Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 4990-4999, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Naturally Occurring Dicistronic Cricket Paralysis
Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Joan E.
Wilson,1
Marguerite J.
Powell,1
Susan E.
Hoover,2 and
Peter
Sarnow1,*
Department of Microbiology and Immunology,
Stanford University School of Medicine, Stanford, California
94305,1 and Department of Biochemistry
and Molecular Genetics, University of Colorado Health Sciences
Center, Denver, Colorado 802622
Received 2 February 2000/Returned for modification 28 March
2000/Accepted 7 April 2000
 |
ABSTRACT |
Cricket paralysis virus is a member of a group of insect
picorna-like viruses. Cloning and sequencing of the single plus-strand RNA genome revealed the presence of two nonoverlapping open reading frames, ORF1 and ORF2, that encode the nonstructural and structural proteins, respectively. We show that each ORF is preceded by one internal ribosome entry site (IRES). The intergenic IRES is located 6,024 nucleotides from the 5' end of the viral RNA and is more active
than the IRES located at the 5' end of the RNA, providing a mechanistic
explanation for the increased abundance of structural proteins relative
to nonstructural proteins in infected cells. Mutational analysis of
this intergenic-region IRES revealed that ORF2 begins with a noncognate
CCU triplet. Complementarity of this CCU triplet with sequences in the
IRES is important for IRES function, pointing to an involvement of
RNA-RNA interactions in translation initiation. Thus, the cricket
paralysis virus genome is an example of a naturally occurring,
functionally dicistronic eukaryotic mRNA whose translation is
controlled by two IRES elements located at the 5' end and in the middle
of the mRNA. This finding argues that eukaryotic mRNAs can express
multiple proteins not only by polyprotein processing, reinitiation and
frameshifting but also by using multiple IRES elements.
 |
INTRODUCTION |
Cricket paralysis virus (CrPV) was
isolated in 1970 by Carl Reinganum (47), who observed that
laboratory colonies of Australian field crickets (Teleogryllus
oceanicus and T. commodus) contained some early-instar
nymphs which developed a paralysis of the hind legs, became
uncoordinated, and died. Electron microscopic sections of paralyzed
insects revealed many virus-like particles in crystalline arrays
reminiscent of those observed in picornavirus-infected cells. Although
originally isolated from crickets, CrPV has a wide host range,
infecting insects which belong to Diptera, Lepidoptera, Orthoptera, and Heteroptera species (8). Importantly, it
also replicates in cultured cells from various insect species including Drosophila SL2 cells (37, 55).
More recently, CrPV has been classified as a member of a group of
insect picorna-like viruses which also includes Drosophila C virus
(DCV) (24), Plautia stali intestine virus (PSIV)
(53), himetobi P virus (HiPV) (40), and
Rhopalosiphum padi virus (RhPV) (36). Insect
picorna-like viruses share with mammalian picornaviruses many physical
and morphological properties of the viral structural proteins
(37, 56, 59), and the presence of a single plus-strand RNA genome with a genome-linked protein at the 5' end (25)
and polyadenosine residues at the 3' end (9). In contrast to
earlier reports (26), recent cloning and sequencing of
several insect picorna-like viruses has revealed that the organization
of these viral genomes differs from that of human picornaviruses
(8, 28). Specifically, picornavirus RNA genomes consist of a
single open reading frame (ORF) encoding a polyprotein which is
posttranslationally processed to give rise to both structural (encoded
in the N-terminal part of the polyprotein) and nonstructural viral
proteins (49). In contrast, certain insect picorna-like
virus genomes encode two distinct polyproteins. In these genomes, the
polyprotein precursors to the nonstructural viral proteins are encoded
by the upstream ORF (ORF1), while the structural protein precursors are
encoded by the downstream ORF (ORF2) (24, 36, 40, 53).
Furthermore, it has been noted that structural proteins accumulate in
vast excess over nonstructural proteins in cells infected with such insect picorna-like viruses (37, 38). In contrast, cells
infected with human picornaviruses produce equimolar amounts of
structural and nonstructural proteins (49). The differential
expression of the two insect virus polyproteins from a single mRNA
has led to the suggestion that the two ORFs might be under independent translational control. By analogy to picornavirus polyproteins, which
are known to be translated by an internal initiation mechanism, we
speculated that both ORFs in picorna-like virus mRNAs might be
translated by internal initiation. Consistent with this idea, ORF2 in
the PSIV RNA genome is translated cap independently in the rabbit
reticulocyte lysate (RRL) (52).
Here we show that the CrPV RNA genome encodes two large, nonoverlapping
ORFs with viral nonstructural and structural polyprotein precursors
encoded by the upstream and downstream ORFs, respectively. Each ORF is
preceded by an internal ribosome entry site (IRES), demonstrating that
the CrPV RNA genome is a naturally occurring eukaryotic RNA that is
functionally dicistronic. Mutational analysis of the downstream
IRES has revealed that the first three nucleotides in the CrPV
downstream ORF are CCU, which differs from the canonical AUG start
codon at all three positions. This finding, together with the fact that
complementarity of the CCU codon with an upstream sequence in the IRES
must be maintained to preserve IRES function, suggests an unusual
mechanism of translation initiation mediated by the intragenic region
(IGR) of CrPV.
 |
MATERIALS AND METHODS |
Viruses and cells.
A CrPV stock was originally obtained from
Chris Hellen and Eckard Wimmer (State University of New York at Stony
Brook, Stony Brook, N.Y.). By comparison to genomic sequences of
several independent CrPV isolates kindly provided by Peter Christian
(Commonwealth Scientific and Industrial Research Organisation,
Canberra, Australia), the CrPV isolate used in this study was similar
to one isolated from Telegryllus commodus, Victoria,
Australia (23). Viruses were propagated in cultured
Drosophila Schneider's line 2 (SL2) cells. For infection,
the medium was removed and the cells were overlaid with 150 to 250 µl
of virus suspension per flask of 6 × 106 cells. After
1 h, the cells were overlaid with 4.5 ml of Schneider's Drosophila medium containing 2% serum. The cells were harvested 48 h after infection by sedimentation, and virus was released by
repeated cycles of freezing and thawing.
Cloning and sequencing of the CrPV genome.
Total RNA was
prepared from mock- and CrPV-infected SL2 cells by using the
guanidinium method (2). RNA was resuspended in TES solution
(10 mM Tris-HCl [pH 7.4], 5 mM EDTA, 1% sodium dodecyl sulfate
[SDS]), precipitated twice with 0.3 M sodium acetate (pH
5.2)-ethanol, resuspended in water, and stored at
20°C.
First-strand cDNA, representing the 3' end of the viral genome, was
produced using an anchored oligo(dT) primer whose 3' sequences were
complementary to the published 3'-end sequence of CrPV (26). Reverse transcription was carried out in a reaction mixture containing 20 mM Tris-HCl (pH 8.3), 20 mM KCl, 6 mM MgCl2, 10 mM
dithiothreitol, 0.5 mM each deoxynucleoside triphosphate (dNTP), 80 µg of actinomycin D per ml, 2 µg of RNA, 3 pmol of DNA primer, and
either 0.1 U of avian myeloblastosis virus reverse transcriptase (Life
Sciences Inc.) per µl or 9.5 U of Superscript reverse transcriptase
(Gibco/BRL) per µl. One-eighth of each reverse transcription product
was used for PCR amplification with Vent polymerase (New England
Biolabs). The reaction mixtures contained 1× ThermoPol buffer (New
England Biolabs), 0.2 mM each dNTP, and 20 µmol of primers selected
based on published 3'-end sequences (26). The remainder of
the viral genome was cloned and sequenced by sequential application of
the 5' rapid amplification of cDNA ends method (11) with
reagents purchased from Gibco/BRL. Reverse transcription was carried
out in reaction mixtures containing 20 mM Tris-Cl (pH 8.4), 50 mM KCl,
3 mM MgCl2, 10 mM DTT, 0.4 mM each dNTP, 0.5 µg of RNA,
2.5 pmol of cDNA primer, and 8 U of Superscript II reverse
transcriptase per µl. First-strand cDNA was purified on Glassmax spin
columns (Gibco/BRL), and one-fifth of the total product was used for dC tailing. Tailing reaction mixtures contained 10 mM Tris-HCl (pH 8.4),
25 mM KCl, 1 mM MgCl2, 0.2 mM dCTP, and 0.4 U of terminal deoxynucleotidyltransferase per µl. One-fifth of the tailed product was used for PCR amplification in reaction mixtures containing 20 mM
Tris-Cl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each
dNTP, 100 to 400 nM each primer, and 0.04 U of Taq DNA
polymerase (Promega) per µl. Amplification reactions were performed
under the following conditions: 94°C for 1 min, 50°C for 0.5 to 1 min, and 72°C for 2 to 3 min for 35 cycles, followed by 10 min at
72°C. Amplified DNA products were purified and inserted into pGEM-3
(Promega). Automated sequencing was performed by Macromolecular
Resources (Fort Collins, Colo.) and by the PAN facility at Stanford
University (Stanford, Calif.).
Cloning of the 5'NCR and IGR of CrPV.
The 5' noncoding
region (5'NCR) of CrPV was obtained by PCR using primers
5'AGAATTCTTTAATAAGTGTTGTGCAGATTAATCTGCACAGCACTAGCC3', which
includes nucleotides 1 to 41 of the viral genome, and
5'GCCATGGTCACATTGTAAGAATCGGTTACTCC3', which is complementary
to nucleotides 682 to 706 of the viral genome. For amplification of the
IGR, primers 5'CGGAATTCAAAGCAAAAATGTGATCTTGCTT3' (nucleotides 6025 to 6047 of the CrPV genome) and
5'CATGCCATGGTATCTTGAAATGTAGCAGGTAAA3' (complementary to
nucleotides 6210 to 6232) were used; these 5' and 3' primers contained
EcoRI and NcoI restriction sites, respectively.
