Previous Article
Molecular and Cellular Biology, July 2000, p. 4948-4957, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Ribosomal DNA Replication Fork Barrier and HOT1
Recombination Hot Spot: Shared Sequences but Independent
Activities
Teresa R.
Ward,1,
Margaret L.
Hoang,1
Reeta
Prusty,2,
Corine K.
Lau,1,§
Ralph L.
Keil,2
Walton L.
Fangman,1 and
Bonita
J.
Brewer1,*
Department of Genetics, University of
Washington, Seattle, Washington 98195,1 and
Department of Biochemistry and Molecular Biology, Milton S. Hershey Medical Center, Pennsylvania State University, Hershey,
Pennsylvania 170332
Received 14 February 2000/Accepted 21 March 2000
 |
ABSTRACT |
In the ribosomal DNA of Saccharomyces cerevisiae,
sequences in the nontranscribed spacer 3' of the 35S ribosomal RNA gene are important to the polar arrest of replication forks at a site called
the replication fork barrier (RFB) and also to the
cis-acting, mitotic hyperrecombination site called
HOT1. We have found that the RFB and HOT1
activity share some but not all of their essential sequences. Many of
the mutations that reduce HOT1 recombination also decrease
or eliminate fork arrest at one of two closely spaced RFB sites, RFB1
and RFB2. A simple model for the juxtaposition of RFB and
HOT1 sequences is that the breakage of strands in
replication forks arrested at RFB stimulates recombination. Contrary to
this model, we show here that HOT1-stimulated recombination
does not require the arrest of forks at the RFB. Therefore, while
HOT1 activity is independent of replication fork arrest,
HOT1 and RFB require some common sequences, suggesting the
existence of a common trans-acting factor(s).
 |
INTRODUCTION |
The ribosomal DNA (rDNA) locus in
the yeast Saccharomyces cerevisiae consists of 9.1-kb tandem
repeats with the 35S rRNA gene, the much smaller 5S rRNA gene, and two
nontranscribed spacer (NTS) regions (see Fig. 1) (see references
29 and 22 for reviews of sequence
elements in the NTS). NTS2, located between the 5' ends of the two
genes, contains the promoter for the 35S rRNA gene, a weak origin of
replication named the rDNA ARS, and sequences essential for
the cis-acting mitotic recombination hot spot
HOT1. The 35S RNA polymerase I transcriptional enhancer lies
in NTS1 near the 3' end of the 35S gene. NTS1 also contains sequences important for the polar arrest of replication forks (replication fork
barrier [RFB]) and HOT1. The extent of sequence overlap
and the interdependence of these two events in DNA metabolism are unknown.
The rDNA RFB was first identified in S. cerevisiae, when
high-resolution two-dimensional (2D) gel electrophoresis revealed two
closely spaced sites where forks arrest (2), herein called RFB1 and RFB2. RFBs appear to be a highly conserved feature of rDNAs,
with barriers being found at the 3' end of the rRNA genes in a number
of other organisms (9, 21, 23, 32, 36, 38). The yeast RFBs
efficiently block replication forks traveling in the direction opposite
to 35S transcription, together impeding ~90% of encountered forks
(2). Fork arrest is not a consequence of transcription per
se, since replication forks still arrest at the RFB in cells lacking
functional RNA polymerase I (2). The RFB sequences are also
not inherently difficult to replicate (2), and thus fork
arrest is thought to result from the binding of proteins at the RFB
sequences. A protein-mediated mechanism of fork arrest in the rDNA RFB
has also been implicated in peas and Tetrahymena thermophila
(24, 37) and reported to involve the
transcription-terminating factor TTF-I in mice and humans (8,
23).
HOT1 sequences from the rDNA, when assayed at ectopic sites
in the genome, stimulate mitotic homologous recombination between intra- and interchromosomal repeats (14). Subcloning
analysis showed that the sequences necessary for HOT1
recombination are localized to two noncontiguous regions of the rDNA
NTS (35); the E fragment contains the enhancer for 35S
transcription, and the I fragment contains the 35S promoter and
initiation site (see Fig. 1). When the HOT1 sequences E and
I are inserted next to a construct consisting of direct repeats of
his4 sequences on chromosome III (see Fig. 2A),
recombination can be elevated more than 350-fold (12).
Through studies of recombination at this ectopic site, HOT1
activity has been shown to require RNA polymerase I transcription of
the repeat elements involved in recombination (12, 35).
Mutations in four genes, HRM1 through HRM4,
reduce HOT1-stimulated recombination (19).
HRM1 was later found to be identical to FOB1
(3), a gene that was identified in a search for mutants
defective for both HOT1 and RFB activities (17). Studies on FOB1 indicate that the protein is important for
the expansion and contraction of the rDNA array (15) and
plays a role in regulating life span (3). The
FOB1 protein is a candidate for creating the physical fork
barrier at the RFB, but it is not yet known whether the protein
functions by directly binding to DNA.
Evidence from Escherichia coli that the arrest of
replication forks at sequence-specific sites may be
recombinogenic (1, 11, 11a; reviewed in
references 18 and 31) has led to the hypothesis that forks blocked at
the RFB contribute substantially to HOT1 recombination
(15, 17). However, the apparent difference between the
transcription requirements for fork arrest at the RFB and for
HOT1-stimulated recombination and the requirement of the I
fragment for only the latter event might suggest that these activities
are independent. We report here that fork arrest is not required for
HOT1 recombination. However, we show that RFB activity and
HOT1 recombination share some common cis-acting sequences in the rDNA NTS1 region.
 |
MATERIALS AND METHODS |
Construction of RFB plasmids.
Plasmid pBB3NTS (see Fig. 3A)
was provided by Katherine Friedman and was constructed as follows.
Vector pBB3 was constructed by ligating the 967-bp
NdeI-SmaI URA3 fragment to the
2.435-kb NdeI-SmaI pUC18 vector. Yeast RM14-3a
DNA prepared by glass bead lysis (10) was cleaved with
EcoRI. Fragments were separated by gel electrophoresis, and
a visible rDNA band of approximately 2.5 kb was excised and
electroeluted. This fragment was cloned into the unique
EcoRI site of vector pBB3. The resulting plasmid was
partially digested with EcoRV, and a 425-bp
NheI-HindIII fragment containing
ARS1 was blunt-ended with Klenow enzyme (Boehringer) and
cloned into the EcoRV site of the rDNA. ARS1 was
oriented so that its HindIII site is closest to the RFB.
The HindIII-HpaI fragment in plasmid
pBB3NTS
HH was deleted by digesting plasmid pBB3NTS with
HindIII and HpaI, filling in the
HindIII site with Klenow polymerase, and ligating the
resulting ends.
YEp24 plasmids containing the
HindIII-HpaI RFB fragment were
constructed in two steps following the procedure used by Kobayashi et
al. (16). The HindIII site of the
HindIII-HpaI fragment from pBB3NTS was
blunted with Klenow polymerase, and the fragment was ligated into the
HincII site of the polylinker of pUC18. Plasmids were
screened for orientation of the insert by sequencing across the plasmid
with the M13 sequencing primer 1211 (New England Biolabs). For each
orientation, the SphI-BamHI fragment of the pUC18
derivatives was cloned between the SphI and BamHI
sites of YEp24 to create plasmids YEp24HH+ and
YEp24HH
. YEp24HH+ (see Fig. 5A, top) contains
the HindIII-HpaI fragment in the orientation expected to block replication forks coming from the 2µm
origin of replication.
Two plasmids were constructed for in vitro mutagenesis. The first
construct, used to make mutations M2 through M11, in which
blocks of
DNA in the region required for RFB activity were replaced,
was made by
inserting the 837-bp NTS1
EcoRI-
PvuII fragment
from
pBB3NTS into the
EcoRI and
PvuII sites of
the polylinker of pUC118
to create pUC118RFB. Mutated
HindIII-
HpaI fragments were excised
from
pUC118RFB and ligated between the
HindIII and
HpaI sites
of pBB3NTS in place of the wild-type fragment.
