Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 4572-4579, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A GG Nucleotide Sequence of the 3' Untranslated
Region of Amyloid Precursor Protein mRNA Plays a Key Role in the
Regulation of Translation and the Binding of Proteins
E. G. Mbongolo
Mbella,1
S.
Bertrand,2
G.
Huez,2 and
J.-N.
Octave1,*
Laboratoire de Pharmacologie
Expérimentale, Université Catholique de Louvain, UCL
54.10, B-1200 Brussels,1 and
Département de Biologie Moléculaire, Laboratoire de
Chimie Biologique, Université Libre de Bruxelles, B-1640
Rhodes-Saint-Genèse,2 Belgium
Received 10 December 1999/Returned for modification 1 February
2000/Accepted 5 April 2000
 |
ABSTRACT |
The alternative polyadenylation of the mRNA encoding the amyloid
precursor protein (APP) involved in Alzheimer's disease generates two
molecules, with the first of these containing 258 additional nucleotides in the 3' untranslated region (3'UTR). We have previously shown that these 258 nucleotides increase the translation of APP mRNA
injected in Xenopus oocytes (5). Here, we
demonstrate that this mechanism occurs in CHO cells as well. We also
present evidence that the 3'UTR containing 8 nucleotides more than the
short 3'UTR allows the recovery of an efficiency of translation similar
to that of the long 3'UTR. Moreover, the two guanine residues located at the 3' ends of these 8 nucleotides play a key role in the
translational control. Using gel retardation mobility shift assay, we
show that proteins from Xenopus oocytes, CHO cells, and
human brain specifically bind to the short 3'UTR but not to the long
one. The two guanine residues involved in the translational control
inhibit this specific binding by 65%. These results indicate that
there is a correlation between the binding of proteins to the 3'UTR of
APP mRNA and the efficiency of mRNA translation, and that a GG motif
controls both binding of proteins and translation.
| |
INTRODUCTION |
The control of gene expression
governs cell differentiation. The first step of this control is
provided by the transcription of specific genes. In eucaryotic cells,
the scanning of a gene by the RNA polymerase II leads to the production
of a nuclear transcript which, in most cases, will undergo three major
modifications: capping of its 5' untranslated region (5'UTR),
polyadenylation of the 3'UTR, and splicing of introns (13,
38).
At the postranscriptional level, the efficiency of translation of
mature mRNA can also regulate gene expression. The phosphorylation of
initiation factors of translation, which interact with the 5' end of
mRNAs, has been demonstrated to modulate translation (21,
31).
The presence of secondary structures in the 5'UTR can also influence
mRNA translation either by increasing the binding affinity of some
eucaryotic initiation factors (18) or by interacting with
cellular proteins which can completely inhibit the initiation of
translation (9, 33).
Although the 3'UTR is located downstream of the coding sequence, it has
been widely demonstrated that this region can also modulate mRNA
translation (41). The poly(A) tail is one element of the
3'UTR implicated in both the stability of mRNA and the regulation of
its translation (34). The poly(A) tail can increase the
stability of an mRNA molecule by protecting the mRNA from digestion by
3'
5' exonucleases (7). A more dynamic role has been
attributed to the poly(A) tail since it was demonstrated that its
removal from the 3' end of capped mRNA decreases translation (22,
37). In Saccharomyces cerevisiae the enhancement of
translation mediated by the poly(A) tail requires the formation of a
complex between the poly(A) tail and a poly(A) binding protein (PABP) since the depletion of the PABP results in the inhibition of
translation (36). This complex is supposed to promote the
initiation of translation of capped mRNA by promoting the recruitment
of the 40S ribosomal subunit (40). In addition, the PABP was
also demonstrated to interact with eukaryotic initiation factors
(11, 17). The interaction of PABP with different components
of the preinitiation complex of translation might explain why a
sequence located downstream of a coding region is able to control translation.
Adenosine-uridine rich (AUR) sequences within the 3'UTR are known to
affect mRNA translation (3, 43, 44). In this case, the
mechanism involved in the regulation of translation is not clearly
understood. Indeed, AUR sequences have been demonstrated to reduce the
stability of mRNA (16), but in some cases AUR sequences
inhibit translation without affecting the mRNA stability (15). Proteins can interact with AUR sequences (2, 19, 24, 42), and some of these protein-AUR complexes can either increase mRNA stability (27) or decrease their translational efficiency (10, 46).
In erythroblasts, inhibitory proteins have been purified and
demonstrated to interact with oligonucleotide repeats present in the
3'UTR of the lipoxygenase mRNA (25).
We have previously shown that alternative polyadenylation of amyloid
precursor protein (APP) mRNA generates two sets of transcripts which
differ by the length of their 3'UTR and by their translational efficiency (5). The 258 nucleotides (nt) located within the two utilized polyadenylation sites are clearly involved in the modulation of translation. In this study, we demonstrate that the
addition of only 8 nt to the short mRNA allows the recovery of an
efficiency of translation similar to that of the long mRNA.
Since recent data show that protein-3'UTR complexes are involved in the
regulation of translation (14, 25, 29, 39), we have also
investigated a possible interaction between proteins and the 3'UTR of
the APP mRNA. We demonstrate that proteins specifically bind to the
3'UTR of the short APP mRNA. The same proteins do not interact with the
long 3'UTR. The addition of 8 nucleotides to the short 3'UTR inhibits
the specific binding of proteins and induces a concomitant increase of
translational efficiency.
| |
MATERIALS AND METHODS |
Plasmid constructions.
The sequence from the 3'UTR of the
APP695 cDNA was amplified from the pHMG695 plasmid (4) with
a sense oligonucleotide (5'GTGCACACATTAGGCATTGAGAC3') and an
antisense oligonucleotide (5'GGATCCGGATCCGCTCCTCCAAGAATGTATT
TATTTAC3'). A PstI-BamHI fragment of this
PCR product was cloned in the PstI-BamHI sites of
either the pSP64CAT plasmid (5) or the pSP64 plasmid to
obtain pSP64CAT APP and pSP64 APP, respectively.
Cell culture.
CHO cells were cultured at 37°C under 5%
CO2 in Ham's F-12 medium with L-glutamine
(Biowhitaker) supplemented with 10% fetal calf serum (Biowhitaker),
penicillin, and streptomycin.
