Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 5196-5207, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of Functionally Important Domains in the
N-Terminal Region of Telomerase Reverse Transcriptase
Jinqiang
Xia,1
Yun
Peng,1
I. Saira
Mian,2 and
Neal F.
Lue1,*
Department of Microbiology and Immunology,
W. R. Hearst Microbiology Research Center, Weill Medical College
of Cornell University, New York, New York
10021,1 and Life Sciences Division,
Lawrence Berkeley National Laboratory, Berkeley, California
947202
Received 8 March 2000/Accepted 18 April 2000
 |
ABSTRACT |
Telomerase is a ribonucleoprotein reverse transcriptase responsible
for the maintenance of one strand of telomere terminal repeats. The key
protein subunit of the telomerase complex, known as TERT,
possesses reverse transcriptase-like motifs that presumably mediate
catalysis. These motifs are located in the C-terminal region of the
polypeptide. Hidden Markov model-based sequence analysis revealed in
the N-terminal region of all TERTs the presence of four conserved
motifs, named GQ, CP, QFP, and T. Point mutation analysis of conserved
residues confirmed the functional importance of the GQ motif. In
addition, the distinct phenotypes of the GQ mutants suggest that this
motif may play at least two distinct functions in telomere maintenance.
Deletion analysis indicates that even the most N-terminal nonconserved
region of yeast TERT (N region) is required for telomerase
function. This N region exhibits a nonspecific nucleic acid binding
activity that probably reflects an important physiologic function.
Expression studies of various portions of the yeast TERT in
Escherichia coli suggest that the N region and the GQ motif
together may constitute a stable domain. We propose that all TERTs may
have a bipartite organization, with an N-GQ domain connected to the
other motifs through a flexible linker.
 |
INTRODUCTION |
Telomerase is a ribonucleoprotein
(RNP) that is responsible for maintaining the terminal repeats of
telomeres in most organisms (15). It acts as an unusual
reverse transcriptase (RT), using a small segment of an integral RNA
component as template for the synthesis of the dGT-rich strand of
telomeres (16).
Telomerase activity has been characterized from a wide range of
organisms and genes encoding both the RNA and protein components of the
enzyme complex identified (for reviews, see references 2 and 41). Telomerase RNAs found
in ciliated protozoa, in addition to having a short templating region,
share a common secondary structure. Telomerase RNAs from yeasts and
mammals are considerably larger and exhibit no evident structural
conservation. The catalytic RT protein subunit (TERT), initially
purified from Euplotes aediculatus as p123, was subsequently
found to be homologous to Est2p, a yeast protein required for telomere
maintenance (25, 26, 28). Both proteins possess RT-like
motifs, alterations in which led to inactivation of telomerase
activity and reduced telomere length. Subsequently, homologs of TERT
were identified in Schizosaccharomyces pombe, humans, mice,
and Tetrahymena, Oxytricha, and
Arabidopsis spp. (3, 6, 10, 13, 22, 33, 38, 42).
An evident homolog can also be discerned in the incomplete
Candida albicans database (see Materials and Methods).
Additional mutational analysis of the RT motifs in these latter
proteins supports a role for TERT in directly mediating catalysis
(20, 50). Because coexpression of TERT and
telomerase RNA in vitro in the rabbit reticulocyte lysate
system suffices to reconstitute enzyme activity (1, 50),
these two subunits probably constitute the core of the enzyme complex.
Several groups of telomerase-associated polypeptides have been
identified using either biochemical or genetic tools. First, purification of the Tetrahymena telomerase complex
led to the discovery of two associated polypeptides (p80 and p95).
Cloning and characterization of p80 and p95 suggest that these proteins may interact with telomerase RNA and the DNA primer,
respectively (8, 12). Mouse and human homologs of p80 have
also been identified and been shown to associate with the respective
telomerases (19, 39). Second, a significant fraction
of the human telomerase complex is apparently associated with
the molecular chaperones Hsp90 and p23, which are also necessary for
reconstitution of telomerase in vitro activity in the rabbit
reticulocyte lysate system (21). These molecular chaperones
are hypothesized to play a role in telomerase biogenesis.
Third, two Sm proteins that are necessary for snRNA maturation are also
components of the yeast telomerase complex, suggesting a role
for these factors in telomerase RNA processing and
telomerase complex assembly (47). Finally, genetic
analysis of yeast identified two Est proteins (Est1p and Est3p)
that act in the same pathway as telomerase RNA and TERT.
Subsequent characterizations indicate that Est1p and Est3p are also
subunits of the telomerase complex and that Est1p may play a
role in the recruitment of telomerase core to telomere ends in
vivo (9, 25, 41, 49). The precise biochemical and
physiologic functions of the telomerase-associated proteins remain to be elucidated. The stoichiometry of telomerase
components in the native complex is unclear. However, recent studies
suggest that the yeast complex may contain more than one copy of the
RNA component (43).
Previous analysis of all of the cloned TERTs revealed several salient
features of their structural organization: (i) all of the RT motifs are
located in the C-terminal half of the protein; (ii) a
telomerase-specific motif (T motif), located just N terminal to
the RT motifs, can be discerned in all TERTs; and (iii) a motif positioned further toward the N terminus (CP motif) appears to be much
more highly conserved among all the ciliate telomerases and may
perform a function specific to ciliate telomere formation (3). Point mutations in conserved residues of the T motif
significantly impaired telomerase function in the rabbit
reticulocyte lysate system (50). Other N-terminal regions of
the TERT polypeptide have not been subjected to detailed molecular analysis.
To determine if the uncharacterized, N-terminal regions of TERT are
functionally important and if they played conserved roles in telomere
maintenance, we initiated mutagenic analysis of the yeast TERT (Est2p).
As a starting point for this analysis, we performed a hidden Markov
model (HMM)-based alignment of all available TERTs, including the
recently identified C. albicans homolog. Several earlier
applications of the HMM approach have resulted in the detection of
homologies between distantly related proteins (34, 35, 37).
Interestingly, such an approach in the case of TERT led to the
identification of four conserved motifs in the N-terminal, non-RT
region. To validate the predictions arising from comparative sequence
analysis, we introduced substitution mutations into the yeast TERT
(EST2) gene and investigated their effects on growth,
telomere maintenance, and telomerase activity. In this paper,
we report that the most N-terminal motif, called GQ, is indeed
functionally important. Characterization of mutant phenotypes suggests
that the GQ motif may play at least two distinct functions.
Furthermore, we show that a nonconserved region located N terminal to
the GQ motif (which we call the N region) is also functionally
important, possibly through interacting with some nucleic acid target
in the context of the native RNP.
While this work was in progress, Friedman and Cech (11)
reported the identification of essential domains located in the N-terminal region of yeast TERT using a unigenic evolution approach. In
this approach, the gene of interest is heavily mutagenized, and
functional variants are selected. Essential and dispensable regions of
the protein are then identified by statistically analyzing the
distribution of missense and silent mutations. The regions identified
in both their and our studies are largely concordant, and we comment on
the similarities and discrepancies in the Discussion section.
This work was supported by the American Cancer Society, the
Concert for the Cure, and the AMDeC Foundation (N. F. Lue) and by
the Director, Office of Science, Office of Basic Energy Sciences, of
the U.S. Department of Energy under contract no. DE-AC03-76SF00098 (I.S. Mian). Sequencing of C. albicans was accomplished with
the support of the NIDR and the Burroughs Wellcome Fund.
