Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 4879-4887, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Developmental Expression of Latent Transforming
Growth Factor
Binding Protein 2 and Its Requirement Early in
Mouse Development
J. Michael
Shipley,1,*
Robert P.
Mecham,2
Erika
Maus,1
Jeffrey
Bonadio,3
Joel
Rosenbloom,4
Ronald T.
McCarthy,5
Mary L.
Baumann,5
Cheryl
Frankfater,1
Fernando
Segade,2 and
Steven D.
Shapiro2,5
Division of Pulmonary and Critical Care
Medicine, Department of Medicine, Barnes-Jewish Hospital at Washington
University School of Medicine1 and
Departments of Cell Biology and
Physiology2 and
Pediatrics,5 Washington University
School of Medicine, St. Louis, Missouri 63110; Selective
Genetics, San Diego, California 921213; and
University of Pennsylvania School of Dental Medicine,
Philadelphia, Pennsylvania 191044
Received 23 February 2000/Accepted 20 March 2000
 |
ABSTRACT |
Latent transforming growth factor
(TGF-
) binding protein 2 (LTBP-2) is an integral component of elastin-containing microfibrils. We studied the expression of LTBP-2 in the developing mouse and rat by
in situ hybridization, using tropoelastin expression as a marker of
tissues participating in elastic fiber formation. LTBP-2 colocalized
with tropoelastin within the perichondrium, lung, dermis, large
arterial vessels, epicardium, pericardium, and heart valves at various
stages of rodent embryonic development. Both LTBP-2 and tropoelastin
expression were seen throughout the lung parenchyma and within the
cortex of the spleen in the young adult mouse. In the testes, LTBP-2
expression was seen within lumenal cells of the epididymis in the
absence of tropoelastin. Collectively, these results imply that LTBP-2
plays a structural role within elastic fibers in most cases. To
investigate its importance in development, mice with a targeted
disruption of the Ltbp2 gene were generated.
Ltbp2
/
mice die between embryonic day 3.5 (E3.5) and E6.5. LTBP-2 expression was not detected by in situ
hybridization in E6.5 embryos but was detected in E3.5 blastocysts by
reverse transcription-PCR. These results are not consistent with the
phenotypes of TGF-
knockout mice or mice with knockouts of other
elastic fiber proteins, implying that LTBP-2 performs a yet
undiscovered function in early development, perhaps in implantation.
 |
INTRODUCTION |
The elastic resilience and
structural integrity of the lungs, skin, and large blood vessels of
vertebrate animals are imparted by elastic fibers. These fibers consist
of the protein elastin and a network of 10- to 12-nm microfibrils,
which are composed of a number of glycoproteins (1, 33). In
elastic fibers, microfibrils are located around the periphery of the
amorphous elastin component of the fiber, as has been shown at the
electron microscopic level (4, 10). Microfibrils are also
present in tissues devoid of elastin, such as the ocular ciliary
zonules and the periodontal ligament. In these structures, the
microfibrils are nearly indistinguishable from microfibrils found in
elastic tissue. In the skin, microfibrils extend from the epidermis
into the dermis. Superficially, these fibers are not associated with elastin but become associated with elastin as they traverse the dermis.
The largest microfibrillar proteins identified thus far are the
fibrillins. Two fibrillins have been isolated and demonstrated to be
integral structural components of elastic fibers (35, 42).
Both are 350-kDa molecules rich in six-cysteine epidermal growth
factor-like repeats, which bind calcium through hydroxylation of
asparagine and aspartic acid residues. Both also contain unique eight-cysteine repeats which are also found in the latent transforming growth factor
(TGF-
) binding proteins (12). Marfan
syndrome is an autosomal dominant disorder linked to the fibrillin 1 gene on chromosome 15 (3, 9, 15, 18). This disease is
characterized by skeletal, ocular, and cardiovascular abnormalities.
Another disorder, congenital contractural arachnodactyly, is linked to the fibrillin 2 gene on chromosome 5 (15).
The latent TGF-
binding proteins (LTBPs) share a high degree of
homology with the fibrillins. Currently, there are four members of the
LTBP family. All have several copies of six-cysteine epidermal growth
factor-like repeats as well as a more limited number of eight-cysteine
repeats unique to this family of proteins and the fibrillins. While all
of the LTBPs appear to be constituents of the extracellular matrix,
LTBP-1 and -2 may be unique in their localization to elastin-containing
microfibrils. The major portion of LTBP-2 in elastic tissues is
strongly bound to microfibrils, as 6 M guanidine and dithiothreitol are
required to extract it (7). The requirement of guanidine for
extraction suggests that LTBP-2 is integrally associated with the
elastic fiber matrix, and the requirement of dithiothreitol suggests
that the covalent attachment occurs at least in part through disulfide
bonding. Taken together with its high sequence similarity with the
fibrillins, which are known structural components of elastic fibers, it
is likely that LTBP-2 performs a structural role within elastic fibers.
The TGF-
s are a family of multifunctional polypeptides which affect
the growth, differentiation, adhesion, migration, and matrix
synthesizing capacity of a variety of cell types (17, 19,
39). Most cell types that produce TGF-
secrete this protein in
an inactive form (21). TGF-
noncovalently associated with its propeptide (also called the latency associated peptide [LAP]) is
referred to as the small latent complex. In order for TGF-
to exert
cellular effects, it must dissociate from the LAP to bind its receptor.
TGF-
can also form a large latent complex when a molecule of LTBP-1
covalently bound to the LAP of the small latent complex via a disulfide
bond is secreted (8, 12, 20, 34). Incorporation of the large
latent complex into the extracellular matrix requires cross-linking by
transglutaminase (13, 24), while release of this complex
from the matrix is protease dependent (40, 41). Activation
of complexed TGF-
appears to involve the action of
cell-surface-associated plasmin, which cleaves the LAP and disrupts the
noncovalent interaction between the mature TGF-
and the LAP (6,
14, 25). While this paradigm has developed exclusively with
LTBP-1, it has been suggested that human (23) and murine
(5) LTBP-2 can form a large latent complex with TGF-
in
cotransfection experiments.
The purpose of this study was to determine the temporal and spatial
pattern of LTBP-2 expression in the mouse and rat in order to gain
insight into the likely function of LTBP-2 in development and to
determine the consequences of eliminating LTBP-2 expression in mice by
targeted disruption of the gene. LTBP-2 expression was localized
previously in embryonic day 16.5 (E16.5) mouse embryos (5),
but expression at other embryonic time points as well as in adult
tissues was not examined. In this study, we demonstrate coexpression of
LTBP-2 with tropoelastin in elastogenic tissues, suggestive of a
structural role for LTBP-2 in these tissues. However, inactivation of
the gene was found to result in lethality early in development,
suggesting that LTBP-2 plays a role unrelated to elastic fiber
homeostasis or TGF-
regulation, perhaps as a structural component of
elastin-free microfibrils during implantation.
 |
MATERIALS AND METHODS |
In situ hybridization.