In vitro transcription and production of 32P-labeled
probes.
Four micrograms of pSP64CAT APP or pSP64 APP plasmids was
linearized with BamHI, XmaI, or SmaI.
They were then transcribed with 40 U of SP6 RNA polymerase
(Boehringer Mannheim) in 60 µl of reaction buffer containing 149 U of RNase inhibitor (HPRI; Amersham Pharmacia Biotech) and a 1 mM
concentration of each nucleotide triphosphate. Samples were incubated
for 1 h at 37°C prior to the addition of 15 U of RNase-free
DNase (GIBCO-BRL). A further incubation of 20 min at 37°C allowed the
digestion of the DNA template. The transcripts were then filtered on
Sephadex G-50 columns, phenol-chloroform extracted, ethanol
precipitated, and lyophilized. The mRNA was resuspended in deionized
water and analyzed on agarose gels. For transcripts used in in vivo
translation experiments, 7-methyl guanosine (Boehringer Mannheim) was
added to the mixture and the concentration of GTP was reduced to 167 µM. Radiolabeled probes were transcribed from 1 µg of linearized
DNA in the presence of 100 µCi of [
-32P]UTP (800 Ci/mmol; Amersham Pharmacia Biotech), 72 µM unlabeled UTP, and an 800 µM concentration of each of the remaining three unlabeled nucleotide
triphosphates. The approximate concentration of the labeled probes was
calculated according to the specific activity of
[-32P]UTP, the percentage of UTP molecules in each
transcript, and the percentage of [-32P]UTP
incorporation in the synthesized probe.
Addition of a poly(A) tail was performed in vitro using poly(A)
polymerase (Pharmacia Biotech). Briefly, 1 µg of mRNA was incubated
for 30 min at 37°C in 50 µl of Tris buffer (40 mM Tris-HCl [pH
8], 10 mM MgCl2, 2.5 mM MnCl2, 250 mM NaCl, 50 µg of bovine serum albumin per µl) containing 250 µM of ATP and 2 U of poly(A) polymerase. The transcripts were ethanol precipitated and
further sequenced to determine the length of the poly(A) tail.
The chloramphenicol acetyltransferase (CAT) antisense riboprobe used in
the Northern blot analyses was synthesized in the
presence of T7 RNA
polymerase from the pGEM CAT linearized with
PstI.
In vivo translation of capped mRNA.
For translation in
Xenopus oocytes, the capped mRNAs were diluted in deionized
water to a final concentration of 100 ng/µl. They were then injected
in stage VI Xenopus oocytes (50 nl of mRNA solution/oocyte)
in which they were translated at room temperature for 6 h. During
the in vivo translation, the oocytes were incubated in Marc's modified
Ringer's solution. The oocytes were then immersed in liquid nitrogen
to stop the translation process. Translation in CHO cells was performed
by transfection of 106 cells with 2 µg of capped mRNA
using the Lipofectamine reagent from Gibco. After 4 h incubation,
the cells were scrapped, harvested by centrifugation at 200 × g, and stored at 
80°C.
CAT assay.
Xenopus oocytes were crushed in a 250 mM
Tris solution (50 µl/oocyte) and CHO cells were lysed in the same
solution by three freezing-thawing steps. The amount of CAT protein
produced after translation was evaluated by the CAT assay described by
Gorman et al. (8). The quantification of the CAT assay was
performed using a phosphorimager (Molecular Dynamics).
RNA isolation.
The injected oocytes were crushed in 500 µl
of a Tris solution (10 mM, pH 7.4) containing NaCl (150 mM), EDTA (1 mM), and 100 µg of proteinase K. Following phenol-chloroform
extraction, total RNA was ethanol precipitated and resuspend in water.
Total RNA from CHO cells was extracted from the pellet using the
Tripure reagent from Boehringer
Mannheim.
Northern blot analysis.
Ten micrograms of total RNA was
denatured in a solution containing dimethyl sulfoxide, glyoxal, and 10 mM phosphate buffer; loaded on 1% agarose gel, and transferred after
migration on nylon membrane Hybond-N (Amersham Pharmacia Biotech). The
membrane was hybridized for 16 h at 65°C with the CAT antisense
riboprobe in 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate)-50% formamide-0.5% sodium dodecyl sulfate (SDS) solution,
then washed twice for 30 min at 68°C in 2× SSC-1.5% SDS solution
and twice for 30 min at 72°C in 0.2× SSC-1% SDS solution.
The 18S and 28S rRNAs were revealed using methylene blue staining
(
20).
Preparation of cellular and tissular extracts.
Stage VI
oocytes, CHO cells, or brain tissues were homogenized on ice with a
Potter homogenizer in 2 volumes of Tris buffer (50 mM, pH 7.5)
containing glycerol (25%), KCl (50 mM), EDTA (0.1 mM), and
dithiothreitol (0.5 mM) in the presence of protease inhibitors phenylmethylsulfonyl fluoride [1 mM], leupeptin (1 µg/ml) and pepstatin (0.1 µg/ml). The sample was centrifuged at 4°C for 1 h at 100,000 × g. The supernatant was recovered and
aliquoted at 80°C. Protein concentration was determined with the
Bio-Rad protein assay kit.
Mobility shift assay.
Radiolabeled 3'UTR-L (344 nt), 3'
UTR-2G (88 nt), and 3' UTR-S (86 nt) were transcribed in vitro from the
pSP64 APP plasmid restricted by BamHI, XmaI, and
SmaI, respectively. [-32P]UTP-labeled 3'UTR
mRNA (2.2 fmol) was incubated on ice in 16 µl of a solution
containing either 10 µg of proteins or water (control), 20 µg of
yeast tRNA, 149 U of HPRI and 8 µl of reaction buffer (Tris [20 mM,
pH 7.4], MnCl2 [0.5 mM], KCl [100 mM],
CaCl2 [20 mM], ZnCl2 [0.5 mM],
dithiothreitol [1 mM], glycerol [5%]). For competition
experiments, a 50× molar excess of unlabeled 3'UTR mRNA was added to
the reaction mixture prior to the addition of labeled probe. After 20 min of incubation, 20 U of RNase T1 was added to the
sample, which was further incubated for 45 min at 37°C. Sample was
then loaded on a 5% nondenaturing polyacrylamide gel prepared in TBE
buffer (Tris [89 mM], boric acid [89 mM], EDTA [2 mM, pH 8]) and
electrophoresed at a constant current (30 mA) for 3 to 4 h. The
gel was then dried and subjected to autoradiography on X-Omat film (Kodak).
| |
RESULTS |
The 3'UTR of APP mRNA regulates translation in the absence of a
poly(A) tail.
