Previous Article | Next Article ![]()
Molecular and Cellular Biology, July 2000, p. 5041-5047, Vol. 20, No. 14
Department of Adult Oncology, Dana-Farber
Cancer Institute, Boston, Massachusetts 02115
Received 25 February 2000/Returned for modification 20 March
2000/Accepted 24 April 2000
Growth factor modulation of estrogen receptor (ER) activity plays
an important role in both normal estrogen physiology and the
pathogenesis of breast cancer. Growth factors are known to stimulate
the ligand-independent activity of ER through the activation of
mitogen-activated protein kinase (MAPK) and the direct phosphorylation of ER. We found that the transcriptional activity of AIB1, a
ligand-dependent ER coactivator and a gene amplified preferentially in
ER-positive breast cancers, is enhanced by MAPK phosphorylation. We
demonstrate that AIB1 is a phosphoprotein in vivo and can be
phosphorylated in vitro by MAPK. Finally, we observed that MAPK
activation of AIB1 stimulates the recruitment of p300 and associated
histone acetyltransferase activity. These results suggest that the
ability of growth factors to modulate estrogen action may be mediated through MAPK activation of the nuclear receptor coactivator AIB1.
The estrogen receptor (ER) is a
member of the class I family of nuclear receptors (NRs) (for a review,
see reference 24). It contains three major
functional domains: an N-terminal activation domain (AF-1), a
DNA-binding domain (DBD) highly conserved among other NRs, and a
C-terminal hormone-binding domain which contains a second activation
domain (AF-2) (19, 38). Although AF-1 and AF-2 contribute
synergistically to the transcription of targeted genes, they have
different mechanisms of activation. AF-1 activity is highly dependent
on phosphorylation of serine 118 by mitogen-activated protein kinase
(MAPK) (18). In contrast, the more potent AF-2 is activated
by the binding of estrogenic ligands (3).
ER-mediated gene transcription is regulated at yet another level
depending on the ligand; ER interacts with corepressors or coactivators
that inhibit or enhance its activity on target genes. In the absence of
ligand, ER is sequestered in the nucleus by interaction with heat shock
proteins (29, 33). When activated by agonist ligand binding,
ER exerts its action by promoting chromatin remodeling and stimulating
the basal transcriptional machinery through interaction with a variety
of coactivators (1, 14-16, 23, 27, 28, 34). One of the
best-characterized groups of NR coactivators is the p160 family. When
bound to agonists such as estradiol, ER AF-2 engages signature motifs
(LXXLL) in the center of the p160 molecule (11). Recent
studies have shown that the AF-1 domain of ER also interacts with p160
coactivators (40, 42), though the interaction seems to occur
at a different site found in the C terminus of the p160 molecule. The
p160 coactivators also contain two activation domains, AD1 and AD2,
which are localized in the C terminus (6, 7, 41) and bind
the secondary coactivators p300/CREB binding protein (CBP) and
coactivator-associated arginine methyltransferase 1 (CARM1),
respectively. Thus, AD1 and AD2 act as signal output domains in the
process of transcriptional activation (22). Mutations in the
AD1 region greatly reduced or eliminated the ability of p160 proteins
to bind CBP or p300 and to serve as coactivators for NRs (7,
41), suggesting that AD1 is the principal coactivator domain responsible for downstream signaling through p300/CBP. In addition, the DRIP-ARC-TRAP-SMCC complex has also
been implicated in activation mediated by several NRs, including the
thyroid hormone and vitamin D receptors (17, 31). However,
the exact role this complex plays in ER-mediated activation remains to
be determined.
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
AIB1 Is a Conduit for Kinase-Mediated Growth Factor
Signaling to the Estrogen Receptor
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (24K):
[in a new window]
FIG. 1.
The MAPK pathway promotes ER-signaling. (A) COS cells
were transiently cotransfected with the wild-type human ER
and
either MKP1 or constitutively activated MEK1 (R
F). The transfection
also included the luciferase reporter under the control of the ERE2 and
tk-lacZ as an internal control. One day following transfection, cells
were stimulated with 10 nM 17-
-estradiol (E2) (+) or with ethanol
alone (
). On the third day, cells were lysed and assayed for the
reporter activity. Values represent the ratio between luciferase units
and
-galactosidase, relative to the basal activity of either ER or
ER(S118A) in the absence of estrogen. (B) ER
containing the S118A
mutation was cotransfected into COS cells as described above.
Autoradiographs in the insets demonstrate the MAPK activity for each of
the transfection conditions, using MBP as a substrate.