J.X. and Y.P. contributed equally to the work.
 |
MATERIALS AND METHODS |
Yeast strains and plasmids.
The haploid Saccharomyces
cerevisiae strain W303-a (MATa ade2-1 trp1-1
leu2-3,112 his3-11,15 ura3-1 can1-100) was used for the
construction of the
est2 strain. The disruption cassette was made by inserting ~600 to 800 bp of the est2 gene
flanking sequence upstream and downstream of the kanamycin marker of
pUG6. The resulting fragment replaced amino acids 50 to 690 of Est2p open reading frame with the kanamycin resistance marker. Following transformation and selection on G418-containing plates, deletion of the
est2 gene in selected isolates was confirmed by PCR.
The plasmid-borne est2 gene was derived from yeast strain
JX-MH19 and contained at its C terminus both a three-Myc tag and a
six-His tag. The JX-MH19 strain was constructed using the PCR recombination method described by Schneider et al.
(46). The pMPY-3XMYC plasmid was amplified using the
following two primers: EST2TAG1,
5'-AAGATAATATCATTCTTTTGAGAAAGGAAATTCAACACTTGCAAGCAAGGGAACAAAAGCTGG; and EST2TAG2, 5'-CCTTATCAGCATCATAAGCTGTCAGTATTTCATGTAT TATTAGTACTACTAGTGATGGTGATGGTGATGTAGGGCGAATTGGG TACC.
The disruption cassette was introduced into W303-a, and transformants
were selected on a Ura
plate. Subsequent selection in the
presence of 5-fluoroorotic acid allowed homologous recombination of the
repeated Myc tags such that the chromosomal copy of the EST2
gene became fused at its C terminus with a three-Myc tag and a six-His
tag. Telomere lengths and telomerase activity in this strain
(JX-MH19) are comparable to those of W303-a. To introduce this modified
EST2 gene onto a plasmid, a 3.6-kb fragment encompassing the
modified est2 coding region (and containing ~500 bp of
upstream region and ~500 bp of downstream region) was amplified by
PCR and inserted between the BamHI and SalI sites
of pSE358 to give pSE-Est2TA. To allow for the construction of deletion
mutants, the sequence surrounding the start codon of pSE-Est2TA was
converted to an NdeI site by site-directed mutagenesis to
give pSE-Est2Nde. Additionally, a protein A-tagged
est2-containing plasmid was constructed by inserting two
copies of the immunoglobulin G (IgG) binding domain of protein A
(generated by PCR from pEZZ 18) between the XhoI and
KpnI sites of pSE-Est2Nde to give pSE-Est2-proA.
For deletion mutants, fragments encompassing amino acids 10 to 119, 20 to 119, 30 to 119, and 50 to 119 of Est2 were amplified
by PCR and
inserted between the
NdeI and
pflMI sites of
pSE-Est2Nde
to generate the desired plasmids. All point mutations were
generated
by using the Quick-Change protocol (Stratagene), appropriate
primer
oligonucleotides, and pSE-Est2Nde as template. All point
mutations
were confirmed by sequencing. Some of the deletion and point
mutants
were also made with the protein A tag by transferring the
NdeI-to-
NcoI
fragment from the mutated
pSE-Est2Nde plasmid to the pSE-Est2-proA
plasmid.
To overexpress Est2p, a vector containing the triose phosphate
isomerase promoter (pYX212 from Ingenious Inc.) was utilized.
The
NcoI site within the polylinker of pYX212 was converted to
an
NdeI site, and the
NdeI-
SalI
fragments from the pSE-Est2Nde
series of plasmids (containing wild-type
or mutated EST2) were
inserted between the
NdeI and
SalI sites of the resulting
vector.
Sequence comparison.
All sequences used in comparative
analysis, with the exception of the C. albicans TERT
homolog, were obtained from GenBank. Sequence data for C. albicans was obtained from the Stanford DNA Sequencing and
Technology Center website at
http://www-sequence.stanford.edu/group /candida.
Determination of telomere length.
Chromosomal DNA was
isolated using the Smash and Grab protocol, digested with
XhoI or PstI restriction enzyme, and
electrophoretically separated on a 1% agarose gel. Following capillary
transfer to nylon membranes, telomere-containing fragments were
detected by hybridization with a 32P-labeled poly(dG-dT) probe.
Purification of and assay for yeast telomerase.
Whole-cell extracts and active DEAE fractions were prepared as
previously described (5, 29, 30). A typical
telomerase reaction was carried out in 30 µl containing the
following: 10 mM Tris-HCl (pH 8.0), 2 mM magnesium acetate, ~300 mM
sodium acetate (contributed by the protein fraction), 1 mM spermidine,
1 mM dithiothreitol, 5% glycerol (contributed by the protein
fraction), 50 µM dTTP, 20 µCi of [
-32P]dGTP (3,000 Ci/mmol), 5 µM primer oligodeoxynucleotides (TEL66 [30]), and 15 µl of column fractions. Primer
extension products were processed and analyzed by gel electrophoresis
as previously described (29, 30). Signals were quantified
using a PhosphorImager system (Molecular Dynamics). For quantification
of activity, the signals from all labeled and RNase-sensitive products
are summed.
For affinity depletion of protein A-tagged yeast telomerase,
about 100 µl of DEAE fraction (in a buffer that contains ~700
mM
sodium acetate) was directly incubated with 5 µl of IgG-Sepharose
beads (Pharmacia) at 4°C with gentle rocking for 2 h. The beads
were pelleted by centrifugation, and the supernatant was assayed
for
activity.
Western analysis of protein A-tagged Est2p.
Depending on the
expression level, the amount of protein A-tagged Est2p was analyzed
either directly in crude extracts or following IgG-Sepharose
precipitation using the ProtoBlot system (Promega). For analysis using
crude extracts, ~300 to 500 µg of total protein was electrophoresed
into a sodium dodecyl sulfate (SDS)-8% polyacrylamide gel and
transferred to nitrocellulose membrane. Primary anti-protein A antibody
(Sigma) and secondary antibody were used at 1:1,000,000 and 1:5,000
dilutions, respectively. The high primary antibody dilution was
necessary to minimize background arising from cross-reacting
polypeptides. For analysis using IgG-Sepharose-purified telomerase, ~5 mg of unfractionated extracts was treated with 40 µl of IgG-Sepharose at 4°C for 16 h. The beads were washed three times with TMG-10(600), and bound proteins were eluted with SDS-polyacrylamide gel electrophoresis (PAGE) loading buffer. Following
electrophoresis and blotting, Est2p was detected by using primary and
secondary antibody at 1:20,000 and 1:5,000 dilutions, respectively.
Construction of Escherichia coli EST2 fusion protein
expression plasmids and purification of fusion proteins from E. coli.
Fragments of the EST2 gene were amplified by PCR
and cloned between the BamHI and PstI sites of
the pMAL-cri vector (New England Biolabs). In addition, the downstream
primers all possessed sequences that encode an in-frame six-His tag,
allowing the fusion proteins to be purified using both nickel-affinity
and amylose-affinity chromatography. The proteins expressed from these
plasmids are named MBP-Est2(1-160)p, etc., with the numbers in
parentheses indicating the amino acid residues of Est2p included in the
fusion protein.
The plasmids carrying the maltose-binding protein
(MBP)-
EST2 fusion genes were transformed into BL21 cells.
