Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 5032-5040, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Postcleavage Sequence Specificity in V(D)J
Recombination
Emily A.
Agard and
Susanna M.
Lewis*
Program in Genetics and Genomic Biology,
Hospital for Sick Children Research Institute, Toronto, Ontario, Canada
M5G 1X8, and Department of Immunology, University of Toronto, Toronto,
Ontario, Canada M5S 1A8
Received 16 March 2000/Returned for modification 7 April
2000/Accepted 24 April 2000
 |
ABSTRACT |
Unintended DNA rearrangements in a differentiating lymphocyte can
have severe, oncogenic consequences, but the mechanisms for avoiding
pathogenic outcomes in V(D)J recombination are not well understood. The
first level at which fidelity is instituted is in discrimination by the
recombination proteins between authentic and inauthentic recombination
signal sequences. Nevertheless, this discrimination is not absolute and
cannot fully eliminate targeting errors. To learn more about the basis
of specificity during V(D)J recombination, we have investigated whether
it is possible for the recombination machinery to detect an
inaccurately targeted sequence subsequent to cleavage. These studies
indicate that even postcleavage steps in V(D)J recombination are
sequence specific and that noncanonical sequences will not efficiently support the resolution of recombination intermediates in vivo. Accordingly, interventions after a mistargeting event conceivably occur
at a late stage in the joining process and the likelihood may well be
crucial to enforcing fidelity during antigen receptor gene rearrangement.
 |
INTRODUCTION |
A critical process in B- and
T-lymphocyte development is the assembly of antigen receptor genes. In
this developmentally regulated DNA rearrangement, variable (V),
diversity (D), and joining (J) gene segments become connected to one
another to create the variable exon of an immunoglobulin (Ig) or T-cell
receptor (TCR) gene. V(D)J recombination entails the site-specific
recombination of specific DNA motifs termed recombination signal
sequences (RSSs) in a process that can be conceptually as well as
biochemically divided into two stages: stage 1, where RSS recognition,
synapsis, and cleavage takes place, and stage 2, where DNA ends are
modified by nucleotide addition and subtraction and become rejoined.
Necessary DNA transactions are accomplished through a collaboration
between DNA sequence-specific proteins, RAG-1 and RAG-2, and
non-sequence-specific nucleases, polymerases, ligases, and structural
components (the list includes terminal deoxynucleotidyltransferase, DNA
ligase IV, DNA-PKcs, Ku70, Ku80, and XRCC4; reviewed in reference
15). Ultimately, this multicomponent recombination
machinery accomplishes the precisely localized cut-and-paste operations
that can convert dispersed V, D, and J gene segments into a functional
antigen receptor gene.
Central to stage 1 is the site-specific recognition of two RSSs, each
comprised of a heptamer (CACAGTG), a spacer of 12 or 23 bp,
and a nonamer (ACAAAAACC). Although a consensus RSS is evident from examination of natural joining signals (30,
44), typically only a small minority of RSSs at an Ig or TCR
locus exactly match this canonical sequence (for example, see reference 27). The V(D)J recombination machinery therefore is
constrained in two opposing ways: it must have sufficient flexibility
to recognize naturally occurring RSS variations, but at the same time
it must be able to avoid recombination of inappropriate DNA sequences. Such sequences, termed cryptic RSSs, happen to resemble real RSSs, but
if joined will promote unintended genome rearrangement.
The recombination machinery is not able to discriminate between target
authentic RSSs and cryptic RSSs with absolute success. This is
illustrated by the fact that DNA sequences that match a canonical RSS
at only about 50% of the heptamer- or nonamer-equivalent positions
will still recombine when tested in an extrachromosomal V(D)J
recombination assay (24). The number of cryptic RSSs that can be documented within artificial recombination substrates suggests that a site with functionally relevant similarities to an RSS can be
expected to occur at least once every 600 bp in the mammalian genome
(24). Even though the intrinsic joining proficiency of most
such cryptic RSSs is several orders of magnitude lower than that of an
authentic RSS, the number of cryptic sites is overwhelming
fidelity must certainly involve biological strategies that go beyond target site
discrimination alone.
Accuracy in V(D)J recombination can be envisioned to rely upon the
regulation of the accessibility of genomic sequences to recombination
proteins (reviewed in references 35 and
40). Features of chromatin structure are known to
allow recombination of appropriate Ig and TCR loci during B- and T-cell
differentiation (for recent discussions, see references 8, 13,
45, and 46), and it is reasonable to
suppose, by extension, that an inaccessible chromatin configuration may
protect every other site in the genome from illegitimate rearrangement.
However, the molecular basis of accessibility is only beginning to be
elucidated, and how much genome alteration is actually prevented by
such a mechanism has not been investigated. Here we have examined an
additional, complementary possibility, which is that the recombination
enzymes can detect the participation of a cryptic RSS even after
cleavage of the mistargeted sequence has already taken place.
Postcleavage sequence specificity may provide an important means of
error avoidance by allowing for late-stage interventions when
mistargeting occurs.
The need for a midcourse correction mechanism is underscored by the
observation that site-specific cryptic RSS rearrangement can occur
between cryptic signal-like sequences at locations completely removed
from any Ig or TCR locus. The threat this type of event poses, and the
necessity for safeguards is illustrated for T-cell acute lymphocytic
leukemia (T-ALL). In a subset of T-ALL cases, a pair of cryptic RSSs at
the scl/tal locus have recombined, resulting in the
unscheduled expression of the tal gene and contributing to
leukemogenesis (3, 7, 9). Cryptic RSSs have also been shown
to mediate a less-disastrous site-specific deletion at the hprt locus, detectable in T cells sampled from healthy
adults (11, 34). A key feature illustrated by these examples
is that the site-specific cryptic rearrangements can take place without interfering with the concomitant recombination of the Ig or TCR loci in
the affected cell. Thus, this type of aberrant outcome is unlikely to
be screened out by any of the highly specialized cellular selective
forces operating in T- and B-cell development, all of which focus on
the products of antigen receptor gene rearrangement. A cell that
harbors a potentially harmful rearrangement would be just as likely as
any other to undergo proper recombination at its antigen receptor loci
and thereby to receive further proliferative signals.
In this regard, clearly a mechanism that can detect mistargeting even
though the joining process has already proceeded as far as RSS
cleavage, would help to maintain genome stability during V(D)J
recombination. To discover whether such a mechanism exists, we have