All mutations were
confirmed by sequencing and then tested for RFB
function. The
second mutagenesis construct, used to make mutations M1,
M12,
and M13, consisted of an insertion of the
NsiI-
PvuII fragment
of pBB3NTS in place of the
small
NsiI-
PvuII fragment of a modified
YIp5
vector (pMUTBIAS, provided by Katherine Kolor, has a mutation
in the
ampicillin resistance gene created by filling in a
PstI
site). The resulting plasmid, pMUTBIASRFB, was ampicillin sensitive.
For sequencing and testing of RFB function, the
NsiI-
SphI fragment
of a mutated pMUTBIASRFB was
ligated between the
SphI and
NsiI
sites of
pBB3NTS in place of the wild-type
fragment.
Site-directed mutagenesis.
Site-directed mutations were made
in the HindIII-HpaI fragment by
oligonucleotide-directed mutagenesis (4). The annealing reaction mixture consisted of 70 ng of vector, 25 pmol of each kinase-treated oligonucleotide, 2 µl of solution TN (0.2 M Tris-HCl [pH 7.5], 0.5 M NaCl), and 2 µl of 0.1 M MgCl2 in a
total volume of 20 µl. This reaction mixture was incubated at 100°C
for 3 min and then chilled for 5 min on ice. The synthesis reaction
mixture consisted of the 20-µl annealing reaction, 3 µl of solution
TDD (5 mM deoxynucleoside triphosphates, 0.1 M Tris-HCl [pH 7.5], 20 mM dithiothreitol), 1 µl (3 U) of T4 DNA polymerase (New England Biolabs), and 1 µl (400 U) of T4 DNA ligase (New England Biolabs) in
a total volume of 30 µl. This reaction mix was incubated at 37°C
for 90 min. The synthesis reaction was stopped by the addition of 3 µl of solution SE (0.25% sodium dodecyl sulfate, 5 mM EDTA) and a
5-min incubation at 65°C.
For mutagenesis of plasmid pUC118RFB, 5 µl of the synthesis reaction
mixture was used to transform the mismatch repair-defective
E. coli strain DSM3 (
33). Primary transformants were
cultured
in 10 ml of Luria-Bertani medium with 10 µg of ampicillin
per
ml overnight. Plasmids were recovered with a Qiagen Midi Column
procedure. Plasmid DNA (1 µg) was digested with
ScaI in a
20-µl
reaction mix to select against the parental plasmid which had
not incorporated the selection oligonucleotide
(CTGTGACTGGTGACGCGTCAACCAAGTC).
Then 5 µl of the digest
was transformed into
E. coli DH5

. Plasmids
which had lost
the
ScaI site were then screened for the presence
of the new
restriction site indicative of a mutation in the
HindIII-
HpaI
fragment. Approximately 75%
of plasmids that had incorporated
the selection oligonucleotide had
also incorporated the mutagenesis
oligonucleotide.
For mutagenesis of plasmid pMUTBIASRFB, 5 µl of the synthesis
reaction mix was used to transform the mismatch repair-defective
E. coli strain DSM3, and after a 2-h incubation at 37°C,
transformants
were spread on plates containing ampicillin (10 µg/ml).
Incorporation
of the selection oligonucleotide
(CACCACGATGCCTGCAGCAATTGGCAAC)
restores the
PstI
site in the ampicillin resistance gene so that
cells containing the
plasmid are ampicillin resistant. Ampicillin-resistant
colonies were
screened by restriction digest to determine if the
plasmid had
incorporated the mutagenesis oligonucleotide. The
wild-type and mutant
sequences for each
HindIII-
HpaI mutation
(M1 to M13) are shown in Table
1.
Construction of plasmids containing HOT1
mutations.
The C20 single-base-pair mutation (12) was
reconstructed in the RFB test plasmid by two in vitro mutagenesis
steps. First, a 2-bp mutation which created an MluI site and
included the C20 single-base-pair conversion was produced by using the
pMUTBIASRFB construct as explained above. Second, the
NsiI-PvuII fragment that included the 2-bp
mutation was moved into a fresh pMUTBIAS vector, mutagenized to the C20
single-base-pair mutation, and screened for the loss of the
MluI site. The C20 mutation was cloned into pBB3NTS for
sequencing and testing for RFB function as explained above.
To house the other
HOT1 mutations for 2D gel analysis,
pBB3NTS was modified to create plasmid L3520 by replacing the
HpaI
site with an
XbaI linker and deleting the
EcoRI site distal to
the enhancer. The 320-bp
EcoRI-
XbaI enhancer-containing fragment
of L3520
was deleted and replaced with an
EcoRI-
HindIII-
XbaI polylinker
to create L3520

E. The
HOT1 mutants G182, G188, G190, and
N35
(mutant sequences are described in reference
12)
were recovered
as a 320-bp
EcoRI-
XbaI fragment
and ligated into the polylinker
site of L3520

E for assay by 2D
gel.
2D agarose gel conditions.
DNA for 2D gels was isolated from
asynchronous, log-phase cultures as described previously
(7). The yeast strain RM14-3a (MATa cdc7-1
bar1 ura3-53 trp1-289 leu2-3,112 his6) was used to
construct the strains for all 2D gel experiments. From 1 to 4 µg of
DNA was used for each 2D gel. The conditions for the first dimension of
the gels to test the mutant plasmids and integrated constructs were
0.5% agarose and 1 V/cm for approximately 22 h at 23°C.
Conditions for the second dimension were 1.5% agarose, 0.3 µg of
ethidium bromide per ml, and 4 to 5 V/cm for 5 to 6 h at 4°C.
Probes were labeled by the hexanucleotide priming method (5).
HOT1 quantitative intrachromosomal recombination
assay.
Mutations M4, M5, M6, M10, and M11 were isolated from the
pBB3NTS clones as a 320-bp EcoRI-HpaI fragment.
The EcoRI and HpaI ends of the fragment were
converted to BamHI and XbaI, respectively, by the
addition of linkers. The resulting fragment replaced the corresponding
region of the plasmid G141 (12). All plasmids were digested
at the unique ClaI site and targeted to the his4 locus of chromosome III in RLK 88-3C (35). Mutant
chromosomal constructs were confirmed by Southern blot hybridization,
and the HOT1 activity of these mutants was assayed as
previously described (12).
 |
RESULTS |
Does replication fork arrest contribute to HOT1
recombination?
An appealing hypothesis to explain HOT1
mitotic hyperrecombination is that replication forks stalled at the RFB
are fragile (17, 31). DNA strand breakage at the RFB may
generate a lesion that is repaired by homologous recombination. This
possibility led us to test whether the two phenotypes are related
mechanistically. That is, is the level of HOT1-stimulated
recombination detected at the chromosome III site dependent on the
efficiency of the RFB at this site? The ultimate test of this
hypothesis is to determine whether forks are actually being blocked at
the chromosome III HOT1 assay site and whether the presence
or absence of barriers correlates with the functional status of
HOT1.
The E and I fragments of the rDNA NTS (Fig.
1) that are required for
HOT1
activity were assayed for their ability to stimulate
recombination at
an ectopic site on chromosome III (Fig.
2A) (
12,
35).
Previous work revealed that both orientations of the E
element
conferred similar levels of
HOT1 recombination
(
35).
If fork arrest at the polar RFB does play a role in
HOT1 activity,
then replication forks must proceed through
the E fragment equally
in both directions within different cells in a
population to establish
a similar number of blocked forks. The E
fragment is located between
ARS305 and
ARS306,
which fire at similar times early in S phase
(
30) and
initiate very efficiently (
28). However, the asymmetrical
location of E, closer to
ARS306 than to
ARS305,
predicts that
E would be replicated by forks from
ARS306
(Fig.
2A). The normal
test orientation of
the E fragment in the
HOT1 chromosome III
assay is such that
replication forks reaching this locus from
ARS306 travel in
the direction where they do not confront the
barrier activity in E. Consistent with this expectation, a test
for barriers in the
XhoI fragment containing
HOT1 sequences gave
no
evidence for the RFB (Fig.
2C). The 2D gel pattern was comparable
to
that of the construct that was missing the 320-bp
EcoRI-
HpaI
E fragment (Fig.