Transformants
were inoculated into Luria-Bertani broth and grown under
ampicillin
selection (50 µg/ml) at 37°C overnight. A 10-ml culture
of saturated
cells was diluted with 1 liter of Luria-Bertani broth with
ampicillin
and grown at 37°C for 2.5 h. When the optical density
at 600 nm
of the culture reached 0.3 to 0.5, the cultures were cooled
down
to room temperature and induced by the addition of IPTG
(isopropyl-

-
D-thiogalactopyranoside)
to 1 mM and growth
at room temperature for 3 additional h. The
cells were harvested, and
extracts were prepared by sonication.
Fusion proteins were purified
successively over an Ni-nitrilotriacetic
acid resin (Qiagen) and an
amylose resin (Bio-Lab) according to
the manufacturers' instructions.
All preparations were found to
be >90% pure by SDS-PAGE and Coomassie
blue
staining.
Filter binding assay.
Protein-nucleic acid binding assays
were performed using a modification of a published procedure
(4). Est2p fusion proteins (from 0.25 to 5 µg) were mixed
with 32P-labeled nucleic acid and 50 µg of bovine serum
albumin in 10 mM Tris (pH 8.0) and 10% glycerol. The reaction mixtures
(50-µl total volume) were incubated on ice for 30 min and pipetted
over a prewetted nitrocellulose filter (BA85; Schleicher & Schuell) sandwiched in a slot blot apparatus. The reaction mixtures were then
slowly filtered through the membrane using gentle suction. The filters
were washed three times with 0.5 ml of buffer (10 mM Tris, 300 mM
sodium acetate, 50 µg of bovine serum albumin), air dried, and
exposed to a PhosphorImager screen (Molecular Dynamics). All assays
were done in duplicate, and the signals were averaged for further
analysis. The difference between duplicate samples was generally
<10%.
 |
RESULTS |
HMM-based analysis revealed four conserved motifs located in the
N-terminal, non-RT region of TERT.
To determine if the N-terminal,
non-RT regions of TERT are functionally important and if they play
conserved roles in telomere maintenance, we initiated mutagenic
analysis of Est2p (the yeast TERT). Several earlier applications of
HMM-based sequence comparison resulted in detection of homologies
between distantly related proteins (34, 35, 37). Therefore,
as a starting point for our analysis, we performed an HMM-based
alignment of all available TERTs, including recently identified
Arabidopsis thaliana and C. albicans homologs.
After obtaining an alignment of the entire amino-terminal region, we
defined the motif-domain boundaries by visual inspection. The criteria
used for assigning regions of the alignment as linkers included low
compositional complexity, absence of clusters of conserved residues,
and large numbers of gaps in the majority of sequences. Interestingly,
this protocol identified four conserved motifs in the N-terminal,
non-RT region of TERT (Fig.
1). We call these
motifs in order from N to C terminus the GQ, CP, QFP, and T motifs,
respectively. The locations of these motifs within Est2p are as
follows: GQ, residues 45 to 163; CP, residues 245 to 265; QFP, residues
267 to 343; and T, residues 367 to 413. Each motif contains nearly
invariant amino acid residues that are located at fixed distances from
one another. The GQ and QFP motifs have not been previously recognized.
In addition, the CP motif, hypothesized earlier to be ciliate specific,
is shown in our analysis to possess invariant and nearly invariant
residues. The identification of conserved motifs throughout the
N-terminal region of TERT suggests that this region mediates a
conserved function(s) in telomere synthesis. The overall comparison
also revealed a particularly degenerate region that is variable in length, located between motifs GQ and CP, implying the presence of a
flexible linker (Fig. 1B).


View larger version (135K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of conserved motifs in the N-terminal,
non-RT region of telomerase RT. (A) A schematic illustration of the
locations of RT motifs in the telomerase RT polypeptide as determined
by an earlier analysis is shown at the top (3). HMM-based
analysis revealed four conserved motifs located in the N-terminal
region of all TERTs that have been identified thus far (from
Tetrahymena thermophila, Oxytricha trifallax,
E. aediculatus, S. cerevisiae, S. pombe, C. albicans, Mus musculus, Homo
sapiens, and A. thaliana). These motifs are named in
order from N to C terminus the GQ, CP, QFP, and T motifs, respectively.
For ease of discussion, we also designate the most N-terminal
nonconserved region of TERT the N region. The segment between the GQ
motif and the CP motif is particularly variable in length, consistent
with the existence of a flexible linker in this region. (B) A detailed
alignment of the four motifs is shown. The GQ motif is shaded yellow,
and the CP, QFP, and T motifs are shaded gray. Invariant residues are
italicized, and highly conserved residues are shown in red. Conserved
hydrophobic residues are shown in boxes. Closed circles denote point
mutations described in this study, and open triangles denote functional
mutations at nonconserved positions as reported by Friedman and Cech
(11). Functional amino acid substitutions at conserved
positions are explicitly given at the bottom. The numbers in
parentheses are the numbers of functional mutations in connecting
regions. Regions I, II, III, and IV as defined by Friedman and Cech
(11) are indicated at the top. Sequences are from T. thermophila, C. trifallax, E. aediculatus,
S. cerevisiae, S. pombe, C. albicans,
M. musculus, H. sapiens, and A. thaliana (top to bottom, respectively).
|
|
The GQ motif is required for telomere maintenance.
To validate
some of the predictions arising from comparative sequence analysis, we
constructed mutants of the EST2 gene bearing alanine
substitutions in conserved residues in the GQ motif. The mutated
EST2 gene, located on a centromeric shuttle vector under the
control of its natural promoter, was transformed into an
est2::Kanr strain that had been grown
in the absence of Est2p for ~25 to 50 generations. The resulting
strain was then monitored for defects in growth, telomere maintenance,
and telomerase activity. To facilitate future biochemical
analysis, the plasmid-borne EST2 gene was fused at its 3'
end with three tandem Myc tags and a six-His tag. In some cases, an
additional protein A tag (consisting of two copies of the IgG binding
domain from protein A) was inserted in between the Myc and His tags to
allow even more efficient affinity purification. These C-terminal
modifications have no effect on telomere maintenance and
telomerase activity (J. Xia, unpublished data).
A total of eight alanine substitutions at conserved GQ motif
residues were constructed and tested: D66A, G85A, N104AV105A,
W115A, F118AH119A, G123A, Q138AF139A, and G141A. Two additional
mutants
with substitutions in nonconserved residues (D93A and
E154A) were also
made and tested for comparison. As summarized
in Table
1, three of these mutants (W115A,
F118AH119A, and G123A),
located quite close to one another, exhibited
the most pronounced
growth defects, giving rise to small and variably
sized colonies
suggestive of senescence (
31). The senescent
phenotype, characterized
by progressively slower cell multiplication,
has been observed
in several other telomerase knockout
strains (
25,
48). The
display of senescence suggests that
the W115A, F118AH119A, and
G123A mutants are quite compromised in
telomerase function. In
contrast, the other mutants either did
not show any growth defects
or grew only slightly slower (compared to a
strain carrying a
plasmid containing the wild-type
EST2
gene) and failed to exhibit
signs of senescence upon repeated
restreaking.
Chromosomal DNA was isolated from individual transformants following
two restreaks (~50 generations) and assayed for telomere
lengths. As
shown in Fig.