AIB1 (also named RAC3, ACTR, SRC-3, or p/CIP in mice) (7, 21, 36, 39) is amplified in certain breast and ovarian cancers (1) and is a member of the p160 family of coactivators (1, 21). Furthermore, AIB1 amplification is preferentially found in ER- and progesterone receptor-positive breast cancers (2). These findings suggest that AIB1 may play a critical role in steroid receptor signaling and breast cancer development. Other members of this family include SRC-1 and TIF2 (also named GRIP1); however, there is as of yet no evidence that they play an important role in human breast cancer.
Growth factors of the insulin-like growth factor (IGF) and epidermal
growth factor (EGF) family and their receptors have also been
implicated in the development and progression of breast tumors (4,
20, 30). These molecules signal by triggering a cytosolic kinase
cascade, including the activation of MAPK. In mice lacking ER
, both
estrogen and EGF stimulation of uterine growth is disrupted (10). Thus, ER may mediate the transcription of target genes by integrating different signals from growth factor-activated kinases
and the binding of steroid hormones. Accordingly, activation of
cytosolic kinases by growth factors may constitute a mechanism for
regulating NR responsiveness. We hypothesized that ligand-dependent coactivators such as AIB1 may mediate one level of the cross talk between growth factors and ER. To test this hypothesis, we evaluated the role of MAPK in AIB1-mediated coactivation. Our results suggest a
novel mechanism by which the MAPK signaling pathway is coupled to the
regulation of gene transcription by modulation of AIB1 transactivation capacity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and transfection.
MCF-7 and MDA-MB-468 human
breast cancer cells, COS African green monkey kidney cells, and BOSC
fetal human kidney cells were maintained in Dulbecco's modified
Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS). BT-474
human breast cancer cells were cultured in RPMI 1640 supplemented with
10% FBS. Transfections were performed with FuGene 6 reagent
(Boehringer Mannheim) according to company specifications. For estrogen
stimulation (10 nM for 24 h), cells were seeded in DMEM
phenol-red-free medium before transfection. The medium also included
10% charcoal- and dextran-treated FBS (HyClone) to remove estrogens
and glucocorticoids. For reporter assays, cells were plated at 1.5 × 105/well in six-well dishes. To assay ER-dependent
reporter transactivity, the following amounts of plasmids were used:
ER
or ER(S118A), 30 ng; ERE2-tk-luciferase, 500 ng; tk-lacZ, 20 ng;
AIB1, 700 ng; MKP1, 500 ng; and R
F, 900 ng. In Gal4-DBD-dependent
reporter assays, the plasmid amounts used were 25 ng of Gal4-DBD or an equimolar ratio of Gal4-DBD AIB1 constructs, 500 ng of luciferase reporter containing five copies of upstream activation sequence (UAS),
and 20 ng of tk-lacZ. In all cases, transfections were compensated with
empty vector pcDNA3.1 to yield equimolar concentrations of plasmid DNA.
The association of p300 and AIB1 was studied in BOSC cells.
Sixty-millimeter culture dishes were seeded with 2.5 × 106 cells that were transfected on the next day with 4 µg
of pCIp300, 4 µg of Gal4-DBD constructs, and either 2 µg of R
F
or 750 ng of pcDNA3.1. The MEK inhibitor U0126 was purchased from
Promega (catalog no. 1121).
Plasmids.
The ER S118A mutation was created in the
pcDNA3.1
vector using the oligonucleotides
5'CCCGCCGCCGCAGCTGGCGCCTTTCCTGCAGCCCC3' and
5'GGGGCTGCAGGAAAGGCGCCAGCTGCGGCGGCGGG3' by PCR (QuickChange site-directed mutagenesis kit; Stratagene). pcDNA3.1+AIB1 was provided
by Paul Meltzer (National Institutes of Health, Bethesda, Md.).
Full-length pCMX Gal4-DBD AIB1 and AIB1 fragment 556-1420 were
constructed by subcloning as NheI and
SspI/NheI fragments, respectively. Other AIB1
fragments were generated by adding appropriate flanking restriction
sites by PCR, subcloning into the pCMX Gal4-DBD vector, and sequencing
to confirm orientation.
Antibodies. Monoclonal antibodies against p300 (clone RW128) were kindly provided by David Livingston (Dana-Farber Cancer Institute, Boston, Mass.). Polyclonal antibodies against Gal4-DBD were purchased from Santa Cruz Biotechnology (no. sc-577) and used to immunoprecipitate Gal4-DBD-AIB1 proteins from transient transfected cells. Western blot analysis of Gal4-DBD proteins was performed with a monoclonal antibody against Gal4-DBD (Santa Cruz Biotechnology; no. sc-510). To test whether AIB1 was a phosphoprotein, we first developed polyclonal antibodies against glutathione S-transferase (GST)-AIB1 (amino acids 695 to 933). The rabbit serum was then affinity purified using GST-AIB1 which had been cleaved by thrombin and covalently immobilized to Affi-Gel 15 (Bio-Rad). The preimmune serum was also purified in the same manner.