Embryos were harvested from timed
pregnant Swiss Webster mice (Taconic). Tissues were also harvested from
5-week-old Swiss Webster mice. Embryos or adult tissues were fixed for
1 to 3 days in 10% buffered formalin (DeRuscio and Associates, St.
Louis, Mo.). Tissues were processed by shaking 2 times for 15 min each time in phosphate-buffered saline, followed by gentle agitation in 30%
ethanol for 1 h, 50% ethanol for 1 h, and 70% ethanol
overnight prior to processing. All solutions were treated with
diethylpyrocarbonate (0.1%). A fragment of the mouse LTBP-2 cDNA
(nucleotides 777 to 1140) was generated by PCR using the primers
5'GCAATTAACCCTCACTAAAGGCCACCATCACCACCTCCATC3' and
5'CGTAATACGACTCACTATAGGAAGCCAGACTTGGGGTCA3', in which the binding sites for T7 or T3 RNA polymerases were incorporated into the
primers. Sense (T3) and antisense (T7) probes were generated by using
35S-UTP and 0.1 µg of template DNA with the Riboprobe
system (Promega, Madison, Wis.). Synthesis of an in situ hybridization
probe for rat tropoelastin was done as described previously
(29). In situ hybridization was carried out as described
previously (31), with exposure times ranging from 2 to 12 weeks.
Northern hybridization.
The LTBP-2 template DNA used for in
situ hybridization was labeled with [32P]dCTP using the
Redi-Prime system (Amersham Pharmacia Biotech, Piscataway, N.J.). A
multiple-tissue Northern blot including eight adult mouse tissue
sources was purchased from Clontech (Palo Alto, Calif.). Northern
hybridization was done according to the manufacturer's instructions.
Construction of the LTBP-2 targeting vector.
A mouse 129 genomic library in a bacteriophage P1 vector (Genome Systems, St.
Louis, Mo.) was screened by PCR using primers 1F
(5'TGATGGGGACAAGTCATGCCC3') and 1R
(5'ATGGCTTCTCCGAGTCTGGAC3'), which were predicted and
subsequently shown to be located in exon 1. Four clones were
identified, one of which was digested with ApaI or
KpnI. Fragments were subcloned into pBluescript SK(
) (Stratagene, La Jolla, Calif.), and subclones containing exon 1 were
identified by colony hybridization. Overlapping 6.0-kb ApaI
and 5.2-kb KpnI subclones were characterized by restriction mapping, PCR, and DNA sequencing. A targeting construct was generated in pBluescript SK(
) that included 3.5 kb of 5' homology and 2.7 kb of
3' homology. The 5' homology consisted of an EcoRI fragment from the ApaI subclone that encompassed part of the
Ltbp2 promoter, ending ~800 bp 5' to exon 1. The 3'
homology consisted of an ApaI fragment from the
KpnI subclone and encompassed part of intron 1, beginning
about 1 kb downstream of exon 1. A cassette containing the neomycin
phosphotransferase cDNA driven by the phosphoglycerate kinase promoter
(PGK-neo) was used to replace the intervening region, which includes
exon 1. The targeting construct was linearized with NotI
prior to electroporation of embryonic stem cells.
Generation of Ltbp2 heterozygous mice.
The
linearized targeting construct was used to electroporate clone RW4
129/SvJ embryonic stem cells. G418-resistant clones were analyzed by
Southern blot analysis of XbaI-digested genomic DNA, probed
with a 1-kb BamHI fragment located 5' to the targeting construct. Two heterozygous clones representing homologous recombinants were identified out of 350 that were screened. Heterozygous ES cells
were injected into C57BL/6J blastocysts, which were transferred into
the uteri of pseudopregnant females. Chimeric males were mated
initially to C57BL/6J females, and agouti offspring were screened by
Southern blotting of tail genomic DNA for germline transmission of the
targeted Ltbp2tm1Ship allele (i.e.,
Ltbp2
/
allele). Once productive chimeric
males were identified, these mice were bred to 129/SvJ females, and
heterozygous offspring on a pure 129/SvJ background were identified by
Southern blotting.
Identification of Ltbp2
/
embryos.
Embryos at E12 or older embryos from heterozygous matings
were genotyped by Southern blotting. Embryos between E6.5 and E11 were
genotyped by PCR. In the case of E6.5 embryos, embryos were removed
from the decidua by microdissection. The ectoplacental cone was removed
and the embryos were digested for 2 h in tail buffer (50 mM Tris
[pH 8], 25 mM EDTA, 100 mM NaCl, 1% Triton X-100) containing 2 mg of
proteinase K per ml at 55°C in a volume of 20 µl. After boiling for
10 min, 2 µl of the cleared lysate was used for PCR with the primers
5'AGAAGCAGTTCATCTGGGTC3' and 5'CTCCTTCCTCGTCTATGCTC3'
located 1.2 kb 5' and 1.2 kb 3' to exon 1, respectively. Klentaq
LA polymerase (Sigma, St. Louis, Mo.) was used with an annealing
temperature of 58°C for 35 cycles.
Genotyping of blastocyst-stage embryos was done with two rounds of PCR.
Blastocysts were collected by flushing the uteri with phosphate-buffered saline (PBS) and treated briefly with acidic Tyrode
buffer (11) to remove the zona pellucida. Blastocysts were
incubated with 200 µg of proteinase K per ml in Klentaq LA PCR buffer
containing all PCR components except Klentaq LA for 2 h at 55°C.
Samples were heated for 10 min at 85°C, and 1 µl of Klentaq LA was
added along with mineral oil. The first round of PCR was for 40 cycles
at an annealing temperature of 58°C with the primers described above
used to genotype later embryos. A 4-µl volume of this reaction
mixture was used in a second PCR which incorporated two sets of
primers, one set which amplifies exon 1 of Ltbp2 which is
only present in the normal allele and one set which amplifies part of
the neomycin cassette only present in the targeted allele. The exon 1 primers 1F and 1R (described above) amplify a 289-bp product, while the
neo primers (5'ATGATTGAACAAGATGGATTGCAC3' and
5'TTCGTCCAGATCATCCTGATCGAC3') amplify a 500-bp product. The second round of PCR was for 35 cycles at an annealing temperature of
58°C.
Detection of LTBP-2 expression by reverse transcription
(RT)-PCR.