2, the Y' class of
telomeres in all
mutants with substitutions in conserved residues shows
dramatic
telomere shortening of at least 150 to 200 bp (all mutants
except
D93A and E154A, lanes 2 to 5, 8 and 9, and 12 to 21). The
senescent
mutants have even shorter telomeres and gave especially weak
signals
for hybridization (W115A, F118AH119A, and G123A, lanes 12 to
17).
Thus, there is a good correlation between growth defects and
telomere
repeat loss, consistent with earlier findings. In contrast to
mutations in conserved residues, the two strains with mutations
in
nonconserved residues (D93A and E154A) failed to show any evidence
of
telomere shortening.

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 2.
Telomere length determination in strains that contain
mutations in the conserved and nonconserved residues within the GQ
motif. The est2 strain that had been grown for ~25 to
50 generations was transformed with plasmids bearing either wild-type
(W.T.) or mutated EST2. The transformants were restreaked
twice, and single colonies were picked for growth in liquid culture.
Chromosomal DNAs were isolated from the cultures, digested with
PstI, electrophoresed into a 1% agarose gel, transferred to
a nylon membrane, and probed with 32P-labeled poly(dG-dT).
The locations of the Y' telomeres and an X telomere are indicated by a
vertical bar and an arrowhead, respectively. The mobilities of several
molecular size standards are indicated on the left.
|
|
Two mutations impaired telomere maintenance without affecting
telomerase activity.
Because several studies point to the
existence of mutations that uncouple in vitro telomerase
activity from in vivo telomere maintenance (e.g., est1 and
est3 mutants [27]), we were interested in
determining if any of the GQ mutations had similar properties. Extracts
were prepared from each of the mutant strains, and telomerase activity was partially purified over DEAE columns and tested. Earlier
studies indicated that, under standard reaction conditions, this
chromatographic fraction yields labeled products that are almost
entirely due to TLC1 and Est2p (5; N. Lue,
unpublished data). As shown in Fig. 3A,
almost the entire primer extension signal in this preparation is
sensitive to RNase A pretreatment. In addition, when the Est2p in the
strain is tagged with two copies of the IgG binding domain from protein
A, >80% of the activity in the DEAE fraction can be specifically
trapped on IgG-Sepharose beads and depleted from supernatant,
indicating that this fraction is largely free of other contaminating
activities (Fig. 3A).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Telomerase primer extension assays for wild-type and
mutated RNPs. (A) The DEAE fraction was prepared from strains whose
Est2p was either tagged or untagged with two copies of the IgG binding
domain from protein A. The fractions were incubated either in the
absence ( ) or in the presence (+) of IgG-Sepharose beads. The
supernatants were then recovered, incubated in the absence ( ) or the
presence (+) of RNase A, and assayed for telomerase activity
using TEL66 (TAGGGTAGTAGTAGGG) as the primer
oligonucleotide. The position of the primer +3 products is marked to
the left of the panel. (B) DEAE fractions were prepared from strains
bearing wild-type and mutated Est2p. Each mutant fraction was tested
alongside the wild-type fraction using equal amounts of total protein.
Each panel presents results from a single set of assays. The identities
of the mutations are indicated at the top of each panel, and
RNase-sensitive signals derived from telomerase are indicated
by vertical bars to the left of each panel. An RNase-insensitive band
(indicated by an asterisk) is occasionally observed in some assays.
|
|
Each mutant telomerase was tested side by side with the
wild-type fraction using equal amounts of total protein (Fig.
3B).
As
expected, the control mutants that exhibited no telomere shortening
had
in vitro activities that were comparable to those of the wild-type
enzyme (D93A and E154A, lanes 5 and 15). This result further
demonstrates
the reproducibility of our protocol. Six of the eight
mutants
with substitutions in conserved residues exhibited greatly
reduced
telomerase activity, ranging from ~12-fold reduction
for G85A
(lane 3) to more than 50-fold reduction for the senescent
mutants
(W115A and G123A, lanes 9 and 10). Interestingly, two mutants,
D66A and N104AV105A (lanes 2 and 7), appear to uncouple
telomerase
activity in vitro from telomere maintenance in vivo;
though the
telomeres in these two strains are greatly shortened, the
mutant
enzymes exhibited nearly wild-type levels of activity. Other
strains
that had similar telomere length defects such as G85 and
Q138AF139A
(lanes 3 and 12) suffered a ~12- to 20-fold reduction in
telomerase
activity (Table
1). All mutant fractions were
assayed at least
twice, and where a significant reduction in activity
relative
to that of the wild-type fraction was observed, the mutant
activity
as a percentage of the wild-type activity varied by less than
5%.
The extreme N-terminal region of Est2p (N region) is also required
for telomere maintenance in vivo and telomerase activity in
vitro.
Our comparative analysis suggests that the extreme
N-terminal 50 amino acids (termed N region) of yeast TERT could not be reliably aligned with its homologs from other species. To test the
importance of this N region, we constructed N-terminal truncation mutants of the EST2 gene and tested their ability to support
telomere length maintenance and telomerase activity using the
previously described system.
Four deletion mutants missing amino acids 2 to 10, 2 to 20, 2 to 30, and 2 to 50 (abbreviated as N-10, N-20, N-30, and N-50,
respectively)
were tested in this system. As shown in Fig.
4A
and Table
2, the N-10 and N-20 mutants exhibited
significantly
reduced growth rates in minimal medium on agar plates.
However,
they showed no evidence of senescence upon repeated
restreaking
(data not shown). In contrast, the N-30 and N-50 mutants
gave
rise to heterogeneously sized colonies suggestive of
senescence.
Chromosomal DNA from two independent clones of each strain
was
isolated following two restreaks and analyzed for telomere length
by Southern hybridization. Consistent with the growth defects,
all deletion mutants, including the smallest one (N-10), possessed
significantly shortened telomeres relative to the control strain
(Fig.
4B, compare lanes 1 and 8 with lanes 2 to 7). Both Y'-type
telomeres
(marked by a vertical bar) and X-type telomeres (marked
by arrows) in
the mutant strains were shortened, consistent with
a general defect in
telomere maintenance.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
N-terminal deletions result in defective Est2p function.
(A) Transformants bearing either wild-type or N-terminally deleted
Est2p were restreaked twice and monitored for growth defects on minimal
plates. The photographs show colonies from the second restreak after 2 days of growth. The identities of the clones are indicated at the left
of each panel. (B) Transformants bearing either wild-type or
N-terminally deleted Est2p were restreaked twice, and single colonies
were picked for growth in liquid cultures. Chromosomal DNAs were
isolated from the cultures, digested with XhoI
electrophoresed into a 1% agarose gel, transferred to a nylon
membrane, and probed with 32P-labeled poly(dG-dT). The
locations of the Y' telomeres and X telomeres are indicated by a
vertical bar and several arrowheads to the right of the panel,
respectively. (C) DEAE fractions were prepared from strains bearing
wild-type and N-terminally deleted Est2p and tested for
telomerase primer extension activity using TEL66 as the primer
oligonucleotide.
|
|
The deletion mutants were also tested for defects in telomerase
activity using the primer extension assay. As shown in Fig.
4C,
fractions derived from the N-10 and N-20 strains exhibited
significantly reduced telomerase activity compared to those
from
the control strain. Quantification by PhosphorImager analysis
indicates that the reduction is approximately 40- to 50-fold.
The N-30
and N-50 strains were not tested for in vitro activity.