2B). These data
suggest that this region is replicated
by forks traveling from
ARS306. To confirm this proposal, we performed
2D gel
analysis of the direction of replication fork movement
(
7)
in these constructs. We observed that >95% of the replication
forks
arrive at the
HOT1-RFB locus from
ARS306 (data
not shown).
Therefore, >95% of the forks replicate through the E
region in
the permissive direction.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Features of the NTS region of S. cerevisiae.
(Top) Repetitive nature of the rDNA array, where 100 to 200 rDNA repeat
units (9.1 kb) are found in tandem on chromosome XII. The NTS lies
between 35S genes and is separated into NTS1 and NTS2 by the
intervening 5S gene. Fragments containing the 35S rDNA transcriptional
enhancer and initiator (called E and I, respectively) are essential to
HOT1-stimulated recombination (35) and are
labeled with the arrows oriented in the direction of RNA polymerase I
transcription of the 35S gene. (Bottom) A 2.68-kb EcoRI (RI)
fragment that spans most of the NTS region. Only relevant restriction
sites are shown. The positions of RFB1 and RFB2 within the 129-bp
HindIII-HpaI (HIII-HI) fragment of the E
fragment are delineated in this report. RFB1 and RFB2 block replication
forks polarly, inhibiting forks traveling in the direction opposite of
35S gene transcription (2). The rDNA ARS, near
the EcoRV (RV) site, is also noted. BII, BglII.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
HOT1-stimulated recombination independent of
RFB fork arrest. (A) Construct for HOT1 quantitative
intrachromosomal recombination assay. The sequences that lie between
the ClaI (C) sites were integrated into the his4
locus on chromosome III of RLK 88-3C as previously described
(12). The E-I HOT1 sequences are inserted to the
5' side of the repeated his4 sequences to stimulate
homologous recombination between these sequences. Intramolecular
recombination between repeated sequences of the 5' end of
his4 or the flanking chromosomal DNA, indicated by the
striped area, can result in excision of the intervening URA3
marker. The two flanking origins are indicated: ARS305 and
ARS306 are located ~38 and ~6 kb, respectively, from the
E-I region. The bottom map displays the orientation of the 255-bp I and
320-bp E fragments and the RFBs. The arrows for E and I and restriction
sites in E are indicated as in Fig. 1. The HpaI (HI) site is
not present in this construct. Xh, XhoI. (B, C, and D)
Autoradiograms of high-resolution 2D gel of three HOT1
constructs at the his4 locus on chromosome III. For each
gel, the XhoI fragment was probed with chromosomal sequences
(open rectangles in panel A). The XhoI fragment of interest
is a 1.7-kb fragment for B and a 2-kb fragment for C and D. Due to the
duplicated chromosomal and his4 sequences in the
HOT1 cassette, the probe hybridized to a second
XhoI fragment near the his4-260 gene.
Hybridization to this smaller fragment, 1.4 kb, is observed as a second
simple Y arc in the lower right corner of the 2D gels. The number
beneath each gel is the fold stimulation of excision by
HOT1, taken from Voelkel-Meiman et al. (35).
These data were reconfirmed in the present study (data not shown). The
strains used were M51 (B), M39 (C), and M78 (D) (35).
|
|
The possibility that the RFB is not active at this chromosome III
location was tested by inverting the E element so that it
would now be
expected to arrest forks arriving from
ARS306.
High-resolution
2D gel analysis shows that both arrest sites in the
HOT1 XhoI
fragment, RFB1 and RFB2, are functional (Fig.
2D).
This observation
was confirmed by examining two other restriction
fragments in
which the RFB was located at different positions (data not
shown).
From these results, we conclude that a replication fork reaches
the E region from
ARS306 and that, if oriented properly, the
RFB
is capable of efficient fork arrest. Therefore, the two constructs
that differ in the orientation of E have significant differences
in
fork blocking at the RFB. If arresting forks did contribute
to
HOT1 activity, we would expect a significant increase in
levels
of
HOT1-stimulated recombination from the construct
that impeded
forks. However, as observed earlier (
35) and
reconfirmed for
the present study, the two constructs were
indistinguishable in
the level of excisive recombination (bottom of
Fig.
2C and D and
data not shown). These findings clearly demonstrate
that the stimulation
of recombination associated with the
HOT1 sequences is not dependent
upon stalled replication
forks.
Role of the 129-bp HindIII-HpaI
fragment in RFB1 and RFB2.
Although HOT1 recombination
does not require replication fork arrest, it is possible that common
cis-acting sequences play a role in these two activities. To
test this possibility, it was first necessary to better define the
sequences involved in the rDNA RFB activity.
Previous mapping of the barrier in the yeast rDNA NTS by 2D gel
analysis demonstrated that forks initiating at the rDNA
ARS in NTS2 arrest between the
HindIII and
HpaI
sites (Fig.
1) (
2,
16). High-resolution 2D gel analysis of
the chromosomal RFB
revealed two discrete arrest sites of unequal
strength in this
region, RFB1 and RFB2 (
2). Because the
barriers continue to
function when transplanted to plasmids (
2,
16), it was possible
to perform deletion analysis to identify the
sequences important
for RFB activity. Kobayashi et al. (
16)
determined that a 69-bp
region within the 129-bp
HindIII-
HpaI fragment was sufficient
to
generate reduced RFB activity on a plasmid. However, their
2D gel
conditions failed to resolve the two arrest sites, and
it is not known
whether the 69-bp region or the 129-bp
HindIII-
HpaI
fragment containing it is
sufficient for arrest at both RFB1 and
RFB2.
To determine if sequences for both RFB1 and RFB2 activity are present
in the 129-bp
HindIII-
HpaI fragment, we
analyzed replication
of an NTS region from which this fragment was
deleted. First,
a plasmid was constructed to include the 2.46-kb
EcoRI fragment
that spans most of the NTS region of the rDNA
(Fig.
1). The rDNA
ARS that lies within this
EcoRI fragment proved to be inefficient
in episome
maintenance, with the plasmid often integrating into
chromosomal rDNA.
Therefore, the efficient
ARS1 origin was inserted
at the
EcoRV site near the rDNA
ARS (Fig.
1), creating
plasmid
pBB3NTS (Fig.
3A). The location
and orientation of the RFB with
respect to the origin in pBB3NTS
ensured that the replication
fork proceeding counterclockwise (CCW)
from
ARS1 will encounter
the RFB before the fork moving
clockwise (CW) (Fig.
3A). Therefore,
replication intermediates in which
the CCW fork arrests at the
RFB until it is met by the CW fork will
accumulate. To detect
the accumulation of these branched molecules, we
examined the
2.2-kb
SspI fragment from pBB3NTS under 2D gel
conditions in which
the two arrest sites, RFB1 and RFB2, were revealed
(Fig.
3C).
Although the plasmid RFB generated less intense spots
relative
to chromosomal barriers (
2), the plasmid RFB blocks
replication
forks long enough for site-specific termination events to
occur.
Accumulation of the two expected replication termination
structures,
TER1 and TER2, that correspond with the arrest at RFB1 and
RFB2,
respectively, are observed along the hybridization line of
X-shaped
molecules (Fig.
3B and C).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Deletion of the
HindIII-HpaI region eliminates RFB1 and
RFB2. (A) Map of the 6.3-kb plasmid pBB3NTS. The dashed line is vector
sequence from pUC18. Only relevant restriction sites are noted. The
thicker line between the EcoRI (RI) sites corresponds to the
2.46-kb EcoRI NTS region (a subfragment from the restriction
map in Fig. 1) from the rDNA of RM14-3a. The locations of
ARS1 and URA3 are indicated. A 425-bp
NheI-HindIII (Nh-H3) fragment containing
ARS1 was blunt-ended and inserted into the EcoRV
(RV) site near the rDNA ARS (Fig. 1) to improve the
efficiency of extrachromosomal maintenance of the plasmid.