Wild-type blastocysts were isolated at E3.5 by flushing
the uterine horns of timed-pregnant mice with PBS. Blastocysts were treated briefly in acidic Tyrode buffer to remove the zona pellucida and transferred to PBS. Groups of five blastocysts were collected in a
minimal volume of PBS (~10 µl), and diethylpyrocarbonate-treated water was added to bring the final volume to 25 µl. A single tube was
subjected to three freeze-thaw cycles, boiled for 2 min, and centrifuged for 5 min. The supernatant was divided into two tubes. Reverse transcription was carried out on one sample with random hexamers using the Superscript preamplification system following the
manufacturer's instructions (Life Technologies, Grand Island, N.Y.).
The other sample was mock treated with all components except reverse
transcriptase. Following cDNA synthesis, PCR was done on both samples
for 45 cycles (94°C for 1 min, 55°C for 2 min, and 72°C for 1 min) using the primers 1F (see above) and 2R
(5'GTTTGATACAGTGGTTGGTGC3'), located in exons 1 and 2, respectively. Specific products were visualized by Southern blotting,
with a cDNA fragment encompassing exons 1 and 2 used as the probe.
 |
RESULTS |
Expression of LTBP-2 in mid- to late-gestation embryos.
Because LTBP-2 may play at least two important roles in development, as
both a structural component of the elastic fiber and a regulator of
TGF-
activity, we anticipated that its expression would reflect
these functions. To gain insight into the function(s) of this protein,
we investigated LTBP-2 expression in the developing mouse and rat by in
situ hybridization. Expression of LTBP-2 was not detected at E10.5
(data not shown). Expression of LTBP-2 was first detected at E13.5 in
perichondrial regions surrounding the developing vertebrae and ribs
(Fig. 1). Tropoelastin is also expressed by the same cells, as well as in other perichondrial regions which do
not appear to express LTBP-2. This may reflect differences in
microfibrillar composition in different elastic fibers. Some tropoelastin-positive regions which did not express LTBP-2 were also
negative for fibrillin 1 expression (not shown). LTBP-2 expression was
also seen in other perichondrial regions at this stage, such as in the
developing limb buds (data not shown). Sense-strand probes for both
LTBP-2 and tropoelastin showed no specific hybridization in any tissues
investigated (data not shown).

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of LTBP-2 and tropoelastin mRNAs in E13.5
mouse embryos. In situ hybridization was done to localize expression of
each. (A) Bright-field staining of developing ribs. (B) Section
hybridized to a LTBP-2 antisense probe showing perichondrial expression
(arrows). (C) Section hybridized to a tropoelastin antisense probe,
showing perichondrial expression similar to LTBP-2 as well as arterial
expression (arrow). Sense probes showed no specific hybridization (not
shown). Magnification, ×90.
|
|
At E15.5, LTBP-2 and tropoelastin are both expressed in the snout,
tongue, lungs, and dermis (Fig.
2). While
tropoelastin
expression is observed throughout perichondrial areas in
the snout,
LTBP-2 expression is more limited, consistent with the
distribution
seen in the perichondrium at E13.5. However, areas that
express
LTBP-2 also appear to express elastin, suggesting a structural
role for LTBP-2 in the developing snout. In the lungs and the
dermis at
E15.5, LTBP-2 and tropoelastin are expressed only by
a few cell layers
directly underlying the epithelial basement
membrane (lining airways in
the case of the lung). In both the
lungs and the skin, the majority of
mesenchymal cells do not express
either LTBP-2 or tropoelastin to an
appreciable extent. Both tropoelastin
(Fig.
2D) and LTBP-2 (data not
shown) are expressed within the
large blood vessels as well. At E17.5,
the most prominent tissue
coexpressing both LTBP-2 and tropoelastin is
large arterial vessels
(Fig.
3). Both
mRNAs are expressed primarily in the medial layer
of the aorta and
other arterial vessels composed largely of smooth
muscle cells.
Fibrillin 2 has also been shown to be expressed
within the aorta of the
developing human embryo (
42). Coexpression
of LTBP-2 and
tropoelastin in a number of elastogenic tissues
within developing
embryos, together with the identification of
LTBP-2 as a structural
component of elastic microfibrils in developing
bovine tissues
(
7), strongly suggests that LTBP-2 plays a similar
structural role within elastogenic tissues of the developing mouse.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of LTBP-2 and tropoelastin mRNAs in E15.5
mouse embryos. In situ hybridization was done to localize expression of
LTBP-2 in the snout (A), lung (C), and dermis (E) and expression of
tropoelastin in the snout (B), lung (D), and dermis (F). Perichondrial
expression of both mRNAs is seen throughout the snout. Expression in
the lung is observable in a limited number of cell layers of the
subepithelial mesenchyme of developing airways (arrows), and intense
tropoelastin expression in arterial vessels (asterisks) is evident.
Both signals are also seen in the dermis. Sense probes showed no
specific hybridization (not shown). Magnification for panels A and B,
×36. Magnification for panels C through F, ×180.
|
|

View larger version (119K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of LTBP-2 (A) and tropoelastin (B) mRNAs in
E17.5 mouse embryos. In situ hybridization was done to localize
expression of each. Expression of both mRNAs is seen by medial cells of
the descending aorta. Sense probes showed no specific hybridization
(not shown). Magnification, ×200.
|
|
LTBP-2 expression was also examined in the developing rat. At E14 in
the developing rat thorax (Fig.
4A),
LTBP-2 expression
is seen in the pericardium, epicardium, heart valves,
large vessels,
and lung. Expression in the pericardium and epicardium
is consistent
with a structural elastic role. As in the mouse at E15.5,
expression
in the lung is limited to a few mesenchymal cell layers
underlying
the airway epithelium, suggesting a role for LTBP-2 in lung
growth
or branching morphogenesis. This pattern is even more pronounced
at E18 in the developing rat lung for LTBP-2 as well as for
tropoelastin
(Fig.
4B and C).

View larger version (118K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of LTBP-2 and tropoelastin mRNAs in the
developing rat thorax. In situ hybridization was done to localize
expression of each. (A) Expression of LTBP-2 in the E14 rat thorax.
Specific hybridization is seen in the lungs (L), the pericardium (P),
the epicardium (E), the heart valves (V), and the pulmonary artery
(PA), as well as in other large vessels. The pattern of expression is
identical to that seen with tropoelastin probes (data not shown).
Magnification, ×36. (B) Expression of LTBP-2 in the E18 rat lung.
Expression in the lung is observable in a limited number of cell layers
of the subepithelial mesenchyme of developing mid-sized airways, with
no or minimal corresponding expression seen in the smallest and largest
airways. Magnification, ×90. (C) Expression of tropoelastin in the E18
rat lung. The pattern of expression is identical to that of LTBP-2.