However, based
on the growth defects, it is likely that these
latter strains would
have exhibited the same or less telomerase
activity. We
conclude that the N region of Est2p is required for
full
telomerase primer extension activity as measured in
vitro.
Loss of telomerase activity in the mutants cannot be
accounted for by loss of protein expression-stability alone.
To
determine if reduced telomerase activity of the deletion and
point mutants was due to reduced expression-stability of Est2p, we
determined the amount of protein A-tagged Est2p in the mutant strains
by Western analysis. To minimize potential variations introduced by
IgG-Sepharose binding, we first directly analyzed unfractionated
extracts for the presence of Est2p. An immunoreactive species of ~115
kDa can be detected in extracts from the tagged strain, but not from
the untagged strain, supporting the specificity of our assay (Fig.
5A). As expected, the two functionally
defective mutants that exhibited wild-type levels of in vitro
telomerase activity (D66A and N104AV105A) had wild-type levels
of Est2p (data not shown). Four mutants with reduced telomerase
activity in vitro (G85A, Q138AF139A, G141A, and N-10) also exhibited
levels of Est2p comparable to that of the wild-type strain (Fig. 5B).
The 12-fold or greater loss of in vitro activity of these four mutants
was therefore not due to reduced Est2p expression-stability.
Interestingly, the four senescent mutants (W115A, F118AH119A, G123A,
and N-30) did manifest a significant reduction in Est2p level such that it was not possible to detect these polypeptides unequivocally in
unfractionated extracts (data not shown). However, following IgG-Sepharose purification, even these mutant proteins can be clearly
visualized in Western analysis (Fig. 5C). The increased background in
these latter assays (marked by a vertical bar to the right of the
panel) came from IgG that was released by heating of the IgG-Sepharose
beads in SDS and that reacted with the secondary antibody. Using
signals derived from different amounts of Sepharose beads carrying
wild-type Est2p as standards, these four mutant polypeptides appear to
be present at approximately one-third to one-fifth of the wild-type
protein level (compare lanes 3 to 6 with lane 1 and lane 2). The N-30
mutant polypeptide exhibited a slightly increased mobility by SDS-PAGE,
further confirming the authenticity of our signal (Fig. 5C, lane 6).
Given that telomerase activity was reduced by 50-fold or more
in these senescent mutants, it appears that the mild reduction in Est2p
level cannot solely account for the enzymatic defect.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of mutant protein expression. (A) Whole-cell
extracts were prepared from strains whose Est2p was either tagged (+)
or untagged ( ) with the IgG binding domain of protein A and subjected
to Western analysis. For each extract, 300 µg of total protein was
examined. The position of the protein A-tagged Est2p is indicated by an
arrow. (B) Est2p levels in whole-cell extracts from wild-type (W.T.) or
mutant strains were analyzed by Western blotting. For each extract, 500 µg of total protein was examined. The position of the protein
A-tagged Est2p is indicated by an arrow. (C) Est2p levels in whole-cell
extracts from wild-type (W.T.) or mutant strains were assessed by
affinity precipitation followed by Western analysis. For each extract,
4 mg of total proteins was incubated with 40 µl of IgG-Sepharose
resin with gentle agitation at 4°C for 16 h. The beads were
washed extensively, and the indicated amount of Sepharose was boiled in
SDS-PAGE loading buffer. The eluted proteins were then subjected to
immunoblotting. The position of the protein A-tagged Est2p is indicated
by an arrow. The increased background (marked by a vertical bar) was
due to IgG that eluted from the beads and that cross-reacted with the
secondary antibody.
|
|
If the senescent mutant proteins were indeed defective in function (as
opposed to defective only in expression-stability),
then they might act
in a dominant-negative fashion when overexpressed
in the presence of
wild-type protein. This was found to be indeed
the case. Four mutants
that caused senescence (W115A, F118AH119A,
G123A, and N-30) were placed
downstream of a strong constitutive
promoter, and the resulting
plasmids were introduced into a wild-type
strain (W303). Following
three restreaks (~75 generations), chromosomal
DNAs were isolated
from the transformants and analyzed for telomere
length alteration
(Fig.
6). Consistent with a defect in
function,
all four mutants caused significant telomere shortening in
the
host strain (Fig.
6A, compare lane 3 with lanes 1 and 4; Fig.
6B,
compare lanes 3 to 5 with lane 1). As expected, two mutant
proteins
that supported normal telomere maintenance (D93A and
E154A) had no
effect when overproduced (Fig.
6B, lanes 2 and 6),
and an Est2p with an
RT active site mutation (D670A) caused the
most severe telomere
shortening (Fig.
6A, lane 2). The other nonsenescent
GQ motif mutants
caused at most a slight shortening of telomeres
(~50 bp) when
overexpressed in W303, possibly because they retain
a significant level
of function (data not shown).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Several Est2p mutants can cause telomere shortening when
overexpressed in the presence of wild-type protein. (A) W303 was
transformed with a pYX212 plasmid expressing mutated Est2p. After
restreaking of the transformants three times, chromosomal DNAs were
isolated from the strains, digested with PstI, and analyzed
for telomere lengths. DNAs were also isolated from untransformed W303
and tested for comparison. The source of the DNA is indicated at the
top of the panel. (B) DNAs from strains overexpressing different Est2p
mutant proteins were isolated and digested as for panel A and tested
for telomere lengths. The source of the DNA is indicated at the top of
the panel. The mobilities of several molecular size standards (in
kilobases) are indicated at the sides.
|
|
Identification of a protease-resistant stable domain in the
N-terminal region of Est2p.
To begin to biochemically dissect the
TERT polypeptide, we attempted to express recombinantly the N-terminal
region of Est2p in Escherichia coli as MBP (maltose-binding
protein) fusion proteins. To facilitate purification, the proteins were
also fused to a six-His tag at its C terminus. Three fragments, 1-304,
1-270, and 1-160, were chosen for initial characterization as parts
of the MBP fusion protein [designated MBP-Est(1-304)p,
MBP-Est2(1-270)p, and MBP-Est2(1-160)p, respectively].
Interestingly, the two larger fragments appear to be sensitive to
proteolysis in E. coli. For example, following affinity
purification over a maltose column, fractions derived from the
MBP-Est2(1-304)p-overproducing strain contained not only the
full-length fusion polypeptide but also several smaller fragments (Fig.