We have previously shown that the APP mRNA uses two
polyadenylation sites separated by 258 nt. In Xenopus
oocytes, the APP mRNA with the long 3'UTR (APP-L) was translated three
times more efficiently than the APP mRNA with the short 3'UTR (APP-S).
When the 3'UTR of the APP mRNA [2871 to poly(A) tail in Fig.
1] was cloned downstream of the CAT cDNA
sequence, the in vivo translation of these polyadenylated chimeric
mRNAs in Xenopus oocytes indicated that the long mRNA
produced two times more protein than the short one (5).
Since the poly(A) tail was demonstrated to be able to influence
translation (22), we first measured whether the difference
in translation was confirmed after removal of the poly(A) sequence from
the long and the short chimeric mRNAs.
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence of the 3'UTR of APP mRNA. The
PstI-BamHI fragment involved in the translational
control was amplified by PCR and cloned downstream of a CAT reporter
gene. Boxes indicate the two polyadenylation sites used by the APP
mRNA. Restriction sites used for linearization or cloning are
underlined. Arrows indicate the position of the poly(A) tail on the
short or the long 3'UTR. The translation termination codon is indicated
in boldface type. The sequence is numbered according to the numbering
of Kang et al. (12).
|
|
A
PstI-
BamHI PCR fragment amplified from the long
3'UTR of APP mRNA (Fig.
1) was cloned in the pSP64CAT vector (Fig.
2A).
In vitro transcription performed after linearization with
BamHI
generated the long chimeric CAT mRNA bearing the
3'UTR-L of APP
mRNA (CAT-L), which is not polyadenylated. When the same
construct
was linearized with
SmaI (Fig.
2A), in vitro
transcription allowed
us to produce a short chimeric CAT mRNA bearing
the 3'UTR-S of
APP mRNA (CAT-S), which is not polyadenylated. The 3'UTR
of this
last messenger contains 6 nt more than the short 3'UTR
previously
described (
5) (Fig.
1).
CAT-S and CAT-L mRNAs were injected in
Xenopus oocytes, and
the CAT activity was measured 6 h later as previously described
(
5). The results in Fig.
2B
shows that more CAT activity was
measured from CAT-L than from CAT-S
mRNA although Northern blot
analysis showed that similar amounts of
both mRNAs were recovered
from injected oocytes. Quantification of
several CAT assays indicated
that CAT-L produces 2.9 ± 0.4 (mean ± standard deviation) (
n =
5) times more
CAT activity than CAT-S.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
(A) The pSP64CAT APP plasmid results from the cloning of
the PstI-BamHI PCR fragment of the 3'UTR of APP
mRNA downstream of the CAT reporter gene. This construct was digested
with SmaI or BamHI to produce CAT-S and CAT-L
mRNAs after in vitro transcription. These mRNAs were translated in
Xenopus oocytes (B) as well as in CHO cells (C). Typical CAT
assays were performed with extracts from both cellular models. Northern
blot analysis was performed with a CAT antisense riboprobe, and the
rRNAs were visualized by methylene blue staining of the membranes.
Phosphorimager quantification of several CAT assays indicates that in
Xenopus oocytes (B) or in CHO cells (C), CAT-L mRNA produces 2.9 ± 0.4 (n = 5) and 2.2 ± 0.2 (n = 4) times more CAT activity than CAT-S mRNA, respectively. Results
are expressed as means + standard deviations (error bars).
|
|
A 1.9-fold difference was previously measured with constructs
containing a poly(A) sequence (Table
1).
We conclude, therefore,
that the difference of in vivo translation
between the long and
the short mRNAs is still observed when mRNAs are
not polyadenylated.
It has been demonstrated that the enhancement of translation mediated
by the poly(A) tail needs the presence of a PABP which
can interact
with eucaryotic initiation factors (
17), thus facilitating
the reinitiation of translation. The PABP expression is developmentally
regulated in
Xenopus oocytes, and its mRNA is translated
from
the blastula stage (
47). Since all the in vivo
translations
were performed in stage VI oocytes, the absence of PABP at
this
stage could explain why the polyadenylation of mRNAs is
dispensable
for the control of mRNA translation in oocytes.
Consequently,
the influence of the polyA tail on the regulation of
translation
was studied in CHO
cells.
CHO cells were transfected with the cDNA encoding either APP-S or
APP-L. The APP protein was quantified and normalized for
APP mRNA.
Results presented in Table
1 show that the APP-L mRNA
produces 4.5 times more APP when compared to the APP-S
mRNA.
CHO cells were transfected with cDNA encoding either the CAT-L or CAT-S
chimeric mRNAs (
5). At 48 h after transfection,
the CAT
activity produced by translation of the in situ polyadenylated
mRNAs
was quantified and normalized for the CAT mRNA. CAT-L mRNA
was
demonstrated to produce 3.3 ± 0.3 (
n = 3) times
more CAT activity
than CAT-S mRNA (Table
1).
The nonpolyadenylated chimeric CAT-L and CAT-S mRNAs
injected in
Xenopus oocytes were also transfected in
CHO cells. The results
presented in Fig.
2C indicate that more CAT
activity was measured
from CAT-L mRNA. After Northern blot analysis,
CAT-L mRNA was
more abundant in CHO cells than CAT-S mRNA. However,
quantification
of several CAT assays normalized for CAT mRNA indicates
that CAT-L
mRNA produces 2.2 ± 0.2 (
n = 4) times
more CAT activity than CAT-S
mRNA (Fig.
2C and Table
1).
Altogether, these results clearly indicate that, in both
Xenopus oocytes and CHO cells, the 3'UTR of APP mRNA
regulates translation
without polyadenylation of the long and the short
mRNAs. Furthermore,
we have previously demonstrated that elongation of
the short 3'UTR
sequence with a poly(A) tail or a sequence which is not
related
to APP mRNA does not allow recovery of the efficiency of
translation
of the long 3'UTR sequence (
5). This
demonstrates that the
nucleotide sequence rather than the length of the
sequence that
follows the short 3'UTR is critical for the control of
translation.