refined an in vivo plasmid assay so that the capacity of a particular
RSS to support postcleavage operations can be distinguished from its
function in precleavage and cleavage phases of the V(D)J recombination
process. By applying this assay to various cryptic RSSs, our results
indicate that the events that occur after cleavage in V(D)J
recombination are indeed sequence specific. These observations provide
in vivo support for suggestions based upon in vitro evidence that RAG1
and RAG2 (RAG1/2) and its maintenance within a site-specific
protein-DNA complex has an important role to play in the later steps of
Ig and TCR gene recombination (for example, see references 5,
18, 20, 33, and 37). In the context of
fidelity and genome stability, the postcleavage sequence specificity
observed here raises the possibility that an interruption of V(D)J
recombination and/or reduced cellular survival results as a late-stage
consequence of target misrecognition.
 |
MATERIALS AND METHODS |
Substrates pWT-SJ
, pWT-Inv (designated p12x23 in reference
25), p6131-SJ
, p6131-Inv, pCA-SJ
, pCA-Inv,
pT4Anon-SJ
, pT4Anon-Inv, p6131hWTnon-SJ
, p6131hWTnon-Inv,
pNOnon-SJ
, and pNOnon-Inv were derived from p23 (25) and
differ from one another only in the identity and orientation of the RSS
occupying site 1. Twelve-spacer RSSs (12-RSS) were inserted in the form
of a double-stranded oligonucleotide cassette with SalI
compatible ends at a unique SalI site in the common p23
plasmid backbone. pWT-CJ
was derived from p12 (25) after
introducing a canonical 23-spacer RSS (23-RSS) that is identical to the
23-RSS in p23 and its derivatives, at a unique BamHI site. An intermediate plasmid, pEA23flip, was constructed from pJH298 (26) after removal of its 23-RSS and replacement with our
23-RSS used in the desired orientation. p6131-CJ
and pT4Anon-CJ
were then constructed by insertion of the appropriate 12-RSS
oligonucleotide cassette at the SalI site of pEA23flip. All
modifications were confirmed by dideoxy sequencing (Sequenase).
p6131-Invno2 was constructed from pJH298 and p6131-Inv. The two
plasmids were double digested with SalI and
AatII, and the small fragment of the former was ligated to
the large fragment of the latter. p6131-Inv(506) was constructed from
p6131-Invno2 by duplication of the 227-bp ClaI fragment
between the two RSSs; p6131-CJ
(546) was similarly constructed from
p6131CJ
. The control site 2 plasmid is p6912 described elsewhere
(24) and is identical to the SJ
constructs except that it
contains a nonfunctional sequence at site 1. In summary, all of the
plasmids used in the present study are identical to one another save
only for (i) the identity and orientation of the sequence in site 1, and/or (ii) the orientation of the sequence in site 3, and/or (iii) the
presence or absence of a functional RSS at site 2.
Cell culture.
A pre-B-like cell line, 204-1-8, derived by
Abelson virus transformation was used for all experiments
(32). Cells were maintained in RPMI-10% heat-inactivated
fetal bovine serum-50 µM
-mercaptoethanol.
Extrachromosomal recombination assay.
Transfections of
204-1-8 cells were performed with 150 ng of substrate DNA and included
1 mM caffeine as described previously (24). Transfected DNA
was harvested, and recombinant colonies were selected as described
earlier. Every construct was transfected 4 to 10 times, and at minimum
500 colonies were picked in grid arrays to nitrocellulose filters. No
more than 20% of a given transfection was sampled. For experiments
involving cotransfection with the site 2 control plasmid, 75 ng of each
plasmid was used.
Screening of recombinants.
Chloramphenicol-resistant
colonies were picked to replicate grids and transferred to
nitrocellulose filters for hybridization to 32P-end-labeled
oligonucleotides. The diagnostic hybridization patterns are given in
Fig. 2. As shown in the figure, probe A is LACPRIME (CTCATTAGGCACCCCAGGCT), probe B is LACMER
(TATGTTGTGTGGAATTGT), probe C is PLAC20
(TCCTAACAGCTATGACCATG), and probe D is TER-2 (TCCAAAGTTCTCAATGCTGC). Probe X represents the RSS-specific
oligonucleotides used in the screening of CJ
and Inv substrates:
PD12MER (AGGTCGACACAGTGG) was used for WT, T4Anon, and
NOnon; O/6131INV (AGGTCGACACAACAT) was used for 6131 and
6131hWTnon; and O/CAINV (AGGTCGACACACACA) was used for CA.
Any colony that gave an ambiguous signal by hybridization was
reanalyzed. The accuracy of the recombinant designations for all
experiments was tested by subjecting DNA samples from random, typed
colonies to diagnostic restriction enzyme analysis; in all cases there
was 100% concordance.
In experiments with a cotransfected control site 2 plasmid, the ratio
of plasmids within the transfected cells was determined by treating an
aliquot of the recovered plasmid DNA with DpnI prior to
transformation of Escherichia coli. Nonrecombinant colonies were selected on media without chloramphenicol and were randomly picked
and typed according to whether or not they hybridized to the
oligonucleotide B probe (see Fig. 2). This gives the ratio of
successfully transfected (replicated) molecules in the cells, and the
number was used to normalize the score obtained for each class of
recombinant according to the sample calculation shown in Fig. 4B.
 |
RESULTS |
Experimental design.
Stage 2 sequence discrimination is
detected by the configuration-specific test illustrated in Fig.
1. This test measures the number of
complete recombinants recovered when the orientation of the RSSs (and
only this) is varied in an artificial recombination substrate. The
configuration-specific test (described in more detail below) avoids
complications associated with attempts to quantify cut recombination
intermediates in vivo. Though seemingly more direct, any measurement of
cleaved intermediates must be related in some fashion to rates of
formation, degradation, and conversion to product before being
meaningfully interpreted, and this is not possible at present for any
in vivo V(D)J recombination system.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Configuration-specific differences in recombination
outcome. RSS orientation dictates the type of junction that will be
recovered after recombination. Three different outcomes, a signal joint
via deletion, a signal and coding joint via inversion, and a coding
joint via deletion via represent the recovered products resulting from
the configurations shown in sections A, B, and C, respectively.
Regardless of configuration, stage 1 operations involve cleavage at the
heptamers of each RSS (shown as an open triangle for the 12-RSS and as
a solid triangle for the 23-RSS). At the end of stage 1, as shown in
the middle column (`Cleaved intermediate'), two blunt signal ends and
two hairpin-terminated coding ends are formed in every case.
Subsequently, during stage 2, there are different operations required
for resolution of the coding and/or signal ends. The identity of stage
1 operations and the divergence of stage 2 operations with different
configurations forms the basis for distinguishing the postcleavage
effects of RSS sequence in vivo.
|
|
In brief, a pair of 12- and 23-RSSs will recombine when present in any
of three possible configurations, here designated SJ