Sense probes showed no specific hybridization (data not shown).
Magnification, ×90.
|
|
Expression of LTBP-2 in young adult mice.
In order to guide in
situ hybridization studies of LTBP-2 expression in adult mouse tissues,
a multiple-tissue Northern blot prepared with poly(A)+ RNA
from a variety of adult mouse tissues (Clontech) was probed for LTBP-2
(Fig. 5). LTBP-2 is most abundantly
expressed in the adult lung. In fact, densitometric scanning indicates
that the level of expression in lung is at least 10-fold higher than
that in any other tissue examined. Significant levels of LTBP-2 mRNA are observed in the testes, spleen, and heart as well. LTBP-2 expression was examined in several tissues of 5-week-old mice by in
situ hybridization. Both LTBP-2 and tropoelastin were expressed throughout the mesenchyme of the lungs of 5-week-old mice (Fig. 6A and
B). Mice at 5 weeks of age are still
growing, and it is therefore not surprising that one might still find
elastin expression. Elastin synthesis in other mammals declines after
birth, with little or no elastin synthesized during adulthood under
physiologic conditions (26). The pattern of both
tropoelastin and LTBP-2 expression in the 5-week-old lung is markedly
different from that of the late-gestation lung. Expression of each is
much more ubiquitous throughout the mesenchyme in the young adult mice.
Expression is still abundant within large vessels, although much more
so for tropoelastin than LTBP-2. Both are also expressed by cells underlying the fibrous capsule of the spleen (Fig. 6C and D).

View larger version (104K):
[in this window]
[in a new window]
|
FIG. 5.
Northern blot analysis of LTBP-2 expression in adult
mouse tissues. A multiple tissue Northern blot including eight adult
mouse tissue sources (Clontech) was hybridized to a LTBP-2 cDNA probe.
A 7.5-kb mRNA is most abundantly detected in the lung, spleen, and
testes.
|
|

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of LTBP-2 and tropoelastin mRNAs in
5-week-old mouse tissues. In situ hybridization was done to localize
expression of LTBP-2 in the lung (A) and spleen (C) and expression of
tropoelastin in the lung (B) and spleen (D). Coexpression of LTBP-2 and
tropoelastin is seen throughout the mesenchyme and vasculature of the
lung and the capsule of the spleen. In the testes, LTBP-2 (E) but not
tropoelastin (F) is expressed by lumenal cells of the epididymis. Sense
probes showed no specific hybridization (data not shown). Magnification
for panels A, B, E, and F, ×90. Magnification for panels C and D,
×36.
|
|
The expression patterns of LTBP-2 and tropoelastin are clearly distinct
in the testes (Fig.
6E and F). In the epididymis,
tropoelastin
expression is weak and is observable only in cells
lining the outside
of the spermatic ducts. In contrast, intense
LTBP-2 expression is
observed in cells within the lumen of the
epididymis. This is the first
clear example of LTBP-2 expression
where the function of LTBP-2 is
likely distinct from its role
as a structural component of elastic
fibers. However, neither
TGF-

1, -

2, nor -

3 appears to be
coexpressed with LTBP-2 in
the testes by in situ hybridization (data
not shown). TGF-

expression
within the adult mouse testes has been
reported (
38). The potential
function of LTBP-2 in the
testes is therefore unclear. LTBP-2
signal was not detected in the
heart by in situ hybridization
(data not shown). Expression of LTBP-2
in the liver, brain, ovary,
oviduct, uterus, and kidney was also
undetectable (data not
shown).
Ltbp2
/
mice.
In order to directly
examine the role of LTBP-2 in mouse development, a targeting construct
was made to eliminate its expression in mice (Fig.
7A). Exon 1, as well, the proximal
regions of the promoter and intron 1, was replaced in the targeting
vector with a PGK-neo cassette. The targeting vector was introduced
into 129/SvJ embryonic stem cells by electroporation. DNA from
G418-resistant ES clones was analyzed by Southern blotting of
XbaI-digested genomic DNA, using a probe located 5' to the
targeting construct (Fig. 7B and C). Two homologous recombinants were
identified out of 350 screened and were used to create chimeric mice.
Chimeric males were mated to C57BL/6J and 129/SvJ females to generate
heterozygotes on mixed and pure genetic backgrounds, respectively.
Heterozygous mice appear phenotypically normal in all respects.
Additionally, the architecture of elastic tissues such as the lung and
aorta appears normal in heterozygotes by Verhoeff Van Gieson staining, which stains elastic fibers (data not shown). Over 400 live offspring of heterozygous matings were screened by Southern blotting. No live
Ltbp2
/
mice were identified, and the ratio
of heterozygous to normal mice was approximately 2:1, indicating that
the knockout resulted in an embryonic lethal phenotype (Fig. 7).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 7.
Generation of Ltbp2 / mice.
(A) The LTBP-2 targeting construct. The 5' and 3' homologies were
derived from the promoter and intron 1, respectively. The intervening
region including exon 1, which contains the ATG, is replaced with a
PGK-neo cassette. (B) Southern blot of ES cell DNA screened as
described for panel A, showing one targeted clone. (C) Live progeny of
heterozygous matings were genotyped by Southern blotting. No
Ltbp2 / mice lived to birth.
|
|
To determine the point at which
Ltbp2
/
embryos die, timed matings of heterozygous mice were carried out, and
at E10.5 through
E19.5, progeny were genotyped by Southern blotting.
Again, no
Ltbp2
/
embryos were identified in
~20 litters examined. Younger postimplantation
embryos were genotyped
by PCR. At E6.5, no
Ltbp2
/
embryos were
identified among six litters examined (Fig.
8A).
These were the youngest
postimplantation embryos that we could
isolate. However, knockout
embryos were identified among E3.5
preimplantation blastocysts (Fig.
8B), implying that LTBP-2 may
play an essential developmental role
during implantation (E4.5),
much earlier than we had initially detected
its expression.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 8.
Genotyping of early postimplantation and preimplantation
embryos. (A) E6.5 early-postimplantation embryos from heterozygous
matings were genotyped by PCR. No Ltbp2 /
embryos were identified at this stage. (B) E3.5 preimplantation
blastocysts, in which knockout embryos were identified, were genotyped
by PCR in an assay similar to that used for panel A. The lowest band in
all lanes corresponds to unincorporated PCR primers. The first lane
following the molecular weight standards is a mock PCR in the absence
of target DNA. KO, knockout; WT, wild type.
|
|
LTBP-2 expression by preimplantation and early postimplantation
embryos.
