regions (E1 to E3), and
the polyadenylation (PA) site of the human -globin gene are
indicated. The relevant restriction sites are shown (C,
ClaI; E, EcoRI; H,
HindIII; M, MluI; X,
XhoI). The human U46 intronic snoRNA (open arrow) with
or without its authentic flanking sequences was inserted into the
ClaI/MluI or ClaI/XhoI
sites of the globin (GL) expression construct. (B) RNase
A/T1 mapping of U46 snoRNA accumulation. RNAs isolated
from human HeLa (H) cells and from transfected (T) or nontransfected
(N) COS7 cells were mapped with sequence-specific RNA probes as
indicated above the lanes; C, control mapping with Escherichia
coli tRNA. RNA fragments protected by the first (E1) and second
(E2) exons of the spliced globin mRNA and the human (hU46) and simian
(sU46) U46 snoRNAs are indicated. Lane M, size markers in
nucleotides.
|
|
Mapping of RNAs obtained from COS7 cells transfected with the
GL-U46(93/54) (Fig. 2B, lane 4) and GL-U46(8/9) (lane 8)
constructs yielded a protected RNA identical in size to the human U46
snoRNA, in addition to the endogenous simian U46-specific fragment.
However, no human U46-specific sequences were detected in RNAs
extracted from COS7 cells transfected with the GL-U46(0/0)
construct, which carried only the coding region of the human U46 gene.
The human
-globin mRNA was correctly and efficiently processed from
the GL-U46(0/0) transcript (Fig. 2B, lane 12), as it was from the GL-U46(93/54) and GL-U46(8/9) transcripts (lanes 4 and 8).
Thus, we concluded that the 8-nucleotide upstream and 9-nucleotide
downstream flanking sequences of the U46 snoRNA carry indispensable
information for snoRNA processing.
An intronic stem structure is required for the accumulation of U46
snoRNA.
We noticed that the upstream and downstream intronic
sequences flanking the human U46 snoRNA in the S8 pre-mRNA possess
the potential to form an 8-bp perfect double helix (Fig.
3A). In the GL-U46(8/9) transcript,
this interaction is accidentally elongated with an additional U-A base
pair originating from the terminal nucleotides of the ClaI
and MluI restriction sites used for the insertion of
U46-containing fragments of the S8 gene. A possible function of the
5',3'-terminal stem might be the folding of C and D boxes into close
proximity with each other (57, 60). For processing of the
human U46 snoRNA, instead of the canonical 5',3'-terminal stem, an
intronic helix may juxtapose the C and D boxes. To test this
hypothesis, the putative intronic stem of the GL-U46(8/9) construct
was destroyed by substitution of either the 5' or the 3' side of the
helix (Fig. 3A). Upon transfection of the resulting
GL-U46(8/9) and GL-U46(8/9) constructs
into COS7 cells, the expression of the U46 snoRNA and the globin
mRNA was tested by RNase mapping (Fig. 3B). The
GL-U46(8/9) and GL-U46(8/9) pre-mRNAs
were correctly and efficiently spliced, but no detectable amount of U46
snoRNA was processed from the excised introns of these transcripts
(Fig. 3B, lanes 8 and 12). When the two stem mutations were combined
and, therefore, the intronic stem structure of U46 was reestablished,
the accumulation of faithfully processed U46 snoRNA was restored
(Fig. 3B, lane 16). These results demonstrate that the formation of an
external helix structure is essential for the production of U46
snoRNA and that the nucleotide composition of the intronic stem
structure does not influence the efficiency or fidelity of the
processing reaction.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Processing of U46 snoRNA with altered external
stems. (A) Proposed secondary structure of the 5',3'-terminal region of
human U46 snoRNA in the GL-U46(8/9) pre-mRNA. Nucleotides
derived from the human S8 pre-mRNA are in uppercase letters. Lowercase
letters indicate nucleotides originating from the
ClaI/MluI sites of the GL expression construct.
Sequences retained in the mature U46 snoRNA are boxed. The C and D
box motifs are highlighted. Sequences used to destroy the external stem
of U46 in the GL-U46(8/9) and
GL-U46(8/9) constructs are in italics. (B) RNase
A/T1 mapping of U46 accumulation. The GL-U46(8/9),
GL-U46(8/9), GL-U46(8/9), and
GL-U46(8/9) constructs were transfected
into COS7 cells. RNAs isolated from transfected (T) or nontransfected
(N) COS cells were mapped with sequence-specific RNA probes as
indicated above the lanes; H and C, control mappings with HeLa cell or
E. coli RNAs, respectively. Lane M, size markers in
nucleotides. See the legend to Fig. 2 for designations.
|
|
The accumulation of an intronic artificial box C/D snoRNA is
supported by an external stem structure.