PCR was performed using the Advantage cDNA PCR kit (Clontech), and PCR
products were cloned directly into the pCR2.1 cloning vector (Invitrogen). Stop codons and nucleotide insertions were introduced into the IGR by PCR using altered 3' primers carrying the desired mutations, listed in Table 1. The
complete nucleotide sequences of all PCR-amplified fragments were
confirmed by DNA sequencing.
Construction of dicistronic luciferase reporter constructs.
The pCR2.1 vectors containing the desired CrPV fragments (see above)
were digested with EcoRI and NcoI; the resulting
EcoRI-NcoI fragments were subcloned into the
intercistronic region of a dicistronic luciferase reporter construct,
described previously (22). For transcription in vitro,
dicistronic luciferase constructs were digested with BamHI
and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX
protocol (Promega) as described previously (17).
Dicistronic vectors containing the IGR linked to its natural coding
region were constructed as follows. First, a
BglII-
PstI
restriction fragment corresponding to
nucleotides 5919 to 8571
of the CrPV genome (i.e., IGR-ORF2) was cloned
into pGEM3 (Promega),
which was digested with
BamHI and
PstI. Subsequently, an
EcoRI-
XbaI
restriction fragment derived from a dicistronic luciferase construct
containing the wild-type encephalomyocarditis virus (EMCV) IRES
fused
in frame to Fluc, or an
XhoI-
XbaI restriction
fragment containing
the

EMCV sequences upstream of Fluc, was cloned
into the
SmaI
site of pGEM3 upstream of the inserted
IGR-CrPV sequences to yield
plasmids T7 EMCV/Fluc-IGR/CrPVORF2 and T7

EMCV/Fluc-IGR/CrPVORF2,
respectively. For in vitro transcription,
these dicistronic constructs
were digested with
HindIII.
For expression in insect cells, dual luciferase constructs containing
no inserted sequences, the 5'NCR, or the IGR were digested
with
HindIII and
BamHI and the dicistronic
fragments were inserted
into the polylinker of pRmHa3, a vector
containing the copper-inducible
promoter of the
Drosophila
metallothionein gene (
7).
In vitro translation.
Uncapped dicistronic RNAs were
translated in the RRL or the wheat germ extract (Promega), as
recommended, in the presence of 154 mM potassium acetate. Products of
translation reactions were measured enzymatically using the dual
luciferase reporter assay system (Promega) or by incorporation of
[35S]methionine-[35S]cysteine (1175 Ci/mmol; New England Nuclear) followed by SDS-polyacrylamide gel
electrophoresis and fluorography.
DNA and RNA transfections.
Transfections of simian virus 40 promoter-containing plasmids were performed using the lipofectin
(GIBCO/BRL) reagent. Briefly, SL2 cells were plated at 4 × 106 cells per 60-mm plate and transfected using 4 µg of
DNA mixed with 20 µl of Lipofectin. Serum-containing medium was added
after 24 h, and extracts were prepared after 72 h. Cells were
pelleted, resuspended in 50 µl of passive lysis buffer (Promega), and
lysed by applying three freezing-thawing cycles. Cellular debris were sedimented, and 20 µl of the soluble extract was assayed using dual
luciferase assay reagents.
Transfections of metallothionein promoter-containing plasmids were
performed as described above, except that the promoter
was induced
12 h after transfection by addition of 0.5 mM cupric
sulfate to
the medium. The cells were harvested 48 h
later.
For RNA transfections, 3 × 10
6 SL2 cells were plated
per 35-mm dish and incubated overnight. The cells were washed once
using
serum-free medium. Then 400 or 800 ng of capped RNA was mixed
with 40 µl of lipofectin and transfected into cells as specified
by
the manufacturer, and the cells were harvested after 3 to 4
h. The
cells were washed in phosphate-buffered saline, sedimented,
resuspended
in 50 µl of passive lysis buffer, and processed for
dual luciferase
measurements as described
above.
Northern analysis.
Total RNA was extracted from cells using
the Trizol reagent as recommended (GIBCO/BRL). Poly(A)-containing RNA
was selected using the Oligotex mRNA kit (Qiagen). RNA was
quantitated by spectrophotometry, and 10 µg of poly(A) RNA was
separated in formaldehyde-containing agarose gels. Radiolabeled probes
were generated using the RadRrime kit (GIBCO/BRL). Hybridization was
carried out in ExpressHyb solution (Clontech) as recommended.
Nucleotide sequence accession number.
The sequence data have
been submitted to GenBank under accession no. AF218039.
 |
RESULTS |
CrPV contains a dicistronic RNA genome whose organization is
similar to that of other insect picorna-like viruses.
We have
constructed a full-length cDNA copy of the CrPV RNA genome and have
determined its nucleotide sequence. Analysis of data predicted a genome
organization (Fig. 1A) which is conserved among the insect picorna-like viruses (24, 36, 40, 53). In
contrast to picornavirus genomes, which encode a single polyprotein, the CrPV genome contains two large ORFs separated by a 189-nucleotide IGR (Fig. 1A). As in picornavirus genomes, the 5'NCR preceding the
upstream ORF (ORF1) is burdened with many AUG codons followed by
numerous stop codons in all three reading frames. Comparative analysis
of amino acid sequence motifs suggests that ORF1 of CrPV encodes
proteins with RNA helicase (32, 54), 3C-like proteinase (57), and RNA-dependent RNA polymerase (27, 42)
activities with amino acid identities of 19, 14, and 20%,
respectively, to the hepatitis A virus proteins and with identities of
65, 53, and 68%, respectively, to the Drosophila C virus proteins
(data not shown). Recently, partial sequence analysis and crystal
structure determination of CrPV has mapped the structural proteins to
the downstream ORF (ORF2) (59). Therefore, unlike in
picornavirus genomes, the structural proteins are encoded from a second
ORF located at the 3' end of the viral genome.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
Properties of the CrPV RNA genome. (A) Schematic of the
general organization of the CrPV genome. Lines and boxes designate
untranslated and translated portions of the viral RNA, respectively.
IGR denotes the region which separates ORF1 and ORF2. The positions, in
nucleotides, of the start and stop codons of each ORF are indicated.
The initiation and termination codons of each ORF, as predicted by
conceptual translation of the viral RNA using DNA Strider or determined
experimentally (see Results), are shown. (B) CrPV contains a single
plus-strand RNA genome. Northern blot analysis of poly(A)-containing
RNA isolated from mock- or CrPV-infected SL2 cells, using a
hybridization probe that was specific to viral RNA, is shown. The
migration of RNA molecular size standards (in kilobases) is shown at
left.
|
|
The predicted dicistronic genome organization argues that ORF2 was
translated (i) from a subgenomic mRNA species, (ii) from
ribosomes that
failed to terminate at the stop codon of ORF1 (readthrough
mechanism),
(iii) from ribosomes that initially entered the genomic
mRNA at the 5'
end but were subsequently transferred to ORF2 (shunting
mechanism), or
(iv) by a second downstream IRES. Because only
a single
polyadenylated viral mRNA species could be detected in
CrPV-infected cells (Fig.
1B) (
39), the structural proteins
are likely to be translated from the genomic RNA, excluding only
the
first
possibility.
The CrPV genome contains two IRES elements.
To examine the
translation of the CrPV mRNA, cultured Drosophila SL2 cells
were infected with CrPV and pulse-labeled with [35S]methionine-[35S]cysteine at different
times after infection. As can be seen in Fig.
2, translation of host cell mRNAs was
inhibited by approximately 3 h after infection. However, viral
mRNA was still efficiently translated between 3 and 5 h after
infection, suggesting that viral mRNA can compete with cellular mRNAs
for the translation apparatus or that viral mRNA is translated by a
mechanism that escapes the translational inhibition experienced by the
cellular mRNAs. These scenarios are reminiscent of events that take
place in picornavirus-infected cells, in which the eukaryotic
translation initiation factors eIF-4G or the eIF-4E-binding proteins
are degraded or modified, respectively (10, 15), resulting
in the inhibition of cap-dependent translation of cellular mRNAs but
allowing translation of IRES-containing viral mRNAs. In contrast to
picornavirus-infected cells, CrPV-infected cells produced viral
structural proteins, migrating between 29,000 and 43,000 Da (Fig. 2),
in supramolecular excess over nonstructural proteins (37, 38,
49).

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of CrPV proteins in infected cells. SL2 cells
were infected with CrPV at a multiplicity of infection of 100 PFU per
cell and, at the indicated times (in hours) after infection, labeled
with [35S]methionine for 10 min. Labeled extracts from
mock-infected cells (M) and cells infected for 6 h (I) are shown
on the right. Soluble extracts were prepared (50) and
analyzed in SDS-polyacrylamide gels. An autoradiograph of the gel is
shown. The migration of proteins with known molecular masses (in
kilodaltons) is shown on the left.
|
|
We wished to examine whether ORF1 and ORF2 in CrPV RNA were each
preceded by IRES elements that could independently regulate
the
translation of ORF1 and ORF2. The cDNA sequences encoding
the 5'NCR
(nucleotides 1 to 709) or the IGR (nucleotides 6022
to 6232) of CrPV
were inserted between the
Renilla luciferase
(Rluc) and
firefly luciferase (Fluc) coding regions in expression
plasmids (Fig.