Bidirectional replication initiating from ARS1 creates a CCW
fork that is blocked by the RFBs before meeting the CW fork. Ss,
SspI; Ns, NsiI; Sp, SphI; PII,
PvuII. (B) Schematic diagram of the migration of different
replication intermediates in 2D gels shown in C and D. Accumulation of
arrested forks results in the two intense spots of hybridization (RFB1
and RFB2) along the arc of Y intermediates. The nearly vertical dashed
line represents the pattern of hybridization seen for X-shaped, or
terminating, molecules. Termination at RFB1 and RFB2 results in the
accumulation of X-shaped molecules TER1 and TER2, respectively. The
thicker diagonal gray line corresponds to the hybridization pattern for
double-Y replication intermediates. (C and D) High-resolution 2D gels
of the 2.2-kb SspI (Ss in panel A) fragment from pBB3NTS and
pBB3NTS HH, respectively, probed with URA3 sequences.
|
|
Next, the role of the
HindIII-
HpaI
fragment in RFB1 and RFB2 was assessed by deleting it from pBB3NTS to
create pBB3NTS

HH.
Under high-resolution 2D gel analysis, the
replication intermediates
from pBB3NTS

HH lacked any trace of either
arrest site and either
specific termination site (Fig.
3D). These
results indicate that
the
HindIII-
HpaI
fragment is necessary for the function of both
RFB1 and RFB2 on a
plasmid. They also demonstrate that no other
regions within the
EcoRI fragment, which spans most of the NTS
region, were
sufficient to significantly arrest the progress of
replication
forks.
Sequences within the HindIII-HpaI
fragment responsible for RFB1 and RFB2.
Since it appeared that the
HindIII-HpaI fragment is necessary to
generate RFB1 and RFB2 at an ectopic site on a plasmid, we subjected
the 129-bp HindIII-HpaI region to
systematic mutagenesis of consecutive 10-bp regions (12 bp in the case
of M1). Mutations in the HindIII-HpaI
region were generated in a mutagenesis plasmid (see Materials and
Methods) and then transferred to pBB3NTS, in which RFB function could
be tested in the context of almost the entire NTS region. Each base
pair within the sequence targeted for mutagenesis was replaced with
another base pair. An effort was made to create the least conservative
changes possible: adenines were replaced with cytosines, guanines were
replaced by thymines, and vice versa. However, for ease of screening,
each mutation created a new restriction site that sometimes made it
impossible to make the least conservative change in the region. In no
case did any base within the mutated sequence remain the same as it was
in the wild-type sequence (Table 1). All mutated
HindIII-HpaI regions were sequenced to
confirm that no unintended base pair changes were created.
High-resolution 2D gel analyses of
SspI fragments from each
of the 13 block mutations were performed. Figure
4A summarizes
all of the 2D results
obtained, and the autoradiograms of wild-type
plasmid and some mutant
plasmids are shown in Fig.
4B. Eight of
the 13 mutations do not differ
significantly from wild-type RFB
behavior (Fig.
4A; M3, M6, and M13 in
Fig.
4B). All exhibit two
intense spots along the simple Y arc,
corresponding in location
to RFB1 and RFB2 and the two prominent
termination signals. Mutations
M4 and M5 displayed only one barrier,
located at the position
of RFB2 and a single termination species at the
position of TER2
(Fig.
4B). This result indicates that the sequences
within the
20 bp covered by mutations M4 and M5 are required for RFB1
but
not for RFB2 when the NTS region is on a plasmid.

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 4.
Scanning mutagenesis of the 129-bp
HindIII-HpaI region. (A) Diagram showing
the locations of the 12 10-bp (M13 to M2) and 1 12-bp (M1) block
mutations within the HindIII-HpaI
fragment. The mutant and the wild-type sequences are listed in Table 1.
The raw data in panel B are summarized by the shading of the boxes in
A: black, similar to wild type; gray, reduced fork arrest; white,
absence of fork arrest. (B) High-resolution 2D gel analysis of the
block mutations in the HindIII-HpaI
region. Mutations were tested for RFB function in plasmid pBB3NTS (see
Fig. 3A for map). The 2.2-kb SspI fragment was probed with
URA3 sequences. A 2D gel of pBB3NTS containing the wild-type
HindIII-HpaI sequence is shown for
comparison. Open arrowheads point to loss of an RFB, and gray
arrowheads point to a significantly decreased RFB. The M5 + M10
composite is an overlay of the M5 and M10 autoradiograms shifted
laterally to display the relative and easily distinguishable positions
of RFB1 and RFB2, indicated by solid arrowheads.
|
|
Similar analysis of mutations M10, M11, and M12 uncovered the
importance of a nearby 30-bp stretch in causing the arrest of
forks at
RFB2. M10 and M11 completely abolished arrest at RFB2
(Fig.
4B). These
changes in an RFB activity are again reflected
in the shift of
terminating structures, in this case to TER1.
M12 produced a somewhat
reduced accumulation of arrested forks
at RFB2 and termination
structures at TER2. Overlapping autoradiograms
of M5 and M10, offset
horizontally by 4 mm, allow the unambiguous
assignment of RFB1 and RFB2
in the two mutations (last panel of
Fig.
4B).
To test whether the plasmid results are valid in the context of the
chromosomal rDNA locus, plasmids containing the mutation
at either M5
or M11 were integrated into the rDNA on chromosome
XII. The plasmid
used for chromosomal integration was similar
to pBB3NTS but lacked the
ARS1 sequence and contained a fragment
of

DNA to serve
as a unique hybridization probe. Transplacement
of just the NTS region
was attempted; however, when 10 transformant
cultures of each mutant
type were screened for the presence of
the unique restriction site
created by the mutation, all were
found to have lost the restriction
site, indicating that the mutations
had been repaired through gene
conversion to wild-type sequence.
A lower rate of gene conversion was
seen when the entire plasmid
was integrated into the rDNA in the
BglII site at the 5' end of
the 35S gene (Fig.
1); 25 to
50% of the transformants screened
retained the restriction site
indicative of the mutated constructs.
High-resolution 2D gel analysis
of the chromosomal M5 mutation
showed the complete loss of RFB1 at the
rDNA locus (data not shown),
a result which is consistent with the
plasmid analysis. Similarly,
the chromosomal M11 mutation abolished
RFB2 activity (data not
shown). The results for the rDNA integrants of
mutations M5 and
M11 support the validity of using the plasmid model to
investigate
RFB
function.
Sequences sufficient for RFB1 and RFB2 activity.
Kobayashi et
al. (16) found that the 129-bp
HindIII-HpaI fragment alone had RFB
activity, although it seemed reduced. We recreated their minimal
HindIII-HpaI plasmid
(YEp24HH+; Fig. 5A, top) to
test whether their minimal construct was sufficient for both RFBs or
only one. Analysis by high-resolution 2D gels showed the presence of
only a single RFB species (Fig. 5A, bottom). Further deletion of the
129-bp fragment by Kobayashi et al. reduced the sequences sufficient
for RFB activity to a 69-bp fragment (white bar in Fig. 5B and C, top).
Since these sequences include M4 and M5, which are required for RFB1,
but do not include those sequences necessary for RFB2 (M10 to M12), we
can conclude that the 69-bp region is sufficient for RFB1.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
HindIII-HpaI sequences
sufficient only for RFB1. (A) Map of the 7.9-kb plasmid
YEp24HH+ and a high-resolution 2D gel of the 2.4-kb
NruI (Nr) fragment. The 2µm origin (solid circle) and the
HindIII-HpaI insert are labeled. Also
shown are the locations of the URA3 gene and pBR322 (pBR)
sequences. (B and C) Maps of 111-bp insertion mutations between RFB1
and RFB2. Disruptions in the HindIII-HpaI
region were tested for RFB function in plasmid pBB3NTS (see Fig. 3A for
map). The 2.3-kb SspI fragment was probed with
URA3 sequences. The map above each gel is similar to the
diagram in Fig. 4A, and mutations 1 and 13 are noted for orientation.