Immunoprecipitations and Western blotting.
Cells were lysed
in a buffer containing 20 mM HEPES buffer (pH 7.5), 150 mM NaCl, 10 mM
EGTA, 40 mM
-glycerophosphate, 1% NP-40, 2.5 mM MgCl2,
2 mM orthovanadate, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride, 10 µg of aprotinin/ml and 10 µg of leupeptin/ml.
Following centrifugation at 15,000 × g for 10 min at
4°C, supernatants were recovered.
-phosphatase (New England BioLabs; no. 753S)
in 30 µl of the supplied buffer. After five washes with the lysis
buffer and one with MAPK buffer, the immune complex was divided into
halves. One half was further treated with 0.1 µg of active Erk2
(Upstate Biotechnology) in 30 µl of a buffer containing 12.5 mM MOPS
(morpholine propanesulfonic acid) (pH 7.5), 12.5 mM
-glycerophosphate, 7.5 mM MgCl2, 0.5 mM EGTA, 0.5 mM
NaF, 0.5 mM orthovanadate, and either 100 µM cold ATP or 1 µCi of
[
-32P]ATP plus 20 µM cold ATP as indicated. After
1 h at 30°C, the reaction was stopped by adding 10 µl of 5×
Laemmli buffer and heating at 95°C for 5 min. Samples were analyzed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE). For the analysis of AIB1 bandshift, we used a 10%
acrylamide gel containing 26% urea. After SDS electrophoresis,
proteins were transferred to Immobilon-P membranes (Millipore, Bedford,
Mass.) and blotted with the indicated antibodies.
MAP kinase activity.
Lysates containing 1 mg of total
protein were immunoprecipitated with 0.5 µg of anti-Erk2 (C14)
antibody (sc-154; Santa Cruz Biotechnology). Immunoprecipitates were
washed three times with lysis buffer, once with 0.5 M LiCl-100 mM
Tris-HCl (pH 7.5), and once with MAPK assay buffer containing 12.5 mM
MOPS (pH 7.5), 12.5 mM
-glycerolphosphate, 7.5 mM MgCl2,
0.5 mM EGTA, 0.5 mM NaF, and 0.5 orthovanadate. Finally, they were
resuspended in 30 µl of MAPK assay buffer containing 1 µCi of
[
-32P]ATP, 20 µM cold ATP, 3.3 µM dithiothreitol,
and 1.5 mg of myelin basic protein (MBP) (M-1891; Sigma) per ml. After
20 min at 30°C, the reaction was stopped with Laemmli buffer. Samples
were analyzed by SDS-PAGE.
HAT activity. Whole-cell lysates were incubated with polyclonal antibodies against Gal4-DBD for 2.5 h at 4°C with protein G-Sepharose beads. Immunoprecipitates were washed three times with the lysis buffer and used for histone acetyltransferase (HAT) assays in solution with histones (Boehringer Mannheim) as substrates (5).
In vitro translation assays. In vitro translation assays were performed by using the Promega TNT kit. AIB1 was transcribed with the T7 polymerase.
Phosphoamino acid analysis. MCF-7 cells grown in DMEM-10% FBS were changed to a phosphate-free medium and labeled for 6 h with [32P]orthophosphate (0.2 mCi/ml; 4 ml). Cells were lysed and immunoprecipitated with anti-AIB1 or preimmune antibodies. Immune complexes were resolved by SDS-8% PAGE. The gel was dried on a 3-mm Whatman paper filter and exposed for autoradiography. BT-474 and MDA-MB-468 cells were labeled in vivo with [32P]orthophosphate as described above for MCF-7 cells.
The predicted AIB1 band was excised from the paper and treated with 200 µl of 6 M HCl at 100°C for 90 min. The pellet was washed twice with deionized water. The supernatants were pooled and dried by vacuum. The remaining pellet was resuspended in 5 ml of deionized water to which was added 1 µl of phosphoamino acid standards (10 mg/ml containing phosphoserine, -threonine, and -tyrosine). The resulting sample was spotted on a thin-layer chromatography (TLC) plate and resolved by ascendant chromatography with 70 ml of isopropanol, 15 ml of HCl and 15 ml of deionized water. Once chromatography was finished, the plate was dried and developed with a solution of ethanol containing 0.2% ninhydrin. The plate was heated in an oven at 100°C for 30 min and then exposed to autoradiography.| |
RESULTS |
|---|
|
|
|---|
MAPK modulates estrogen signaling in the absence of S118.