,
Inv, and
CJ

. Regardless of configuration, identical stage 1 operations
must
take place; that is, the engagement of two RSSs and the cleavage
of
four DNA strands. In all cases, the products of RAG-mediated
cleavage
are one pair of blunt signal ends and one pair of hairpin-terminated
coding ends (Fig.
1). However, after stage 1, each of the three
configurations results in a different product (reviewed in references
15 and
22). For the SJ

configuration, a signal joint is created
by simple ligation of two
signal ends. For CJ

, DNA ends with
hairpin termini must be opened
and variably modified in the process
of becoming connected to form a
coding joint. For the Inv configuration,
coding and signal ends are
both joined, and the coding and signal
joint products must be formed in
a temporally correlated fashion
(Fig.
1). If all steps in stage 1 are
the same and all products
in stage 2 are different, it follows by
simple logic that configuration-related
differences in the joining
proficiency of an RSS should be attributed
to the processes that take
place after stage 1 and during stage
2.
We have employed an extrachromosomal V(D)J recombination assay to
detect configuration-related differences in cryptic RSS
recombination,
and one caveat to the line of reasoning outlined
above is that
topological differences in our recombination substrates
may create
configuration-specific stage 1 effects. By altering
the relative
orientation of the RSSs, it is possible that physical
limitations to
DNA flexibility introduce different degrees of
strain during stage 1 at
the time of synapsis (discussed, for
example, in reference
36). For the sake of clarity, a detailed
description
of the experiments performed to address this possibility
has been
deferred to the end of the Results
section.
The stage 2 competence of a given RSS was determined by inserting the
sequence at a position termed site 1 within the plasmid
construct. The
RSS was tested for joining with a canonical 23-RSS
positioned at site 3 (Fig.
2) in up to three different
configurations
(SJ

, Inv, and CJ

). For standardization, the
recombination of
an invariant control 12-RSS in site 2 with the 23-RSS
in site
3 was also measured in parallel. The ratio of site 1 and site
2 recombinants gave the relative joining proficiency (RJP) for
a given
construct.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Recombination substrates. In all substrates, 12-RSSs
occur at sites 1 or 2, and the canonical 23-RSS is inserted at site 3. The frequency with which a given test RSS positioned at site 1 recombines is tested relative to the frequency with which the invariant
sequence at site 2 is rearranged. In each section of the figure,
labeled bars represent the oligonucleotide probes that are used in the
typing of recombinants (see Materials and Methods). (A) The SJ
substrate and two possible recombinant deletion products, involving
either the site 1 or site 2 RSS. (B) Inv substrate with the inversional
recombinant resulting from site-1-to-site-3 rearrangement and site 2 deletion product. (C) The CJ substrate is shown with the deleted
coding joint product. This plasmid is cotransfected with the site 2 control plasmid, which gives rise to the site 2 deletion product.
|
|
To establish the RJP values for the canonical sequence, three
substrates, pWT-SJ

, pWT-Inv, and pWT-CJ

, were created bearing
a
canonical sequence, called WT, in site 1. Each construct was
transfected multiple times into the 204-1-8 cell line, which is
an
Abelson murine leukemia virus-transformed pre-B-like cell active
for
V(D)J recombination (see Materials and Methods). The RJP of
the WT
sequence when measured in the SJ

plasmid was 90 (units
are arbitrary
and defined by the site 2 control RSS, which is
a noncanonical sequence
[
24,
25]). With pWT-CJ

, a similar
RJP of 62 was
obtained. Finally, the RJP for WT in the pWT-Inv
plasmid was 5.0, a
value much lower than the RJP for WT in either
deletional construct
(Fig.
3).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Variant RSSs and configuration-specific RJP. The
sequence of each tested RSS is given, indicating matches to the
canonical RSS in uppercase letters. Spacer sequences were changed
according to the dictates of a given experiment. The 12a spacer is an
arbitrary sequence as given previously (25). The 12b spacer
is identical to the spacer of the RSS appearing in site 2, and the 12c
spacer is a continuation of the CA repeat. The total number of
recombinants typed as either site 1 or site 2 rearrangements is given
for each of the SJ and Inv constructs. For experiments where the
site 2 control was introduced on a separate plasmid, the values shown
are calculated as described in Materials and Methods (a sample
calculation is given in Fig. 4). The RJP is defined as the ratio of
site 1 to site 2 recombinants. The ratio of inversion to SJ provides
a means by which to compare the stage 2 impact of a different RSS
variants. Superscript numbers: 1, cotransfection of p6131-SJ no2 and
the site 2 control plasmid (see Fig. 2C); 2, cotransfection of
p6131-Invno2 and the site 2 control plasmid; 3, cotransfection of
p6131-Inv(506) (in which the distance between sites 1 and 3 was
increased from 279 to 506 bp) and the site 2 control plasmid; and 4, cotransfection of p6131-CJ (546) (in which the distance between sites
1 and 3 was increased from 319 to 546 bp) and the site 2 control
plasmid.
|
|
The fact that the RJP of a consensus RSS in an inversional
configuration is not on par with the values measured for the deletional
configuration (SJ

or CJ

) demonstrates, as observed by others,
that the joining proficiency of an RSS is configuration sensitive
when
measured in the extrachromosomal assay (
12).
Configuration-specific
differences in joining proficiency have been
attributed to the
fact that inversion requires the coordinate formation
of two joints,
whereas for deletion only one junction need be created.
Having
established a canonical standard in each configuration, we can
compare the behavior of other, noncanonical DNA sequences tested
similarly. That is, with a noncanonical RSS, the RJP for all constructs
may be proportionally depressed, in which case there would be
no
evidence for sequence discrimination during stage 2. Alternatively,
the
RJP for certain configurations might be disproportionately
reduced. The
latter situation would indicate that sequence specificity
pertains even
to the postcleavage phase of V(D)J recombination
and would additionally
provide clues as to the affected postcleavage
process.
Cryptic RSSs show configuration-specific deficits in RJP.
Two
cryptic signals were tested for joining proficiency in each of three
configurations (Fig. 2). One cryptic RSS, termed 6131 (24),
differs from the WT RSS at multiple positions within both the heptamer
and nonamer. In all, 7 of 16 nucleotides in the 6131 sequence are
noncanonical (Fig. 3). (The 6131 sequence also served as the control
against which the RJP of each test RSS was determined.) A second
cryptic RSS, termed CA, was comprised of a CA dinucleotide repeated 14 times. CA repeats are highly represented in both mouse and human
genomes, occurring once every 30 kb according to one estimate
(41), and are known to possess cryptic signal function in an
endogenous chromosomal context as well as by the extrachromosomal assay
(11, 24). Compared to a consensus RSS, the pure CA repeat
diverges at six positions (Fig. 3), and again these differences are
distributed between both the heptamer and the nonamer.
Six constructs (representing each of three configurations for the two
cryptic RSSs) were tested in 204-1-8 cells. The numbers
of site 1 and
site 2 recombinants were determined (details are
given in Materials and
Methods). As expected, both 6131 and CA
were much weaker than the
consensus WT sequence, regardless of
orientation. For example, in an
SJ

-type construct, 6131 and CA
both exhibited RJPs of about 0.5, well below the value of 90 obtained
for the canonical RSS (pWT-SJ

;
see Fig.
3).
The key result however was that both 6131 and CA were considerably more
compromised for inversion than they were for deletional
signal joint
formation (Fig.
3). For comparison, the ratios of
the RJPs obtained
with pInv-type plasmids versus the RJPs obtained
with SJ