The white bar within the chart shows the location of the 69-bp minimum
RFB sequence determined by Kobayashi et al. (16). Mutation
M6HP has an 111-bp insertion (from pUC18) in the MscI site
created by the M6 mutation. Mutation M9HP contains the same 111-bp
fragment inserted just outside of the 69-bp sequence in the
FspI site created by the M9 mutation. The spot located above
the double-Y line of replication intermediates in B is background
hybridization. See the legend to Fig. 4 for other details.
|
|
The 69-bp sequence sufficient for RFB1 activity cannot be further
trimmed by deletion without complete loss of RFB activity
(
16), yet our mutagenesis data suggest that the sequences
within
these deletions, about 35 of these 69 bp (M6 to mid-M9), may not
be necessary for RFB1 (white bar inside map in Fig.
5B and C,
top). One
possibility is that the M6 to M9 region contains functionally
redundant
sequence elements that contribute, together with sequences
in M4 and
M5, to RFB1 activity. If so, moving the M4-M5 and M6-M9
regions apart
might affect RFB1 function. As a test of this idea,
we inserted a
111-bp fragment of pUC18 DNA into the restriction
site of the M6 mutant
sequence (Fig.
5B, top). The insertion mutation
in the
HindIII-
HpaI region was tested for RFB
function in plasmid
pBB3NTS (Fig.
3A). High-resolution 2D gel analysis
shows that
RFB1 activity is eliminated (Fig.
5B, bottom). As a control,
the
same 111-bp fragment was inserted outside of the 69-bp region,
in
the restriction site of the mutant M9 sequence (Fig.
5C, top).
This
construct retains both RFB1 and RFB2 activity (Fig.
5C, bottom),
with
the distance between the two spots increased compared with
the barrier
spacing of the wild-type
HindIII-
HpaI
fragment (compare
with Fig.
3C). These findings support the
functionally redundant
sequence hypothesis and indicate that the
spacing between these
functionally redundant sequences and M4-M5 is
crucial for RFB1
fork
arrest.
From these data, we conclude that the
HindIII-
HpaI NTS fragment contains
discrete sequences that uniquely contribute to the
specification of
RFB1 and RFB2. It should be noted that the identified
sequences
required for RFB1 and RFB2 function do not necessarily
coincide with
the sequences at which the nascent strands are arrested.
Sequences
essential for RFB1 map to the 20-bp region defined by
mutations M4 and
M5 and unspecified, redundant sequences in the
region between M6 and
M9. RFB2 depends absolutely on the sequences
defined by M10 and M11 and
to a lesser extent on sequences in
the region defined by M12. However,
these 30 bp are not by themselves
sufficient for RFB2; on
low-resolution 2D gels, Brewer et al.
(
2) determined that
sequences that lie 35S gene-proximal to
the
HindIII site
contributed to RFB activity. In addition to the
HindIII-
HpaI fragment, sequences within
the 188-bp
EcoRI-
HindIII
fragment most likely
comprise the region sufficient for full RFB2
activity.
Correlation between RFB and HOT1 sequences.
Mutations in the E fragment that abolished HOT1 activity
were identified by Huang and Keil (12) in a screen using the
chromosome III HOT1 recombination assay (Fig. 2A). Those
mutations were scattered in the right halves of both the
HindIII-HpaI (Eb) and
EcoRI-HindIII (Ea) fragments of E
(see Fig. 7A). Five of these mutations (G182, N35, G188, G190, and C20)
were moved into the RFB test plasmid pBB3NTS, and the presence of RFB
activity was determined by high-resolution 2D gels. Results for the
wild-type construct (L3520) and three of the mutations are shown in
Fig. 6. C20, a single-base-pair mutation
in the M5 region, cleanly abolished RFB1 (Fig. 6B). Within the inverted
repeat region of Ea, the point mutation N35 and the scrambled sequence block mutations G188 and G190 eliminated RFB2 (Fig.
6C and data not shown). G182, a block mutation in the poly(T) region
and the most distal mutation from the
HindIII-HpaI fragment tested, had a more
modest effect on RFB2, showing a reduced efficiency of fork arrest at
this site (Fig. 6D). As would be predicted, deleting the entire E
fragment results in the elimination of both barriers (data not shown).
All of these mutations also result in the drastic reduction of
HOT1 recombination (Fig. 7B)
(12). These data show that sequences required for RFB1 and
RFB2 overlap sequences essential to HOT1-stimulated
recombination.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
E fragment mutations that affect HOT1 and RFB
activity. (A) 2D gel of the 2.2-kb SspI fragment of
wild-type (wt) L3520. L3520 differs from pBB3NTS (see Fig. 3A) in two
restriction sites (detailed in Materials and Methods). L3520 was used
to clone the N35 and G182 mutations, which are shown in the other
panels, while C20 was cloned into pBB3NTS. (B, C, and D) 2D gel
analysis of the 2.2-kb SspI fragment of C20, N35, and G182.
C20 and N35 are point mutations (see Fig. 7A for wild-type and mutant
sequences), and G182 is a sequence-scrambled block mutation (see
reference 12 for wild-type and mutant sequences).
The locations of these mutations within the E fragment are shown in
Fig. 7A. See the legend to Fig. 4 for other details.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Summary of the effect of HOT1 and RFB
activity on E fragment mutations. (A) Map of the 320-bp
EcoRI-HpaI E fragment located from the rDNA NTS1
(Fig. 1). The HindIII-HpaI fragment is
represented as in Fig. 4A. Only the mutants that were tested for
HOT1 activity are noted. Ea and Eb
are the two regions within the E fragment that were identified by
linker insertion mutagenesis to be required for HOT1
activity (34). The striped bars underneath the map represent
the HOT1 block mutations tested in the RFB plasmid assay:
G182 in the poly(T) region and G190 and G188 in inverted repeats IR1
and IR2, respectively. Mutant and wild-type sequences for the
HOT1 block mutations are given in Huang and Keil
(12). The base pair changes and locations of the point
mutations N35 and C20 are indicated. The locations of two identified
35S enhancer-binding proteins, REB1 and ABF1, are
noted (13, 27). (B) Summary chart of all the mutant
sequences tested. wt E indicates the presence of wild-type E sequences;
E signifies that the E fragment is absent. HOT1
recombination was measured as the relative excision rate of the
URA3 marker in the chromosome III construct (see Fig. 2A) as
previously described (12). *, data from reference
12.
|
|
Since the screen for
HOT1 mutations may not have been a
saturating screen, the failure to find
HOT1 mutations that
mapped
to the M10 and M11 region may not be meaningful. To test the
role
of the M10-M11 region in
HOT1 recombination and to test
additional
10-bp linker mutations, both normal and mutant for RFB
function,
five of the mutations were cloned into the E fragment of the
HOT1 assay cassette on chromosome III (Fig.
2A) and their
effects on
HOT1 recombination were assessed (Fig.
7B). M5,
as expected from
the previous C20 result, completely eliminated
HOT1 activity.
However, the adjacent M6 mutation, which had
no effect on either
RFB, reduced
HOT1 activity substantially
(about fivefold). Of
the two mutations that eliminate RFB2, M10
significantly reduced
HOT1 activity (sixfold), whereas M11
decreased
HOT1 by only twofold.
The results with M6
and M11 indicate that either
HOT1 or RFB activity
can be
dramatically decreased or eliminated by mutation without
great
reduction in the other one. Therefore, we find that the
cis-acting sequences for RFB and
HOT1 are not
entirely
coincident.
Mutation M4 behaved anomalously, eliminating RFB1 but producing
variable effects on
HOT1 recombination. The recombinational
excision rates for 14 independent M4 transformants ranged from
less
than 1% to more than 100% of the wild-type value (data not
shown).
Most of the isolates showed a very modest (twofold) decrease
in
recombination. Sequence analysis showed that the M4 mutation
was still
present in all 14 transformants examined. The reason
for the unique
variability of mutation M4 on
HOT1-stimulated recombination
is unknown at this
time.
 |
DISCUSSION |
HOT1-stimulated recombination is independent of blocked
replication forks.