To
study the role of MAPK in the regulation of ER signaling, we tested the
effects of the MAPK phosphatase-1 (MKP1) and the constitutively
activated MEK1 (R
F) on ER-mediated transactivation. Transfection
with R
F induces the phosphorylation and activation of MAPK (13,
25), resulting in constitutive activation of the MAPK pathway. In
contrast, MKP1 dephosphorylates MAPK and thus inactivates it, causing
an overall reduction in MAPK signaling (37). Transfection
with MKP1 reduced ER-dependent transcriptional activity approximately
40% (Fig. 1A). Addition of the MEK inhibitor U0126 produced an effect
similar to that of MKP-1 (data not shown). Activation of MAPK by R
F
promoted significant increases in reporter activity. A fully activated
ER
was potently enhanced by the activation of MAPK by R
F,
ninefold over the control and three times more than in the absence of
the activated MEK1 (Fig. 1A). To confirm that MKP1 and R
F altered
MAPK activity, endogenous MAPK (Erk2) from the transfected cultures was
immunoprecipitated and its activity was measured by using MBP as a
substrate. As expected, MKP1 reduced and R
F enhanced the overall
MAPK activity in transfected cells (Fig. 1, insets). To test whether
the effect of MAPK was on ER
alone or whether other factors involved
in ER signaling might be involved, we abrogated the direct regulation
of ER
by MAPK by introducing the S118A mutation. Ligand-independent
activation mediated by the AF-1 domain is dependent on phosphorylation
at this site by MAPK (18). This mutant exhibited a much
lower basal transcriptional activity than the wild type (Fig. 1B).
Thus, the induction in response to estrogen is much greater in the
mutant than in the wild type. Interestingly, in the presence of
estrogen, R
F increased by 26-fold the activity of ER
(S118A),
which was sixfold greater than in the absence of the activated MEK1
(Fig. 1B). These results suggest that factors involved in estrogen
signaling other than ER itself may be modulated by activation of the
MAPK pathway.
AIB1 is phosphorylated in vivo and can serve as a substrate of
MAPK.
Based on the ability of MAPK activation to augment ER(S118A)
signaling, we questioned whether p160 coactivators such as AIB1 might
also be a target of regulatory kinases. To test whether AIB1 is a
phosphoprotein, we labeled subconfluent, proliferating MCF-7 cells with
[32P]orthophosphate. Cells were harvested and lysates
were immunoprecipitated with preimmune or anti-AIB1 antibodies (Fig.
2A, lanes 4 and 5). Anti-AIB1
immunoprecipitates contained a unique radiolabeled band of the
predicted AIB1 molecular weight, strongly suggesting that AIB1 is
phosphorylated in vivo. The band was excised from the gel and subjected
to phosphoamino acid analysis. The results revealed that AIB1 is
predominantly phosphorylated on serine (Fig. 2B). Additionally, no
phosphotyrosine-containing proteins were detected when anti-AIB1
immunocomplexes were probed by Western blotting with
antiphosphotyrosine antibodies (data not shown). We also analyzed the
phosphorylation of AIB1 in other cell lines, including BT-474 and
MDA-MB-468 (Fig. 2C). Interestingly, while AIB1 expression was detected
in both MCF-7 and BT-474 as previously reported (Fig. 2C, upper panel),
significant levels of phosphorylation were detected only in MCF-7 cells
(Fig. 2C, lower panel). We also examined the ER-negative breast cancer
cell line MDA-MB-468; neither expression nor phosphorylation of AIB1
was observed in these cells.
|
-phosphatase. Phosphatase-treated AIB1 migrated faster than
nontreated control immune complexes (Fig.
3, upper panel, lanes 3 and 4). This
result further confirmed that AIB1 is a phosphoprotein.
Dephosphorylated immune complexes were washed and subsequently treated
with active MAPK Erk2 in the presence of ATP. Treatment with Erk2
restored the original mobility of AIB1 in immune complexes (Fig. 3,
upper panel, lane 5), demonstrating that AIB1 can be phosphorylated in
vitro by MAPK. In parallel, we also included [
-32P]ATP
in Erk2 kinase reactions to demonstrate incorporation of radioactivity
into AIB1, as detected by autoradiography (Fig. 3, lower panel).
|
AIB1 transactivation is stimulated by MAPK.
We further
investigated the role of the MAPK pathway in AIB1 function independent
of ER. For that purpose, we fused AIB1 to Gal4-DBD and assayed this
construct for transcriptional activity in transient cotransfections of
COS cells with a reporter plasmid containing the GAL4 UAS (Fig.