-type
plasmids are presented in Fig.
3. Thus, as mentioned
above, the WT
sequence supports inversion less readily than deletional
signal joint
formation, giving an Inv/SJ

ratio of 1:18. If stage
2 operations
were unaffected by substitution of a cryptic RSS,
we would observe the
same Inv/SJ

ratio for the cryptic sequences
despite an overall
depression in recombination proficiency. However,
the cryptic RSS 6131 gave a much lower ratio of 1:167, and CA
gave a ratio of 1:124. Thus,
6130 and CA are excessively impaired
in their ability to support
inversion.
The diminished Inv/SJ

ratio for CA or 6131 does not of itself reveal
whether it is the nature of the joints resulting from
inversion (i.e.,
a coding joint and a signal joint) or the number
of joints that must
form (i.e., two instead of one) that becomes
problematic after cryptic
RSS cleavage (Fig.
1). This question
can be explored through testing
CJ

constructs, where coding joints
are formed in a one-joint
(deletional) rather than the two-joint
(inversional) context. An
impediment that relates specifically
to coding end joining at stage 2 will be revealed if joining proficiency
for a cryptic RSS is
excessively reduced for the CJ
configuration.
It is necessary to reverse the orientation of the 23-RSS at site 3 in
the CJ

configuration (Fig.
1C). Consequently, the 23-RSS
is in the
wrong orientation with respect to the control RSS at
site 2 to measure
site 2 deletion formation as before (see Fig.
2C). CJ

plasmids were
therefore cotransfected with a separate
control plasmid (Fig.
2C). This
control plasmid was identical
to an SJ

plasmids except that at site
1 the RSS was replaced
by an inert sequence. For transfection, the
CJ

plasmid was mixed
in a 1:1 ratio with the control site 2 plasmid.
The effective
ratio (of molecules that successfully reached the
nucleus) was
determined by assessing the representation of each plasmid
among
replicated DNA molecules after transfection, as described in
Materials
and Methods. This result was used to normalize the numbers of
site 1 or site 2 recombinants measured in the usual manner by
filter
hybridization of chloramphenicol-resistant transformants
(see Fig.
4B).
Whereas the canonical RSS had given similar RJPs when tested in either
the SJ

or the CJ

configuration (90 and 62, respectively;
Fig.
3),
this was not the case for either 6131 or CA. The RJP
for p6131-SJ

was 0.50, while the RJP for p6131-CJ

was only 0.064
(Fig.
3).
Similarly, pCA-SJ

gave an RJP of 0.46, while pCA-CJ
gave an RJP
of only 0.031. Thus, it was clear that both of the
cryptic signals,
6131 and CA, were particularly ineffective in
supporting coding-joint
formation.
The RJP for a given construct is reproducible.
The
reproducibility of RJP measurements was good, as shown in Fig.
4A. The construct p6131-SJ
contains
the same sequence (i.e., 6131) at both sites 1 and 2, each being
oriented to promote a deletional signal joint formation. Nine separate
transfections were performed several years apart by different authors.
After analysis by transformation of E. coli with DNA from
each of nine transfections, it can be seen that the RJP for any single
determination is close to the RJP calculated from the pooled numbers
(0.50), and the mean for the nine trials was 0.52 ± 0.15. Based
upon the fact that there was little variation in the RJP from one
transfection to the next, we have pooled the total number of site 1 and
site 2 recombinants to give the RJP for all constructs, as shown in Fig. 3. To assure representative samplings, no more than one-fifth of a
given transfection was transformed into E. coli. DNA
sequence analysis of coding-joint recombinants indicated that the
methods employed were not susceptible to "jackpot" effects (that
is, multiple reisolation of a single recombinant due to vector
replication in the transfected 204-1-8 cells), even in cases where
screening one-fifth of a transfection yielded only a few, rare site 1 recombinants.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Reproducibility of the measured RJP. (A) Nine
transfections of p6131-SJ were conducted and screened. The top four
transfections were performed 4 years earlier than the bottom five.
These numbers correspond to the pooled data reported in Fig. 3. (B) Ten
transfections of p6131-CJ cointroduced with the site 2 control
plasmid were analyzed. Colonies selected on chloramphenicol were typed
to determine the number of site 1 and site 2 recombinants as usual
(columns A and B). Colonies isolated on ampicillin after
DpnI digestion of the harvested DNA were typed to determine
the numbers of each parental plasmid successfully transfected as
described in Materials and Methods (columns C and D). Colony counts
were normalized as shown (two subsequent columns) to give the RJP
(rightmost column).
|
|
The fine-structure features of the products of cryptic RSS
recombination are normal.
Our data suggested that engagement of a
cryptic RSS by the V(D)J joining machinery affects the efficiency of
coding-joint formation. It was therefore of interest to investigate
whether the fine structure of coding joints resulting from cryptic RSS recombination was altered. Abnormal loss of DNA sequence up to a limit
of 111 bp from the site 1-associated coding end and up to 23 nucleotides from the canonical site 3-associated coding end is detected
by the present approach. In addition, it is also informative to score P
nucleotide insertion, which reflects details of the hairpin opening
step (6, 23, 28).
Analysis of 44 recombinant coding joints, incorporating all variant
RSSs, is presented in Fig.
5. There were no gross anomalies.
Nucleotide
loss as well as insertion at the joint were within
normal ranges and
fully consistent with prior analyses of joints
formed in the same cell
line with canonical extrachromosomal recombination
substrates (
21,
24,
25,
28). Coding joints formed from
the CA RSS included bits
of the CA repeat itself at the junction,
but this was not unexpected
given that a CA repeat can be targeted
in multiple ways, by shifting
the recognized sequence by 2-bp
increments (see Fig.
5B for examples). DNA
sequence analysis of
signal joints recovered from pCA-Inv and pCA-SJ

were consistent
with this interpretation and exhibited recombination
sites at
the CAC delimiting the 12th or 13th repeat in addition to that
appearing at the 14th repeat (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Coding joints. (A) Sequences of coding joints from
randomly selected inversions (Inv) and deletions (CJ ). Underlined
nucleotides can be assigned to either end. (B) Variant target
recognition of a CA repeat. As seen in analysis of coding joints in
panel A, as well as of signal joints (not shown), a CA repeat is
recognized in alternative frames displaced by 2 bp. Heptamer and
nonamer elements are in boldface, and capital letters indicate matches
to the canonical sequence.
|
|
Additionally, at least two signal joints were sequenced for each of the
tested RSSs. Dozens more from various experiments
were assessed by
digestion with
ApaLI, (a restriction enzyme specific
for the
GTGCAC sequence formed at a precise signal joint). No
irregularity with respect to signal joint structure was
revealed.
Our analysis indicated that a cryptic RSS causes a depression in coding
joint recovery without affecting the properties of
the junctions that
are observed. The apparent interruption of
recombination events
involving a cryptic RSS is not circumvented
in any obvious way by
alternative resolution
functions.
Both the nonamer and heptamer elements of the RSS are recognized
during rejoining of cleaved ends.
To explore the importance of the
nonamer motif of the RSS in stage 2 operations, we determined
configuration-specific RJP values for the NOnon RSS. As its name
implies, NOnon possessed a noncanonical substitution at each position
of the nonamer. Otherwise, the heptamer (as well as spacer) sequence of
NOnon was identical to that of WT. The result, as shown in Fig. 3, was
that inversion was excessively depressed for NOnon, (the Inv/SJ
ratio was 1:55), indicating that the nonamer portion of the RSS motif
is recognized during postcleavage, stage 2, joining operations.
To determine whether stage 2 operations require site-specific
interactions with the heptamer as well, we tested an RSS variant,
termed 6131h/WTnon (Fig.
3). Here only the three nonamer-proximal
nucleotides of the heptamer deviate from the canonical sequence
(the
heptamer being CACAaca instead of CACAGTG). We
found that
whereas signal joint formation was only mildly affected by
the
variant RSS (the RJP was 24 as opposed to the RJP of 90 for a
canonical RSS), there was nevertheless a significant stage 2 impact.
The inversional construct gave 0.16 for p6131h/WTnon-Inv as opposed
to
5.0 for pWT-Inv. In other words, the Inv/SJ