Sequences necessary for both RFB activity and
HOT1 recombination reside at the 3' end of the 35S gene. An
attractive model to explain this colocalization is that replication
forks arrested at the RFB are prone to strand breaks that can stimulate
homologous recombination (17). If this model were correct,
then, because the arrest is polar, the direction of replication of the
HOT1 sequences should determine the level of
HOT1-stimulated recombination. Earlier work showing that the
E element functions in an orientation-independent manner in
HOT1 recombination (35) cast doubt on this model. Here we have demonstrated directly, both by fork direction analysis and
by 2D gel visualization of fork arrests, that RFB arrested forks are
not required for HOT1-stimulated recombination. These findings are surprising, considering the current model that proposes that RFB arrested forks stimulate rDNA recombination by initiating a
breakage event (3, 15, 30a). Our studies do not support the
paradigm that stalled forks are fragile sites at which recombinational repair is induced. Instead, we favor the idea that proteins that stimulate HOT1 recombination may, as a consequence of DNA
binding, have the ability to arrest replication forks.
While there is evidence in
E. coli that the arrest of
replication forks can lead to double-strand breaks (
1a,
11,
26),
there is no physical evidence that normal fork arrest at the
yeast
RFB causes breaks in vivo. Indeed, two observations suggest that
replication forks arrested at the yeast RFB may have less
single-stranded
character than moving forks and thus may be more
stable. Linskens
and Huberman (
20) observed that RFB
arrested forks behave on
BND-cellulose chromatography as if they
possessed more double-stranded
regions than moving forks. Consistent
with this interpretation,
Lucchini and Sogo (
25) noted that
the DNA immediately behind
the stalled RFB fork appeared to be mostly
double stranded when
visualized by electron microscopy after psoralen
cross-linking.
The lagging strands at forks arrested at the RFB site
thus appeared
to have completed Okazaki fragment replication and
ligation. Therefore,
the RFB arrested forks may be less fragile, hence
less susceptible
to breakage and recombinational repair, than moving
forks.
Sequences responsible for RFB1 and RFB2 are distinct and
independent.
Earlier work revealed that the S. cerevisiae rDNA RFB consisted of two discrete arrest sites
(2), herein named RFB1 and RFB2. Using high-resolution
2D gel analysis of plasmid replication intermediates, we have now
further defined the sequences required for arrest at these two sites.
While the 129-bp HindIII-HpaI region in
NTS1 (Fig. 1) is necessary for fork arrest at both RFB1 and RFB2,
it is sufficient for a barrier only at RFB1. Sequences located in the
adjacent, 35S gene-proximal 188-bp
EcoRI-HindIII fragment (the 35S enhancer)
most likely contain the additional sequences sufficient for fork arrest
at RFB2 (2). No other regions within the
EcoRI fragment that spans most of the NTS region are
sufficient to impede progression of a replication fork.
Essential sequences for RFB1 and RFB2 were localized to two distinct
regions, 20 and 30 bp in length and separated by 40 bp.
The 20-bp
region covered by mutations M4 and M5, which abolish
RFB1 activity,
shows no sequence similarity to the 30-bp region
covered by
mutations M10, M11, and M12, which affect fork arrest
at RFB2.
Interestingly, the M4 and M5 region includes 10 matches
to a 12-bp
stretch of the pea RFB (CTTGTATAAGTT) that Hernandez
et
al. uncovered in a search for RFB homology between pea and
S. cerevisiae (
9). A shorter 7-bp match to this 12-bp
pea sequence
was also found within the yeast 188-bp
EcoRI-
HindIII fragment
(
9),
neighboring the right end of the
REB1 binding site
(Fig.
7A). While this additional restriction fragment appears to be
important to RFB2, it is not yet known if this specific 7-bp sequence
is needed for RFB2
arrest.
Although the molecular mechanism that results in replication fork
arrest at the
S. cerevisiae rDNA RFB has not yet been
determined,
the binding of proteins is likely to be involved
(
2). Our results
from mutating different sequences show that
fork arrests at RFB1
and RFB2 are eliminated independently from one
another. We also
demonstrate that the distance between the barriers can
be increased
by 111 bp without reduction in fork arrest activity at
these sites
(Fig.
5C, bottom). These data make it unlikely that one
protein
molecule binds simultaneously at RFB1 and RFB2. Thus, the RFB1
and RFB2 essential sequences most likely correspond to binding
sites
for either two different proteins or one protein with two
independent
binding
sites.
Sequences essential for HOT1 recombination and the rDNA
RFB overlap.
The fact that sequences necessary for HOT1
and RFB activity colocalize within NTS1 posed the possibility
that the two activities may require the same cis-acting
sequences. While there is some sequence sharing, it is not
complete: mutations C20 and N35 (see Fig. 7A for location) reduce
HOT1 activity to less than 6% of the wild-type level
while simultaneously eliminating one of the barriers (RFB1 and RFB2,
respectively); however, mutation M6 displays normal barrier
activities while reducing HOT1 activity to 22% of the
wild-type level, and mutation M11 abolishes the barrier at RFB2, where
it has only a modest effect on HOT1 (Fig. 7B). These results
should not be surprising, since HOT1 and RFB also respond
differently to mutations in trans-acting factors. For example, HOT1 recombination is dependent upon 35S rRNA gene
transcription by RNA polymerase I (12), while the RFBs
function independently of this process (2).
The abundant nuclear transcription factors
REB1 and
ABF1 (
REB2) have long been known to bind within
the E fragment (
13,
27). While their sites of binding are in
close proximity to
the
HOT1 and RFB essential sequences (see
Fig.
7A for binding
sites), they clearly do not overlap. Deletion of
both sites resulted
in only a modest decrease in
HOT1
activity (
12). Neither protein
is required for RFB1
function, considering that their sites are
not included in sequences
sufficient for RFB1. The
REB1 protein
is most likely not
involved in RFB2, since both barriers are normal
in strains with a
temperature-sensitive allele of
REB1 grown at
the
restrictive temperature for several hours (
6). However,
the
effect of
ABF1 on RFB2 function is not yet known because
scanning
mutagenesis of the
EcoRI-
HindIII
region has not been
done.
Using chromatin immunoprecipitation, two yeast helicases, Pif1p and
Rrm3p, were recently found to preferentially associate
with rDNA
chromatin, including the RFB region (
12a). By measuring
the
generation of extrachromosomal rDNA circles in null mutants,
Ivessa et
al. (
12a) showed that Rrm3p suppressed and Pif1p promoted
rDNA recombination. The authors also performed 2D gel analyses
on the
direction of replication fork movement downstream of the
RFB block and
showed that a greater number of forks bypassed the
RFB in a
pif1 mutant than in the wild type. This finding suggests
that Pif1p plays a role in maintaining an efficient fork arrest
at the
RFB. Further evidence also suggests that Rrm3p is an important
factor
in resolving forks terminating at the RFB. Neither Pif1p
nor Rrm3p is
essential to RFB activity, since forks are still
arrested at the RFB
site in the null mutants. However, it seems
that Pif1p and Rrm3p are
two newly identified
trans-acting factors
that appear to be
involved in both RFB activity and rDNA
recombination.
The
FOB1 protein is localized to the nucleolus and is
essential both for arresting replication forks at the RFB and for
HOT1-stimulated
recombination (
3,
17). It plays a
role in the maintenance
of rDNA repeat number (
15) and in
the accumulation of rDNA extrachromosomal
circles, which appear to
influence life span (
3). Fob1p does
not affect rDNA
transcription (R. Prusty, unpublished data) and
does not appear to
confer any significant growth defects (
15).
Based on the
properties of a
fob1 mutant (
17) and on the
results
reported here, Fob1p must influence protein-DNA interactions at
several sites, those determining replication fork arrest at RFB1
and at
RFB2 and those mediating
HOT1-stimulated recombination.
It
seems likely that the
FOB1 protein facilitates the binding
of different proteins to these different sites. Further studies
will be
needed to clarify the protein-DNA interactions and their
functional
consequences at this complex locus in the
rDNA.
 |
ACKNOWLEDGMENTS |
We thank Katherine Kolor for plasmid pMUTBIAS and Katherine
Friedman for plasmid pBB3NTS. We thank Heather McCune for comments on
the manuscript and M. K. Raghuramen for help with manuscript preparation.