4A, left panel). To determine the contribution of the MAPK pathway to AIB1 activity, we cotransfected Gal4-AIB1 together with MKP1 or with R
F (Fig. 4A, left panel). In
the absence of either MKP1 or R
F, full-length Gal4-AIB1 exhibited potent transcriptional activation as expected. Cotransfection of MKP1
reduced somewhat the level of activation stimulated by Gal4-AIB1. More
significantly, cotransfection of R
F substantially augmented
Gal4-AIB1-mediated transactivation. Thus, Gal4-AIB1 was regulated over
fivefold by alterations in MAPK signaling (Fig. 4B).
|
Activation of AIB1 by MAPK leads to recruitment of p300.
To
further analyze the mechanism by which MAPK regulates AIB1, we focused
on the AD1 domain. AD1 has been shown previously to function through
the recruitment of p300/CBP (7). To test whether p300 was
involved in MAPK activation of AIB1, we cotransfected p300 with the
empty vector pCMX Gal4-DBD or with vector containing either AIB1
positions 556 to 1420, 578 to 1131, or 1210 to 1420. The first two
truncations of AIB1 include AD1, whereas the later contains only the
AD2 domain. As expected, transfection with R
F potently activated
MAPK as revealed by measuring endogenous MAPK activity using MBP as a
substrate (Fig. 5A). Expression of p300 was similar in all samples, as detected in whole-cell extracts by
immunoblot (Fig. 5B), and R
F had no effect on the level of Gal4-AIB1
expressed (Fig. 5D). Lysates were immunoprecipitated with anti-Gal4-DBD
and then probed for the presence of p300. Immunoblotting revealed the
association of p300 with the AD1-containing fragments (AIB1 556 to 1420 and 578 to 1131) but not with AIB1 1210 to 1420, expressing only the
AD2 domain. Significantly, appreciably more p300 was associated with
these AIB1 fragments in the presence of R
F, indicating that potent
activation of MAPK enhances the association between AIB1 and p300 (Fig.
5C). In order to demonstrate that the increased association of p300
with AIB1 was functionally relevant, HAT activity associated with the
Gal4-AIB1 complex was assayed. Significantly more H3/H4
acetyltransferase activity was associated with Gal4-AIB1 in the
presence of activated MAPK (Fig. 5E). These results strongly suggest
that MAPK activation augments ER-mediated transcription by enhancing
the binding of the p160 coactivator AIB1 to p300. Thus, our
observations provide a novel mechanism by which MAPK signaling is
coupled to the regulation of estrogen signaling.
|
| |
DISCUSSION |
|---|
|
|
|---|
AIB1 is a member of the p160 family of steroid receptor coactivators (1), and it shares high homology with the other members of the family, SRC-1 (33% identity) and TIF2 (45%). AIB1 is highly expressed in the mammary gland, uterus, testis, pituitary gland, and muscle (36), suggesting that AIB1 may play a physiological role in these endocrine-responsive tissues. Interestingly, AIB1 is highly amplified in a proportion of breast and ovarian tumors (1), especially in ER-positive breast cancers (2). Here, we demonstrate that AIB1 is phosphorylated by MAPK in MCF-7 cells; activation of the MAPK pathway enhances the transactivation potential of this nuclear coactivator. Moreover, phosphorylation of AIB1 by MAPK recruits p300 and HAT activity to the AIB1 transcriptional complex. Thus, our observations suggest that the MAPK pathway, activated either by ER or growth factor signaling, may modulate AIB1 function to ultimately regulate gene transcription and cell growth.
The interaction between growth factors and estrogen signaling is complex and occurs at multiple levels. Previous work has implicated ER itself as a target of growth factor-signaling pathways involving MAPK. Conversely, activation of MAPK by estrogen and ER also occurs in various tissues and cell types, though the exact mechanism remains to be determined (8, 12, 26, 35). These findings strongly suggest that ER is not only a ligand-induced transcriptional enhancer but also a mediator of common intracellular signaling pathways in multiple cell types (9).
We demonstrate that transcriptional activation mediated by AIB1 is
enhanced by MAPK activation. In addition, we found that endogenous AIB1
is a phosphoprotein in MCF-7 breast cancer cells and that the MAPK Erk2
can phosphorylate AIB1 in vitro. Our results reveal a new level of
complexity in the cross talk among growth factor-signaling pathways. In
addition, we found that activation of AIB1 by MAPK phosphorylation
increases its ability to recruit p300/CBP and its associated HAT
activity, revealing a mechanism by which MAPK may modulate coactivator
activity in the final response to growth factors. Taken together, these
data implicate AIB1 as a molecular conduit for kinase-mediated growth
factor signaling to the ER (Fig. 6) and
presumably to other NRs. As both ER and AIB1 are substrates of MAPK,
further studies will be required to determine how this complex
regulation by phosphorylation ultimately regulates the transcriptional
activation in ER-targeted genes. Phosphorylated AIB1 may also enhance
the transcriptional activation of other NRs. Therefore, the
physiological role of AIB1 activity and its phosphorylation may depend
on the array of NRs and growth factor receptors expressed in a given
cell type.