ratio was 1:150
for the
RSS with a mutant heptamer compared to the 1:18 value
for pWT (Fig.
3).
The 6131h/WTnon result demonstrates that a configuration-related
depression of joining proficiency is seen upon modification
of the
heptamer only. The apparent stage 2 sequence specificity
is revealed
upon introduction of a minimal change in the RSS,
for which, as seen
for the SJ

construct, joining function has
not been greatly
compromised. Thus, there is no obvious correlation
between the strength
of a cryptic signal and its stage 2
impact.
Taken together, the results obtained with 6131h/WTnon and NOnon
highlight differences between RSS features that have been
predicted to
have an impact upon stage 1 binding and cleavage
and those that are of
more consequence in postcleavage, stage
2 operations. Based upon
studies that measure cleavage or binding
of RSSs by RAG1/2 (
2,
10,
19,
31), the nonamer is more
critical than the heptamer for
binding and, in particular, the
nonamer-proximal nucleotides of the
heptamer are relatively unimportant
for either precleavage binding or
cleavage
itself.
Differences between stage 1 and stage 2 sequence specificity are
further established with T4Anon.
Previous studies have shown that
A-to-T transversions within the A tract of the nonamer result in an RSS
that is bound no better than a nonamerless (or randomized-nonamer) RSS
by RAG1/2 (2, 10). To determine if A-to-T transversions
similarly affect RSS function during stage 2, a final variant, T4Anon,
was tested. This sequence was identical to WT except that every A
nucleotide within the nonamer had been replaced by a T (i.e.,
TCTTTTTCC). Overall, the T4Anon RSS is noncanonical at a total
of 6 of 16 positions.
Oddly enough, the results with T4Anon in the configuration-sensitive
assay contrasted with those of every other variant described
above. For
T4Anon, the Inv/SJ

ratio gave no indication of an
impairment of
stage 2 functions. The ratio was 1:15, a value actually
somewhat higher
than the Inv/SJ

ratio for a canonical RSS and
much higher than that
for the nonamerless RSS (NOnon). T4Anon
was also tested in the CJ

configuration, where the RJPs for signal
joints and coding joints were
9.6 versus 2.7. By these tests,
the T4A sequence was found to have only
a mild, if any, effect
on stage 2 joining operations. This is
exceptional and indicates
that T-to-A transversions in the nonamer,
which as noted above
have a large impact on binding and cleavage by
RAG1/2 in vitro,
do not adversely affect stage 2
joining.
The configuration-specific assay is not sensitive to topological
and topographical differences between test plasmids.
In the
present study experimental variation is strictly limited to RSS
orientation, stage 2 effects being deduced on the basis of
configuration-sensitive effects on joining proficiency (Fig. 1). The
distance between the interacting RSSs had been chosen according to the
structure of the original plasmid upon which the present substrates are
based (17) and is within a range (roughly 250 to 300 bp) for
which it is conceivable that synapsis of the two RSSs might be impeded
by the difficulty of bending the intervening DNA in certain
configurations but not others. Should this be the case, then
configuration-sensitive changes in RJP could reflect a need for strong
RSS interactions during synapsis (i.e., during stage 1) and not later,
as outlined in Fig. 1. Additionally, a related concern is that although
the distance between the midpoint of the RSSs in site 1 and that of
site 3 are maintained in all substrates without exception, the
distances between the points of DNA cleavage (located at the heptamer
edge of each RSS) must differ with orientation. Lastly, a feature that might confound the analysis is that the CJ
recombinants have to be
normalized against a cointroduced control plasmid.
To determine which, if any, of the above factors should be taken into
account in the interpretation of the results, several
additional
experiments were performed. We again measured the RJP
for the 6131 RSS
in both the SJ

and the Inv configurations, having
first removed site
2 from the test constructs. The new constructs
(p6131-SJ

no2 and
p6131-Invno2) were then cotransfected with the
site 2 control plasmid,
and results were normalized as described
for the CJ

series of
constructs (Fig.
4). The values obtained
whether or not the site 2 RSS
was located on the same substrate
molecule as the test RSS were quite
close: where the RJP of p6131-Inv
was 0.0030, that of p6131-Invno2 was
0.0059. Similarly, the RJP
of p6131-SJ

was 0.50, while that of
p6131-SJ

no2 was 0.34 (Fig.
3). These results indicated that the
relative joining proficiency
is roughly the same even if the site 2 control is measured on
a separate, cotransfected substrate. Thus, for
example, the possibility
of secondary rearrangements (between the
rearranged 23-RSS in
an inversional site 1 recombinant and the site 2 RSS) can be discounted,
and it is valid to compare the CJ

results
with results obtained
for other
configurations.
Concerns about how the varied inter-RSS distances and the different
topologies might affect synapsis were also addressed.
If the difficulty
of bending covalently closed DNA to bring the
two RSSs together is a
significant factor in these experiments,
configuration-specific joining
deficits may actually reflect poor
RSS binding during stage 1 and not
stage 2. Although differences
in DNA flexibility do not cause marked
differences in ring closure
for DNA fragments in the size range
separating the cleavage and
joining sites in the present substrates
(251 bp for SJ

, 319 bp
for CJ

, and 279 bp for Inv) (
38,
39), shortening the intersignal
distance still further in V(D)J
recombination substrates has been
shown to reduce recombination
frequencies (
36). To determine
whether
configuration-specific joining deficits are a manifestation
of a
hindered synapsis at stage 1 caused by close spacing between
the RSSs,
we looked for an amelioration of the deficits upon increasing
the
intersignal distance. In particular, for the 6131 RSS, we
tested
whether nearly doubling the distance between the 12 and
23 signals
could improve the RJP for this sequence in either the
Inv or the CJ
configuration.
The constructs p6131-Inv(506) and p6131-CJ