This work was supported by National Institute of General Medical
Sciences grant 18926 to B.J.B. and W.L.F. and by U.S. Public Health
Service grant R01 GM36422 to R.L.K. T.R.W. was supported during
part of this work by U.S. Public Health Service training grant T32 GM07735.
Theresa R. Ward, Margaret L. Hoang, and Reeta Prusty contributed
equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, Box 357360, University of Washington, Seattle, WA
98195-7360. Phone: (206) 685-4966. Fax: (206) 543-0754. E-mail:
bbrewer{at}genetics.washington.edu.
Present address: Rosetta Inpharmatics, Kirkland, WA 98034.
Present address: The Whitehead Institute, Cambridge, MA 02142.
§
Present address: Department of Molecular, Cellular and
Developmental Biology, University of Colorado, Boulder, CO 80309.
 |
REFERENCES |
| 1.
|
Bierne, H.,
S. D. Ehrlich, and B. Michel.
1991.
The replication termination signal terB of the Escherichia coli chromosome is a deletion hot spot.
EMBO J.
10:2699-2705[Medline].
|
| 1a.
|
Bierne, H.,
S. D. Ehrlich, and B. Michel.
1997.
Deletions at stalled replication forks occur by two different pathways.
EMBO J.
16:3332-3340[CrossRef][Medline].
|
| 2.
|
Brewer, B. J.,
D. Lockshon, and W. L. Fangman.
1992.
The arrest of replication forks in the rDNA of yeast occurs independently of transcription.
Cell
71:267-276[CrossRef][Medline].
|
| 3.
|
Defossez, P.-A.,
R. Prusty,
M. Kaeberlein,
S.-J. Lin,
P. Ferrigno,
P. A. Silver,
R. L. Keil, and L. Guarente.
1999.
Elimination of replication block protein Fob1 extends the life span of yeast mother cells.
Cell
3:447-455.
|
| 4.
|
Deng, W. P., and J. A. Nickoloff.
1992.
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal. Biochem.
200:81-88[CrossRef][Medline].
|
| 5.
|
Feinberg, A. P., and B. Vogelstein.
1983.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[CrossRef][Medline].
|
| 6.
|
Friedman, K. L.
1996.
Determinants of late origin activation in yeast. Ph.D. thesis
University of Washington, Seattle.
|
| 7.
|
Friedman, K. L., and B. J. Brewer.
1995.
Analysis of replication intermediates by two-dimensional agarose gel electrophoresis.
Methods Enzymol.
262:613-627[Medline].
|
| 8.
|
Gerber, J.-K.,
E. Goegel,
C. Berger,
M. Wallisch,
F. Muller,
I. Grummt, and F. Grummt.
1997.
Termination of mammalian rDNA replication: polar arrest of replication fork movement by transcription termination factor TTF-I.
Cell
90:559-567[CrossRef][Medline].
|
| 9.
|
Hernandez, P.,
P. L. Martin,
R. M. L. Martinez, and J. B. Schvartzman.
1993.
Conserved features in the mode of replication of eukaryotic ribosomal RNA genes.
EMBO J.
12:1475-1485[Medline].
|
| 10.
|
Hoffman, C. S., and F. Winston.
1987.
A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli.
Gene
57:267-272[CrossRef][Medline].
|
| 11.
|
Horiuchi, T., and Y. Fujimura.
1995.
Recombinational rescue of the stalled DNA replication fork: a model based on analysis of an Escherichia coli strain with a chromosome region difficult to replicate.
J. Bacteriol.
177:783-791[Abstract].
|
| 11a.
|
Horiuchi, T.,
Y. Fujimura,
H. Nishitani,
T. Kobayashi, and M. J. Hidaka.
1994.
The DNA replication fork blocked at the Ter site may be an entrance for the RecBCD enzyme into duplex DNA.
J. Bacteriol.
176:4656-4663[Abstract/Free Full Text].
|
| 12.
|
Huang, G. S., and R. L. Keil.
1995.
Requirements for activity of the yeast mitotic recombination hotspot HOT1: RNA polymerase I and multiple cis-acting sequences.
Genetics
141:845-855[Abstract].
|
| 12a.
|
Ivessa, A. S.,
J.-Q. Zhou, and V. A. Zakian.
2000.
The Saccharomyces Pif1p DNA helicase and the highly related Rrm3p have opposite effects on replication fork progression in ribosomal DNA.
Cell
100:479-489[CrossRef][Medline].
|
| 13.
|
Kang, J. J.,
T. J. Yokoi, and M. J. Holland.
1995.
Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.
J. Biol. Chem.
270:28723-28732[Abstract/Free Full Text].
|
| 14.
|
Keil, R. L., and G. S. Roeder.
1984.
cis-acting, recombination-stimulating activity in a fragment of the ribosomal DNA of S. cerevisiae.
Cell
39:377-386[CrossRef][Medline].
|
| 15.
|
Kobayashi, T.,
D. J. Heck,
M. Nomura, and T. Horiuchi.
1998.
Expansion and contraction of ribosomal DNA repeats in Saccharomyces cerevisiae: requirement of replication fork blocking (Fob1) protein and the role of RNA polymerase I.
Genes Dev.
12:3821-3830[Abstract/Free Full Text].
|
| 16.
|
Kobayashi, T.,
M. Hidaka,
M. Nishizawa, and T. Horiuchi.
1992.
Identification of a site required for DNA replication fork blocking activity in the rRNA gene cluster in Saccharomyces cerevisiae.
Mol. Gen. Genet.
233:355-362[Medline].
|
| 17.
|
Kobayashi, T., and T. Horiuchi.
1996.
A yeast gene product, Fob1 protein, required for both replication fork blocking and recombinational hotspot activities.
Genes Cells
1:465-474[Abstract].
|
| 18.
|
Kuzminov, A.
1995.
Instability of inhibited replication forks in E. coli.
Bioessays
17:733-741[CrossRef][Medline].
|
| 19.
|
Lin, Y.-H., and R. L. Keil.
1991.
Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast.
Genetics
127:31-38[Abstract].
|
| 20.
|
Linskens, M. H., and J. A. Huberman.
1988.
Organization of replication of ribosomal DNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:4927-4935[Abstract/Free Full Text].
|
| 21.
|
Little, R. D.,
T. H. Platt, and C. L. Schildkraut.
1993.
Initiation and termination of DNA replication in human rRNA genes.
Mol. Cell. Biol.
13:6600-6613[Abstract/Free Full Text].
|
| 22.
|
Lopez-Estrano, C.,
J. B. Schvartzman, and P. Hernandez.
1997.
The replication of ribosomal RNA genes in eukaryotes.
Chromosomes Today
12:149-169.
|
| 23.
|
Lopez-Estrano, C.,
J. B. Schvartzman,
D. B. Krimer, and P. Hernandez.
1998.
Co-localization of polar replication fork barriers and rRNA transcription terminators in mouse rDNA.
J. Mol. Biol.
277:249-256[CrossRef][Medline].
|
| 24.
|
Lopez-Estrano, C.,
J. B. Schvartzman,
D. B. Krimer, and P. Hernandez.
1999.
Characterization of the pea rDNA replication fork barrier: putative cis-acting and trans-acting factors.
Plant Mol. Biol.
40:99-110[CrossRef][Medline].
|
| 25.
|
Lucchini, R., and J. M. Sogo.
1994.
Chromatin structure and transcriptional activity around the replication forks arrested at the 3' end of the yeast rRNA genes.
Mol. Cell. Biol.
14:318-326[Abstract/Free Full Text].
|
| 26.
|
Michel, B.,
S. D. Ehrlich, and M. Uzest.
1997.
DNA double-strand breaks caused by replication arrest.
EMBO J.
16:430-438[CrossRef][Medline].
|
| 27.
|
Morrow, B. E.,
S. P. Johnson, and J. R. Warner.
1989.
Proteins that bind to the yeast rDNA enhancer.