To exclude the formal
possibility that internal sequence and/or structural elements located
in the U46 snoRNA might contribute to the processing of this
snoRNA, we constructed an artificial box C/D snoRNA, called X1
RNA. Apart from the essential box C and D motifs and the 3'-terminal
nucleotides that were designed to form an 8-bp helix with sequences
preceding the C box, the sequence of the X1 RNA was randomly generated.
The artificial X1 locus was inserted into the ClaI and
MluI sites of the pGLCXM expression vector (Fig.
2A) and transfected into COS7 cells. A predicted two-dimensional
structure of the 5',3'-terminal stem-box C/D domain of the putative
pre-X1 RNA is shown in Fig. 4A. In the GL-X1(0) construct, base pairing
of the terminal stem of X1 RNA was disrupted (Fig.
4A). In the GL-X1(3), GL-X1(5), GL-X1(7), and GL-X1(9) constructs, novel helices of increasing length were constructed outside of the predicted mature X1 RNA sequences.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Processing of an artificial box C/D snoRNA from the
second intron of the human -globin pre-mRNA. (A) Schematic
representation of artificial box C/D snoRNAs. The X1, X1(0), X1(3),
X1(5), X1(7), and X1(9) artificial snoRNAs were expressed in COS7 cells
within the second intron of the human globin pre-mRNA. Asterisks
indicate the 5'-terminal nucleotides of the processed X1, X1(7), and
X1(9) RNAs. (B) RNase mapping of the accumulation of X1 artificial
snoRNAs. RNAs extracted from COS7 cells transfected with the GL,
GL-X1, GL-X1(0), GL-X1(3), GL-X1(5), GL-X1(7), or GL-X1(9) expression
construct were mapped with sequence-specific RNA probes as indicated
above the lanes. Lane N, control mapping performed with RNAs obtained
from nontransfected cells; lane M, size markers in nucleotides. See the
legend to Fig. 2 for designations.
|
|
RNase A/T1 mapping of RNAs extracted from COS7 cells
transfected with the GL-X1 construct detected a 70- to
72-nucleotide-long RNA (Fig. 4B, lane 3) that was absent from cells
transfected with the pGLCXM expression vector (lane 2).
Since the size of the accumulating RNA corresponded to the predicted
length of the mature X1 RNA, we concluded that the artificial
snoRNA was processed from the globin pre-mRNA. This conclusion was
further corroborated by primer extension analysis using an X1-specific
oligo primer (data not shown). The accumulation of X1 RNA further
supported the idea that the processing of box C/D snoRNAs can rely
exclusively on the canonical box C/D-stem core motif (6, 44,
57). Again, predictably enough (6, 9, 20, 57),
disruption of the terminal stem of X1 RNA completely abolished RNA
accumulation (Fig. 4B, lane 4). More importantly, introduction of an
external helix of 7 bp (Fig. 4B, lane 7) but not 3 nor 5 bp (lanes
5 and 6) restored the accumulation of X1 RNA. Extension of the length of the external helix up to 9 bp [GL-X1(9) construct] further improved the accumulation of the mature X1 RNA (Fig. 4B, lane 8),
demonstrating that an intronic helix can substitute for the canonical
terminal stem during the processing of mammalian intron-encoded box C/D
snoRNAs. The 5' termini of X1 RNAs excised from the GL-X1, GL-X1(7), and GL-X1(9) transcripts were determined by primer extension analysis (data not shown). In each case, the accumulating artificial snoRNA featured five 5'-terminal nucleotides preceding the C box motif, indicating that selection of the snoRNA 5' terminus is independent of the position of the stem structure.
Compilation of mammalian intronic pre-snoRNA sequences lacking
a canonical 5',3'-terminal stem.
A closer inspection of the
available human and mouse precursor sequences of box C/D intronic
snoRNAs revealed that each snoRNA that lacks a 5',3'-terminal
stem possesses upstream and downstream intronic sequences which are
able to form short stem structures (Fig.
5). The length of these putative double
helices varies between 5 bp (mouse U27) and 16 bp (human U44).
Unfortunately, the 5'- and 3'-terminal nucleotides have been
experimentally determined for only a few snoRNAs (Fig. 5).