|
Recently it has been reported that recombinant SRC-1 overexpressed in
COS-1 cells is a potential target of MAPK phosphorylation (32). Phosphopeptide mapping of SRC-1 revealed seven
phosphorylation sites clustered in two regions of the protein. Sequence
comparison between SRC-1 and AIB1 revealed that many of the
phosphorylation sites found in SRC-1 are not found in AIB1. In SRC-1,
only serines 395, 517, and 569 are also potentially conserved in AIB1
(serines 404, 505, and 551). However, the AIB1 S404 lacks an upstream
proline, as is found in the SRC-1 S395 site and in other consensus MAPK phosphorylation motifs. Additionally, the presence of an acidic residue
in AIB1, D549, at the
2 position of the S551 site makes it likely to
be a poor substrate for MAPK. More importantly, all of these sites
mapped in SRC-1 lie outside of the minimal region of AIB1 (578 to 1131)
that we find responds to MAPK activation independently of ER and can be
phosphorylated in vitro by MAPK (our unpublished data), suggesting
potential coactivator-specific differences in the response to growth
factor signaling.
We found that while AIB1 is highly expressed in the breast cancer cell
line BT-474, it was not constitutively phosphorylated, as it is in
MCF-7 cells, suggesting that these two cell lines may respond
differently to hormone or growth factor stimulation. Interestingly,
under standard culture conditions, BT-474 cells grow at a much lower
rate than MCF-7 cells. We are currently investigating whether MAPK
phosphorylation of AIB1 is tied to the growth state of the cells and
whether AIB1 phosphorylation may contribute to a feed-forward loop in
which growth factors such as IGF or transforming growth factor-
and
estradiol act synergistically to promote cell cycle progression.
Our results provide new insights into how MAPK may contribute to the overall enhancement of transcriptional activity by promoting the activity of coactivators and by favoring the interaction among them. Furthermore, our results suggest that the ability of growth factors to augment estrogen action may be mediated, at least in part, through MAPK activation of AIB1 and this may explain the selection for AIB1 amplification during progression in ER-positive breast cancers.
| |
ACKNOWLEDGMENTS |
|---|
We thank Paul Meltzer for the AIB1 cDNA clone, David Livingston for antibodies to p300, Molly Yancisin for technical assistance, and James DiRenzo for helpful discussions.
This work was supported by NIH grant CA57374.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Adult Oncology, Dana-Farber Cancer Institute, 44 Binney St., Boston, MA 02115. Phone: (617) 632-3948. Fax: (617) 632-5417. E-mail: myles_brown{at}dfci.harvard.edu.
Present address: Centro de Investigación del Cáncer,
Campus Miguel de Unamuno, 37007 Salamanca, Spain.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Anzick, S. L.,
J. Kononen,
R. L. Walker,
D. O. Azorsa,
M. M. Tanner,
X. Y. Guan,
G. Sauter,
O. P. Kallioniemi,
J. M. Trent, and P. S. Meltzer.
1997.
AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer.
Science
277:965-968 |
| 2. | Bautista, S., H. Valles, R. L. Walker, S. Anzick, R. Zeillinger, P. Meltzer, and C. Theillet. 1998. In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin. Cancer Res. 4:2925-2929[Abstract]. |
| 3. | Bourguet, W., M. Ruff, P. Chambon, H. Gronemeyer, and D. Moras. 1995. Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-alpha. Nature 375:377-382[CrossRef][Medline]. |
| 4. |
Brandt, B. H.,
A. Roetger,
T. Dittmar,
G. Nikolai,
M. Seeling,
A. Merschjann,
J. R. Nofer,
G. Dehmer-Moller,
R. Junker,
G. Assmann, and K. S. Zaenker.
1999.
c-erbB-2/EGFR as dominant heterodimerization partners determine a motogenic phenotype in human breast cancer cells.
FASEB J.
13:1939-1949 |
| 5. |
Brownell, J. E., and C. D. Allis.
1995.
An activity gel assay detects a single, catalytically active histone acetyltransferase subunit in Tetrahymena macronuclei.
Proc. Natl. Acad. Sci. USA
92:6364-6368 |
| 6. |
Chen, D.,
H. Ma,
H. Hong,
S. S. Koh,
S. M. Huang,
B. T. Schurter,
D. W. Aswad, and M. R. Stallcup.
1999.
Regulation of transcription by a protein methyltransferase.