3A) that can direct the synthesis of
dicistronic
mRNAs either in tissue culture cells, using the simian
virus 40
promoter, or in vitro, using the promoter for T7 RNA
polymerase
(
22). A landscape of RNA structures (

EMCV) was
inserted between
the two cistrons to prevent translation of the
downstream ORF
from reinitiation or readthrough of ribosomes
(
44) which had
traversed the first Rluc cistron
(
22). Expression plasmids that
contained the CrPV IGR
sequences, the CrPV 5'NCR sequences, or
no inserted sequences were
transfected into SL2 cells, and the
accumulation of the translation
products from both cistrons was
monitored by an enzymatic luciferase
assay. Figure
3B shows that
dicistronic mRNAs containing the viral
5'NCR and the IGR in the
intercistronic spacer region allowed the
accumulation of the translation
product of the second cistron, Fluc, to
approximately 10- and
25-fold-higher levels, respectively, than did
control dicistronic
mRNAs. Northern analysis showed that the size
and integrity of
all intracellularly expressed dicistronic mRNAs
remained intact
(data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Accumulation of translation products encoded by plasmids
expressing dicistronic mRNAs that contain the CrPV 5'NCR or the CrPV
IGR in the intercistronic spacer region in cultured cells. (A) Diagram
of the dual luciferase dicistronic construct. The locations of
promoters for RNA polymerase II (simian virus 40 [SV40]) and for T7
RNA polymerase (T7) and sequences mediating polyadenylation [SV40 Late
Poly(A) Signal] are indicated. Rluc and Fluc encode Renilla
luciferase and firefly luciferase, respectively. EMCV designates the
cDNA that encodes highly structured RNA sequences to prevent
translational readthrough or reinitiation (see Materials and Methods).
The shaded triangle, labeled Insert, indicates the position at which
the CrPV 5'NCR or CrPV IGR sequences were inserted. (B) The viral 5'NCR
and IGR mediate the translation of second cistrons in dicistronic
mRNAs. Luciferase activities in extracts from SL2 cells, transfected
with expression vectors that contain no added insertion or insertions
of the viral 5'NCR or the viral IGR in the intergenic spacer region
(see panel A), are displayed. The ratio of relative luciferase activity
represents the Fluc/Rluc ratios in reference to the construct with no
insert, whose Fluc/Rluc ratio was set to 1. The mean values from three
independent experiments are shown. Error bars indicate standard
deviations.
|
|
To address the concern that splicing or cryptic promoter activities in
the inserted viral cDNAs generated minor mRNA species
that lacked the
upstream Rluc cistron and could therefore mediate
translation of the
second cistron, Fluc, by a 5'-end-dependent
mechanism, capped
dicistronic mRNAs were synthesized in vitro
by T7 RNA polymerase and
transfected into SL2 cells. The synthesis
of Rluc and Fluc was examined
using enzymatic assays. The results
in Fig.
4 show that both the viral 5'NCR and the
viral IGR mediated
translation of the second cistron of dicistronic
RNAs, transfected
into cultured cells, with an efficiency similar to
that observed
in the DNA transfection experiments in Fig.
3.
Interestingly,
in embryo and ovary extracts from
Drosophila
melanogaster, the
IGR IRES functions with an efficiency similar to
that of the
Drosophila Antennapedia IRES (Y. S. Lie and P. M. Macdonald, personal communication).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
Accumulation of translation products of dicistronic
mRNAs that contain the CrPV 5'NCR or the CrPV IGR in the intercistronic
spacer region in cultured cells. Shown are the ratios of relative
luciferase activities in SL2 cells which were transfected with in
vitro-synthesized dicistronic mRNAs (see the legend to Fig. 3B).
|
|
To test the possibility that ribosomal subunits could have been
tethered from the 5' end of the dicistronic mRNA to the 5'NCR
IRES
sequences (
13,
61), entry of ribosomal subunits to the
5'
end of the dicistronic mRNAs was blocked by the insertion of
a
landscape of RNA structures. Translation of dicistronic mRNAs
that
contained either an active EMCV IRES (EMCV) or RNA structures
that do
not function as an IRES (

EMCV) preceding the first cistron
was
monitored in the RRL. Figure
5 shows that
the presence of
RNA structures (

EMCV) upstream of the Rluc cistron
abolished
the synthesis of Rluc protein (compare columns 1 to 3 with
columns
4 to 6). In contrast, translation of the second cistron
mediated
by the 5'NCR of CrPV was not inhibited in the latter RNAs
(columns
4 to 6).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Translation of dicistronic mRNAs containing the viral
5'NCR in the intercistronic spacer region in the RRL. RNAs containing
an active (EMCV) or inactive ( EMCV) EMCV IRES preceding the first
cistron in the dicistronic mRNAs (top) were translated at 5 ng/µl
(columns 1 and 4), 10 ng/µl (columns 2 and 5), or 20 ng/µl (columns
3 and 6) in the RRL. The average Renilla light units (A) and
firefly luciferase light units (B) of three independent experiments are
shown.
|
|
Similar experiments were performed to determine whether the CrPV IGR
could confer translational initiation of a second cistron
independently
of the translation of the first cistron in a dicistronic
mRNA. In this
case, the second cistron of the dicistronic mRNAs
contained a truncated
ORF2 of CrPV linked to its naturally preceding
IGR element (Fig.
6). In RNAs that contained the EMCV IRES
upstream
of the first cistron Fluc, both translation products were
synthesized,
although the EMCV IRES mediated more efficient translation
than
did the IGR (lanes 1 and 2). Replacing the EMCV IRES with the

EMCV element as leader of Fluc completely abolished the synthesis
of
Fluc (lanes 3 and 4). However, the synthesis of ORF2 was slightly
increased under these conditions (lanes 3 and 4), supporting the
hypothesis that the IGR element functions as an IRES and not as
a
sequence element which allows reinitiation or promotes the shunting
of
ribosomal subunits. These data indicate that both the 5'NCR
and the IGR
sequences in the CrPV genome contain IRES activities
that function both
in cultured cells and in the RRL. Moreover,
under all experimental
conditions examined so far, the IGR IRES
was more active than the 5'NCR
IRES; however, the IGR IRES was
approximately threefold less active
than the well-characterized
EMCV IRES in the RRL (data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Translation of dicistronic mRNAs containing the viral
IGR in the intercistronic spacer region in the RRL. RNAs containing an
active (EMCV) or inactive ( EMCV) encephalomyocarditis IRES preceding
the first cistron in dicistronic Fluc-IGR-CrPV ORF2 mRNAs (top) were
translated in the RRL in the presence of
[35S]methionine-[35S]cysteine. Translation
products were visualized after SDS-polyacrylamide gel electrophoresis.
An autoradiograph of the gel is shown. Lanes 1 and 2 show the reaction
products initiated with 10 and 20 ng of EMCV-containing dicistronic
RNAs per µl, respectively. Lanes 3 and 4 show the translation
products produced in reactions containing 10 and 20 ng of
EMCV-containing dicistronic RNAs per µl, respectively. The
migration of protein molecular mass standards is indicated at left in
kilodaltons. The positions of the CrPV ORF2 and Fluc proteins are
indicated by arrows.
|
|
The IGR IRES functions in wheat germ extracts.
Although
translation of capped mRNAs ensues efficiently in wheat germ
translation extracts, no IRES has been shown to be functional in this
translation system (21). Because the CrPV IRES elements were
evolutionarily divergent from IRES elements present in mammalian RNA
viruses or vertebrate mRNAs, we tested whether the CrPV IRES elements
were active in wheat germ extracts. Different amounts of in
vitro-transcribed, dicistronic mRNAs lacking or containing the two CrPV
IRES elements in the intercistronic spacer region were translated in
the wheat germ extracts, and luciferase synthesis was monitored by
incorporation of radiolabeled amino acids. While the CrPV 5'NCR IRES
was not active in this translation system (data not shown), the CrPV
IGR IRES stimulated Fluc translation 40-fold at the highest RNA
concentration tested relative to the control dicistronic RNA containing
no inserted sequences (Fig. 7). This
finding shows that the wheat germ extract is capable of mediating
internal initiation on at least the CrPV IGR.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
Translation of dicistronic mRNAs containing the viral
IGR in the intercistronic spacer region in the wheat germ lysate. The
RNAs described in Fig. 3 were translated in the presence of
[35S]methionine-[35S]cysteine in wheat germ
extracts at a final concentration of 5 ng/µl (lanes 1 and 4), 10 ng/µl (lanes 2 and 5), or 20 ng/µl (lanes 3 and 6). Dicistronic
mRNAs that encoded Rluc in the first cistron and Fluc in the second
cistron, either lacking an IRES (lanes 1 to 3) or containing the IGR
IRES in the intercistronic spacer, were used in the translation assay.
Translation products were separated by SDS-polyacrylamide gel
electrophoresis, and an autoradiograph of the gel is shown. The
migration of protein molecular mass standards (in kilodaltons) and the
positions of the Fluc and Rluc proteins are indicated.
|
|
ORF2 begins with noncognate CCU triplet.
Inspection of the
predicted ORF2 failed to reveal any cognate AUG or weakly cognate GUG
or CUG codons that could be used as the initiation codon for ORF2; this
feature has been observed in the other picorna-like insect viruses DCV,
RhPV, PSIV and HiPV (24, 36, 40, 53). To determine the first
triplet of the CrPV ORF2, mRNAs which contained the IGR IRES linked to
the 5'-proximal codons in ORF2 were translated in the RRL, translation
products were purified, and N-terminal amino acids were determined by
microcapillary reverse-phase high-pressure liquid chromatography
nanoelectrospray tandem mass spectroscopy (Harvard Microchemistry
Facility). This analysis revealed that the N-terminal amino acid of
ORF2 was alanine, presumably encoded by GCU at nucleotides 6217 to
6219, suggesting that either the preceding codon, CCU, or the
GCU6217-6219 codon itself functions as start codon.