In situ hybridization was done to determine whether
LTBP-2 is expressed by E6.5 postimplantation embryos (Fig.
9). LTBP-2 does not appear to be
expressed to an appreciable extent in the embryo itself at E6.5.
However, much of the decidual stroma, which is maternally derived, as
well as the uterine muscle is weakly positive for LTBP-2 expression by
in situ hybridization. In situ hybridization for a number of other
elastic fiber mRNAs including MAGP-2, fibrillin 1, and tropoelastin
revealed similar patterns of expression of these components. Expression
of LTBP-2 by preimplantation blastocysts (E3.5) was investigated by
RT-PCR (Fig. 10). Primers that span
exons 1 and 2 were used so that PCR products arising from genomic DNA
(7 kb) would be much larger than the mRNA-derived product (0.5 kb) and
undetectable under the conditions used. A specific band of the
predicted size hybridizing to an LTBP-2 probe was detected only in the
presence of reverse transcriptase. The particular cell type within the
blastocyst responsible for this expression is unknown, as in situ
hybridization experiments on blastocysts were not successful. However,
LTBP-2 expression was not detected by Northern blotting of embryonic
stem cell RNA, suggesting that trophectoderm cells express LTBP-2.

View larger version (186K):
[in this window]
[in a new window]
|
FIG. 9.
Expression of LTBP-2 mRNA at E6.5. LTBP-2 expression by
E6.5 embryos was investigated by in situ hybridization. The
bright-field image (A) and a section probed with a sense probe (B) are
shown. Serial sections were probed for LTBP-2 (C) and other elastic
fiber components, including MAGP-2 (D), fibrillin 1 (E), and
tropoelastin (F). A signal for all of the elastic fiber components,
including LTBP-2, is seen within the maternally derived decidual stroma
(D) and the uterine muscle (U) but not within the embryo itself
(arrow).
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 10.
Expression of LTBP-2 by preimplantation embryos. LTBP-2
expression by E3.5 preimplantation blastocysts was investigated by
RT-PCR. Blastocysts were subjected to reverse transcriptase (+RT) or
mock reactions lacking reverse transcriptase ( RT) prior to PCR, as
described in Materials and Methods. Southern blotting and hybridization
with an LTBP-2 cDNA probe identified a band of the predicted size (473 bp) which was present only in samples treated with reverse
transcriptase.
|
|
 |
DISCUSSION |
We have shown that LTBP-2 expression in the developing mouse
largely parallels that of tropoelastin. Both are expressed at E13.5 in
the perichondrium surrounding the developing vertebrae; at E15.5 in the
snout, lungs, and dermis; and at E17.5 primarily in the aorta and other
large vessels. Both are also coexpressed in the developing rat lung,
pericardium, epicardium, and heart valves. In the young adult mouse,
both are expressed in the capsule of the spleen and ubiquitously
throughout the mesenchyme of the lung. In all of these cases,
coexpression suggests a structural role for LTBP-2 in these tissues.
Additionally, there are places where tropoelastin is expressed in the
absence of LTBP-2, such as some perichondrial regions throughout the
head of the developing mouse. This is not completely surprising
considering the distribution of fibrillins 1 and 2 in the mouse. It is
apparent that elastic microfibrils vary in composition between tissues,
and our data suggests that not all elastic fibers include LTBP-2. The
basis for these differences between tissues is not well understood and is a topic of investigation in several laboratories.
The only tissue where LTBP-2 was found to be expressed in the absence
of tropoelastin expression was the testes of the young adult mouse,
where it is expressed by cells lining the lumen of the epididymis. This
pattern of expression suggests that LTBP-2 performs an alternative
function in the testes, perhaps one involving the regulation of TGF-
activity. It is unlikely that LTBP-2 plays a structural role within
elastin-free microfibrils within the testes, largely because expression
occurs within lumenal cells and because fibrillin 1 is not expressed to
any appreciable extent here either (data not shown). TGF-
is known
to be expressed within the adult testes (38). However,
neither TGF-
1, -
2, nor -
3 is coexpressed with LTBP-2 in the
testes by in situ hybridization (data not shown). In fact, there is
disagreement on the issue of whether LTBP-2 can bind TGF-
. While
LTBP-2 was initially shown to have the capability to bind TGF-
in
transfection studies (5, 23), extensive mutagenesis studies
in transfected cells have suggested that TGF-
binding to LTBP-2 is
very weak when compared to its binding to other LTBP-2s (J. Keski-Oja,
personal communication). The functional role of LTBP-2 in the testes
remains unclear.
Because we could not detect LTBP-2 expression at E10.5, it was
surprising that Ltbp2
/
embryos died prior to
E6.5. The basis for the early embryonic lethality of the
Ltbp2 knockout remains an enigma, considering what is known
about knockouts of other elastic fiber components. Elastin knockout
mice die shortly after birth from either vascular or pulmonary
complications (16). Mice homozygous for targeted disruptions
of the microfibril-associated glycoprotein 1 (R. P. Mecham,
unpublished observations) and fibrillin 1 (27, 28) genes
live into adulthood. The finding that mice lacking elastin can survive
past birth suggests that a lethal phenotype associated with a
microfibrillar protein such as LTBP-2 is not due to a function related
to elastic fibers. However, others have suggested that microfibrils may
have elastic properties of their own in the absence of elastin, perhaps
thus explaining why mice lacking a microfibrillar component expressed
very early in development might have a phenotype markedly different
from that of the elastin knockout mouse. Microfibrils are known to
exist devoid of associated elastin in some tissues such as the ciliary
zonules of the eye and the periodontal ligament. It is therefore
possible that LTBP-2 performs an essential structural function in
elastin-free microfibrils, but the presence or absence of LTBP-2 has
not been reported within elastin-free microfibrils. In any case, it is
clear that LTBP-2 performs an essential function that cannot be
compensated for by other members of the LTBP family.