Identification of the nucleotide sequence of the 3'UTR of APP mRNA
involved in the regulation of translation.
Since the 3'UTR of APP
mRNA by itself regulates translation, we have tried to localize the
nucleotide sequence responsible for this regulation. Therefore,
elongation of the short 3'UTR was performed and the possible influence
on translation was monitored. Linearization of the CAT-APP 3'UTR
construct with SmaI allowed us to add 6 nt to the short
3'UTR (Fig. 1). In vivo translation of the CAT-S and CAT-L mRNA
demonstrates that these additional nucleotides failed to restore the
efficiency of translation (Fig. 2). The CAT-APP 3'UTR construct was
then linearized by XmaI. The XmaI site is located
in the 3'UTR of the APP mRNA at position 2958 (Fig. 1). This allowed us
to produce the CAT-2G mRNA, which differs from the CAT-S mRNA by only
two additional G residues at the 3' end (Fig.
3A).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
(A) The pSP64CAT APP plasmid was linearized with
SmaI or XmaI to produce CAT-S and CAT-2G mRNAs.
These mRNAs were translated in Xenopus oocytes (B) as well
as in CHO cells (C). Typical CAT assays were performed with extracts
from both cellular models. Northern blot analysis was performed with a
CAT antisense riboprobe, and the rRNAs were visualized by methylene
blue staining of the membranes. Phosphorimager quantification of
several CAT assays indicates that in Xenopus oocytes (B) or
in CHO cells (C), CAT-2G mRNA produces 2.7 ± 0.3 (n = 3) and 3.1 ± 0.6 (n = 3) times more CAT
activity than CAT-S mRNA, respectively. Results are expressed as
means + standard deviations.
|
|
After 6 h of in vivo translation in
Xenopus oocytes,
the CAT-2G mRNA produced more CAT activity than the CAT-S mRNA (Fig.
3B). Northern blot analysis (Fig.
3B) showed, however, that this
is not
related to the recovery of a larger amount of CAT-2G mRNA
from injected
oocytes. Quantification of several CAT assays indicated
that CAT-2G
mRNA produces 2.73 ± 0.3 (
n = 3) times more CAT
activity
than CAT-S mRNA (Fig.
3B).
In vitro transcribed CAT-2G and CAT-S mRNA were also transfected in CHO
cells. The CAT activity was quantified and normalized
for CAT mRNA.
CAT-2G mRNA produces 3.1 ± 0.6 (
n = 3) more CAT
activity than CAT-S mRNA (Fig.
3C).
Altogether, these results demonstrate that elongation of the short
3'UTR by the next 3' 8 nt increases translation to the
level observed
with the long 3'UTR. This translational control
is particularly
dependent on the presence of the two G residues
localized at the 3' end
of this 8 nt
sequence.
Interaction between the 3'UTR of APP mRNA and proteins.
Since
interactions between proteins and the 3'UTR of mRNAs are involved in
the regulation of translation (24), it was of interest to
determine whether proteins from Xenopus oocytes or CHO cells
could bind to the 3'UTR of APP mRNA.
The
PstI-
BamHI fragment of the long 3'UTR of APP
mRNA (Fig.
1) was cloned in the pSP64 plasmid. After linearization with
BamHI,
SmaI, and
XmaI, the mRNA
corresponding to the long 3'UTR (3'UTR-L),
the short 3'UTR (3'UTR-S),
and the short 3'UTR elongated with
two guanine residues (3'UTR-2G) were
generated by in vitro transcription
and used in electrophoretic
mobility shift
assay.
When incubated in the presence of a protein extract from
Xenopus oocytes, radiolabeled 3'UTR-L failed to interact
with proteins
(Fig.
4 and
5A). On the contrary, 3'UTR-S mRNA
interacts with
proteins, and different RNA-protein complexes are formed
(Fig.
4 and
5A). Some of these complexes appeared to result from a
specific
interaction, since a 50-fold molar excess of unlabeled short
3'UTR
mRNA completely abolished the formation of these RNA-protein
complexes
(Fig.
4 and
5A). Addition of an 80-residue poly(A) tail to
3'UTR-S
does not inhibit the interaction of this short sequence with
the
same proteins (Fig.
4). This indicates that the nucleotide sequence
rather than the length of 3'UTR-L is critical for the binding
of
proteins.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 4.
The PstI-BamHI PCR fragment of the
3'UTR from APP mRNA (Fig. 1) was cloned downstream of the SP6 promoter
of the pSP64 plasmid. This plasmid was digested with BamHI
or SmaI. The linearized plasmids were in vitro transcribed
to produce 3'UTR-L and 3'UTR-S. These probes were tested for their
ability to bind proteins from Xenopus oocyte. The longer
radiolabeled 3'UTR (3'UTR-L) failed to interact with proteins from
Xenopus oocytes, while the shorter radiolabeled 3'UTR
(3'UTR-S) was able to form specific complexes, as demonstrated by
competition with a 50-fold excess of the same cold probe. Addition of
an 80-residue poly(A) tail to the radiolabeled 3'UTR-S (3'UTR-SA) does
not interfere with the binding of these proteins.
|
|
View larger version (53K):
[in this window]
[in a new window]
|
FIG. 5.
The PstI-BamHI PCR fragment of the
3'UTR from APP mRNA (Fig. 1) was cloned downstream of the SP6 promoter
of the pSP64 plasmid. This plasmid was digested with BamHI,
SmaI, or XmaI. The linearized plasmids were in
vitro transcribed to produce 3'UTR-L, 3'UTR-S, and 3'UTR-2G,
respectively. These probes were tested for their ability to bind
proteins from Xenopus oocytes (A) or from CHO cells (B). The
longer radiolabeled 3'UTR (3'UTR-L) failed to interact with proteins
from Xenopus oocytes or CHO extracts, while the shorter
radiolabeled 3'UTR (3'UTR-S) was able to form specific complexes, as
demonstrated by competition with a 50-fold excess of the same cold
probe. 3'UTR-2G and 3'UTR-S bind the same proteins, since it is
possible to displace complexes on radiolabeled 3'UTR-2G with a 50-fold
excess of cold 3'UTR-S. However, when radiolabeled 3'UTR-S and 3'UTR-2G
probes with similar specific activity were incubated with increasing
concentrations of proteins, more 3'UTR-S was engaged in the formation
of complexes (C and D).
|
|
When incubated with the same cellular extracts from
Xenopus
oocytes, 3'UTR-2G mRNA forms mRNA-protein complexes (Fig.