To address this question, a series of stop codon mutations was
systematically introduced into the CrPV IGR in the region spanning
nucleotides 6208 to 6231. All mutated CrPV IGR elements were tested
for
IRES activity in the RRL in the context of dual luciferase
dicistronic
mRNAs. Changing either the AAU codon at positions
6208 to 6210 or the
UUA codon at positions 6211 to 6213 to a nonsense
codon (Fig.
8A, IGRmut1 and IGRmut2) had no effect on
IGR activity
(Fig.
8B). In contrast, mutating the
CCU
6214-6216 or GCU
6217-6219 or any of the
next four downstream codons to a UAA nonsense codon
(Fig.
8A, IGRmut3
through IGRmut8) abolished IRES activity (Fig.
8B). The mutated IRES
elements could be inactive either because
the IRES structure was
disrupted or because a nonsense codon was
introduced into the coding
region, consistent with the notion
that either the
CCU
6214-6216 or the GCU
6217-6219 codon
is the
start site for translation.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
Translational activities of mutagenized CrPV IGR
elements. (A) Description of IGR stop codon insertions (IGRmut1 to
IGRmut8). (B) Dicistronic dual luciferase RNAs bearing IGR stop codon
mutations (IGRmut1 to IGRmut8) were translated in the RRL at a final
concentration of 20 ng/µl. The ratio of relative luciferase activity
was calculated as described in the legend to Fig. 3B. (C) Description
of IGR nucleotide insertions (IGRmut9 to IGRmut13). (D) The translation
of dicistronic RNAs bearing nucleotide insertions (IGRmut9 to IGRmut13)
was determined and is displayed as in panel B.
|
|
To distinguish whether the CCU
6214-6216 or the
GCU
6217-6219 codon was the initiation codon for the CrPV
ORF2,
1 to 3 nucleotides were inserted into the CrPV IGR at various
positions to alter the translational reading frame (Fig.
8C).
The
mutated IGR elements were tested for IRES activity in the
context of
dual luciferase RNAs as described above. Insertion
of 1 or 2 nucleotides immediately downstream of the GCU codon
(Fig.
8C, IGRmut9
and IGRmut10) eliminated the accumulation of
Fluc (Fig.
8D). However,
insertion of 3 nucleotides at the same
position (Fig.
8C, IGRmut11),
predicted to maintain the original
reading frame, restored Fluc
accumulation (Fig.
8D). Therefore,
the GCU codon is part of the CrPV
ORF2. Insertion of 2 nucleotides
immediately upstream of the GCU codon
(Fig.
8C, IGRmut12) eliminated
the accumulation of Fluc (Fig.
8D);
however, the insertion of
a single additional nucleotide downstream of
the GCU codon (Fig.
8C, IGRmut13) partially restored Fluc synthesis
(Fig.
8D). Therefore,
the 2-nucleotide insertion in IGRmut12 was
unlikely to abolish
translation via structural alteration of the IGR
IRES but, instead,
did so by disrupting the reading frame. These
results argue that
the CCU
6214-6216 is the first triplet
of the CrPV
ORF2.
The CCU triplet is part of an inverted-repeat sequence element
whose integrity is important for IRES activity.
A 5-nucleotide
inverted-repeat sequence previously noted in other insect picorna-like
viruses (Fig. 9) was also present in the
CrPV IGR; the length and the spacing between the repeated sequences
elements were conserved among the viral genomes (Fig. 9). Specifically,
nucleotides 6187 to 6191 of the CrPV IGR are complementary to
nucleotides 6212 to 6216. Conspicuously, CCU6214-6216 is
contained within one of the inverted-repeat elements (Fig. 9).
Furthermore, the two elements of the inverted repeat are located in
predicted loop regions of two adjacent hairpin structures, implying
possible tertiary interactions between the inverted-repeat elements. To
test a role of the conserved inverted repeat in IGR IRES activity, two
mutated IGR elements were constructed in which the inverted-repeat
sequences were altered. In IGRmut14 (Fig. 10A), the downstream half of the
inverted repeat was altered from UACCU6212-6216
to UAGGU6212-6216, destroying the predicted
complementarity of the inverted repeat. IGRmut15 (Fig. 10A) contains
the UACCU-to-UAGGU change of IGRmut14 along with
mutations that change the upstream repeat from
AGGUA6187-6191 to
ACCUA6187-6191; as a result, the
complementarity of the inverted repeat elements is restored. These
mutated IGRs were inserted into dual luciferase dicistronic RNAs, and
their translational efficiencies were compared to those of wild-type
IGR elements. All dicistronic mRNAs expressed the first Rluc cistron
with similar efficiency (Fig. 10B, lanes 1 to 4). Dicistronic mRNAs
lacking an IRES between the luciferase cistrons failed to mediate
translation of the second Fluc cistron (lane 1). The wild-type IGR
mediated the translation of Fluc (lane 2). Destruction of the
complementarity of the inverted repeat in IGRmut14 prevented
translation of the second Fluc cistron (lane 3); in contrast, the
compensatory mutations of IGRmut15 restored activation of Fluc
translation (lane 4). Quantitation by enzymatic assays (Fig. 10C)
showed that IGRmut15 restored translation to within 50% of that
seen with the wild-type IGR. Similar results were seen with IGR
elements in which UUACCU6211-6216 was changed
to GACUGA6211-6216, resulting in an inactive IGR; the activity of the mutated IGR could be restored by a
compensatory UCAGU6187-6191 mutation in the
GACUGA6211-6216-containing IGR (data not
shown). These results demonstrate that interaction between the
inverted-repeat sequences is essential for IGR IRES activity and,
furthermore, that certain variations of the sequence of the inverted
repeats may be tolerated if complementarity is maintained.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 9.
Nucleotide alignments between sequences surrounding the
beginning of ORF2 in CrPV (accession no. AF218039), DCV (accession no.
AF0014388), RhPV (accession no. AF0022937), PSIV (accession no.
AB006531), and HiPV (accession no. AB017037). A predicted
inverted-repeat element, conserved among those sequences, is
underlined. Amino acids labeled with an asterisk were identified as
N-terminal amino acids by sequence analysis. Codons highlighted in bold
were identified as start codons using mutational analyses.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 10.
Translational activities in the RRL of IGR IRES
elements with mutations in the inverted-repeat element. (A) Sequences
of wild-type IGR and mutated IGRmut14 and IGRmut15. (B) Translation of
dicistronic luciferase mRNAs containing no insert (lane 1), wild-type
IGR (lane 2), mutated IGRmut14 (lane 3), or IGRmut15 (lane 4) between
the first (Rluc) and second (Fluc) cistrons. RNAs were present at final
concentrations of 20 ng/µl. Radiolabeled translation products were
visualized after separation on SDS-polyacrylamide gels. An
autoradiograph of the gel is shown. The migration of protein molecular
mass standards (in kilodaltons) is indicated at left. The positions of
the Fluc and Rluc proteins are indicated by arrows. (C) Enzymatic
quantitation of the IRES translational efficiencies. Fold activation
represents the Fluc/Rluc ratios in reference to the construct with no
insert (lane ), whose Fluc/Rluc ratio was set to 1. The mean values
from three independent experiments are shown. Error bars show standard
deviations.
|
|
 |
DISCUSSION |
Polycistronic transcripts in eukaryotic cells.
Polycistronic
transcripts are commonly found in bacteria, in the protist trypanosome
and in the nematode Caenorhabditis elegans (5).
However, unlike bacterial transcripts, polycistronic transcripts in
trypanosomes (45) and C. elegans (30,
58) are processed by trans-splicing events
(41) that generate functionally monocistronic mRNAs which
contain a capped 5' end. It is thought that the cap structure provides
stability to the RNA and ensures efficient translation in both
invertebrate (33) and vertebrate (29) mRNAs.
In higher eukaryotic cells, most, but not all, mRNAs encode one protein
product. For example, expression of two ORFs in certain
retroviral RNA
genomes (
20) and in polyamine-regulated synthesis
of
mammalian ornithine decarboxylase antizyme mRNA (
34) occurs
by ribosomal frameshifting, a mechanism in which ribosomes pause
at
defined structural elements in the coding region and then continue
translation in an altered reading frame (
14). Instances of
truly
dicistronic mRNAs in which the two cistrons are separated by
intergenic
nucleotide spacer regions have been described in the
Drosophila stoned locus (
1), the
Drosophila
Adh/Adhr locus (
6), the
vertebrate
growth/differentiation factor 1 gene (
31), and the
mammalian
SNURF-SNRPN gene (
16); however, in none of these
cases
is the mechanism of translation of the downstream cistron known.
The mammalian
SNRPN gene locus, for example, encodes a
dicistronic
mRNA whose two protein products, SNURF and SmN, have been
implicated
in a developmental disease, the Prader-Willi syndrome, which
results
from the loss of function of the paternally inherited gene
(
3).
The two ORFs in the 1.6-kb
SNURF-SNRPN mRNA
are separated by a
150-nucleotide intercistronic spacer region. While
the synthesis
of both SNURF and SmN proteins from the dicistronic mRNA
has been
documented, it is unclear whether the second cistron is
translated
by leaky scanning, reinitiation, or internal
initiation.
With the discovery that picornavirus genomes contain IRES elements in
their 5'NCRs, it was possible to test the idea that
chimeric RNAs which
contain IRES elements between multiple cistrons
are translated by the
eukaryotic translation apparatus. The finding
that several IRES
elements in an mRNA molecule can be used as
start sites for translation
(
12,
35,
62) raised the possibility
that naturally occurring
mRNAs with multiple IRES elements may
exist. Our study of the CrPV
genome provides an example of such
a functionally dicistronic
RNA.
Regulation of the CrPV genome by two IRES elements.