Several findings suggest that the severity of the Ltbp2
knockout phenotype is not likely related to regulation of TGF-
activity. The most compelling is the observation in transfection
studies that LTBP-2 binds TGF-
very poorly if at all in comparison
to the other LTBPs (J. Keski-Oja, personal communication), raising questions about the physiologic significance of this interaction should
it occur in vivo. However, if LTBP-2 retains any ability to bind
TGF-
in the preimplantation embryo, its potential effect on TGF-
activity is not entirely predictable. LTBP-1 has been shown to
facilitate the secretion of TGF-
(22). If this were also
true for LTBP-2, one might predict that mice lacking LTBP-2 would have
a phenotype similar to one or more of the TGF-
knockouts. The
phenotypes of the TGF-
1, -
2, and -
3 knockouts are not similar to that of the Ltbp2 knockout. Although TGF-
1 is
expressed in the preimplantation embryo (32), TGF-
knockout mice survive past this stage of development. A percentage of
TGF-
1 knockout mice die in utero at ~E10.5 from a defect in yolk
sac vasculogenesis (2), while most survive past birth and
die within the first month from infections (37). The
TGF-
2 (36) and TGF-
3 (30) knockouts die in
the perinatal period. Alternatively, LTBP-1 has been shown to mediate
localization of TGF-
to the extracellular matrix, and activation of
TGF-
in this scenario requires a proteolytic cleavage event which
would release it from the matrix, enabling binding to cell-surface
receptors. If this were the case for LTBP-2, then loss of LTBP-2
expression would perhaps result in aberrant localization and/or
activation of TGF-
. While this is a formal possibility, we feel that
the relative inability of LTBP-2 to bind TGF-
in transfection assays
makes this unlikely.
The window of time in which Ltbp2
/
embryos
die, E3.5 to E6.5, coincides with implantation of the embryo into the
uterine wall. The inconsistency of the Ltbp2 knockout
phenotype with that of other elastic fiber knockouts suggests that
LTBP-2 may play a structural role related to elastin-free microfibrils
at this point in development or that it perhaps has a signaling
function. Alternatively, LTBP-2 may have an as-yet-undefined critical
function between E3.5 and E6.5. The lack of LTBP-2 expression detected
at E6.5 (Fig. 9) and E5.5 (data not shown) suggests that this function occurs between E3.5 and E5.5. RT-PCR on blastocysts for other microfibrillar components should help delineate whether these genes are
expressed during implantation (E4.5), which has not been previously determined.
 |
ACKNOWLEDGMENTS |
This work was funded by NIH HL60647 (J.M.S.), NIH AR41474 (R.P.M.
and J.R.), HL 29594 (morphology core), the Alan A. and Edith L. Wolff
Charitable Trust (J.M.S.), and the Parker B. Francis Foundation
(J.M.S.).
We are grateful to Zena Werb, Babette Heyer, and Julie Rinkenberger for
assistance with embryological techniques and to Gail Griffin for
assistance with in situ hybridization.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Washington
University School of Medicine at Barnes-Jewish Hospital, Division of
Pulmonary and Critical Care Medicine, 216 S. Kingshighway Blvd., St.
Louis, MO 63110. Phone: (314) 454-7990. Fax: (314) 454-5919. E-mail: mshipley{at}imgate.wustl.edu.
 |
REFERENCES |
| 1.
|
Cleary, E. G.
1987.
The microfibrillar component of the elastic fibers. Morphology and biochemistry, p. 55-81.
In
J. Uitto, and A. J. Perejda (ed.), Connective tissue disease. Molecular pathology of the extracellular matrix. Marcel Dekker, Inc., New York, N.Y.
|
| 2.
|
Dickson, M. C.,
J. S. Martin,
F. M. Cousins,
A. B. Kulkarni,
S. Karlsson, and R. J. Ackhurst.
1995.
Defective hematopoiesis and vasculogenesis in transforming growth factor-beta 1 knockout mice.
Development
121:1845-1854[Abstract].
|
| 3.
|
Dietz, H. C.,
G. R. Cutting,
R. E. Pyeritz,
C. L. Maslen,
L. Y. Sakai,
G. M. Corson,
E. G. Puffenberger,
A. Hamosh,
E. J. Nanthakumar,
S. M. Curristan,
G. Stetten,
D. A. Meyers, and C. A. Francomano.
1991.
Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene.
Nature
352:337-339[CrossRef][Medline].
|
| 4.
|
Fahrenbach, W. H.,
L. B. Sandberg, and E. G. Cleary.
1966.
Ultrastructural studies on early elastogenesis.
Anat. Rec.
155:563-576[CrossRef].
|
| 5.
|
Fang, J.,
X. Li,
E. Smiley,
U. Francke,
R. P. Mecham, and J. Bonadio.
1997.
Mouse latent TGF- binding protein-2: molecular cloning and developmental expression.
Biochim. Biophys. Acta
1354:219-230[Medline].
|
| 6.
|
Flaumenhaft, R.,
M. Abe,
Y. Sato,
K. Miyazono,
J. Harpel,
C.-H. Heldin, and D. B. Rifkin.
1993.
Role of latent transforming growth factor- binding protein in the activation of latent transforming growth factor- by co-cultures of endothelial and smooth muscle cells.
J. Cell Biol.
120:995-1002[Abstract/Free Full Text].
|
| 7.
|
Gibson, M. A.,
G. Hatzinikolas,
E. C. Davis,
E. Baker,
G. R. Sutherland, and R. P. Mecham.
1995.
Bovine latent transforming growth factor beta 1-binding protein 2: molecular cloning, identification of tissue isoforms, and immunolocalization to elastin-associated microfibrils.
Mol. Cell. Biol.
15:6932-6942[Abstract].
|
| 8.
|
Gleizes, P.-E.,
R. C. Beauis,
R. Mazzieri,
B. Shen, and D. B. Rifkin.
1996.
Identification and characterization of an eight-cysteine repeat of the latent transforming growth factor- binding protein-1 that mediates binding to the latent transforming growth factor- 1.
J. Biol. Chem.
271:29891-29896[Abstract/Free Full Text].
|
| 9.
|
Godfrey, M.,
V. Menashe,
R. G. Weleber,
R. D. Koler,
R. H. Bigley,
E. Lovrien,
J. Zonana, and D. W. Hollister.
1990.
Cosegregation of elastin-associated microfibrillar abnormalities with the Marfan phenotype in families.
Am. J. Hum. Genet.
46:652-660[Medline].
|
| 10.
|
Greenlee, T. K. J.,
R. Ross, and J. L. Hartman.
1966.
The fine structure of elastic fibers.
J. Cell Biol.
30:59-71[Abstract/Free Full Text].
|
| 11.
|
Hogan, B.,
R. Beddington,
F. Constantini, and E. Lacy.
1994.
Manipulating the mouse embryo: a laboratory manual.
Cold Spring Harbor Press, Plainview, N.Y.
|
| 12.
|
Kanzaki, T.,
A. Olofsson,
A. Moren,
C. Wernstedt,
U. Hellman,
K. Miyazono,
L. Claesson-Welsh, and C.-H. Heldin.
1990.
TGF- 1 binding protein: a component of the large latent complex of TGF- 1 with multiple repeat sequences.
Cell
61:1051-1061[CrossRef][Medline].
|
| 13.
|
Kojima, S.,
N. Kiyomitsu, and D. B. Rifkin.
1993.