5A),
with a
pattern identical to that observed with the 3'UTR-S mRNA
(Fig.
5A).
Furthermore, a 50-fold molar excess of unlabeled 3'UTR-S
mRNA was able
to prevent the formation of the same specific complexes
(Fig.
5A),
indicating that the same proteins bind to both 3'UTR-S
and 3'UTR-2G
mRNAs. However, the amount of 3'UTR-2G mRNA found
in complexes is much
lower as compared to the 3'UTR-S mRNA. To
further analyze this
difference, the same amount of either 3'UTR-S
or 3'UTR-2G mRNA at the
same specific radioactivity was incubated
in the presence of increasing
concentrations of proteins from
Xenopus oocytes, and the
radioactivity associated with the complexes
was quantified. The
saturation curves shown in Fig.
5C indicate
that the addition of two
guanine residues to 3'UTR-S decreased
by 70% the amount of complexes
formed.
When incubated with CHO cell extracts, the 3'UTR-L probe failed to
interact with proteins (Fig.
5B). On the contrary, 3'UTR-S
mRNA formed
specific complexes with proteins from CHO cells (Fig.
5B). The 3'UTR-2G
mRNA interacts with the same proteins as 3'UTR-S,
since a 50× molar
excess of unlabeled 3'UTR-S mRNA prevents the
formation of the
complexes with the radiolabeled 3'UTR-2G mRNA
(Fig.
5B). However, the
addition of two guanine residues to the
3'UTR-S mRNA decreases by 62%
the amount of complexes formed (Fig.
5D).
Interestingly enough, in both
Xenopus oocytes and CHO cells,
this higher capacity of 3'UTR-S to form complexes is linked to
a lower
translation efficiency of the CAT-S mRNA compared to that
of CAT-2G
mRNA. Furthermore, proteins which interact with 3'UTR-S
do not form
complexes with 3'UTR-L, which drives a better translation
of a coding
sequence. Therefore, a possible function of these
proteins as
inhibitors of translation cannot be
excluded.
3'UTR-S forms complexes with proteins from human brain
extracts.
In both Xenopus oocytes and CHO cells, mRNAs
bearing the 3'UTR-L are better translated than those bearing the
3'UTR-S. This difference in translation efficiency correlates with the
specific binding of proteins to 3'UTR-S. To investigate whether such
3'UTR-protein interactions could occur in the human brain, radiolabeled
3'UTR-S and 3'UTR-L mRNA were incubated in the presence of a human
brain extract. Interestingly enough, radiolabeled 3'UTR-L mRNA failed to form complexes, while the 3'UTR-S mRNA specifically interacted with
human brain proteins (Fig. 6). Therefore,
these results suggest that the translational control by the 3'UTR of
APP mRNA could occur in the human brain as well.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Interaction of the 3'UTR of APP mRNA with proteins from
human brain. When incubated with human brain extracts, 3'UTR-L failed
to interact with proteins. On the contrary, 3'UTR-S shows specific
interaction.
|
|
| |
DISCUSSION |
Alternative polyadenylation, a mechanism used by numerous genes
(6), results in the production of mRNA molecules differing in the length of their 3'-terminal exon. These mRNAs generally encode
the same protein, and the alternative polyadenylation could appear to
be of low importance in cellular function. Nevertheless, recent data
have demonstrated that the preferential use of a polyadenylation site
could be associated with a modification of either the stability of the
mRNA or the efficiency of its translation (5, 23, 30).
The mRNA encoding the APP involved in Alzheimer's disease uses two
polyadenylation sites. This generates a long and a short mRNA, the
former containing 258 additional nt in the 3'UTR. We have previously
shown that, compared to the short polyadenylated 3'UTR, the long
polyadenylated 3'UTR enhances the translation of APP mRNA
(5). We wondered whether the full-length 258 nt sequence
could enhance translation without the presence of a poly(A) tail. We
also investigated the region of this 258-nt sequence which was
implicated in the regulation of translation. Finally, we have studied
the possible role of interactions between proteins and the 3'UTR of APP
mRNA in the modulation of translation.
The 3'UTR of APP mRNA by itself modulates translation, without the
presence of a poly(A) tail.
Nonpolyadenylated chimeric CAT mRNAs,
either CAT-L or CAT-S, were injected in Xenopus oocytes or
transfected in CHO cells. In these two cellular models, the CAT-L mRNA
was translated more efficiently than the CAT-S mRNA (Fig. 2D; Table 1).
These results clearly indicate that the 3'UTR of APP mRNA by itself
regulates translation in Xenopus oocytes and CHO cells, even
without the polyadenylation of the long and the short mRNAs.
Addition of 8 nt 3' to the APP-S mRNA results in an enhanced
efficiency of translation.
To study the sequence of the 3'UTR
involved in the modulation of translation of the APP mRNA
(5), 8 nt of the long 3'UTR of APP mRNA was added to the
APP-S mRNA. We demonstrate that the addition of these 8 nt is
sufficient to abolish the relative inhibition of the short mRNA
translation (Fig. 3). This regulation occurs in both Xenopus
oocytes and CHO cells. Interestingly, the two guanine residues of the
3' end of this 8-nt sequence play a key role in the regulation of translation.
Binding of proteins to the short 3'UTR of APP mRNA correlates with
a decreased efficiency of translation.
Numerous cases have been
reported in which the translational control is mediated by protein-RNA
interaction. Since the long 3'UTR of APP mRNA increases its
translation, we wondered whether this could result from the binding of
an activator of translation to this sequence.
Surprisingly, our data show that the long 3'UTR failed to interact with
proteins from
Xenopus oocytes, CHO cells, and human
brain
homogenate. On the contrary, the short 3'UTR specifically
interacts
with proteins. Addition of the two guanine residues
3' to the 3'UTR-S
results in a 65 to 70% decrease of the amount
of RNA-protein complexes
formed. This difference related to the
presence of 2 additional nt
could result from the alteration of
a stable structure needed for the
formation of the complexes.