Nevertheless, the available data show that in some instances, the
putative external stem may include nucleotides that are preserved in
the 5'- and/or 3'-terminal sequences of mature snoRNAs
(e.g., hU31, hU36b, hU42, hU48, hU55, and mU36b). In other
instances, the proposed external stem is composed of intronic sequences
that are fully degraded during snoRNA formation (e.g., hU30, hU37,
hU43, hU44, and hU46). While snoRNAs with a canonical box C/D-stem
core motif possess five or six 3'-terminal nucleotides after the D box
motif, snoRNAs lacking a terminal stem usually feature only
two unpaired 3'-terminal nucleotides. In both groups of
snoRNAs, the C box is preceded by four or, more frequently,
five nucleotides (Fig. 5). In summary, the presence of potential
external helices in the pre-RNAs of mammalian intron-encoded box
C/D snoRNAs lacking a canonical 5',3'-terminal stem further underlines the functional importance of intronic stem structures in
snoRNA processing and accumulation.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Proposed structures of the intron-snoRNA junction
regions of human and mouse pre-mRNAs encoding box C/D snoRNAs
without a canonical 5',3'-terminal stem. Sequences of the human (h)
U27, U30, and U31 (54), U36b (18), U37
(38), U42, U43, U44, U46, U48, U55, and U56 (26),
and U76 and U78 (47) pre-snoRNAs and the mouse (m) U25,
U27, U30, and U31 (54), U36b (18), and U44 and
U78 (47) pre-snoRNAs were taken from the literature.
Solid lines represent snoRNA sequences located between the C and D
box motifs. Asterisks indicate the experimentally determined
5',3'-terminal nucleotides of mature snoRNAs.
|
|
An internal helix structure supports the accumulation of X1
artificial snoRNA.
Although the data presented thus far are
consistent with the idea that external helices play an important role
in the biogenesis of box C/D snoRNAs, it remains questionable
whether external helices alone could support the accumulation of
some naturally occurring snoRNAs. The minimal length of the
external stem capable of supporting production of the X1 artificial
snoRNA was established as 7 bp (Fig. 4). Therefore, it seems
unlikely that, for example, processing of the human U31 or the
mouse U25 and U27 snoRNAs, which possess only 5- or
6-bp-long external helices, could rely exclusively on such short
interactions (Fig. 5). Computer-aided modeling of the human U31 and the
mouse U25 and U27 snoRNAs revealed that they contain 7- to
10-bp-long internal helices that could be formed by snoRNA
sequences located between the C and D boxes (Fig.
6A). Moreover, extension of the
structural investigation to other snoRNAs lacking a canonical
5',3'-terminal stem showed that these snoRNAs frequently possess
potential internal stem structures (data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Processing of artificial box C/D snoRNAs carrying
internal stem structures. (A) Proposed internal stems of the human (h)
U31 and the mouse (m) U25 and U27 snoRNAs. For other details, see
the legend to Fig. 5. (B) Schematic representation of artificial X1
snoRNAs. (C) Accumulation of X1 RNAs processed from the human
-globin pre-mRNA. RNA samples obtained from COS7 cells transfected
with the GL-X1, GL-X1(0), GL-X1(0)-(9), GL-X1(5t), or GL-X1(5t)-(9)
expression construct were analyzed by RNase A/T1
mapping. For other details, see the legends to Fig. 2 and 4.
|
|
We assayed whether internal helices could support the accumulation of
intron-encoded box C/D snoRNAs. To this end, processing from
chimeric globin pre-mRNAs carrying the X1 artificial box C/D snoRNA
either possessing or lacking an internal helix structure was
investigated with COS7 cells (Fig. 6B and C). Consistent with our
previous observation (Fig. 4), the X1(0) artificial snoRNA, which
carries neither a terminal nor an external stem, failed to accumulate
in COS7 cells (Fig. 6C, lane 3). However, when an internal stem
of 9 bp was introduced into the X1(0) snoRNA the resulting
X1(0)-(9) snoRNA was correctly, although inefficiently, processed from the globin pre-mRNA (Fig. 6B, lane 4).
Finally, we tested whether internal and external stem structures could
function in a cooperative manner. The X1(5t) artificial snoRNA
possesses the potential to form a terminal stem of 5 bp in a
noncanonical configuration. Namely, the D box and the putative terminal
stem of X1(5t) are separated by an unpaired nucleotide (Fig. 6B). Upon
expression in COS7 cells, the noncanonical terminal stem of X1(5t)
failed to support snoRNA processing from the globin pre-mRNA (Fig.
6C, lane 5). In contrast, when the noncanonical terminal stem of the
X1(5t) snoRNA was supplemented with a 9-bp-long internal stem (Fig.
6B), the resulting X1(5t)-(9) snoRNA was faithfully processed (Fig.
6C, lane 6). Significantly, the level of accumulation of the
X1(5t)-(9) snoRNA was comparable to that of the X1 snoRNA, carrying a canonical 5',3'-terminal stem (Fig. 6C, lane 2). These results demonstrate that an internal stem structure can compensate for
the lack of a functional terminal stem structure and that internal
helices may function in concert with external elements during
snoRNA processing.
 |
DISCUSSION |
Most box C/D snoRNAs are processed from intronic or
polycistronic pre-snoRNAs by exonucleolytic activities (see
above). The box C/D terminal core motif, including the phylogenetically
conserved nucleotides of boxes C and D and the base-paired
5',3'-terminal stem, plays a pivotal role in the biogenesis and
function of these snoRNAs. The box C/D-stem motif directs the correct
processing of the snoRNA (6, 9, 57, 60), provides
metabolic stability for the mature snoRNA (6, 20, 31),
directs the nucleolar localization of the snoRNA (29, 36,
44), and functions in the rRNA 2'-O-methylation
reaction (10, 26, 27). The multiple functions of the box
C/D-stem motif are accomplished by snoRNP proteins which directly
or indirectly bind to this structural motif (8, 14, 28, 58).