The CrPV
genome encodes two nonoverlapping ORFs, both of which are independently
controlled by individual IRES elements. In all systems in which these
two IRESs were studied, the downstream IGR IRES was consistently more
active than the upstream 5'NCR IRES, providing a mechanistic
explanation for the previously noted increased expression of viral
structural proteins relative to the nonstructural proteins in infected
cells (37, 38). The utility of a dicistronic genome and the
use of dual IRES elements of different strengths for differential gene
expression for an RNA virus could be economical, facilitating the
production of the relatively large amounts of structural proteins
required for the formation of the viral capsid while allowing
nonstructural proteins, which function enzymatically in the replication
of the viral genome, to be produced sparingly. The molecular basis of the differential activities of the 5'NCR and IGR IRES elements is not
yet clear but could involve one or more possible mechanisms. For
example, the IGR IRES might compete more effectively than the 5'NCR
IRES for components of the translational machinery; competition among
IRES elements in cis has been previously noted (43). Alternatively, the activity of the 5'NCR IRES may be
modulated by a requirement for some limiting factor or may be directly
repressed by a viral or cellular protein. Further characterization of
these IRES elements is required to distinguish among these possibilities.
An unusual mode of translation initiation at the CrPV IGR
IRES.
Mutational analyses have shown that a noncognate CCU, rather
than an cognate AUG or weakly cognate GUG- or CUG-like codon, is the
first triplet of the CrPV ORF2. Translational start codons which differ
from AUG at one position (18), usually at the first nucleotide, such as GUG (19) and CUG (4, 60), or
the second nucleotide, such as ACG (48), have been
described. In contrast, the CrPV downstream ORF2 is an example of a
cistron whose start codon differs from the canonical AUG start codon at
all three positions. Our study has shown that the N-terminal amino acid of CrPV ORF2 is an alanine, encoded by a GCU codon. Sequencing of DCV
(24) and PSIV (52) VP2 proteins, which represent
the N terminus of ORF2, also revealed that the N-terminal amino acid of
DCV or PSIV VP2 was encoded by GCU (in DCV) and CAA (in PSIV), which
encode alanine and glutamine, respectively. More recently, the N
terminus of ORF2 in HiPV was shown to be a GCA-encoded alanine (40).
Extensive mutagenesis has shown that the CCU codon, immediately
preceding the GCU-encoding alanine codon, is required to set
the
translational reading frame in CrPV (Fig.
8 and
10). How might
the IGR
IRES promote translation initiation at a CCU codon? One
possibility is
that some sequence or structural element of the
CrPV IGR IRES
facilitates the CCU initiator tRNA
Met interactions in the
absence of sequence complementarity at any
position; in this case,
methionine would be the N-terminal amino
acid in ORF2, which is then
posttranslationally removed by aminopeptidases.
Alternatively,
initiator tRNA
Met might not be needed for translational
initiation. This notion
is supported by preliminary toeprinting
experiments indicating
that the CCU triplet is correctly positioned in
the ribosomal
P site in the absence of initiator tRNA
Met
and eukaryotic initiation factor eIF2 and by in vitro translation
assays showing that 80S ribosomes can be assembled in the presence
of
nonhydrolyzable GTP analog and the compound edeine, which normally
inhibits AUG start codon recognition by the scanning 43S ternary
complex (Wilson et al., submitted). That initiator tRNA
Met
is also not required for the translational initiation of ORF2
in PSIV
has been very recently reported by Sasaki and Nakashima
(
51).
A variety of translation strategies in RNA viruses.
RNA
viruses have evolved a remarkable variety of ways to translate their
RNA genomes into structural and nonstructural proteins. Production of
subgenomic mRNAs, synthesis of polyprotein precursors from single
mRNAs, ribosomal readthrough, and frameshifting are all ways to produce
more than one protein product from a single RNA genome. The
identification of CrPV RNA as a dicistronic mRNA regulated by two
independent IRES elements expands this repertoire.
 |
ACKNOWLEDGMENTS |
Joan E. Wilson, Marguerite J. Powell, and Susan E. Hoover
contributed equally to this work.
We thank Karla Kirkegaard for critical reading of the manuscript.
This work was supported by NIH grants R01 GM55979 and R01 AI 25105 (to
P.S.). J.E.W. is a recipient of a fellowship from the Jane Coffin
Childs Memorial Fund for Medical Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305. Phone: (650) 498-7076. Fax: (650) 498-7147. E-mail:
psarnow{at}leland.stanford.edu.
 |
REFERENCES |
| 1.
|
Andrews, J.,
M. Smith,
J. Merakovsky,
M. Coulson,
F. Hannan, and L. E. Kelly.
1996.
The stoned locus of Drosophila melanogaster produces a dicistronic transcript and encodes two distinct polypeptides.
Genetics
143:1699-1711[Abstract].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1994.
Current protocols in molecular biology.
Greene Publishing Associates, Inc., New York, N.Y.
|
| 3.
|
Bartolomei, M. S., and S. M. Tilghman.
1997.
Genomic imprinting in mammals.
Annu. Rev. Genet.
31:493-525[CrossRef][Medline].
|
| 4.
|
Blackwood, E. M.,
T. G. Lugo,
L. Kretzner,
M. W. King,
A. J. Street,
O. N. Witte, and R. N. Eisenman.
1994.
Functional analysis of the AUG- and CUG-initiated forms of the c-Myc protein.
Mol. Biol. Cell
5:597-609[Abstract].
|
| 5.
|
Blumenthal, T.
1998.
Gene clusters and polycistronic transcription in eukaryotes.
Bioessays
20:480-487[CrossRef][Medline].
|
| 6.
|
Brogna, S., and M. Ashburner.
1997.
The Adh-related gene of Drosophila melanogaster is expressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms.
EMBO J.
16:2023-2031[CrossRef][Medline].
|
| 7.
|
Bunch, T. A.,
Y. Grinblat, and L. S. Goldstein.
1988.
Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells.
Nucleic Acids Res.
16:1043-1061[Abstract/Free Full Text].
|
| 8.
|
Christian, P. D., and P. D. Scotti.
1998.
Picornalike viruses of insects, p. 301-336.
In
L. K. Miller, and L. A. Ball (ed.), The insect viruses. Plenum Publishing Corp., New York, N.Y.
|
| 9.
|
Eaton, B. T., and A. D. Steacie.
1980.
Cricket paralysis virus RNA has a terminal poly(A).
J. Gen. Virol.
50:167-171.
|
| 10.
|
Ehrenfeld, E.
1984.
Picornavirus inhibition of host cell protein synthesis, p. 177-221.
In
H. Fraenkel-Conrat, and R. R. Wagner (ed.), Comprehensive virology, vol. 19. Plenum Press, New York, N.Y.
|
| 11.
|
Frohman, M. A.,
M. K. Dush, and G. R. Martin.
1988.
Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc. Natl. Acad. Sci. USA
85:8998-9002[Abstract/Free Full Text].
|
| 12.
|
Fussenegger, M.,
X. Mazur, and J. E. Bailey.
1998.
pTRIDENT, a novel vector family for tricistronic gene expression in mammalian cells.
Biotechnol. Bioeng.
57:1-10[CrossRef][Medline].
|
| 13.
|
Futterer, J.,
Z. Kiss-Laszlo, and T. Hohn.
1993.
Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA.
Cell
73:789-802[CrossRef][Medline].
|
| 14.
|
Gesteland, R. F., and J. F. Atkins.
1996.
Recoding: dynamic reprogramming of translation.
Annu. Rev. Biochem.
65:741-768[CrossRef][Medline].
|
| 15.
|
Gingras, A. C.,
Y. Svitkin,
G. J. Belsham,
A. Pause, and N. Sonenberg.
1996.
Activation of the translational suppressor 4E-BP1 following infection with encephalomyocarditis virus and poliovirus.
Proc. Natl. Acad. Sci. USA
93:5578-5583[Abstract/Free Full Text].
|
| 16.
|
Gray, T. A.,
S. Saitoh, and R. D. Nicholls.
1999.
An imprinted, mammalian bicistronic transcript encodes two independent proteins.
Proc. Natl. Acad. Sci. USA
96:5616-5621[Abstract/Free Full Text].
|
| 17.
|
Haller, A. A., and P. Sarnow.
1997.
In vitro selection of a 7-methyl-guanosine binding RNA that inhibits translation of capped mRNA molecules.
Proc. Natl. Acad. Sci. USA
94:8521-8526[Abstract/Free Full Text].
|
| 18.
|
Hann, S. R.
1994.
Regulation and function of non-AUG-initiated proto-oncogenes.
Biochimie
76:880-886[Medline].
|
| 19.
|
Imataka, H.,
H. S. Olsen, and N. Sonenberg.
1997.
A new translational regulator with homology to eukaryotic translation initiation factor 4G.
EMBO J.
16:817-825[CrossRef][Medline].
|
| 20.
|
Jacks, T.
1990.
Translational suppression in gene expression in retroviruses and retrotransposons.
Curr. Top. Microbiol. Immunol.
157:93-124[Medline].
|
| 21.
|
Jackson, R. J.
1996.
A comparative view of initiation site selection mechanisms, p. 71-112.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Johannes, G.,
M. S. Carter,
M. B. Eisen,
P. O. Brown, and P. Sarnow.
1999.
Identification of eukaryotic mRNAs that are translated at reduced cap binding complex eIF4F concentrations using a cDNA microarray.
Proc. Natl. Acad. Sci. USA
96:13118-13123[Abstract/Free Full Text].
|
| 23.
|
Johnson, K. N., and P. D. Christian.
1996.
A molecular taxonomy for cricket paralysis virus including two new isolates from Australian populations of Drosophila (Diptera: Drosophilidae).
Arch. Virol.
141:1509-1522[CrossRef][Medline].
|
| 24.
|
Johnson, K. N., and P. D. Christian.
1998.