Science
284:2174-2177 |
| 7. | Chen, H., R. J. Lin, R. L. Schiltz, D. Chakravarti, A. Nash, L. Nagy, M. L. Privalsky, Y. Nakatani, and R. M. Evans. 1997. Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569-580[CrossRef][Medline]. |
| 8. | Chen, Z., I. S. Yuhanna, Z. Galcheva-Gargova, R. H. Karas, M. E. Mendelsohn, and P. W. Shaul. 1999. Estrogen receptor alpha mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen. J. Clin. Invest. 103:401-406[Medline]. (Erratum, 103:1363.) |
| 9. | Collins, P., and C. Webb. 1999. Estrogen hits the surface. Nat. Med. 5:1130-1131[CrossRef][Medline]. |
| 10. |
Curtis, S. W.,
T. Washburn,
C. Sewall,
R. DiAugustine,
J. Lindzey,
J. F. Couse, and K. S. Korach.
1996.
Physiological coupling of growth factor and steroid receptor signaling pathways: estrogen receptor knockout mice lack estrogen-like response to epidermal growth factor.
Proc. Natl. Acad. Sci. USA
93:12626-12630 |
| 11. |
Darimont, B. D.,
R. L. Wagner,
J. W. Apriletti,
M. R. Stallcup,
P. J. Kushner,
J. D. Baxter,
R. J. Fletterick, and K. R. Yamamoto.
1998.
Structure and specificity of nuclear receptor-coactivator interactions.
Genes Dev.
12:3343-3356 |
| 12. | Endoh, H., H. Sasaki, K. Maruyama, K. Takeyama, I. Waga, T. Shimizu, S. Kato, and H. Kawashima. 1997. Rapid activation of MAP kinase by estrogen in the bone cell line. Biochem. Biophys. Res. Commun. 235:99-102[CrossRef][Medline]. |
| 13. | Font de Mora, J., A. Porras, N. Ahn, and E. Santos. 1997. Mitogen-activated protein kinase activation is not necessary for, but antagonizes, 3T3-L1 adipocytic differentiation. Mol. Cell. Biol. 17:6068-6075[Abstract]. |
| 14. |
Halachmi, S.,
E. Marden,
G. Martin,
H. MacKay,
C. Abbondanza, and M. Brown.
1994.
Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription.
Science
264:1455-1458 |
| 15. |
Hanstein, B.,
R. Eckner,
J. DiRenzo,
S. Halachmi,
H. Liu,
B. Searcy,
R. Kurokawa, and M. Brown.
1996.
p300 is a component of an estrogen receptor coactivator complex.
Proc. Natl. Acad. Sci. USA
93:11540-11545 |
| 16. | Henttu, P. M. A., E. Kalkhoven, and M. G. Parker. 1997. AF-2 activity and recruitment of steroid receptor coactivator 1 to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol. Cell. Biol. 17:1832-1839[Abstract]. |
| 17. | Ito, M., C. X. Yuan, S. Malik, W. Gu, J. D. Fondell, S. Yamamura, Z. Y. Fu, X. Zhang, J. Qin, and R. G. Roeder. 1999. Identity between TRAP and SMCC complexes indicates novel pathways for the function of nuclear receptors and diverse mammalian activators. Mol. Cell 3:361-370[CrossRef][Medline]. |
| 18. |
Kato, S.,
H. Endoh,
Y. Masuhiro,
T. Kitamoto,
S. Uchiyama,
H. Sasaki,
S. Masushige,
Y. Gotoh,
E. Nishida,
H. Kawashima, et al.
1995.
Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase.
Science
270:1491-1494 |
| 19. | Kumar, V., S. Green, G. Stack, M. Berry, J. R. Jin, and P. Chambon. 1987. Functional domains of the human estrogen receptor. Cell 51:941-951[CrossRef][Medline]. |
| 20. |
Lange, C. A.,
J. K. Richer,
T. Shen, and K. B. Horwitz.
1998.
Convergence of progesterone and epidermal growth factor signaling in breast cancer. Potentiation of mitogen-activated protein kinase pathways.
J. Biol. Chem.
273:31308-31316 |
| 21. |
Li, H.,
P. J. Gomes, and J. D. Chen.
1997.
RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2.
Proc. Natl. Acad. Sci. USA
94:8479-8484 |
| 22. |
Ma, H.,
H. Hong,
S.-M. Huang,
R. A. Irvine,
P. Webb,
P. J. Kushner,
G. A. Coetzee, and M. R. Stallcup.
1999.
Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins.
Mol. Cell. Biol.
19:6164-6173 |
| 23. |
Mak, H. Y.,
S. Hoare,
P. M. A. Henttu, and M. G. Parker.
1999.
Molecular determinants of the estrogen receptor-coactivator interface.
Mol. Cell. Biol.