7A, lane 1). These smaller fragments most
likely resulted from proteolysis of the Est2p segment in vivo, because
they still retained the MBP domain, and because the MBP domain on its
own was stably expressed in E. coli (Fig. 7A, lane 6). Based
on their size, the proteolyzed fragments appear to retain ~160 amino
acids of Est2p (Fig. 7A, compare lanes 1 and 2). Interestingly, the
MBP-Est2(1-160)p can be easily overproduced and purified as a
single polypeptide from E. coli, again suggesting that this
segment of Est2p, encompassing the N region and GQ motif, can form a
stable domain in vivo that is resistant to proteolysis.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
The Est2(1-160)p fragment exhibits a nonspecific
nucleic acid binding activity. (A) Several MBP-Est2p fusion proteins
were expressed and purified from E. coli using both
nickel-affinity and maltose-affinity columns. The resulting
preparations were analyzed in an SDS-10% polyacrylamide gel. The
identities of the fusion proteins are indicated at the top of the
panel. All fusion proteins (lanes 1 to 5) contain ~40 kDa of an MBP
domain besides the Est2p fragments. The MBP (lane 6) derived from the
original cloning vector contains an extra protein fragment beyond the
polylinker and is therefore ~48 kDa in size. (B) Increasing amounts
of MBP and MBP-Est2(1-160)p were incubated with 20 ng of in
vitro-transcribed, labeled TLC1 RNA. The resulting mixtures were passed
through a nitrocellulose filter, and the percentage of probe retained
on the filter was plotted against the amount of protein used. Assays
were performed in duplicate, and the averages and spreads are
indicated. (C) Filter binding assays were performed using 1.3 µg of
MBP-Est2(1-160)p and 20 ng of TLC1 RNA in the presence of increasing
Mg concentrations. The percentage of probe retained on the filter was
plotted against the Mg concentration. (D) Filter binding assays were
performed using 1.3 µg of MBP-Est2(1-160)p and 20 ng of TLC1 RNA in
the presence of increasing sodium acetate concentrations. The
percentage of probe retained on the filter was plotted against the
sodium acetate concentration (taking the amount retained in the
presence of no salt as 100%). (E) Filter binding assays were performed
using increasing amounts of MBP-Est2(1-160)p and 20 ng of either TLC1
RNA or antisense TLC1 RNA probe. The percentage of probe retained on
the filter was plotted against the amount of protein used. (F) Filter
binding assays were performed using 1.3 µg of MBP-Est2(1-160)p and
10 ng of labeled TLC1 RNA in the presence of increasing amounts of
three different unlabeled DNA competitors: denatured salmon sperm DNA,
double-stranded linear DNA, and single-stranded (SS) circular DNA. The
percentage of probe retained on the filter was plotted against the
ratio of competitor to probe (taking the amount retained in the
presence of no competitor as 100%).
|
|
The N-terminal domain of Est2p possesses a nucleic acid binding
activity.
One potential function for the N-terminal domain is
involvement in protein-RNA interactions. To test this idea, we assayed the N-terminal fusion protein for RNA binding activity using a filter retention assay. Initial studies employed MBP-Est2(1-160)p and 32P-labeled full-length TLC1 RNA. As shown in
Fig. 7B, the amount of RNA retained on the filter increased with
increasing protein concentrations. At the highest protein concentration
used (0.05 µg/µl), ~25% of the input RNA was retained on the
filter. The apparent dissociation constant was about 5 µM. The amount
of RNA retained by MBP was substantially less than that by the fusion protein, indicating that RNA binding was mediated by the N-terminal Est2p fragment.
We investigated several reaction parameters and found that both salt
and Mg
2+ concentrations significantly affected the
efficiency of binding.
RNA retention as a function of Mg
2+
concentration is a bell-shaped curve, with a peak at ~5 to 10
mM
(Fig.
7C). The protein-RNA interaction was favored at low salt
concentrations; the binding efficiency was reduced by ~75% at
250 mM
sodium acetate relative to no salt (Fig.
7D).
To determine the sequence specificity of binding, we generated both
sense and antisense TLC1 RNA probes by in vitro transcription
and
compared their abilities to interact with the fusion protein.
As shown
in Fig.
7E, the extent of binding is only twofold higher
for the sense
probe, suggesting that the N-terminal domain, at
least by itself, does
not recognize RNA with significant sequence
specificity. We also tested
the effect of RNA length on the efficiency
of binding using TLC1 RNA
missing increasing numbers of 3'-end
residues. The results indicate
that the fusion protein has similar
affinities for RNAs ranging from
450 to 1,300 nucleotides long
(data not
shown).
We next tested binding of the fusion protein to DNAs of different
structure using a competition filter-binding assay. A fixed
amount of
fusion protein [MBP-Est2(1-160)p, 1.3 µg] was mixed
with
both a fixed amount of labeled TLC1 RNA (10 ng) and variable
amounts of unlabeled DNA competitors. The resulting mixture was
then subjected to filtration through a nitrocellulose membrane
as
previously described. Single-stranded circular

X174 virion
DNA,
sheared and denatured salmon sperm DNA, and double-stranded
linear DNA
were used as the competitors. As shown in Fig.
7F,
at an
RNA/DNA ratio of 2:1, both the

X174 DNA and denatured salmon
sperm
DNA reduced the binding efficiency by 60%. Comparable inhibition
of
RNA binding by double-stranded linear DNA was achieved at a
ratio of
~8:1. We also tested short single-stranded telomere oligonucleotides
(the G-rich strand) in the competition assay, and the same amount
of
these oligonucleotides (by weight) was no more effective than
the
other single-stranded DNAs in reducing the binding signal
(data not
shown). Thus, the Est2p(1-160) fragment can also bind
DNA in a
non-sequence-specific fashion, with a slight preference
for
single-stranded DNA over double-stranded
DNA.
The first 50 amino acid residues of Est2p are required for the
nucleic acid binding activity.
To further define the nucleic acid
binding domain, we constructed a series of plasmids for expressing
subfragments of the Est2p N-terminal domain. As before, these
subfragments were fused to both an MBP and a six-His tag. The fusion
proteins were expressed in and purified from E. coli as
previously described (Fig. 7A) and used in filter binding assays.
As shown in Fig.
8A, a large deletion
from the C-terminal end of the Est2p fragment had little effect on RNA
binding. Even
a fusion protein with only the first 50 amino acid
residues of
Est2p [MBP-Est2(1-50)p] showed binding to RNA comparable
to that
of MBP-Est2(1-160)p. In contrast, a 10-amino-acid deletion
from
the N terminus significantly reduced the RNA binding activity,
by
approximately fivefold. When 30 or 50 amino acids were deleted
from the
N terminus, the RNA binding activity was reduced to the
background
level (Fig.
8B; also see the MBP plot in Fig.
7B).
A similar series of
assays using a double-stranded linear DNA
as the probe gave essentially
identical results (data not shown).
These observations suggest that the
N region (first 50 amino acids)
of Est2p is largely responsible for the
nonspecific nucleic acid
binding activity exhibited by the 1-160
fragment.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 8.
The first 50 amino acid residues of Est2p are largely
responsible for the nucleic acid binding activity exhibited by the N-GQ
fragment. (A) Filter binding assays were performed using 1.3 µg of
MBP, MBP-Est2(1-50)p, and MBP-Est2(1-160)p and 20 ng of labeled TLC1
RNA. The percentage of probe retained on the filter for each protein
was plotted. (B) Filter binding assays were performed using increasing
amounts of N-terminally truncated fusion proteins and 20 ng of labeled
TLC1 RNA. The percentage of probe retained on the filter was plotted
against the amount of protein used.
|
|
 |
DISCUSSION |
We have investigated the function of the N-terminal region of
Est2p (yeast TERT) by a combination of HMM-based sequence comparison, mutagenesis, and biochemical studies. In this report, we describe the
identification of four phylogenetically conserved non-RT motifs (named
GQ, CP, QFP, and T) located in the N-terminal region of TERTs. The
locations of these motifs within Est2p are as follows: GQ, residues 45 to 163; CP, residues 245 to 265; QFP, residues 267 to 343; and T,
residues 367 to 413. Alanine substitutions of conserved GQ motif
residues confirmed the functional importance of this motif. Indeed, the
identification of two phenotypic classes of mutations within this motif
suggests that it may mediate at least two distinct biochemical
functions. Finally, we showed that the extreme N-terminal, nonconserved
region (N region) of TERT possesses a nonspecific nucleic acid binding
activity when analyzed in isolation. Furthermore, the N region proved
to be important for telomere maintenance and telomerase
activity in the context of the native telomerase RNP.