The novel genome organization of the insect picorna-like virus Drosophila C virus suggests this virus belongs to a previously undescribed virus family.
J. Gen. Virol.
79:191-203[Abstract].
|
| 25.
|
King, L. A., and N. F. Moore.
1988.
Evidence for the presence of a genome-linked protein in two insect picornaviruses, cricket paralysis and Drosophila C viruses.
FEMS Microbiol. Lett.
50:41-44[CrossRef].
|
| 26.
|
King, L. A.,
J. S. K. Pullin,
G. Stanway,
J. W. Almond, and N. F. Moore.
1987.
Cloning of the genome of cricket paralysis virus: sequence of the 3' end.
Virus Res.
6:331-344.
|
| 27.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.
Crit. Rev. Biochem. Mol. Biol.
28:375-430[Medline]. (Erratum, 28:546.)
|
| 28.
|
Koonin, E. V., and A. E. Gorbalenya.
1992.
An insect picornavirus may have genome organization similar to that of caliciviruses.
FEBS Lett.
297:81-86[CrossRef][Medline].
|
| 29.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241[Abstract/Free Full Text].
|
| 30.
|
Krause, M., and D. Hirsh.
1987.
A trans-spliced leader sequence on actin mRNA in C. elegans.
Cell
49:753-761[CrossRef][Medline].
|
| 31.
|
Lee, S. J.
1991.
Expression of growth/differentiation factor 1 in the nervous system: conservation of a bicistronic structure.
Proc. Natl. Acad. Sci. USA
88:4250-4254[Abstract/Free Full Text].
|
| 32.
|
Luking, A.,
U. Stahl, and U. Schmidt.
1998.
The protein family of RNA helicases.
Crit. Rev. Biochem. Mol. Biol.
33:259-296[CrossRef][Medline].
|
| 33.
|
Maroney, P. A.,
J. A. Denker,
E. Darzynkiewicz,
R. Laneve, and T. W. Nilsen.
1995.
Most mRNAs in the nematode Ascaris lumbricoides are trans-spliced: a role for spliced leader addition in translational efficiency.
RNA
1:714-723[Abstract].
|
| 34.
|
Matsufuji, S.,
T. Matsufuji,
Y. Miyazaki,
Y. Murakami,
J. F. Atkins,
R. F. Gesteland, and S. Hayashi.
1995.
Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme.
Cell
80:51-60[CrossRef][Medline].
|
| 35.
|
Molla, A.,
S. K. Jang,
A. V. Paul,
Q. Reuer, and E. Wimmer.
1992.
Cardioviral internal ribosomal entry site is functional in a genetically engineered dicistronic poliovirus.
Nature
356:255-257[CrossRef][Medline].
|
| 36.
|
Moon, J. S.,
L. L. Domier,
N. K. McCoppin,
C. J. D'Arcy, and H. Jin.
1998.
Nucleotide sequence analysis shows that Rhopalosiphum padi virus is a member of a novel group of insect-infecting RNA viruses.
Virology
243:54-65[CrossRef][Medline].
|
| 37.
|
Moore, N. F.,
A. Kearns, and J. S. K. Pullin.
1980.
Characterization of cricket paralysis virus-induced polypeptides in Drosophila cells.
J. Virol.
33:1-9[Abstract/Free Full Text].
|
| 38.
|
Moore, N. F.,
B. Reavy, and J. S. K. Pullin.
1981.
Processing of cricket paralysis virus induced polypeptides in Drosophila cells: production of high molecular weight polypeptides by treatment with iodoacetamide.
Arch. Virol.
68:1-8[CrossRef][Medline].
|
| 39.
|
Moore, N. F., and T. W. Tinsley.
1982.
The small RNA-viruses of insects.
Arch. Virol.
72:229-245[CrossRef][Medline].
|
| 40.
|
Nakashima, N.,
J. Sasaki, and S. Toriyama.
1999.
Determining the nucleotide sequence and capsid-coding region of himetobi P virus: a member of a novel group of RNA viruses that infect insects.
Arch. Virol.
144:2051-2058[CrossRef][Medline].
|
| 41.
|
Nilsen, T. W.
1995.
trans-splicing: an update.
Mol. Biochem. Parasitol.
73:1-6[CrossRef][Medline].
|
| 42.
|
O'Reilly, E. K., and C. C. Kao.
1998.
Analysis of RNA-dependent RNA polymerase structure and function as guided by known polymerase structures and computer predictions of secondary structure.
Virology
252:287-303[CrossRef][Medline].
|
| 43.
|
Ohlmann, T., and R. J. Jackson.
1999.
The properties of chimeric picornavirus IRESes show that discrimination between internal translation initiation sites is influenced by the identity of the IRES and not just the context of the AUG codon.
RNA
5:764-778[Abstract].
|
| 44.
|
Peabody, D. S., and P. Berg.
1986.
Termination-reinitiation occurs in the translation of mammalian cell mRNAs.
Mol. Cell. Biol.
6:2695-2703[Abstract/Free Full Text].
|
| 45.
|
Perry, K., and N. Agabian.
1991.
mRNA processing in the Trypanosomatidae.
Experientia
47:118-128[CrossRef][Medline].
|
| 46.
|
RajBhandary, U. L.
2000.
More surprises in translation: initiation without the initiator tRNA.
Proc. Natl. Acad. Sci. USA
97:1325-1327[Free Full Text].
|
| 47.
|
Reinganum, C.,
G. T. O'Loughlin, and T. W. Hogan.
1970.
A non-occluded virus of the field crickets Teleogryllus oceanicus and T. commodus (Orthoptera: Gryllidae).
J. Invertebr. Pathol.
16:214-220[CrossRef].
|
| 48.
|
Riechmann, J. L.,
T. Ito, and E. M. Meyerowitz.
1999.
Non-AUG initiation of AGAMOUS mRNA translation in Arabidopsis thaliana.
Mol. Cell. Biol.
19:8505-8512[Abstract/Free Full Text].
|
| 49.
|
Rueckert, R. R.
1996.
Piconaviridae: the viruses and their replication, p. 609-654.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa.
|
| 50.
|
Sarnow, P.,
Y. S. Ho,
J. Williams, and A. J. Levine.
1982.
Adenovirus E1b-58kd tumor antigen and SV40 large tumor antigen are physically associated with the same 54kd cellular protein in transformed cells.
Cell
28:387-394[CrossRef][Medline].
|
| 51.
|
Sasaki, J., and N. Nakashima.
2000.
Methionine-independent initiation of translation in the capsid protein of an insect RNA virus.
Proc. Natl. Acad. Sci. USA
97:1512-1515[Abstract/Free Full Text].
|
| 52.
|
Sasaki, J., and N. Nakashima.
1999.
Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro.
J. Virol.
73:1219-1226[Abstract/Free Full Text].
|
| 53.
|
Sasaki, J.,
N. Nakashima,
H. Saito, and H. Noda.
1998.
An insect picorna-like virus, Plautia stali intestine virus, has genes of capsid proteins in the 3' part of the genome.
Virology
244:50-58[CrossRef][Medline].
|
| 54.
|
Schmid, S. R., and P. Linder.
1992.
D-E-A-D protein family of putative RNA helicases.
Mol. Microbiol.
6:283-291[Medline].
|
| 55.
|
Scotti, P. D.
1976.
Cricket paralysis virus replicates in cultured Drosophila cells.
Intervirology
6:333-342.
|
| 56.
|
Scotti, P. D.,
J. F. Longworth,
N. Plus,
G. Crozier, and C. Reinganum.
1981.
The biology and ecology of strains of an insect small RNA virus complex.
Adv. Virus Res.
26:117-143[Medline].
|
| 57.
|
Seipelt, J.,
A. Guarne,
E. Bergmann,
M. James,
W. Sommergruber,
I. Fita, and T. Skern.
1999.
The structures of picornaviral proteinases.
Virus Res.
62:159-168[CrossRef][Medline].
|
| 58.
|
Spieth, J.,
G. Brooke,
S. Kuersten,
K. Lea, and T. Blumenthal.
1993.
Operons in C. elegans: polycistronic mRNA precursors are processed by trans-splicing of SL2 to downstream coding regions.
Cell
73:521-532[CrossRef][Medline].
|
| 59.
|
Tate, J.,
L. Liljas,
P. Scotti,
P. Christian,
T. Lin, and J. E. Johnson.
1999.
The crystal structure of cricket paralysis virus: the first view of a new virus family.
Nat. Struct. Biol.
6:765-774[CrossRef][Medline].
|
| 60.
|
Vagner, S.,
C. Touriol,
B. Galy,
S. Audigier,
M. C. Gensac,
F. Amalric,
F. Bayard,
H. Prats, and A. C. Prats.
1996.
Translation of CUG- but not AUG-initiated forms of human fibroblast growth factor 2 is activated in transformed and stressed cells.
J. Cell Biol.
135:1391-1402[Abstract/Free Full Text].
|
| 61.
|
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev.
10:1557-1567[Abstract/Free Full Text].
|
| 62.
|
Zhu, J.,
M. L. Musco, and M. J. Grace.
1999.
Three-color flow cytometry analysis of tricistronic expression of eBFP, eGFP, and eYFP using EMCV-IRES linkages.
Cytometry
37:51-59[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2000, p. 4990-4999, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deniz, N., Lenarcic, E. M., Landry, D. M., Thompson, S. R.
(2009). Translation initiation factors are not required for Dicistroviridae IRES function in vivo. RNA
15: 932-946
[Abstract]
[Full Text]
-
Barria, M. I., Gonzalez, A., Vera-Otarola, J., Leon, U., Vollrath, V., Marsac, D., Monasterio, O., Perez-Acle, T., Soza, A., Lopez-Lastra, M.