(546) were each
cotransfected with the control site 2 plasmid, and the RJPs were
determined. Results for both of the larger substrates were fully
consistent with those obtained using the original, standard versions
(Fig.
3). No site 1 recombinants were found among the 805 recombinants
screened for p6131-Inv(506), which compares well to, and is certainly
not better than, the 8 site 1 recombinants per 1,358 obtained
with the
construct for which the intersignal distance was 279
bp (Fig.
3).
Reconstruction experiments confirmed that the recombinant
form of
p6131-Inv should have been detected (data not shown).
The plasmid
p6131-CJ

(546) also had an RJP value like its standard
counterpart:
0.071 compared to 0.064. Thus, there was no evidence
that precleavage
strain due to the different topologies of the
variously configured
substrates could account for the observed
configuration-sensitive
depressions in
RJP.
 |
DISCUSSION |
Cells in which cryptic RSSs have been recognized and cleaved can
threaten survival of an animal, even when the breaks are generated at a
very low frequency. This is because the proliferative and highly
selective nature of the lymphoid tissue is such that a cell with a
preleukemic rearrangement caused by illegitimate V(D)J recombination is
especially at risk of becoming clonally expanded. We know that the
stringency of target site recognition is not so refined as to eliminate
mistargeting altogether (discussed in reference 24),
and it is of interest to learn what biological mechanism might exist to
recognize and rectify recombination errors once the process has
proceeded as far as cleavage.
Two cryptic RSSs, 6131 and CA, were chosen for a detailed analysis.
Although neither sequence closely matches a canonical RSS, both
sequences are able to function at a low level in V(D)J recombination
(24). 6131 is a sequence discovered to contribute to an
unwanted background in the extrachromosomal assay (17). The
other cryptic RSS, CA, corresponds to an abundant dinucleotide repeat
in the mouse and human genomes (41) and has been seen to
function as a cryptic RSS in the human hprt locus
(11). 6131 and CA are representative of millions of
naturally occurring RSS-like sequences in the genome with respect to
their resemblance to the canonical RSS, being similarly divergent in
both the heptamer and the nonamer (24).
To learn whether sequence discrimination occurs not only in the initial
binding and cleavage of a V(D)J recombination target (stage 1) but also
during the second, rejoining phase of the gene assembly process (stage
2), we tested 6131 and CA for evidence of configuration-sensitive
differences in V(D)J joining proficiency. In both cases, the results
reveal a defect in carrying out stage 2 operations, indicating that
there is indeed sequence recognition late in the joining reaction.
These findings extend previous studies that implicate RAG1/2 in
postcleavage operations (5, 20, 29, 33, 37, 42) by providing
evidence that the protein-DNA interactions are both sequence specific
and relevant in vivo.
Significantly, despite the fact that by the second stage of V(D)J
recombination the coding ends have become unlinked from their RSSs, the
CA and 6130 sequences quite clearly exhibited a deficit in coding-joint
formation. This raises the logical question as to why operations that
effect coding-end joining should depend upon site-specific DNA
recognition between recombination proteins and the signal ends.
One likely explanation for postcleavage sequence specificity is a
requirement for RAG1/2 to be retained within a protein-DNA complex in
order to carry out an enzymatic role in the postcleavage processing of
coding ends. The notion that later steps in V(D)J recombination take
place in the context of a specific postcleavage complex has had
experimental support from several quarters (1, 14, 18, 20)
and, although the complex itself (along with all associated components)
is not yet biochemically defined, several stable postcleavage complexes
containing RAG1/2 and cleaved DNA ends have been described. The various
complexes contain RAG1/2, HMG-1 (or -2) and all four ends
(18), RAG1/2 and the cut coding and signal end derived from
a single RSS (4), and complexes comprised of RAG1/2 together
with two cut signal ends (1). The present results are
consistent with an in vivo role for a postcleavage complex minimally
involving RAG protein and both types of cut end (signal end as well as
coding end) in the resolution of recombination intermediates.
A more specific suggestion that fits well with our data is that RAG1/2
itself is responsible for opening hairpin coding-end intermediates
and/or for further processing of the coding ends during their ligation
(5, 33, 37). If the signal ends help to anchor RAG1/2 in the
vicinity of the hairpin coding ends through RSS-specific interactions
and if RAG1/2 provides essential hairpin DNA processing functions, then
it follows that sequence-specific interactions involving the RSS should
influence the joining of coding ends even though coding ends have, by
this time, become unlinked from the RAG recognition motifs.
Further, characterization of stage 2 sequence specificity has revealed
the importance of both heptamer and nonamer elements in postcleavage
joint formation. Of particular interest, a marked postcleavage effect
was revealed with the RSS-like sequence, 6131H/WTnon, in which the only
noncanonical alteration was in the three nonamer-proximal nucleotides
of the heptamer (i.e., CACAGTG to CACAaga).
Mutational analyses of the nonamer-proximal nucleotides in the
heptamer have shown relatively small effects on the early binding
and/or cleavage of RSS-containing DNA by purified RAG1/2 in vitro
(2, 31). In contrast, these three nucleotides have a clear
in vivo function during stage 2 of V(D)J joining. It is possible that
the interaction in question is fairly weak and/or transient, and it is
of particular interest that nonamer-proximal nucleotides of the
heptamer have been highlighted as a possible contact site for RAG1/2 in