Comparison of the unigenic evolution approach and the HMM-based
alignment approach in identifying functionally important TERT
regions.
While our work was in progress, Friedman and Cech
(11) reported the identification of essential yeast TERT
N-terminal domains using a unigenic evolution approach. In this
approach, the gene of interest is heavily mutagenized, and functional
variants are selected. Essential and dispensable regions of the protein
are then identified by statistically analyzing the distribution of missense and silent mutations. This analysis led to the identification of four essential regions in the Est2p N-terminal portion: region I,
residues 31 to 163; region II, 214 to 265; region III, 285 to 374; and
region IV, 378 to 432. A casual comparison between these regions and
our motifs immediately indicates that they are largely concordant, with
the GQ motif corresponding to region I, the CP motif corresponding to
region II, and the QFP and T motifs corresponding to regions III and
IV, respectively (Fig. 1B).
Because the unigenic evolution approach is aimed at identifying all
essential regions, one would predict that the conserved
motifs should
constitute subparts of these regions. This is indeed
the case for both
the GQ and CP motifs. However, in the case of
QFP and T motifs, there
are two evident discrepancies that are
worth noting. First, the QFP
motif appears to encompass more residues
at its N-terminal boundary
than does region III. Nevertheless,
mutations that are tolerated in the
spacer between region II and
region III do not affect conserved
residues. Second, the boundary
between region III and region IV and
that between motif QFP and
motif do not correspond. However, as noted
by Friedman and Cech
(
11), because of the close proximity of
these two regions, the
choice of boundary is somewhat
arbitrary.
While we did not present mutagenesis of conserved CP, QFP, and T motif
residues in this report, preliminary studies indicate
that conserved
residues within these motifs are also required
for normal telomere
maintenance (Y. Peng and N. Lue, unpublished
data). Furthermore, close
inspection of tolerated mutations reported
by Friedman and Cech
(
11) lends further credence to the validity
of the
alignment. Out of the 166 tolerated missense mutations,
only 14 affect
conserved or nearly conserved residues, and out
of the 14 mutations,
only 5 (N80

D, A360

E, T384

A, T384

I, and
E385

V) change a
conserved residue to a chemically dissimilar
one. The identification of
physiologically important conserved
motifs that account for much of the
N-terminal portion of TERTs
suggests that this region shares a common
structure and mediates
conserved functions in telomere
maintenance.
The function of the GQ motif.
While mutagenesis indicates that
the GQ motif mediates an important function(s), its precise mechanisms
are not understood. As described earlier, two mutations in nonconserved
residues failed to affect telomerase function in vitro and in
vivo. In contrast, eight out of eight mutants with changes in conserved
residues show defective telomerase function in vivo. These
mutations can be further classified according to the level of
telomerase primer extension activity in vitro: one class of
mutants (called class A, six of eight mutants) has 1/12 or less the
wild-type levels of activity, while the other class (called class B,
D66A and N104AV105A) has nearly wild-type levels of activity. The
identification of phenotypically distinct mutants suggests that the GQ
motif may play at least two functions in telomere maintenance.
Potential defects for the two classes of mutants are discussed
separately below.
For class A mutants, there is a good correlation between telomere
shortening and loss of telomerase activity. For example,
the
G85A, Q138AF139A, and G141A mutants, which exhibit ~1/12 to
1/20 of
the wild-type activity, have telomeres that are on average
~150 bp
shorter and do not exhibit signs of senescence. The senescent
strains
(W115A, F118AH119A, and G123A) have nearly undetectable
levels of
telomerase activity (>50-fold reduction) and even shorter
telomeres. Taken together, these results are consistent with the
prevailing model that the equilibrium telomere length is established
by
both lengthening and shortening mechanisms, with the level
of
telomerase activity being a key component of the lengthening
mechanism (
32).
Since class A mutant proteins are present at normal or slightly reduced
levels, their defects in telomere maintenance and
telomerase
activity cannot be explained by loss of expression
or stability. Two
possibilities can be considered. First, the
assembly of Est2p into the
telomerase complex may be affected.
Consistent with this
hypothesis, Friedman and Cech (
11) found
that two of their
alanine substitution mutants (Ala-4, which changes
residues 110 to 119 all to alanine, and Ala-5, which changes residues
145 to 154 all to
alanine) exhibited reduced binding to TLC1 RNA.
In this regard, it is
also interesting to note that the region
of hTERT (1 to 200)
hypothesized to bind Hsp90 and P23 contains
the GQ motif
(
21). Binding to Hsp90 and P23 has been suggested
to play a
role in the assembly of human telomerase RNP. It is
possible
that some of the class A mutations may disrupt Est2p
interaction with
Hsp90 and/or P23, thereby causing a reduction
in telomerase
activity. However, it should be noted that the ability
of the four
senescent mutants to act in a dominant-negative fashion
suggests that
the mutant proteins are capable of interacting with
some component of
the telomere pathway and interfering with its
action. Second, it
is possible that some of the class A residues
participate directly in
telomerase primer extension. Interestingly,
secondary structure
predictions suggest that the residues mutated
in the senescent strains
(W115A, F118AH119A, and G123A) may lie
on the same face of an
alpha helix and may therefore mediate the
same function (I. Saira Mian,
unpublished
data).
Because the class B mutants (D66A and N104AV105A) have wild-type levels
of telomerase activity, the synthesis and assembly
of the RNP
are probably not affected. Instead, functional interaction
between
Est2p and other factors that regulate telomerase in vivo
may be
disrupted. Three groups of factors are potential candidates
for this
interaction based on epistasis analysis: Est1p and Est3p,
the
Rad50-Mre11-Xrs2 complex, and factors in the Tel1p-Tel2p pathway.
Strains that contain mutations in both telomerase core
components
(Est2p and TLC1) and factors in one of these three groups do
not
exhibit more severe growth defects or telomere shortening than
do
strains that carry single mutations (
24,
40,
44). Thus,
these factors may functionally interact with telomerase core
components.
Est1p and Est3p are presumed components of the
telomerase holoenzyme
but neither is required for in vitro
activity. While the function
of Est3p is not known, recent studies
suggest that the Est1p may
be involved in the recruitment of the core
telomerase to chromosomal
ends (
9). The
Rad50-Mre11-Xrs2 complex participates in nonhomologous
double-stranded
DNA break end-joining repair and possesses a 5'-to-3'
exonuclease
activity (
17). Tel1p is homologous to DNA-dependent
protein
kinases and other kinases involved in cell cycle checkpoint
control
(
14,
36). Tel2p is an essential protein that exhibits
a
telomere sequence-specific DNA and RNA binding activity in vitro
(
23,
45). The mechanisms of these non-Est factors in
telomere
maintenance are poorly understood. Regardless of the precise
interaction
partner for the Est2p GQ motif, the fact that disruption of
interaction
can be caused by mutations in conserved residues suggests
that
the interaction may also be evolutionarily
conserved.
The function of the N region.
Our results suggest that the
first 50 amino acid residues of Est2p (N region) are required for
telomere maintenance in vivo and telomerase activity in vitro.
These 50 amino acid residues, when separated from the rest of the RNP,
are also capable of mediating nucleic acid binding in vitro. Deleting
the first 10 amino acids of Est2p results in significant telomere
shortening and an ~50-fold reduction in telomerase activity.