(2009). Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation. Nucleic Acids Res
37: 957-971
[Abstract]
[Full Text]
-
Carter, J. R., Fraser, T. S., Fraser, M. J. Jr
(2008). Examining the relative activity of several dicistrovirus intergenic internal ribosome entry site elements in uninfected insect and mammalian cell lines. J. Gen. Virol.
89: 3150-3155
[Abstract]
[Full Text]
-
Powell, M. L., Napthine, S., Jackson, R. J., Brierley, I., Brown, T. D. K.
(2008). Characterization of the termination-reinitiation strategy employed in the expression of influenza B virus BM2 protein. RNA
14: 2394-2406
[Abstract]
[Full Text]
-
Belsham, G. J., Nielsen, I., Normann, P., Royall, E., Roberts, L. O.
(2008). Monocistronic mRNAs containing defective hepatitis C virus-like picornavirus internal ribosome entry site elements in their 5' untranslated regions are efficiently translated in cells by a cap-dependent mechanism. RNA
14: 1671-1680
[Abstract]
[Full Text]
-
Pfingsten, J. S., Kieft, J. S.
(2008). RNA structure-based ribosome recruitment: Lessons from the Dicistroviridae intergenic region IRESes. RNA
14: 1255-1263
[Abstract]
[Full Text]
-
Thomas, J. D., Dias, L. M., Johannes, G. J.
(2008). Translational repression during chronic hypoxia is dependent on glucose levels. RNA
14: 771-781
[Abstract]
[Full Text]
-
Martinez-Salas, E., Pacheco, A., Serrano, P., Fernandez, N.
(2008). New insights into internal ribosome entry site elements relevant for viral gene expression. J. Gen. Virol.
89: 611-626
[Abstract]
[Full Text]
-
Treder, K., Pettit Kneller, E. L., Allen, E. M., Wang, Z., Browning, K. S., Miller, W. A.
(2008). The 3' cap-independent translation element of Barley yellow dwarf virus binds eIF4F via the eIF4G subunit to initiate translation. RNA
14: 134-147
[Abstract]
[Full Text]
-
Maori, E., Lavi, S., Mozes-Koch, R., Gantman, Y., Peretz, Y., Edelbaum, O., Tanne, E., Sela, I.
(2007). Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: evidence for diversity due to intra- and inter-species recombination. J. Gen. Virol.
88: 3428-3438
[Abstract]
[Full Text]
-
Galkin, O., Bentley, A. A., Gupta, S., Compton, B.-A., Mazumder, B., Kinzy, T. G., Merrick, W. C., Hatzoglou, M., Pestova, T. V., Hellen, C. U.T., Komar, A. A.
(2007). Roles of the negatively charged N-terminal extension of Saccharomyces cerevisiae ribosomal protein S5 revealed by characterization of a yeast strain containing human ribosomal protein S5. RNA
13: 2116-2128
[Abstract]
[Full Text]
-
Chaudhuri, S., Vyas, K., Kapasi, P., Komar, A. A., Dinman, J. D., Barik, S., Mazumder, B.
(2007). Human ribosomal protein L13a is dispensable for canonical ribosome function but indispensable for efficient rRNA methylation. RNA
13: 2224-2237
[Abstract]
[Full Text]
-
Lu, J., Hu, Y., Hu, L., Zong, S., Cai, D., Wang, J., Yu, H., Zhang, J.
(2007). Ectropis obliqua picorna-like virus IRES-driven internal initiation of translation in cell systems derived from different origins. J. Gen. Virol.
88: 2834-2838
[Abstract]
[Full Text]
-
Pal, N., Boyapalle, S., Beckett, R., Miller, W. A., Bonning, B. C.
(2007). A Baculovirus-Expressed Dicistrovirus That Is Infectious to Aphids. J. Virol.
81: 9339-9345
[Abstract]
[Full Text]
-
Groppelli, E., Belsham, G. J., Roberts, L. O.
(2007). Identification of minimal sequences of the Rhopalosiphum padi virus 5' untranslated region required for internal initiation of protein synthesis in mammalian, plant and insect translation systems. J. Gen. Virol.
88: 1583-1588
[Abstract]
[Full Text]
-
Matsuda, D., Dreher, T. W.
(2007). Cap- and initiator tRNA-dependent initiation of TYMV polyprotein synthesis by ribosomes: Evaluation of the Trojan horse model for TYMV RNA translation. RNA
13: 129-137
[Abstract]
[Full Text]
-
Shibuya, N., Nakashima, N.
(2006). Characterization of the 5' internal ribosome entry site of Plautia stali intestine virus. J. Gen. Virol.
87: 3679-3686
[Abstract]
[Full Text]
-
Ongus, J. R., Roode, E. C., Pleij, C. W. A., Vlak, J. M., van Oers, M. M.
(2006). The 5' non-translated region of Varroa destructor virus 1 (genus Iflavirus): structure prediction and IRES activity in Lymantria dispar cells.. J. Gen. Virol.
87: 3397-3407
[Abstract]
[Full Text]
-
Baird, S. D., Turcotte, M., Korneluk, R. G., Holcik, M.
(2006). Searching for IRES. RNA
12: 1755-1785
[Abstract]
[Full Text]
-
Lanzi, G., de Miranda, J. R., Boniotti, M. B., Cameron, C. E., Lavazza, A., Capucci, L., Camazine, S. M., Rossi, C.
(2006). Molecular and Biological Characterization of Deformed Wing Virus of Honeybees (Apis mellifera L.).. J. Virol.
80: 4998-5009
[Abstract]
[Full Text]
-
Lancaster, A. M., Jan, E., Sarnow, P.
(2006). Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site. RNA
12: 894-902
[Abstract]
[Full Text]
-
Wang, X.-H., Aliyari, R., Li, W.-X., Li, H.-W., Kim, K., Carthew, R., Atkinson, P., Ding, S.-W.
(2006). RNA Interference Directs Innate Immunity Against Viruses in Adult Drosophila. Science
312: 452-454
[Abstract]
[Full Text]
-
Takao, Y., Mise, K., Nagasaki, K., Okuno, T., Honda, D.
(2006). Complete nucleotide sequence and genome organization of a single-stranded RNA virus infecting the marine fungoid protist Schizochytrium sp.. J. Gen. Virol.
87: 723-733
[Abstract]
[Full Text]
-
Li, P. W.-L., Li, J., Timmerman, S. L., Krushel, L. A., Martin, S. L.
(2006). The dicistronic RNA from the mouse LINE-1 retrotransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition. Nucleic Acids Res
34: 853-864
[Abstract]
[Full Text]
-
Schepens, B., Tinton, S. A., Bruynooghe, Y., Beyaert, R., Cornelis, S.
(2005). The polypyrimidine tract-binding protein stimulates HIF-1{alpha} IRES-mediated translation during hypoxia. Nucleic Acids Res
33: 6884-6894
[Abstract]
[Full Text]
-
Humphreys, D. T., Westman, B. J., Martin, D. I. K., Preiss, T.
(2005). MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and poly(A) tail function. Proc. Natl. Acad. Sci. USA
102: 16961-16966
[Abstract]
[Full Text]
-
Kojima, K. K., Matsumoto, T., Fujiwara, H.
(2005). Eukaryotic Translational Coupling in UAAUG Stop-Start Codons for the Bicistronic RNA Translation of the Non-Long Terminal Repeat Retrotransposon SART1. Mol. Cell. Biol.
25: 7675-7686
[Abstract]
[Full Text]
-
Terenin, I. M., Dmitriev, S. E., Andreev, D. E., Royall, E., Belsham, G. J., Roberts, L. O., Shatsky, I. N.
(2005). A Cross-Kingdom Internal Ribosome Entry Site Reveals a Simplified Mode of Internal Ribosome Entry. Mol. Cell. Biol.
25: 7879-7888
[Abstract]
[Full Text]
-
Czibener, C., Alvarez, D., Scodeller, E., Gamarnik, A. V.
(2005). Characterization of internal ribosomal entry sites of Triatoma virus. J. Gen. Virol.
86: 2275-2280
[Abstract]
[Full Text]
-
Fillebeen, C., Rivas-Estilla, A. M., Bisaillon, M., Ponka, P., Muckenthaler, M., Hentze, M. W., Koromilas, A. E., Pantopoulos, K.
(2005). Iron Inactivates the RNA Polymerase NS5B and Suppresses Subgenomic Replication of Hepatitis C Virus. J. Biol. Chem.
280: 9049-9057
[Abstract]
[Full Text]
-
COSTANTINO, D., KIEFT, J. S.
(2005). A preformed compact ribosome-binding domain in the cricket paralysis-like virus IRES RNAs. RNA
11: 332-343
[Abstract]
[Full Text]
-
Cherry, S., Doukas, T., Armknecht, S., Whelan, S., Wang, H., Sarnow, P., Perrimon, N.
(2005). Genome-wide RNAi screen reveals a specific sensitivity of IRES-containing RNA viruses to host translation inhibition. Genes Dev.
19: 445-452
[Abstract]
[Full Text]
-
Cevallos, R. C., Sarnow, P.
(2005). Factor-Independent Assembly of Elongation-Competent Ribosomes by an Internal Ribosome Entry Site Located in an RNA Virus That Infects Penaeid Shrimp. J. Virol.
79: 677-683
[Abstract]
[Full Text]
-
Ongus, J. R., Peters, D., Bonmatin, J.-M., Bengsch, E., Vlak, J. M., van Oers, M. M.
(2004). Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor. J. Gen. Virol.
85: 3747-3755
[Abstract]
[Full Text]
-
Shibuya, N., Nishiyama, T., Nakashima, N.