one modification interference study (43).
We suggest that the postcleavage complex serves as a focal point in the
control of fidelity in V(D)J recombination. After RSS cleavage, coding
ends are excluded from ligation events until the hairpin structure at
the DNA ends is opened. For a cryptic RSS, a failure to anchor RAG1/2
in a postcleavage complex through its interactions with the RSS could
interfere with efficient hairpin removal. Such a delay in hairpin end
opening, perhaps interpreted by cellular control mechanisms as
irreparable DNA damage, may trigger an apoptotic response. Given the
fact that mistakes in RSS target recognition are not fully avoidable,
sequence specificity during stage 2 of V(D)J recombination may provide
an essential safeguard against pathogenic rearrangements during pre-B-
and pre-T-cell differentiation.
 |
ACKNOWLEDGMENTS |
We thank Howard Lipshitz and anonymous reviewers for comments on
the manuscript.
This work was supported by a grant from the National Cancer Institute
of Canada (NCIC). E.A.A. is a recipient of a Doctoral Research Award
from the Medical Research Council of Canada. S.M.L. is a Scientist of
the NCIC.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Program in
Genetics and Genomic Biology, Hospital for Sick Children Research
Institute, 555 University Ave., Toronto, ON, Canada M5G 1X8. Phone:
416-813-8980. Fax: 416-813-8883. E-mail: susanna{at}sickkids.on.ca.
 |
REFERENCES |
| 1.
|
Agrawal, A., and D. B. Schatz.
1997.
RAG1 and RAG2 form a stable post-cleavage synaptic complex with DNA containing signal ends in V(D)J recombination.
Cell
89:43-53[CrossRef][Medline].
|
| 2.
|
Akamatsu, Y., and M. A. Oettinger.
1998.
Distinct roles of RAG1 and RAG2 in binding the V(D)J recombination signal sequences.
Mol. Cell. Biol.
18:4670-4678[Abstract/Free Full Text].
|
| 3.
|
Aplan, P. D.,
D. P. Lombardi,
A. M. Ginsberg,
J. Cossman,
V. L. Bertness, and I. R. Kirsch.
1990.
Disruption of the human SCL locus by "illegitimate" V-(D)-J recombinase activity.
Science
250:1426-1429[Abstract/Free Full Text].
|
| 4.
|
Bailin, T.,
X. Mo, and M. Sadofsky.
1999.
A RAG1 and RAG2 tetramer complex is active in cleavage in V(D)J recombination.
Mol. Cell. Biol.
19:4664-4671[Abstract/Free Full Text].
|
| 5.
|
Besmer, E.,
J. Mansilla-Soto,
S. Cassard,
D. J. Sawchuk,
G. Brown,
M. Sadofsky,
S. M. Lewis,
M. C. Nussenzweig, and P. Cortes.
1998.
Hairpin coding end opening is mediated by the recombination activating genes RAG1 and RAG2.
Mol. Cell
2:817-828[CrossRef][Medline].
|
| 6.
|
Binnie, A.,
S. Olson,
G. E. Wu, and S. M. Lewis.
1999.
Gamma-irradiation directly affects the formation of coding joints in SCID cell lines.
J. Immunol.
163:5418-5426[Abstract/Free Full Text].
|
| 7.
|
Brown, L.,
J.-T. Cheng,
Q. Chen,
M. J. Siciliano,
W. Crist,
G. Buchanan, and R. Baer.
1990.
Site-specific recombination of the tal-1 gene is a common occurrence in human T cell leukemia.
EMBO J.
9:3343-3351[Medline].
|
| 8.
|
Cherry, S. R., and D. Baltimore.
1999.
Chromatin remodeling directly activates V(D)J recombination.
Proc. Natl. Acad. Sci. USA
96:10788-10793[Abstract/Free Full Text].
|
| 9.
|
Chervinsky, D. S.,
X. F. Zhao,
D. H. Lam,
M. Ellsworth,
K. W. Gross, and P. D. Aplan.
1999.
Disordered T-cell development and T-cell malignancies in SCL LMO1 double-transgenic mice: parallels with E2A-deficient mice.
Mol. Cell. Biol.
19:5025-5035[Abstract/Free Full Text].
|
| 10.
|
Difilippantonio, M. J.,
C. J. McMahan,
Q. M. Eastman,
E. Spanopoulou, and D. G. Schatz.
1996.
RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination.
Cell
87:253-262[CrossRef][Medline].
|
| 11.
|
Fuscoe, J. C.,
L. J. Zimmerman,
M. J. Lippert,
J. A. Nicklas,
J. P. O'Neill, and R. J. Albertini.
1991.
V(D)J recombinase-like activity mediates hprt gene deletion in human fetal T-lymphocytes.
Cancer Res.
51:6001-6005[Abstract/Free Full Text].
|
| 12.
|
Gauss, G. H., and M. R. Lieber.
1992.
The basis for the mechanistic bias for deletional over inversional V(D)J recombination.
Genes Dev.
6:1553-1561[Abstract/Free Full Text].
|
| 13.
|
Golding, A.,
S. Chandler,
E. Ballestar,
A. P. Wolffe, and M. S. Schlissel.
1999.
Nucleosome structure completely inhibits in vitro cleavage by the V(D)J recombinase.
EMBO J.
18:3712-3723[CrossRef][Medline].
|
| 14.
|
Grawunder, U., and M. R. Lieber.
1997.
A complex of RAG-1 and RAG-2 proteins persists on DNA after single-strand cleavage at V(D)J recombination signal sequences.
Nucleic Acids Res.
7:1375-1382[Abstract/Free Full Text].
|
| 15.
|
Grawunder, U.,
R. B. West, and M. R. Lieber.
1998.
Antigen receptor gene rearrangement.
Curr. Opin. Immunol.
10:172-180[CrossRef][Medline].
|
| 16.
|
Hammarsten, O.,
L. G. DeFazio, and G. Chu.
2000.
Activation of DNA-dependent protein kinase by single-stranded DNA ends.
J. Biol. Chem.
275:1541-1550[Abstract/Free Full Text].
|
| 17.
|
Hesse, J. E.,
M. R. Lieber,
K. Mizuuchi, and M. Gellert.
1989.
V(D)J recombination: a functional definition of the joining signals.
Genes Dev.
3:1053-1061[Abstract/Free Full Text].
|
| 18.
|
Hiom, K., and M. Gellert.
1998.
Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination.
Mol. Cell
1:1011-1019[CrossRef][Medline].
|
| 19.
|
Hiom, K., and M. Gellert.
1997.
A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage.
Cell
88:65-72[CrossRef][Medline].
|
| 20.
|
Leu, R. M. J.,
Q. M. Eastman, and D. G. Schatz.
1997.
Coding joint formation in a cell-free V(D)J recombination system.
Immunity
7:303-314[CrossRef][Medline].
|
| 21.
|
Lewis, S.,
J. E. Hesse,
K. Mizuuchi, and M. Gellert.
1988.
Novel strand exchanges in V(D)J recombination.
Cell
55:1099-1107[CrossRef][Medline].
|
| 22.
|
Lewis, S. M.
1994.
The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses.
Adv. Immunol.
56:27-150[Medline].
|
| 23.
|
Lewis, S. M.
1994.
P nucleotide insertions and the resolution of hairpin DNA structures in mammalian cells.
Proc. Natl. Acad. Sci. USA
91:1332-1336[Abstract/Free Full Text].
|
| 24.
|
Lewis, S. M.,
E. Agard,
S. Suh, and L. Czyzyk.
1997.
Cryptic signals and the fidelity of V(D)J joining.