In vitro reconstitution experiments suggested that, in addition to the
conserved C and D boxes, the adjacent 5',3'-terminal stem also plays a
fundamental role in snoRNP assembly (8, 58). Consistent
with this conclusion, the terminal stem is essential for the processing
(57, 60) and accumulation (9, 20, 31) of box C/D snoRNAs.
Contrary to the observed essentiality of the 5',3'-terminal stem, many
box C/D snoRNAs lack a terminal helix (26, 32, 54).
Elements underlying the accumulation of these snoRNAs remain conjectural. In this study, systematic modeling of pre-mRNA introns hosting a box C/D snoRNA suggested that the presence of an external intronic stem is a common feature of mammalian snoRNAs lacking a
terminal stem (Fig. 5). Indeed, in vivo processing studies demonstrated that an intronic stem is required for the accumulation of the human U46
snoRNA, which features no terminal stem (Fig. 2 and 3). Apparently,
the nucleotide composition of the external stem of U46 snoRNA has
no functional importance, since replacement of the cognate intronic
stem of U46 snoRNA with an artificial helix influenced neither the
efficiency nor the fidelity of snoRNA excision (Fig. 3). The above
conclusion was further corroborated by the fact that, in the presence
of an external stem, the X1 artificial snoRNA was efficiently
processed from the
-globin pre-mRNA (Fig. 4). Together, these
findings suggest that the processing of mammalian box C/D snoRNAs
lacking a canonical 5',3'-terminal stem is supported by external stem
structures that are fully or partially formed by intronic sequences
flanking the snoRNA.
The notion that external stem structures can facilitate the processing
of intronic box C/D snoRNAs reinforces the previous idea that
bringing boxes C and D into close proximity is an important requirement
for snoRNA accumulation (52, 57). Most likely, appropriate spatial arrangement of the C and D boxes promotes binding
of the snoRNP core proteins that protect the snoRNA sequences from exonucleolytic degradation. Since the intronic sequences involved
in external helix formation are degraded during snoRNA excision, we
propose that folding of the C and D boxes together is essential only
for snoRNA processing and that snoRNP proteins bound to the C
and D boxes provide metabolic stability for the mature snoRNA. This
idea also implies that, contrary to the previous belief, the canonical
5',3'-terminal stem functions mainly, if not exclusively, in the
processing of box C/D snoRNAs. Production of mature intronic
snoRNAs can be considered a compromise of two competitive
processes, namely, exonucleolytic intron degradation and snoRNP
assembly on the intronic precursor RNA. In vitro snoRNP reconstitution experiments suggested that the canonical box C/D core
motif, in which the terminal helix is immediately followed by the D box
and is separated from the C box by one unpaired nucleotide (Fig. 5),
represents the most favorable structural configuration for snoRNP
assembly (8, 58). We assume that the accumulation of
intronic snoRNAs with a canonical 5',3'-terminal stem depends mainly on the level of synthesis of the host pre-mRNA, since these snoRNAs are processed with high efficacy. In contrast, the
expression of snoRNAs lacking a canonical terminal stem can depend
greatly on the structural conformation of the pre-snoRNA (Fig.
4 and 6). In other words, intronic pre-snoRNAs with weak
snoRNP binding capacity are more likely to be degraded by
processing exonucleases; therefore, these snoRNAs may accumulate
less efficiently (Fig. 4).
Previously, it has been hypothesized that the processing of box C/D
snoRNAs lacking a 5',3'-terminal stem is facilitated by internal
stem structures that are formed by snoRNA sequences located between
the C and D boxes (57). Although an internal helix
introduced into the X1 artificial snoRNA restored a detectable
level of snoRNA accumulation, it failed to support the efficient
production of the X1 RNA (Fig. 6). This result indicates that folding
of the C and D boxes together by an internal stem could not entirely fulfill the structural requirements of efficient snoRNA processing. However, in concert with a short noncanonical terminal stem, the same
internal helix could support the efficient processing of X1 RNA, even
though the noncanonical stem was unable to sustain snoRNA
processing alone (Fig. 6). This result suggests that internal stem
structures, in conjunction with other structural elements, such as
noncanonical terminal or external stem structures, may significantly
influence the accumulation of box C/D snoRNAs.