J. Biol. Chem.
264:9061-9068[Abstract/Free Full Text].
|
| 28.
|
Newlon, C. S.,
I. Collins,
A. Dershowitz,
A. M. Deshpande,
S. A. Greenfeder,
L. Y. Ong, and J. F. Theis.
1993.
Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae.
Cold Spring Harbor Symp. Quant. Biol.
58:415-423[Abstract/Free Full Text].
|
| 29.
|
Reeder, R. H.
1999.
Regulation of RNA polymerase I transcription in yeast and vertebrates.
Prog. Nucleic Acid Res. Mol. Biol.
62:293-327[Medline].
|
| 30.
|
Reynolds, A. E.,
R. M. McCarroll,
C. S. Newlon, and W. L. Fangman.
1989.
Time of replication of ARS elements along yeast chromosome III.
Mol. Cell. Biol.
9:4488-4494[Abstract/Free Full Text].
|
| 30a.
|
Rothstein, R., and S. Gangloff.
1999.
The shuffling of a mortal coil.
Nat. Genet.
22:4-6[CrossRef][Medline].
|
| 31.
|
Rothstein, R.,
B. Michel, and S. Gangloff.
2000.
Replication fork pausing and recombination, or "gimme a break."
Genes Dev.
14:1-10[Free Full Text].
|
| 32.
|
Sanchez, J. A.,
S. M. Kim, and J. A. Huberman.
1998.
Ribosomal DNA replication in the fission yeast, Schizosaccharomyces pombe.
Exp. Cell Res.
238:220-230[CrossRef][Medline].
|
| 33.
|
Seligman, L., and C. Manoil.
1994.
An amphipathic sequence determinant of membrane protein topology.
J. Biol. Chem.
269:19888-19896[Abstract/Free Full Text].
|
| 34.
|
Stewart, S. E., and G. S. Roeder.
1989.
Transcription by RNA polymerase I stimulates mitotic recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:3464-3472[Abstract/Free Full Text].
|
| 35.
|
Voelkel-Meiman, K.,
R. L. Keil, and G. S. Roeder.
1987.
Recombination-stimulating sequences in yeast ribosomal DNA correspond to sequences regulating transcription by RNA polymerase I.
Cell
48:1071-1079[CrossRef][Medline].
|
| 36.
|
Wiesendanger, B.,
R. Lucchini,
T. Koller, and J. M. Sogo.
1994.
Replication fork barriers in the Xenopus rDNA.
Nucleic Acids Res.
22:5038-5046[Abstract/Free Full Text].
|
| 37.
|
Yue, M.,
K. P. Reischmann, and G. M. Kapler.
1998.
Conserved cis- and trans-acting determinants for replication initiation and regulation of replication fork movement in tetrahymenid species.
Nucleic Acids Res.
26:4635-4644[Abstract/Free Full Text].
|
| 38.
|
Zhang, Z.,
D. M. Macalpine, and G. M. Kapler.
1997.
Developmental regulation of DNA replication: replication fork barriers and programmed gene amplification in Tetrahymena thermophila.
Mol. Cell. Biol.
17:6147-6156[Abstract/Free Full Text].
|
Molecular and Cellular Biology, July 2000, p. 4948-4957, Vol. 20, No. 13
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
James, S. A., O'Kelly, M. J.T., Carter, D. M., Davey, R. P., van Oudenaarden, A., Roberts, I. N.
(2009). Repetitive sequence variation and dynamics in the ribosomal DNA array of Saccharomyces cerevisiae as revealed by whole-genome resequencing. Genome Res
19: 626-635
[Abstract]
[Full Text]
-
Mohanty, B. K., Bairwa, N. K., Bastia, D.
(2009). Contrasting Roles of Checkpoint Proteins as Recombination Modulators at Fob1-Ter Complexes with or without Fork Arrest. Eukaryot Cell
8: 487-495
[Abstract]
[Full Text]
-
Mirkin, E. V., Mirkin, S. M.
(2007). Replication Fork Stalling at Natural Impediments. Microbiol. Mol. Biol. Rev.
71: 13-35
[Abstract]
[Full Text]
-
Mohanty, B. K., Bairwa, N. K., Bastia, D.
(2006). The Tof1p-Csm3p protein complex counteracts the Rrm3p helicase to control replication termination of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA
103: 897-902
[Abstract]
[Full Text]
-
Ganley, A. R. D., Hayashi, K., Horiuchi, T., Kobayashi, T.
(2005). Identifying gene-independent noncoding functional elements in the yeast ribosomal DNA by phylogenetic footprinting. Proc. Natl. Acad. Sci. USA
102: 11787-11792
[Abstract]
[Full Text]
-
Calzada, A., Hodgson, B., Kanemaki, M., Bueno, A., Labib, K.
(2005). Molecular anatomy and regulation of a stable replisome at a paused eukaryotic DNA replication fork. Genes Dev.
19: 1905-1919
[Abstract]
[Full Text]
-
Duggin, I. G., Matthews, J. M., Dixon, N. E., Wake, R. G., Mackay, J. P.
(2005). A Complex Mechanism Determines Polarity of DNA Replication Fork Arrest by the Replication Terminator Complex of Bacillus subtilis. J. Biol. Chem.
280: 13105-13113
[Abstract]
[Full Text]
-
Serizawa, N., Horiuchi, T., Kobayashi, T.
(2004). Transcription-mediated hyper-recombination in HOT1. GENES CELLS
9: 305-315
[Abstract]
[Full Text]
-
Sanchez-Gorostiaga, A., Lopez-Estrano, C., Krimer, D. B., Schvartzman, J. B., Hernandez, P.
(2004). Transcription Termination Factor reb1p Causes Two Replication Fork Barriers at Its Cognate Sites in Fission Yeast Ribosomal DNA In Vivo. Mol. Cell. Biol.
24: 398-406
[Abstract]
[Full Text]
-
Kobayashi, T.
(2003). The Replication Fork Barrier Site Forms a Unique Structure with Fob1p and Inhibits the Replication Fork. Mol. Cell. Biol.
23: 9178-9188
[Abstract]
[Full Text]
-
Falcon, A. A., Aris, J. P.
(2003). Plasmid Accumulation Reduces Life Span in Saccharomyces cerevisiae. J. Biol. Chem.
278: 41607-41617
[Abstract]
[Full Text]
-
Huang, J., Moazed, D.
(2003). Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing. Genes Dev.
17: 2162-2176
[Abstract]
[Full Text]
-
Takeuchi, Y., Horiuchi, T., Kobayashi, T.
(2003). Transcription-dependent recombination and the role of fork collision in yeast rDNA. Genes Dev.
17: 1497-1506
[Abstract]
[Full Text]
-
Benguria, A., Hernandez, P., Krimer, D. B., Schvartzman, J. B.
(2003). Sir2p suppresses recombination of replication forks stalled at the replication fork barrier of ribosomal DNA in Saccharomyces cerevisiae. Nucleic Acids Res
31: 893-898
[Abstract]
[Full Text]
-
Pasero, P., Bensimon, A., Schwob, E.
(2002). Single-molecule analysis reveals clustering and epigenetic regulation of replication origins at the yeast rDNA locus. Genes Dev.
16: 2479-2484
[Abstract]
[Full Text]
-
Wai, H., Johzuka, K., Vu, L., Eliason, K., Kobayashi, T., Horiuchi, T., Nomura, M.
(2001). Yeast RNA Polymerase I Enhancer Is Dispensable for Transcription of the Chromosomal rRNA Gene and Cell Growth, and Its Apparent Transcription Enhancement from Ectopic Promoters Requires Fob1 Protein. Mol. Cell. Biol.
21: 5541-5553
[Abstract]
[Full Text]
-
Michel, B., Flores, M.-J., Viguera, E., Grompone, G., Seigneur, M., Bidnenko, V.
(2001). Rescue of arrested replication forks by homologous recombination. Proc. Natl. Acad. Sci. USA
98: 8181-8188
[Abstract]
[Full Text]
-
Kobayashi, T., Nomura, M., Horiuchi, T.
(2001). Identification of DNA cis Elements Essential for Expansion of Ribosomal DNA Repeats in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 136-147
[Abstract]
[Full Text]