In CHO cells as well as in
Xenopus oocytes, the lack of complexes
(3'UTR-L) or a
decrease of the amount of the mRNA found in complexes
(3'UTR-2G)
correlates with an increased efficiency of translation.
On the
contrary, an efficient and specific binding of 3'UTR-S
to proteins
correlates with a decreased efficiency of translation.
Therefore,
proteins involved in the formation of these complexes
could be involved
in the translational control of the APP
mRNA.
Although the nucleotide sequence involved in the specific APP
mRNA-protein interactions is present in both the short and the
long
3'UTR, the specific complexes are only found with the short
3'UTR. The
absence of these specific interactions between proteins
and the long
3'UTR could result from the presence of secondary
structures in the
long nucleotide
sequence.
The nucleotide sequence rather than the length of the sequence
following the short 3'UTR of APP mRNA seems of importance to
prevent
the formation of complexes. Indeed, addition of 80 A residues
to this
short 3'UTR by poly(A) polymerase has no effect on the
binding of the
proteins to the short
sequence.
Different translational controls of APP mRNA have been recently
reported. In the 5'UTR, APP mRNA contains a sequence homologous
to the
iron-responsive element which modulates translation in
response to
interleukin 1 stimulation of astrocytoma cells (
32).
In the
3'UTR, a 29-oligonucleotide element (
28,
45) and an
81-oligonucleotide element (
1) have been demonstrated to
increase
the stability of the APP mRNA through protein-mRNA
interactions.
These stabilizing elements are located upstream of the
regulatory
sequence reported here and have no homology with our
cis sequence.
These different posttranscriptional controls of APP mRNA translation
and stability could be of importance, since the overproduction
of APP
could be related to the development of the characteristic
neuropathological lesions of Alzheimer's disease (
35). Such
an overproduction of APP has been well documented in Down's syndrome
patients and is related to the trisomy of the chromosome 21, which
carries the APP gene. In these patients, abundant senile plaques
and
neurofibrillary tangles are found in adult brain. In patients
with
Alzheimer's disease, the number of APP genes is the same
as that in
normal subjects (
26), but the control of translation
and
stability of the APP mRNA could modify APP production without
additional copy of the APP gene. The further identification of
proteins
which could inhibit APP mRNA translation by interacting
with its 3'UTR
will be useful in controlling the production of
APP, which is
transformed into amyloid peptide, the major constituent
of the amyloid
core of senile plaques of Alzheimer's
disease.
| |
ACKNOWLEDGMENTS |
We thank Véronique Kruys for gifts of pGEM CAT and the
pSP64 plasmid. We also acknowledge Bernadette Tasiaux, Huguette Delhez, and Jacques Doumont for their technical assistance.
This work was supported by the Belgian Queen Elizabeth Medical
Fundation. J.-N.O. is a senior research associate of the Belgian FNRS.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Pharmacologie Expérimentale, Université Catholique de
Louvain, UCL 54.10, Avenue Hipppocrate 54, B-1200 Brussels, Belgium.
Phone: 32 2 764 93 41. Fax: 32 2 764 93 40. E-mail:
Octave{at}nchm.ucl.ac.be.
| |
REFERENCES |
| 1.
|
Amara, F. M.,
A. Junaid,
R. R. Clough, and B. Liang.
1999.
TGF-beta(1), regulation of Alzheimer' amyloid precursor protein mRNA expression in a normal human astrocyte cell line: mRNA stabilization.
Brain Res. Mol. Brain Res.
71:42-49[Medline].
|
| 2.
|
Brewer, G.
1991.
An A+U-rich element RNA-binding factor regulates c-myc mRNA stability in vitro.
Mol. Cell. Biol.
11:2460-2466[Abstract/Free Full Text].
|
| 3.
|
Chen, C.-Y. A., and A.-B. Shyu.
1995.
AU-rich elements: characterization and importance in mRNA degradation.
Trends Biochem. Sci.
20:465-470[CrossRef][Medline].
|
| 4.
|
Czech, C.,
P. Delaere,
A.-F. Macq,
M. Reibaud,
S. Dreisler,
N. Touchet,
B. Schombert,
M. Mazadier,
L. Mercken,
M. Theisen,
L. Pradier,
J. N. Octave,
K. Beyreuther, and G. Tremp.
1997.
Proteolytical processing of mutated human amyloid precursor protein in transgenic mice.
Brain Res. Mol. Brain Res.
47:108-116[Medline].
|
| 5.
|
de Sauvage, F.,
V. Kruys,
O. Marinx,
G. Huez, and J. N. Octave.
1992.
Alternative polyadenylation of the amyloid protein precursor mRNA regulates translation.
EMBO J.
11:3099-3103[Medline].
|
| 6.
|
Edwards-Gilbert, G.,
K. L. Veraldi, and C. Milcareck.
1997.
Alternative poly(A) site selection in complex transcription units: means to an end?
Nucleic Acids Res.
25:2547-2561[Abstract/Free Full Text].
|
| 7.
|
Ford, L. P.,
P. S. Bagga, and J. Wilusz.
1997.
The poly(A) tail inhibits the assembly of a 3'-to-5' exonuclease in an vitro RNA stability system.
Mol. Cell. Biol.
17:398-406[Abstract].
|
| 8.
|
Gorman, C. M.,
L. F. Moffat, and B. H. Howard.
1982.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol.
2:1044-1051[Abstract/Free Full Text].
|
| 9.
|
Gray, N. K., and M. Wickens.
1998.
Control of translation initiation in animals.
Annu. Rev. Cell Dev. Biol.
14:399-458[CrossRef][Medline].
|
| 10.
|
Gueydan, C.,
L. Houzet,
A. Marchant,
A. Sels,
G. Huez, and V. Kruys.
1996.
Engagement of tumor necrosis factor mRNA by an endotoxin-inducible cytoplasmic protein.
Mol. Med.
2:479-488[Medline].
|
| 11.
|
Hentze, M. H.
1997.
eIF4G: A multiple purpose ribosome adapter?