Very recently, processing of the yeast U18 and snR38
intron-encoded snoRNAs has been reported to be dependent
on external intronic stem structures (56), suggesting
that parallels can be drawn between the processing mechanisms of yeast
and mammalian intronic snoRNAs lacking a terminal stem. Indeed, a
closer examination of yeast polycistronic and intronic box C/D
snoRNAs devoid of a canonical terminal stem revealed that these
snoRNAs are flanked by inverted repeat sequences that, in
principle, are able to form helix structures (56;
data not shown). In contrast to the mammalian introns, large parts of
the yeast snoRNA host introns can be folded into long rod-shaped
structures that are built of 27 (U18) to 59 (snR39 and snR59) bp
forming small internal loops and bulges (data not shown). Remarkably,
the snoRNAs are located invariantly on the top of the long intronic
stem structure. The functional importance of this unique organization
of the yeast snoRNA host introns, if any, remains to be established.
In conclusion, in vivo processing experiments performed with the human
U46 snoRNA and an artificial box C/D snoRNA revealed that the
biogenesis of mammalian intron-encoded box C/D snoRNAs is a more
complex process than has been anticipated. Besides the previously
characterized box C/D-stem core motif, additional cis-acting elements located within the snoRNA and/or in the flanking intronic sequences may contribute to the processing and accumulation of this
class of snoRNAs. Most likely, the external and internal stem
structures, like the canonical 5',3'-terminal stem, promote the folding
of C and D boxes into close proximity with each other and thereby
facilitate the assembly of the snoRNP core complex on the
pre-snoRNA.
 |
ACKNOWLEDGMENTS |
We thank Y. de Preval for the synthesis of oligonucleotides.
X.D. was supported by Ministère de l'Education Nationale, de la
Recherche, et de la Technologie. This work was supported by the Centre
Nationale de la Recherche Scientifique, Université Paul Sabatier,
Toulouse, France, and by grants from la Ligue Nationale Contre le
Cancer and l'Association pour la Recherche sur le Cancer.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Biologie Moléculaire Eucaryote du CNRS, 118 route de Narbonne,
31062 Toulouse, France. Phone: (33) 5 61 33 59 91. Fax: (33) 5 61 33 58 86. E-mail: tamas{at}ibcg.biotoul.fr.
 |
REFERENCES |
| 1.
|
Allmang, C.,
E. Petfalski,
A. Podtelejnikov,
M. Mann,
D. Tollervey, and P. Mitchell.
1999.
The yeast exosome and human PM-Scl are related complexes of 3' 5' exonucleases.
Genes Dev.
13:2148-2158[Abstract/Free Full Text].
|
| 2.
|
Allmang, C.,
J. Kufel,
G. Chanfreau,
P. Mitchell,
E. Petfalski, and D. Tollervey.
1999.
Functions of the exosome in rRNA, snoRNA and snRNA synthesis.
EMBO J.
18:5399-5410[CrossRef][Medline].
|
| 3.
|
Bachellerie, J.-P.,
B. Michot,
M. Nicoloso,
A. Balakin,
J. Ni, and M. J. Fournier.
1995.
Antisense snoRNAs: a family of nucleolar RNAs with long complementarities to rRNA.
Trends Biochem. Sci.
20:261-264[CrossRef][Medline].
|
| 4.
|
Balakin, A. G.,
L. Smith, and M. J. Fournier.
1996.
The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions.
Cell
86:823-834[CrossRef][Medline].
|
| 5.
|
Bortolin, M.-L.,
P. Ganot, and T. Kiss.
1999.
Elements essential for accumulation and function of small nucleolar RNAs directing site-specific pseudouridylation of ribosomal RNAs.
EMBO J.
18:457-469[CrossRef][Medline].
|
| 6.
|
Caffarelli, E.,
A. Fatica,
S. Prislei,
E. De Gregorio,
P. Fragapane, and I. Bozzoni.
1996.
Processing of the intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA.
EMBO J.
15:1121-1131[Medline].
|
| 7.
|
Caffarelli, E.,
M. Arese,
B. Santoro,
P. Fragapane, and I. Bozzoni.
1994.
In vitro study of processing of the intron-encoded U16 snoRNA in Xenopus laevis.
Mol. Cell. Biol.
14:2966-2974[Abstract/Free Full Text].
|
| 8.
|
Caffarelli, E.,
M. Losito,
C. Giorgi,
A. Fatica, and I. Bozzoni.
1998.
In vitro identification of nuclear factors interacting with the conserved elements of box C/D small nucleolar RNAs.
Mol. Cell. Biol.
18:1023-1028[Abstract/Free Full Text].
|
| 9.
|
Cavaillé, J., and J.-P. Bachellerie.
1996.