(2004). Cell-Free Synthesis of Polypeptides Lacking an Amino-Terminal Methionine by Using a Dicistroviral Intergenic Internal Ribosome Entry Site. J Biochem
136: 601-606
[Abstract]
[Full Text]
-
de Miranda, J. R., Drebot, M., Tyler, S., Shen, M., Cameron, C. E., Stoltz, D. B., Camazine, S. M.
(2004). Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J. Gen. Virol.
85: 2263-2270
[Abstract]
[Full Text]
-
Royall, E., Woolaway, K. E., Schacherl, J., Kubick, S., Belsham, G. J., Roberts, L. O.
(2004). The Rhopalosiphum padi virus 5' internal ribosome entry site is functional in Spodoptera frugiperda 21 cells and in their cell-free lysates: implications for the baculovirus expression system. J. Gen. Virol.
85: 1565-1569
[Abstract]
[Full Text]
-
HATAKEYAMA, Y., SHIBUYA, N., NISHIYAMA, T., NAKASHIMA, N.
(2004). Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts. RNA
10: 779-786
[Abstract]
[Full Text]
-
Shen, R., Miller, W. A.
(2004). The 3' Untranslated Region of Tobacco Necrosis Virus RNA Contains a Barley Yellow Dwarf Virus-Like Cap-Independent Translation Element. J. Virol.
78: 4655-4664
[Abstract]
[Full Text]
-
Wang, X., Zhang, J., Lu, J., Yi, F., Liu, C., Hu, Y.
(2004). Sequence analysis and genomic organization of a new insect picorna-like virus, Ectropis obliqua picorna-like virus, isolated from Ectropis obliqua. J. Gen. Virol.
85: 1145-1151
[Abstract]
[Full Text]
-
Izumi, R. E., Das, S., Barat, B., Raychaudhuri, S., Dasgupta, A.
(2004). A Peptide from Autoantigen La Blocks Poliovirus and Hepatitis C Virus Cap-Independent Translation and Reveals a Single Tyrosine Critical for La RNA Binding and Translation Stimulation. J. Virol.
78: 3763-3776
[Abstract]
[Full Text]
-
Jan, E., Kinzy, T. G., Sarnow, P.
(2003). Divergent tRNA-like element supports initiation, elongation, and termination of protein biosynthesis. Proc. Natl. Acad. Sci. USA
100: 15410-15415
[Abstract]
[Full Text]
-
Shibuya, N., Nishiyama, T., Kanamori, Y., Saito, H., Nakashima, N.
(2003). Conditional Rather than Absolute Requirements of the Capsid Coding Sequence for Initiation of Methionine-Independent Translation in Plautia stali Intestine Virus. J. Virol.
77: 12002-12010
[Abstract]
[Full Text]
-
Bonnal, S., Schaeffer, C., Creancier, L., Clamens, S., Moine, H., Prats, A.-C., Vagner, S.
(2003). A Single Internal Ribosome Entry Site Containing a G Quartet RNA Structure Drives Fibroblast Growth Factor 2 Gene Expression at Four Alternative Translation Initiation Codons. J. Biol. Chem.
278: 39330-39336
[Abstract]
[Full Text]
-
Jaag, H. M., Kawchuk, L., Rohde, W., Fischer, R., Emans, N., Prufer, D.
(2003). An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein. Proc. Natl. Acad. Sci. USA
100: 8939-8944
[Abstract]
[Full Text]
-
Beales, L. P., Holzenburg, A., Rowlands, D. J.
(2003). Viral Internal Ribosome Entry Site Structures Segregate into Two Distinct Morphologies. J. Virol.
77: 6574-6579
[Abstract]
[Full Text]
-
Nishiyama, T., Yamamoto, H., Shibuya, N., Hatakeyama, Y., Hachimori, A., Uchiumi, T., Nakashima, N.
(2003). Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding with ribosomes. Nucleic Acids Res
31: 2434-2442
[Abstract]
[Full Text]
-
Johansson, E. S., Niklasson, B., Tesh, R. B., Shafren, D. R., Travassos da Rosa, A. P. A., Lindberg, A. M.
(2003). Molecular characterization of M1146, an American isolate of Ljungan virus (LV) reveals the presence of a new LV genotype. J. Gen. Virol.
84: 837-844
[Abstract]
[Full Text]
-
Brasey, A., Lopez-Lastra, M., Ohlmann, T., Beerens, N., Berkhout, B., Darlix, J.-L., Sonenberg, N.
(2003). The Leader of Human Immunodeficiency Virus Type 1 Genomic RNA Harbors an Internal Ribosome Entry Segment That Is Active during the G2/M Phase of the Cell Cycle. J. Virol.
77: 3939-3949
[Abstract]
[Full Text]
-
Pestova, T. V., Hellen, C. U.T.
(2003). Translation elongation after assembly of ribosomes on the Cricket paralysis virus internal ribosomal entry site without initiation factors or initiator tRNA. Genes Dev.
17: 181-186
[Abstract]
[Full Text]
-
Domier, L. L., McCoppin, N. K.
(2003). In vivo activity of Rhopalosiphum padi virus internal ribosome entry sites. J. Gen. Virol.
84: 415-419
[Abstract]
[Full Text]
-
van Munster, M., Dullemans, A. M., Verbeek, M., van den Heuvel, J. F. J. M., Clerivet, A., van der Wilk, F.
(2002). Sequence analysis and genomic organization of Aphid lethal paralysis virus: a new member of the family Dicistroviridae. J. Gen. Virol.
83: 3131-3138
[Abstract]
[Full Text]
-
Chatterji, U., de Parseval, A., Elder, J. H.
(2002). Feline Immunodeficiency Virus OrfA Is Distinct from Other Lentivirus Transactivators. J. Virol.
76: 9624-9634
[Abstract]
[Full Text]
-
Bushell, M., Sarnow, P.
(2002). Hijacking the translation apparatus by RNA viruses. JCB
158: 395-399
[Abstract]
[Full Text]
-
Fernandez, J., Yaman, I., Sarnow, P., Snider, M. D., Hatzoglou, M.
(2002). Regulation of Internal Ribosomal Entry Site-mediated Translation by Phosphorylation of the Translation Initiation Factor eIF2alpha. J. Biol. Chem.
277: 19198-19205
[Abstract]
[Full Text]
-
Dorokhov, Y. L., Skulachev, M. V., Ivanov, P. A., Zvereva, S. D., Tjulkina, L. G., Merits, A., Gleba, Y. Y., Hohn, T., Atabekov, J. G.
(2002). Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. Proc. Natl. Acad. Sci. USA
99: 5301-5306
[Abstract]
[Full Text]
-
Mari, J., Poulos, B. T., Lightner, D. V., Bonami, J.-R.
(2002). Shrimp Taura syndrome virus: genomic characterization and similarity with members of the genus Cricket paralysis-like viruses. J. Gen. Virol.
83: 915-926
[Abstract]
[Full Text]
-
Thompson, J. R., Leone, G., Lindner, J. L., Jelkmann, W., Schoen, C. D.
(2002). Characterization and complete nucleotide sequence of Strawberry mottle virus: a tentative member of a new family of bipartite plant picorna-like viruses. J. Gen. Virol.
83: 229-239
[Abstract]
[Full Text]
-
Schneider, R., Kozak, M.
(2001). New Ways of Initiating Translation in Eukaryotes?. Mol. Cell. Biol.
21: 8238-8246
[Full Text]
-
Hinnebusch, A. G.
(2001). Unleashing yeast genetics on a factor-independent mechanism of internal translation initiation. Proc. Natl. Acad. Sci. USA
98: 12866-12868
[Full Text]
-
Woolaway, K. E., Lazaridis, K., Belsham, G. J., Carter, M. J., Roberts, L. O.
(2001). The 5' Untranslated Region of Rhopalosiphum padi Virus Contains an Internal Ribosome Entry Site Which Functions Efficiently in Mammalian, Plant, and Insect Translation Systems. J. Virol.
75: 10244-10249
[Abstract]
[Full Text]
-
Thompson, S. R., Gulyas, K. D., Sarnow, P.
(2001). Internal initiation in Saccharomyces cerevisiae mediated by an initiator tRNA/eIF2-independent internal ribosome entry site element. Proc. Natl. Acad. Sci. USA
10.1073/pnas.241286698v1
[Abstract]
[Full Text]
-
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text]
-
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text]
-
Donnelly, M. L. L., Hughes, L. E., Luke, G., Mendoza, H., ten Dam, E., Gani, D., Ryan, M. D.
(2001). The 'cleavage' activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring '2A-like' sequences. J. Gen. Virol.
82: 1027-1041
[Abstract]
[Full Text]
-
Kozak, M.
(2001). New Ways of Initiating Translation in Eukaryotes?. Mol. Cell. Biol.
21: 1899-1907
[Full Text]
-
JAN, E., THOMPSON, S.R., WILSON, J.E., PESTOVA, T.V., HELLEN, C.U.T., SARNOW, P.
(2001). Initiator Met-tRNA-independent Translation Mediated by an Internal Ribosome Entry Site Element in Cricket Paralysis Virus-like Insect Viruses. Cold Spring Harb Symp Quant Biol
66: 285-292
[Abstract]
-
GEBAUER, F., OSTARECK, D.H., OSTARECK-LEDERER, A., GRSKOVIC, M., HENTZE, M.W.
(2001). Translational Control of 15-Lipoxygenase and msl-2 mRNAs: Single Regulators or Corepressor Assemblies?. Cold Spring Harb Symp Quant Biol
66: 329-336
[Abstract]
-
Thompson, S. R., Gulyas, K. D., Sarnow, P.
(2001). Internal initiation in Saccharomyces cerevisiae mediated by an initiator tRNA/eIF2-independent internal ribosome entry site element. Proc. Natl. Acad. Sci. USA
98: 12972-12977
[Abstract]
[Full Text]