Science
275:500-501[Free Full Text].
|
| 12.
|
Kang, J.,
H. G. Lemaire,
A. Unterbeck,
M. J. Salbaum,
C. L. Masters,
K. H. Grzeschik,
G. Multhaup,
K. Beyreuther, and B. Muller-Hill.
1987.
The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor.
Nature
331:733-736.
|
| 13.
|
Keller, W.
1995.
No end yet to messenger RNA 3' processing!
Cell
81:829-832[CrossRef][Medline].
|
| 14.
|
Kern, P. A.,
G. Ranganathan,
A. Yukht,
J. M. Ong, and R. C. Davis.
1996.
Translational regulation of lipoprotein lipase by thryoid hormone is via a cytoplasmic repressor that interacts with the 3' untranslated region.
J. Lipid Res.
37:2332-2340[Abstract].
|
| 15.
|
Kruys, V.,
M. Wathelet,
P. Poupart,
R. Contreras,
W. Fiers,
J. Content, and G. Huez.
1987.
The untranslated region of the human interferon- mRNA has an inhibitory effect on translation.
Proc. Natl. Acad. Sci. USA
84:6030-6034[Abstract/Free Full Text].
|
| 16.
| Lai, W. S., E. Carballo, J. R. Strum, E. A. Kennington, R. S. Phillips, and P. J. Blackshear.
1999. Evidence that tristetraprolin binds to AU-rich element and
promotes the deadenylation and destabilization of tumor necrosis factor
alpha mRNA. 19:4311-4323.
|
| 17.
|
Le, H.,
R. L. Tanguay,
M. L. Balasta,
C.-C. Wei,
K. S. Browning,
A. M. Metz,
D. J. Goss, and D. R. Gallie.
1997.
Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity.
J. Biol. Chem.
272:16247-16255[Abstract/Free Full Text].
|
| 18.
|
Liarakos, C. D.,
S. A. Theus,
A. S. Watson,
A. J. Wahba, and J. N. Dholakia.
1994.
The translation efficiency of ovalbumine mRNA is determined in part by a 5'-end hairpin structure.
Arch. Biochem. Biophys.
315:54-59[CrossRef][Medline].
|
| 19.
|
Malter, J. S.
1989.
Identification of an AUUUA-specific messenger RNA binding protein.
Science
246:664-666[Abstract/Free Full Text].
|
| 20.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual, p. 206.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 21.
|
Merrick, W. C.
1992.
Mechanism and regulation of eucaryotic protein synthesis.
Microbiol. Rev.
56:291-315[Abstract/Free Full Text].
|
| 22.
|
Munroe, D., and A. Jacobson.
1990.
mRNA poly(A) tail, a 3' enhancer of translation initiation.
Mol. Cell. Biol.
10:3441-3455[Abstract/Free Full Text].
|
| 23.
|
Myamoto, S.,
J. A. Chiorini,
E. Urcelay, and B. Safer.
1996.
Regulation of gene expression for translation initiation factor eIF-2a: importance of the 3' untranslated region.
Biochem. J.
315:791-798.
|
| 24.
|
Nakamaki, T.,
J. Imamura,
G. Brewer,
N. Tsuruoka, and H. P. Koeffler.
1995.
Characterization of adenosine-uridine-rich RNA binding factors.
J. Cell. Physiol.
65:484-492.
|
| 25.
|
Ostareck, D. H.,
A. Ostareck-Ledere,
M. Wilm,
B. J. Thiele,
M. Mann, and M. W. Hentze.
1997.
mRNA silencing in erythroid differentiation: hnRNP K and hnRNP E1 regulate 15-lipoxygenase translation from the 3' end.
Cell
89:597-606[CrossRef][Medline].
|
| 26.
|
Podlisny, M. B.,
G. Lee, and D. J. Selkoe.
1987.
Gene dosage of the amyloid beta precursor protein in Alzheimer's disease.
Science
238:669-671[Abstract/Free Full Text].
|
| 27.
|
Rajagopalan, L. E., and J. S. Malter.
1997.
Regulation of eukaryotic messenger RNA turnover.
Prog. Nucleic Acid Res. Mol. Biol.
56:257-286[Medline].
|
| 28.
|
Rajagopalan, L. E.,
C. J. Westmark,
J. A. Jarzembowski, and J. S. Malter.
1998.
hnRNP C increases amyloid protein (APP) production by stabilizing APP mRNA.
Nucleic Acids Res.
26:3418-3423[Abstract/Free Full Text].
|
| 29.
|
Ranganathan, G.,
J. M. Ong,
A. Yukht,
M. Saghizadeh,
R. B. Simsolo,
A. Pauers, and P. A. Kern.
1995.
Tissue specific expression of human lipoprotein lipase, effect of the 3'-untranslated region on translation.
J. Biol. Chem.
270:7149-7155[Abstract/Free Full Text].
|
| 30.
|
Ranganathan, G.,
D. Vu, and A. Kern.
1997.
Translational regulation of lipoprotein lipase by epinephrine involves a trans-acting binding protein interacting with the 3' untranslated region.
J. Biol. Chem.
272:2515-2519[Abstract/Free Full Text].
|
| 31.
|
Rhoads, R. E.
1993.
Regulation of eukaryotic protein synthesis by initiation factors.
J. Biol. Chem.
268:3017-3020[Free Full Text].
|
| 32.
|
Rogers, J. T.,
L. M. Leiter,
J. McPhee,
C. M. Cahill,
S. S. Zhan,
H. Potter, and L. N. Nilsson.
1999.
Translation of the alzheimer amyloid precursor protein mRNA is up-regulated by interleukin-1 through 5'-untranslated region sequences.
J. Biol. Chem.
274:6421-6431[Abstract/Free Full Text].
|
| 33.
|
Romeo, D. S.,
K. Park,
A. B. Roberts,
M. B. Sporn, and S.-J. Kim.
1993.
Growth factor-b1 5' untranslated region represses translation and specifically binds a cytosolic factor.
Mol. Endocrinol.
7:759-766[Abstract/Free Full Text].
|
| 34.
|
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450[Abstract/Free Full Text].
|
| 35.
|
Rumble, B.,
R. Retallack,
C. Hilbich,
G. Simms,
G. Multhaup,
R. Martins,
A. Hockey,
P. Montgomery,
K. Beyreuther, and C. L. Masters.
1989.