Processing of fibrillarin-associated snoRNAs from pre-mRNA introns: an exonucleolytic process exclusively directed by the common stem-box terminal structure.
Biochimie
78:443-456[Medline].
|
| 10.
|
Cavaillé, J.,
M. Nicoloso, and J.-P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[CrossRef][Medline].
|
| 11.
|
Cecconi, F.,
P. Mariottini, and F. Amaldi.
1995.
The Xenopus intron-encoded U17 snoRNA is produced by exonucleolytic processing of its precursor in oocytes.
Nucleic Acids Res.
23:4670-4676[Abstract/Free Full Text].
|
| 12.
|
Chanfreau, G.,
G. Rotondo,
P. Legrain, and A. Jacquier.
1998.
Processing of a dicistronic small nucleolar RNA precursor by the RNA endonuclease Rnt1.
EMBO J.
17:3726-3737[CrossRef][Medline].
|
| 13.
|
Chanfreau, G.,
P. Legrain, and A. Jacquier.
1998.
Yeast RNase III as a key processing enzyme in small nucleolar RNA metabolism.
J. Mol. Biol.
284:975-988[CrossRef][Medline].
|
| 14.
|
Fatica, A.,
S. Galardi,
F. Altieri, and I. Bozzoni.
2000.
Fibrilarin binds directly and specifically to U16 box C/D snoRNA.
RNA
6:88-95[Abstract].
|
| 15.
|
Fragapane, P.,
S. Prislei,
A. Michienzi,
E. Caffarelli, and I. Bozzoni.
1993.
A novel small nucleolar RNA (U16) is encoded inside a ribosomal protein intron and originates by processing of the pre-mRNA.
EMBO J.
12:2921-2928[Medline].
|
| 16.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 17.
|
Ganot, P.,
M.-L. Bortolin, and T. Kiss.
1997.
Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs.
Cell
89:799-809[CrossRef][Medline].
|
| 18.
|
Gilley, J., and M. Fried.
1998.
Evolution of U24 and U36 snoRNAs encoded within introns of vertebrate rpL7a gene homologs: unique features of mammalian U36 variants.
DNA Cell Biol.
17:591-602[Medline].
|
| 19.
|
Goodall, G. J.,
K. Wiebauer, and W. Filipowicz.
1990.
Analysis of pre-mRNA processing in transfected plant protoplasts.
Methods Enzymol.
181:148-161[Medline].
|
| 20.
|
Huang, G. M.,
A. Jarmolowski,
J. C. R. Struck, and M. J. Fournier.
1992.
Accumulation of U14 small nuclear RNA in Saccharomyces cerevisiae requires box C, box D, and a 5',3'-terminal stem.
Mol. Cell. Biol.
12:4456-4463[Abstract/Free Full Text].
|
| 21.
|
Hughes, J. M. X., and M. Ares, Jr.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 22.
|
Kass, S.,
K. Tyc,
J. A. Steitz, and B. Sollner-Webb.
1990.
The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing.
Cell
60:897-908[CrossRef][Medline].
|
| 23.
|
Kiss, T.,
M. L. Bortolin, and W. Filipowicz.
1996.
Characterization of the intron-encoded U19 RNA, a new mammalian small nucleolar RNA that is not associated with fibrillarin.
Mol. Cell. Biol.
16:1391-1400[Abstract].
|
| 24.
|
Kiss, T., and W. Filipowicz.
1993.
Small nucleolar RNAs encoded by introns of the human cell cycle regulatory gene RCC1.
EMBO J.
12:2913-2920[Medline].
|
| 25.
|
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424[Abstract/Free Full Text].
|
| 26.
|
Kiss-László, Z.,
Y. Henry,
J.-P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[CrossRef][Medline].
|
| 27.
|
Kiss-László, Z.,
Y. Henry, and T. Kiss.
1998.
Sequence and structural elements of methylation guide snoRNAs essential for site-specific ribose methylation of pre-rRNA.
EMBO J.
17:797-807[CrossRef][Medline].
|
| 28.
|
Lafontaine, D. L. J., and D. Tollervey.
1999.
Nop58 is a common component of the box C+D snoRNPs that is required for snoRNP stability.
RNA
5:455-467[Abstract].
|
| 29.
|
Lange, T. S.,
A. Borovjagin,
E. S. Maxwell, and S. A. Gerbi.
1998.
Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs.
EMBO J.
17:3176-3187[CrossRef][Medline].
|
| 30.
|
Li, H. V.,
J. Zagorski, and M. J. Fournier.
1990.
Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:1145-1152[Abstract/Free Full Text].
|
| 31.
|
Li, H. V., and M. J. Fournier.
1992.
U14 function in Saccharomyces cerevisiae can be provided by large deletion variants of yeast U14 and hybrid mouse-yeast U14 RNAs.
EMBO J.