19:3895-3903 |
| 24. | Mangelsdorf, D. J., C. Thummel, M. Beato, P. Herrlich, G. Schutz, K. Umesono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, et al. 1995. The nuclear receptor superfamily: the second decade. Cell 83:835-839[CrossRef][Medline]. |
| 25. |
Mansour, S. J.,
W. T. Matten,
A. S. Hermann,
J. M. Candia,
S. Rong,
K. Fukasawa,
G. F. Vande Woude, and N. G. Ahn.
1994.
Transformation of mammalian cells by constitutively active MAP kinase kinase.
Science
265:966-970 |
| 26. | Migliaccio, A., M. Di Domenico, G. Castoria, A. de Falco, P. Bontempo, E. Nola, and F. Auricchio. 1996. Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J. 15:1292-1300[Medline]. |
| 27. |
Norris, J. D.,
D. Fan,
M. R. Stallcup, and D. P. McDonnell.
1998.
Enhancement of estrogen receptor transcriptional activity by the coactivator GRIP-1 highlights the role of activation function 2 in determining estrogen receptor pharmacology.
J. Biol. Chem.
273:6679-6688 |
| 28. |
Peters, G. A., and S. A. Khan.
1999.
Estrogen receptor domains E and F: role in dimerization and interaction with coactivator RIP-140.
Mol. Endocrinol.
13:286-296 |
| 29. | Picard, D., B. Khursheed, M. J. Garabedian, M. G. Fortin, S. Lindquist, and K. R. Yamamoto. 1990. Reduced levels of hsp90 compromise steroid receptor action in vivo. Nature 348:166-168[CrossRef][Medline]. |
| 30. | Pollak, M. 1998. IGF-I physiology and breast cancer. Recent Results Cancer Res. 152:63-70[Medline]. |
| 31. | Rachez, C., B. D. Lemon, Z. Suldan, V. Bromleigh, M. Gamble, A. M. Naar, H. Erdjument-Bromage, P. Tempst, and L. P. Freedman. 1999. Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. Nature 398:824-828[CrossRef][Medline]. |
| 32. |
Rowan, B. G.,
N. L. Weigel, and B. W. O'Malley.
2000.
Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen-activated protein kinase pathway.
J. Biol. Chem.
275:4475-4483 |
| 33. | Scherrer, L. C., D. Picard, E. Massa, J. M. Harmon, S. S. Simons, Jr., K. R. Yamamoto, and W. B. Pratt. 1993. Evidence that the hormone binding domain of steroid receptors confers hormonal control on chimeric proteins by determining their hormone-regulated binding to heat-shock protein 90. Biochemistry 32:5381-5386[CrossRef][Medline]. |
| 34. | Shiau, A. K., D. Barstad, P. M. Loria, L. Cheng, P. J. Kushner, D. A. Agard, and G. L. Greene. 1998. The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927-937[CrossRef][Medline]. |
| 35. |
Singer, C. A.,
X. A. Figueroa-Masot,
R. H. Batchelor, and D. M. Dorsa.
1999.
The mitogen-activated protein kinase pathway mediates estrogen neuroprotection after glutamate toxicity in primary cortical neurons.
J. Neurosci.
19:2455-2463 |
| 36. |
Suen, C. S.,
T. J. Berrodin,
R. Mastroeni,
B. J. Cheskis,
C. R. Lyttle, and D. E. Frail.
1998.
A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity.
J. Biol. Chem.
273:27645-27653 |
| 37. | Sun, H., C. H. Charles, L. F. Lau, and N. K. Tonks. 1993. MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo. Cell 75:487-493[CrossRef][Medline]. |
| 38. | Tora, L., J. White, C. Brou, D. Tasset, N. Webster, E. Scheer, and P. Chambon. 1989. The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477-487[CrossRef][Medline]. |
| 39. | Torchia, J., D. W. Rose, J. Inostroza, Y. Kamei, S. Westin, C. K. Glass, and M. G. Rosenfeld. 1997. The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677-684[CrossRef][Medline]. |
| 40. | Tremblay, A., G. B. Tremblay, F. Labrie, and V. Giguere. 1999. Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1. Mol. Cell 3:513-519[CrossRef][Medline]. |
| 41. | Voegel, J. J., M. J. Heine, M. Tini, V. Vivat, P. Chambon, and H. Gronemeyer. 1998. The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J. 17:507-519[CrossRef][Medline]. |
| 42. |
Webb, P.,
P. Nguyen,
J. Shinsako,
C. Anderson,
W. Feng,
M. P. Nguyen,
D. Chen,
S. M. Huang,
S. Subramanian,
E. McKinerney,
B. S. Katzenellenbogen,
M. R. Stallcup, and P. J. Kushner.
1998.
Estrogen receptor activation function 1 works by binding p160 coactivator proteins.
Mol. Endocrinol.
12:1605-1618 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»