Requirement of transglutaminase in the activation of transforming growth factor- in bovine endothelial cells.
J. Cell Biol.
121:439-448[Abstract/Free Full Text].
|
| 14.
|
Kojima, S., and D. B. Rifkin.
1993.
Mechanism of retinoid-induced activation of latent transforming growth factor- in bovine endothelial cells.
J. Cell. Physiol.
155:323-332[CrossRef][Medline].
|
| 15.
|
Lee, B.,
M. Godfrey,
E. Vitale,
H. Hori,
M. Mattei,
M. Sarfarazi,
P. Tsipouras,
F. Ramirez, and D. W. Hollister.
1991.
Linkage of Marfan syndrome and a phenotypically related disorder to two different fibrillin genes.
Nature
352:330-334[CrossRef][Medline].
|
| 16.
|
Li, D. Y.,
B. Brooke,
E. C. Davis,
R. P. Mecham,
L. K. Sorensen,
B. B. Boak,
E. Eichwald, and M. T. Keating.
1998.
Elastin is an essential determinant of arterial morphogenesis.
Nature
393:276-280[CrossRef][Medline].
|
| 17.
|
Lyons, R. M., and H. L. Moses.
1990.
Transforming growth factor- and the regulation of cell proliferation.
Eur. J. Biochem.
187:467-473[Medline].
|
| 18.
|
Maslen, C. L.,
G. M. Corson,
B. K. Maddox,
R. W. Glanville, and L. Y. Sakai.
1991.
Partial sequence of a candidate gene for the Marfan syndrome.
Nature
352:334-337[CrossRef][Medline].
|
| 19.
|
Massague, J.
1990.
The transforming growth factor- family.
Annu. Rev. Cell Biol.
6:597-641[CrossRef].
|
| 20.
|
Miyazono, K.,
U. Hellman,
C. Wernstedt, and C. Heldin.
1988.
Latent high molecular weight complex of transforming growth factor 1.
J. Biol. Chem.
263:6407-6415[Abstract/Free Full Text].
|
| 21.
|
Miyazono, K.,
H. Ichijo, and C.-H. Heldin.
1993.
Transforming growth factor-beta: latent forms, binding proteins, and receptors.
Growth Factors
8:11-22[Medline].
|
| 22.
|
Miyazono, K.,
A. Oloffson,
P. Colosetti, and C.-H. Heldin.
1991.
A role of the latent TGF- 1 binding protein in the assembly and secretion of TGF- 1.
EMBO J.
10:1091-1101[Medline].
|
| 23.
|
Moren, A.,
A. Olofsson,
G. Stenman,
P. Sahlin,
T. Kanzaki,
L. Claesson-Welsh,
P. ten Dijke,
K. Miyazono, and C. H. Heldin.
1994.
Identification and characterization of LTBP-2, a novel latent transforming growth factor-beta-binding protein.
J. Biol. Chem.
269:32469-32478[Abstract/Free Full Text].
|
| 24.
|
Nunes, I.,
P.-E. Gleizes,
C. N. Metz, and D. B. Rifkin.
1997.
Latent transforming growth factor- binding protein domains involved in activation and transglutaminase-dependent cross-linking of latent transforming growth factor- .
J. Cell Biol.
136:1151-1163[Abstract/Free Full Text].
|
| 25.
|
Nunes, I.,
R. L. Shapiro, and D. B. Rifkin.
1995.
Characterization of latent transforming growth factor- activation by murine peritoneal macrophages.
J. Immunol.
155:1450-1459[Abstract].
|
| 26.
|
Parks, W. C.,
R. A. Pierce,
K. A. Lee, and R. P. Mecham.
1993.
Elastin, p. 133-182.
In
H. K. Kleinman (ed.), Advances in molecular and cell biology, vol. 6. JAI Press, Inc., Greenwich, Conn.
|
| 27.
|
Pereira, L.,
K. Andrikopoulos,
J. Tian,
S. Y. Lee,
D. R. Keene,
R. Ono,
D. P. Reinhardt,
L. Y. Sakai,
N. J. Biery,
T. Bunton,
H. C. Dietz, and F. Ramirez.
1997.
Targeting of the gene encoding fibrillin-1 recapitulates the vascular aspect of Marfan syndrome.
Nat. Genet.
17:218-222[CrossRef][Medline].
|
| 28.
|
Pereira, L.,
S. Y. Lee,
B. Gayraud,
K. Andrikopoulos,
S. D. Shapiro,
T. Bunton,
N. J. Biery,
H. C. Dietz,
L. Y. Sakai, and F. Ramirez.
1999.
Pathogenetic sequence for aneurysm revealed in mice underexpressing fibrillin-1.
Proc. Natl. Acad. Sci. USA
96:3819-3823[Abstract/Free Full Text].
|
| 29.
|
Pierce, R. A.,
S. B. Deak,
C. A. Stolle, and C. D. Boyd.
1990.
Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning.
Biochemistry
29:9677-9683[CrossRef][Medline].
|
| 30.
|
Proetzel, G.,
S. A. Pawlowski,
M. V. Wiles,
M. Yin,
G. P. Boivin,
P. N. Howles,
J. Ding,
M. W. Ferguson, and T. Doetschman.
1995.
Transforming growth factor-beta 3 is required for secondary palate fusion.
Nat. Genet.
11:409-414[CrossRef][Medline].
|
| 31.
|
Prosser, I. W.,
K. R. Stenmark,
M. Suthar,
E. C. Crouch,
R. P. Mecham, and W. C. Parks.
1989.
Regional heterogeneity of elastin and collagen gene expression in intralobar arteries in response to hypoxic pulmonary hypertension as demonstrated by in situ hybridization.
Am. J. Pathol.
135:1073-1088[Abstract].
|
| 32.
|
Rappolee, D. A.,
C. A. Brenner,
R. Schultz,
D. Mark, and Z. Werb.
1988.
Developmental expression of PDGF, TGF-alpha, and TGF-beta genes in preimplantation mouse embryos.
Science
241:1823-1825[Abstract/Free Full Text].
|
| 33.
|
Rosenbloom, J.,
W. B. Abrams, and R. Mecham.
1993.
Extracellular matrix 4: the elastic fiber.
FASEB J.
7:1208-1218[Abstract].
|
| 34.
|
Saharinen, J.,
J. Taipale, and J. Keski-Oja.
1996.
Association of the small latent transforming growth factor- with an 8-cysteine repeat of its binding protein LTBP-1.
EMBO J.
15:245-253[Medline].
|
| 35.
|
Sakai, L. Y.,
D. R. Keene, and E. Engvall.
1986.
Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils.