Amyloid A4 protein and its precursor in Down's syndrome and Alzheimer's disease.
N. Engl. J. Med.
320:1446-1452[Abstract].
|
| 36.
|
Sachs, A. B., and R. W. Davis.
1989.
The poly(A) binding protein is required for poly(A) shortening and 60S ribosomal subunit-dependent translation initiation.
Cell
58:857-867[CrossRef][Medline].
|
| 37.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle, and end: translation initiation in eukaryotes.
Cell
89:831-838[CrossRef][Medline].
|
| 38.
|
Sharp, P. A.
1994.
Split genes and RNA splicing.
Cell
77:805-815[CrossRef][Medline].
|
| 39.
|
Smibert, C. A.,
J. E. Wilson,
K. Kerr, and P. M. Macdonald.
1996.
Smaug protein represses translation of unlocalized nanos mRNA in the Drosophila embryo.
Genes Dev.
10:2600-2609[Abstract/Free Full Text].
|
| 40.
|
Tarun, S. Z., and A. Sachs.
1995.
A common function for mRNA 5' and 3' ends in translation initiation in yeast.
Genes Dev.
9:2997-3007[Abstract/Free Full Text].
|
| 41.
|
Thomson, A. M.,
J. T. Rogers, and P. J. Leedman.
1999.
Iron regulatory proteins, iron responsive elements and ferritin mRNA translation.
Int. J. Biochem. Cell Biol.
31:1139-1152[CrossRef][Medline].
|
| 42.
|
Vakalopoulou, E.,
J. Schaack, and T. Shenk.
1991.
A 32-kilodalton protein binds to AU-rich domains in the 3' untranslated regions of rapidly degraded mRNAs.
Mol. Cell. Biol.
11:3355-3364[Abstract/Free Full Text].
|
| 43.
|
Winstall, E.,
M. Gamache, and V. Raymond.
1995.
Rapid mRNA degradation mediated by the c-fos 3' AU-rich element and that mediated by the granulocyte-macrophage colony-stimulating factor 3' AU-rich element occur through similar polysome-associated mechanisms.
Mol. Cell. Biol.
15:3796-3804[Abstract].
|
| 44.
|
Xu, N.,
C.-Y. Chen, and A.-B. Shyu.
1997.
Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key sequence features controlling mRNA deadenylation and decay.
Mol. Cell. Biol.
17:4611-4621[Abstract].
|
| 45.
|
Zaidi, S. H. E., and J. S. Malter.
1995.
Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA.
J. Biol. Chem.
270:17292-17298[Abstract/Free Full Text].
|
| 46.
|
Zelus, B. D.,
D. H. Giebelhaus,
D. W. Eib,
K. A. Kenner, and R. T. Moon.
1989.
Expression of the poly(A)-binding protein during development of Xenopus laevis.
Mol. Cell. Biol.
9:2756-2760[Abstract/Free Full Text].
|
| 47.
|
Zhao, C.,
W. Tan,
M. Sokolowski, and S. Schwartz.
1996.
Identification of nuclear and cytoplasmic proteins that interact specifically with an AU-rich, cis-acting inhibitory sequence in the 3' untranslated region of human papillomavirus type 1 late mRNAs.
J. Virol.
70:3659-3667[Abstract].
|
Molecular and Cellular Biology, July 2000, p. 4572-4579, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lahiri, D. K., Chen, D., Maloney, B., Holloway, H. W., Yu, Q.-s., Utsuki, T., Giordano, T., Sambamurti, K., Greig, N. H.
(2007). The Experimental Alzheimer's Disease Drug Posiphen [(+)-Phenserine] Lowers Amyloid-beta Peptide Levels in Cell Culture and Mice. J. Pharmacol. Exp. Ther.
320: 386-396
[Abstract]
[Full Text]
-
Utsuki, T., Yu, Q.-s., Davidson, D., Chen, D., Holloway, H. W., Brossi, A., Sambamurti, K., Lahiri, D. K., Greig, N. H., Giordano, T.
(2006). Identification of Novel Small Molecule Inhibitors of Amyloid Precursor Protein Synthesis as a Route to Lower Alzheimer's Disease Amyloid-beta Peptide. J. Pharmacol. Exp. Ther.
318: 855-862
[Abstract]
[Full Text]
-
Shell, S. A., Hesse, C., Morris, S. M. Jr., Milcarek, C.
(2005). Elevated Levels of the 64-kDa Cleavage Stimulatory Factor (CstF-64) in Lipopolysaccharide-stimulated Macrophages Influence Gene Expression and Induce Alternative Poly(A) Site Selection. J. Biol. Chem.
280: 39950-39961
[Abstract]
[Full Text]
-
Subramaniam, K., Chen, K., Joseph, K., Raymond, J. R., Tholanikunnel, B. G.
(2004). The 3'-Untranslated Region of the {beta}2-Adrenergic Receptor mRNA Regulates Receptor Synthesis. J. Biol. Chem.
279: 27108-27115
[Abstract]
[Full Text]
-
Rogers, J. T., Randall, J. D., Cahill, C. M., Eder, P. S., Huang, X., Gunshin, H., Leiter, L., McPhee, J., Sarang, S. S., Utsuki, T., Greig, N. H., Lahiri, D. K., Tanzi, R. E., Bush, A. I., Giordano, T., Gullans, S. R.
(2002). An Iron-responsive Element Type II in the 5'-Untranslated Region of the Alzheimer's Amyloid Precursor Protein Transcript. J. Biol. Chem.
277: 45518-45528
[Abstract]
[Full Text]
-
Mazumder, B., Seshadri, V., Imataka, H., Sonenberg, N., Fox, P. L.
(2001). Translational Silencing of Ceruloplasmin Requires the Essential Elements of mRNA Circularization: Poly(A) Tail, Poly(A)-Binding Protein, and Eukaryotic Translation Initiation Factor 4G. Mol. Cell. Biol.
21: 6440-6449
[Abstract]
[Full Text]
-
Cok, S. J., Morrison, A. R.
(2001). The 3'-Untranslated Region of Murine Cyclooxygenase-2 Contains Multiple Regulatory Elements That Alter Message Stability and Translational Efficiency. J. Biol. Chem.
276: 23179-23185
[Abstract]
[Full Text]
Top
Abstract
Introduction