11:683-689[Medline].
|
| 32.
|
Lowe, T. M., and S. R. Eddy.
1999.
A computational screen for methylation guide snoRNAs in yeast.
Science
283:1168-1171[Abstract/Free Full Text].
|
| 33.
|
Lyman, S. K.,
L. Gerace, and S. L. Baserga.
1999.
Human Nop5/Nop58 is a component common to the box C/D small nucleolar ribonucleoproteins.
RNA
5:1597-1604[Abstract].
|
| 34.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-934[CrossRef].
|
| 35.
|
Morrissey, J. P., and D. Tollervey.
1993.
Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis.
Mol. Cell. Biol.
13:2469-2477[Abstract/Free Full Text].
|
| 36.
|
Narayanan, A.,
W. Speckmann,
R. Terns, and M. P. Terns.
1999.
Role of the box C/D motif in localization of small nucleolar RNAs to coiled bodies and nucleoli.
Mol. Biol. Cell
10:2131-2147[Abstract/Free Full Text].
|
| 37.
|
Ni, J.,
A. L. Tien, and M. J. Fournier.
1997.
Small nucleolar RNAs direct site-specific synthesis of pseudouridine in ribosomal RNA.
Cell
89:565-573[CrossRef][Medline].
|
| 38.
|
Nicoloso, M.,
L.-H. Qu,
B. Michot, and J.-P. Bachellerie.
1996.
Intron-encoded antisense small nucleolar RNAs: the characterization of nine novel species points to their role as guides for the 2'-O-ribose methylation of rRNAs.
J. Mol. Biol.
260:178-195[CrossRef][Medline].
|
| 39.
|
Ooi, S. L.,
D. A. Samarsky,
M. J. Fournier, and J. D. Boeke.
1998.
Intronic snoRNA biosynthesis in Saccharomyces cerevisiae depends on the lariat-debranching enzyme: intron length effects and activity of precursor snoRNA.
RNA
4:1096-1110[Abstract].
|
| 40.
|
Peculis, B. A., and J. A. Steitz.
1993.
Disruption of U8 nucleolar snRNA inhibits 5.8S and 28S rRNA processing in the Xenopus oocyte.
Cell
73:1233-1245[CrossRef][Medline].
|
| 41.
|
Petfalski, E.,
T. Dandekar,
Y. Henry, and D. Tollervey.
1998.
Processing of the precursors to small nucleolar RNAs and rRNAs requires common components.
Mol. Cell. Biol.
18:1181-1189[Abstract/Free Full Text].
|
| 42.
|
Prislei, S.,
A. Michienzi,
C. Presutti,
P. Fragapane, and I. Bozzoni.
1993.
Two different snoRNAs are encoded in introns of amphibian and human L1 ribosomal protein genes.
Nucleic Acids Res.
21:5824-5830[Abstract/Free Full Text].
|
| 43.
|
Qu, L.-H.,
A. Henras,
Y.-J. Lu,
H. Zhou,
W. X. Zhou,
Y.-Q. Zhu,
J. Zhao,
Y. Henry,
M. Caizergues-Ferrer, and J.-P. Bachellerie.
1999.
Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast.
Mol. Cell. Biol.
19:1144-1158[Abstract/Free Full Text].
|
| 44.
|
Samarsky, D. A.,
M. J. Fournier,
R. H. Singer, and E. Bertrand.
1998.
The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization.
EMBO J.
17:3747-3757[CrossRef][Medline].
|
| 45.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Savino, R., and S. A. Gerbi.
1990.
In vivo disruption of Xenopus U3 snRNA affects ribosomal RNA processing.
EMBO J.
9:2299-2308[Medline].
|
| 47.
|
Smith, M. S., and J. A. Steitz.
1998.
Classification of gas5 as a multi-small-nucleolar-RNA (snoRNA) host gene and a member of the 5'-terminal oligopyrimidine gene family reveals common features of snoRNA host genes.
Mol. Cell. Biol.
18:6897-6909[Abstract/Free Full Text].
|
| 48.
|
Sollner-Webb, B.,
K. T. Tycowski, and J. A. Steitz.
1996.
Ribosomal RNA processing in eukaryotes, p. 469-490.
In
R. A. Zimmermann, and A. E. Dahlberg (ed.), Ribosomal RNA. Structure, evolution, processing, and function in protein biosynthesis. CRC Press, Inc., Boca Raton, Fla.
|
| 49.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342[CrossRef][Medline].
|
| 50.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 51.
|
Tycowski, K. T.,
C. M. Smith,
M.-D. Shu, and J. A. Steitz.
1996.
A small nucleolar RNA required for site-specific ribose methylation of rRNA in Xenopus.
Proc. Natl. Acad. Sci. USA
93:14480-14485[Abstract/Free Full Text].
|
| 52.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1993.