J. Cell Biol.
103:2499-2509[Abstract/Free Full Text].
|
| 36.
|
Sanford, L. P.,
I. Ormsby,
A. C. Gittenberger-de Groot,
H. Sariola,
R. Friedman,
G. P. Boivin,
E. L. Cardell, and T. Doetschman.
1997.
TGF-beta 2 knockout mice have multiple developmental defects that are non-overlapping with other TGF-beta knockout phenotypes.
Development
124:2659-2670[Abstract].
|
| 37.
|
Shull, M. M.,
I. Ormsby,
A. B. Kier,
S. Pawlowski,
R. J. Diebold,
M. Yin,
R. Allen,
C. Sidman,
G. Proetzel,
D. Calvin,
N. Annuziata, and T. Doetschman.
1992.
Targeted disruption of the mouse transforming growth factor-beta-1 gene results in multifocal inflammatory disease.
Nature
359:693-699[CrossRef][Medline].
|
| 38.
|
Skinner, M. K., and H. L. Moses.
1989.
Transforming growth factor gene expression and action in the seminiferous tubule: peritubular cell-Sertoli cell interactions.
Mol. Endocrinol.
3:625-634[Abstract/Free Full Text].
|
| 39.
|
Sporn, M. B., and A. B. Roberts.
1992.
Transforming growth factor- : recent progress and new challenges.
J. Cell Biol.
119:1017-1021[Free Full Text].
|
| 40.
|
Taipale, J.,
J. Lohi,
J. Saharinen,
P. T. Kovanen, and J. Keski-Oja.
1995.
Human mast cell chymase and leukocyte elastase release latent transforming growth factor- 1 from the extracellular matrix of cultured human epithelial and endothelial cells.
J. Biol. Chem.
270:4689-4696[Abstract/Free Full Text].
|
| 41.
|
Taipale, J.,
K. Koli, and J. Keski-Oja.
1992.
Release of transforming growth factor- 1 from the pericellular matrix of cultured fibroblasts and fibrosarcoma cells by plasmin and thrombin.
J. Biol. Chem.
267:25378-25384[Abstract/Free Full Text].
|
| 42.
|
Zhang, H.,
S. D. Apfelroth,
W. Hu,
E. C. Davis,
C. Sanguineti,
J. Bonadio,
R. P. Mecham, and F. Ramirez.
1994.
Structure and expression of fibrillin-2, a novel microfibrillar component preferentially located in elastic matrices.
J. Cell Biol.
124:855-863[Abstract/Free Full Text].
|
Molecular and Cellular Biology, July 2000, p. 4879-4887, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cheung, C.-L., Sham, P. C., Chan, V., Paterson, A. D., Luk, K. D. K., Kung, A. W. C.
(2008). Identification of LTBP2 on Chromosome 14q as a Novel Candidate Gene for Bone Mineral Density Variation and Fracture Risk Association. J. Clin. Endocrinol. Metab.
93: 4448-4455
[Abstract]
[Full Text]
-
Anderson, S. B., Goldberg, A. L., Whitman, M.
(2008). Identification of a Novel Pool of Extracellular Pro-myostatin in Skeletal Muscle. J. Biol. Chem.
283: 7027-7035
[Abstract]
[Full Text]
-
Shifren, A., Mecham, R. P.
(2006). The stumbling block in lung repair of emphysema: elastic fiber assembly.. Proc Am Thorac Soc
3: 428-433
[Abstract]
[Full Text]
-
Colarossi, C., Chen, Y., Obata, H., Jurukovski, V., Fontana, L., Dabovic, B., Rifkin, D. B.
(2005). Lung Alveolar Septation Defects in Ltbp-3-Null Mice. Am. J. Pathol.
167: 419-428
[Abstract]
[Full Text]
-
Rifkin, D. B.
(2005). Latent Transforming Growth Factor-{beta} (TGF-{beta}) Binding Proteins: Orchestrators of TGF-{beta} Availability. J. Biol. Chem.
280: 7409-7412
[Full Text]
-
Koli, K., Wempe, F., Sterner-Kock, A., Kantola, A., Komor, M., Hofmann, W.-K., von Melchner, H., Keski-Oja, J.
(2004). Disruption of LTBP-4 function reduces TGF-{beta} activation and enhances BMP-4 signaling in the lung. JCB
167: 123-133
[Abstract]
[Full Text]
-
Hyytiainen, M., Keski-Oja, J.
(2003). Latent TGF-{beta} binding protein LTBP-2 decreases fibroblast adhesion to fibronectin. JCB
163: 1363-1374
[Abstract]
[Full Text]
-
Vehvilainen, P., Hyytiainen, M., Keski-Oja, J.
(2003). Latent Transforming Growth Factor-{beta}-binding Protein 2 Is an Adhesion Protein for Melanoma Cells. J. Biol. Chem.
278: 24705-24713
[Abstract]
[Full Text]
-
Sterner-Kock, A., Thorey, I. S., Koli, K., Wempe, F., Otte, J., Bangsow, T., Kuhlmeier, K., Kirchner, T., Jin, S., Keski-Oja, J., von Melchner, H.
(2002). Disruption of the gene encoding the latent transforming growth factor-beta binding protein 4 (LTBP-4) causes abnormal lung development, cardiomyopathy, and colorectal cancer. Genes Dev.
16: 2264-2273
[Abstract]
[Full Text]
-
Kielty, C. M., Sherratt, M. J., Shuttleworth, C. A.
(2002). Elastic fibres. J. Cell Sci.
115: 2817-2828
[Abstract]
[Full Text]
-
Mariani, T. J., Reed, J. J., Shapiro, S. D.
(2002). Expression Profiling of the Developing Mouse Lung . Insights into the Establishment of the Extracellular Matrix. Am. J. Respir. Cell Mol. Bio.
26: 541-548
[Abstract]
[Full Text]
-
Wu, X., Blanck, A., Norstedt, G., Sahlin, L., Flores-Morales, A.
(2002). Identification of genes with higher expression in human uterine leiomyomas than in the corresponding myometrium. Mol Hum Reprod
8: 246-254
[Abstract]
[Full Text]
-
Penttinen, C., Saharinen, J., Weikkolainen, K., Hyytiainen, M., Keski-Oja, J.
(2002). Secretion of human latent TGF-{beta}-binding protein-3 (LTBP-3) is dependent on co-expression of TGF-{beta}. J. Cell Sci.
115: 3457-3468
[Abstract]
[Full Text]
-
Unsold, C, Hyytiainen, M, Bruckner-Tuderman, L, Keski-Oja, J
(2001). Latent TGF-beta binding protein LTBP-1 contains three potential extracellular matrix interacting domains. J. Cell Sci.
114: 187-197
[Abstract]