Mol. Cell. Biol.
17:3125-3136[Abstract].
|
| 25.
|
Lewis, S. M., and J. E. Hesse.
1991.
Cutting and closing without recombination in V(D)J joining.
EMBO J.
10:3631-3639[Medline].
|
| 26.
|
Lieber, M. R.,
J. E. Hesse,
S. Lewis,
G. C. Bosma,
N. R. Rosenberg,
K. Mizuuchi,
M. J. Bosma, and M. Gellert.
1988.
The defect in murine severe combined immune deficiency: Joining of signal sequences but not coding segments in V(D)J recombination.
Cell
55:7-16[CrossRef][Medline].
|
| 27.
|
Matsuda, F.,
K. Ishii,
P. Bourvagnet,
K. Kuma,
H. Hayashida,
T. Miyata, and T. Honjo.
1998.
The complete nucleotide sequence of the human immunoglobulin heavy chain variable region locus.
J. Exp. Med.
188:2151-2162[Abstract/Free Full Text].
|
| 28.
|
Meier, J. T., and S. M. Lewis.
1993.
P nucleotides in V(D)J recombination: a fine-structure analysis.
Mol. Cell. Biol.
13:1078-1092[Abstract/Free Full Text].
|
| 29.
|
Ramdsen, D. A.,
T. T. Paull, and M. Gellert.
1997.
Cell-free V(D)J recombination.
Nature
388:488-491[CrossRef][Medline].
|
| 30.
|
Ramsden, D. A.,
K. Baetz, and G. E. Wu.
1994.
Conservation of sequence in recombination signal sequence spacers.
Nucleic Acids Res.
22:1785-1796[Abstract/Free Full Text].
|
| 31.
|
Ramsden, D. A.,
J. F. McBlane,
D. C. V. Gent, and M. Gellert.
1996.
Distinct DNA sequence and structure requirements for the two steps of V(D)J recombination signal cleavage.
EMBO J.
15:3197-3206[Medline].
|
| 32.
|
Rosenberg, N., and D. Baltimore.
1976.
A quantitative assay for transformation of bone marrow cells by Abelson murine leukemia virus.
J. Exp. Med.
143:1453-1463[Abstract/Free Full Text].
|
| 33.
|
Santagata, S.,
E. Besmer,
A. Villa,
F. Bozzi,
J. Allingham,
C. Sobacchi,
D. B. Haniford,
P. Vezzoni,
M. C. Nussenzweig,
Z.-Q. Pan, and P. Cortes.
1999.
The RAG1/RAG2 complex constitutes a 3' flap endonuclease: implications for junctional diversity in V(D)J and transpositional recombination.
Mol. Cell
4:935-947[CrossRef][Medline].
|
| 34.
|
Scheerer, J. B.,
L. Xi,
G. W. Knapp,
R. W. Setzer,
W. L. Bigbee, and J. C. Fuscoe.
1999.
Quantification of illegitimate V(D)J recombinase-mediated mutations in lymphocytes of newborns and adults.
Mutat. Res.
431:291-303[Medline].
|
| 35.
|
Schlissel, M. S., and P. Stanhope-Baker.
1997.
Accessibility and the developmental regulation of V(D)J recombination.
Semin. Immunol.
9:161-170[CrossRef][Medline].
|
| 36.
|
Sheehan, K. M., and M. R. Lieber.
1993.
V(D)J recombination: signal and coding joint resolution are uncoupled and depend on parallel synapsis of the sites.
Mol. Cell. Biol.
13:1363-1370[Abstract/Free Full Text].
|
| 37.
|
Shockett, P. E., and D. G. Schatz.
1999.
DNA hairpin opening mediated by the RAG1 and RAG2 proteins.
Mol. Cell. Biol.
19:4159-4166[Abstract/Free Full Text].
|
| 38.
|
Shore, D., and R. L. Baldwin.
1983.
Energetics of DNA twisting. II. Topoisomer analysis.
J. Mol. Biol.
170:983-1007[CrossRef][Medline].
|
| 39.
|
Shore, D.,
J. Langowski, and R. L. Baldwin.
1981.
DNA flexibility studied by covalent closure of short fragments into circles.
Proc. Natl. Acad. Sci. USA
78:4833-4837[Abstract/Free Full Text].
|
| 40.
|
Sleckman, B. P.,
J. R. Gorman, and F. W. Alt.
1996.
Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements.
Annu. Rev. Immunol.
14:459-481[CrossRef][Medline].
|
| 41.
|
Smider, V.,
W. K. Rathmell,
G. Brown,
S. Lewis, and G. Chu.
1998.
Failure of hairpin-ended and nicked DNA to activate DNA-dependent protein kinase: implications for V(D)J recombination.
Mol. Cell. Biol.
18:6853-6858[Abstract/Free Full Text].
|
| 42.
|
Stallings, R. L.,
A. F. Ford,
D. Nelson,
D. C. Torney,
C. E. Hildebrand, and R. K. Moyzis.
1991.
Evolution and distribution of (GT)n repetitive sequences in mammalian genomes.
Genomics
10:807-815[CrossRef][Medline].
|
| 43.
|
Steen, S. B.,
J. O. Han,
C. Mundy,
M. A. Oettinger, and D. B. Roth.
1999.
Roles of the "dispensable" portions of RAG-1 and RAG-2 in V(D)J recombination.
Mol. Cell. Biol.
19:3010-3017[Abstract/Free Full Text].
|
| 44.
|
Swanson, P. C., and S. Desiderio.
1998.
V(D)J recombination signal recognition: Distinct, overlapping DNA-protein contacts in complexes containing RAG1 with and without RAG2.
Immunity
9:115-125[CrossRef][Medline].
|
| 45.
|
Tonegawa, S.
1983.
Somatic generation of antibody diversity.
Nature
302:575-581[CrossRef][Medline].
|
| 46.
|
Whitehurst, C. E.,
S. Chattopadhyay, and J. Chen.
1999.
Control of V(D)J recombinational accessibility of the D beta 1 gene segment at the TCR beta locus by a germline promoter.
Immunity
10:313-322[CrossRef][Medline].
|
| 47.
|
Zhong, X. P.,
J. Carabana, and M. S. Krangel.
1999.
Flanking nuclear matrix attachment regions synergize with the T cell receptor delta enhancer to promote V(D)J recombination.
Proc. Natl. Acad. Sci. USA
96:11970-11975[Abstract/Free Full Text].
|
Molecular and Cellular Biology, July 2000, p. 5032-5040, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Swanson, P. C., Volkmer, D., Wang, L.
(2004). Full-length RAG-2, and Not Full-length RAG-1, Specifically Suppresses RAG-mediated Transposition but Not Hybrid Joint Formation or Disintegration. J. Biol. Chem.
279: 4034-4044
[Abstract]
[Full Text]
-
Montalbano, A., Ogwaro, K. M., Tang, A., Matthews, A. G. W., Larijani, M., Oettinger, M. A., Feeney, A. J.
(2003). V(D)J Recombination Frequencies Can Be Profoundly Affected by Changes in the Spacer Sequence. J. Immunol.
171: 5296-5304
[Abstract]
[Full Text]
-
Olaru, A., Patterson, D. N., Villey, I., Livak, F.
(2003). DNA-Rag Protein Interactions in the Control of Selective D Gene Utilization in the TCR{beta} Locus. J. Immunol.
171: 3605-3611
[Abstract]
[Full Text]
-
Marculescu, R., Le, T., Simon, P., Jaeger, U., Nadel, B.
(2002). V(D)J-mediated Translocations in Lymphoid Neoplasms: A Functional Assessment of Genomic Instability by Cryptic Sites. JEM
195: 85-98
[Abstract]
[Full Text]
-
Mo, X., Bailin, T., Sadofsky, M. J.
(2001). A C-Terminal Region of RAG1 Contacts the Coding DNA during V(D)J Recombination. Mol. Cell. Biol.
21: 2038-2047
[Abstract]
[Full Text]