A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein S3.
Genes Dev.
6:1120-1130[Abstract/Free Full Text].
|
| 53.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1994.
Requirement for intron-encoded U22 small nucleolar RNA in 18S ribosomal RNA maturation.
Science
266:1558-1561[Abstract/Free Full Text].
|
| 54.
|
Tycowski, K. T.,
M.-D. Shu, and J. A. Steitz.
1996.
A mammalian gene with introns instead of exons generating stable RNA products.
Nature
379:464-466[CrossRef][Medline].
|
| 55.
|
Villa, T.,
F. Ceradini,
C. Presutti, and I. Bozzoni.
1998.
Processing of the intron-encoded U18 small nucleolar RNA in the yeast Saccharomyces cerevisiae relies on both exo- and endonucleolytic activities.
Mol. Cell. Biol.
18:3376-3383[Abstract/Free Full Text].
|
| 56.
|
Villa, T.,
F. Ceradini, and I. Bozzoni.
2000.
Identification of a novel element required for processing of intron-encoded box C/D small nucleolar RNAs in Saccharomyces cerevisiae.
Mol. Cell. Biol.
20:1311-1320[Abstract/Free Full Text].
|
| 57.
|
Watkins, N. J.,
R. D. Leverette,
L. Xia,
M. T. Andrew, and E. S. Maxwell.
1996.
Elements essential for processing intronic U14 snoRNA are located at the termini of the mature snoRNA sequence and include conserved nucleotide boxes C and D.
RNA
2:118-133[Abstract].
|
| 58.
|
Watkins, N. J.,
D. R. Newman,
J. F. Kuhn, and E. S. Maxwell.
1998.
In vitro assembly of the mouse U14 snoRNP core complex and identification of a 65-kDa box C/D-binding protein.
RNA
5:582-593.
|
| 59.
|
Weinstein, L. B., and J. A. Steitz.
1999.
Guided tours: from precursor snoRNA to functional snoRNP.
Curr. Opin. Cell Biol.
11:378-384[CrossRef][Medline].
|
| 60.
|
Xia, L.,
N. J. Watkins, and E. S. Maxwell.
1997.
Identification of specific nucleotide sequences and structural elements required for intronic U14 snoRNA processing.
RNA
3:17-26[Abstract].
|
Molecular and Cellular Biology, July 2000, p. 4522-4531, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liang, X.-h., Hury, A., Hoze, E., Uliel, S., Myslyuk, I., Apatoff, A., Unger, R., Michaeli, S.
(2007). Genome-Wide Analysis of C/D and H/ACA-Like Small Nucleolar RNAs in Leishmania major Indicates Conservation among Trypanosomatids in the Repertoire and in Their rRNA Targets. Eukaryot Cell
6: 361-377
[Abstract]
[Full Text]
-
Richard, P., Kiss, A. M., Darzacq, X., Kiss, T.
(2006). Cotranscriptional Recognition of Human Intronic Box H/ACA snoRNAs Occurs in a Splicing-Independent Manner.. Mol. Cell. Biol.
26: 2540-2549
[Abstract]
[Full Text]
-
SZEWCZAK, L. B. W., GABRIELSEN, J. S., DEGREGORIO, S. J., STROBEL, S. A., STEITZ, J. A.
(2005). Molecular basis for RNA kink-turn recognition by the h15.5K small RNP protein. RNA
11: 1407-1419
[Abstract]
[Full Text]
-
Aspegren, A., Hinas, A., Larsson, P., Larsson, A., Soderbom, F.
(2004). Novel non-coding RNAs in Dictyostelium discoideum and their expression during development. Nucleic Acids Res
32: 4646-4656
[Abstract]
[Full Text]
-
MARMIER-GOURRIER, N., CLERY, A., SENTY-SEGAULT, V., CHARPENTIER, B., SCHLOTTER, F., LECLERC, F., FOURNIER, R., BRANLANT, C.
(2003). A structural, phylogenetic, and functional study of 15.5-kD/Snu13 protein binding on U3 small nucleolar RNA. RNA
9: 821-838
[Abstract]
[Full Text]
-
Zhou, H., Chen, Y.-Q., Du, Y.-P., Qu, L.-H.
(2002). The Schizosaccharomyces pombe mgU6-47 gene is required for 2'-O-methylation of U6 snRNA at A41. Nucleic Acids Res
30: 894-902
[Abstract]
[Full Text]
-
Hirose, T., Steitz, J. A.
(2001). Position within the host intron is critical for efficient processing of box C/D snoRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA
10.1073/pnas.231490998v1
[Abstract]
[Full Text]
-
Hirose, T., Steitz, J. A.
(2001). Position within the host intron is critical for efficient processing of box C/D snoRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA
98: 12914-12919
[Abstract]
[Full Text]