The same deletion reduced the binding activity of the 1-160 fragment
by fivefold. Deleting the first 30 or 50 amino acids had more severe
effects both on the function of the full-length protein and on the
binding activity of the 1-160 fragment. The correlation between
function of the full-length protein and the binding activity of the
N-terminal fragment suggests that the binding activity reflects an
important physiologic function. We have been unable to express and
purify a significant amount of full-length Est2p. Thus, it is not
possible to compare the binding properties of N-terminal domain with
those of the full-length protein. However, given the localization of the RT motifs in the C terminus of Est2p, the N-terminal domain is
unlikely to account completely for the binding activity of the
full-length protein.
The physiologic binding target for the Est2p N region is not clear. It
seems unlikely that this fragment is binding both RNA
and DNA
nonspecifically in the context of the entire telomerase
complex. Possibly, it has a specific binding target in vivo, but
that
it requires other domains of Est2p or other components of
telomerase to achieve specific binding. One attractive target
is the telomerase RNA. The N-terminal fragment may, for
example,
be involved in the formation of a stable RNP. This idea would
be consistent with its important role in telomerase activity
and
telomere maintenance. Another attractive target is the telomeric
DNA. TERT has been reported to possess a second primer-binding
site
away from the reverse transcription catalytic site (also
known as the
anchor site [
7,
18]). The anchor site has been
postulated to be important for processive elongation by ciliate
telomerases. Earlier studies also suggest that anchor site
interactions
may be important for high-affinity
primer-telomerase complex formation
(
29). Further
studies will be necessary to define the precise
target of the Est2p N
region.
The N-GQ fragment may constitute a stable domain of TERT.
Sequence analysis suggests that the conserved GQ motif is followed in
the alignment by a presumed flexible spacer, which exhibits little
conservation and is variable in length. This conjecture is supported by
our expression studies with E. coli. As described in the
Results section, while the 1-160 fragment can be easily overproduced
and purified from E. coli, larger fragments are quite susceptible to proteolysis. In addition, unigenic evolution
analysis indicates that this linker region may be largely dispensable
for function. The sequence alignment, mutagenesis, and biochemical studies, taken together, suggest that all TERTs may have at least a
bipartite domain organization, with conserved N-terminal (N-GQ fragment) and C-terminal (CP-QFP-T-RT fragment) domains connected through a flexible spacer. The identification of a stable domain of
TERT should open the way toward detailed structural analysis of at
least an important part of telomerase. Given that
telomerase has been shown to be an attractive anticancer drug
target, such a structural study will no doubt be interesting both from
a biochemical and from a pharmacological perspective.
 |
ACKNOWLEDGMENTS |
We thank B. Futcher, B. Schneider, and B. Schwer for strains and
plasmids and B. Schwer for comments on the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, W. R. Hearst Microbiology Research
Center, Weill Medical College of Cornell University, 1300 York Ave.,
New York, NY 10021. Phone: (212) 746-6506. Fax: (212) 746-8587. E-mail: nflue{at}mail.med.cornell.edu.
 |
REFERENCES |
| 1.
|
Beattie, T. L.,
W. Zhou,
M. O. Robinson, and L. Harrington.
1998.
Reconstitution of human telomerase activity in vitro.
Curr. Biol.
8:177-180[CrossRef][Medline].
|
| 2.
|
Blackburn, E. H.
1992.
Telomerases.
Annu. Rev. Biochem.
61:113-129[CrossRef][Medline].
|
| 3.
|
Bryan, T. M.,
J. M. Sperger,
K. B. Chapman, and T. R. Cech.
1998.
Telomerase reverse transcriptase genes identified in Tetrahymena thermophila and Oxytricha trifallax.
Proc. Natl. Acad. Sci. USA
95:8479-8484[Abstract/Free Full Text].
|
| 4.
|
Buchman, A. R.,
N. F. Lue, and R. D. Kornberg.
1988.
Connections between transcriptional activators, silencers, and telomeres revealed by functional analysis of a yeast DNA-binding protein.
Mol. Cell. Biol.
8:5086-5099[Abstract/Free Full Text].
|
| 5.
|
Cohn, M., and E. H. Blackburn.
1995.
Telomerase in yeast.
Science
269:396-400[Abstract/Free Full Text].
|
| 6.
|
Collins, K., and L. Gandhi.
1998.
The reverse transcriptase component of the Tetrahymena telomerase ribonucleoprotein complex.
Proc. Natl. Acad. Sci. USA
95:8485-8490[Abstract/Free Full Text].
|
| 7.
|
Collins, K., and C. W. Greider.
1993.
Tetrahymena telomerase catalyzes nucleolytic cleavage and nonprocessive elongation.
Genes Dev.
7:1364-1376[Abstract/Free Full Text].
|
| 8.
|
Collins, K.,
R. Kobayashi, and C. W. Greider.
1995.
Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme.
Cell
81:677-686[CrossRef][Medline].
|
| 9.
|
Evans, S. K., and V. Lundblad.
1999.
Est1 and Cdc13 as comediators of telomerase access.
Science
286:117-120[Abstract/Free Full Text].
|
| 10.
|
Fitzgerald, M. S.,
K. Riha,
F. Gao,
S. Ren,
T. D. McKnight, and D. E. Shippen.
1999.
Disruption of the catalytic telomerase subunit gene from Arabidopsis inactivates telomerase and leads to a slow loss of telomeric DNA.
Proc. Natl. Acad. Sci. USA
96:14813-14818[Abstract/Free Full Text].
|
| 11.
|
Friedman, K. L., and T. R. Cech.
1999.
Essential functions of amino-terminal domains in the yeast telomerase catalytic subunit revealed by selection for viable mutants.
Genes Dev.
13:2863-2874[Abstract/Free Full Text].
|
| 12.
|
Gandhi, L., and K. Collins.
1998.
Interaction of recombinant Tetrahymena telomerase proteins p80 and p95 with telomerase RNA and telomeric DNA substrates.
Genes Dev.
12:721-733[Abstract/Free Full Text].
|
| 13.
|
Greenberg, R. A.,
R. C. Allsopp,
L. Chin,
G. B. Morin, and R. A. DePinho.
1998.
Expression of mouse telomerase reverse transcriptase during development, differentiation and proliferation.
Oncogene
16:1723-1730[CrossRef][Medline].
|
| 14.
|
Greenwell, P. W.,
S. L. Kronmal,
S. E. Porter,
J. Gassenhuber,
B. Obermaier, and T. D. Petes.
1995.
TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human telangiectasia gene.
Cell
82:823-829[CrossRef][Medline].
|
| 15.
|
Greider, C. W., and E. H. Blackburn.
1985.
Identification of a specific telomere terminal transferase activity in Tetrahymena extracts.
Cell
43:405-413[CrossRef][Medline].
|
| 16.
|
Greider, C. W., and E. H. Blackburn.
1989.
A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis.
Nature
337:331-337[CrossRef][Medline].
|
| 17.
|
Haber, J. E.
1998.
The many interfaces of Mre11.
Cell
95:583-586[CrossRef][Medline].
|
| 18.
|
Hammond, P. W.,
T. N. Lively, and T. R. Cech.
1997.
The anchor site of telomerase from Euplotes aediculatus revealed by photo-cross-linking to single- and double-stranded DNA primers.
Mol. Cell. Biol.
17:296-308[Abstract].
|
| 19.
|
Harrington, L.,
T. McPhail,
V. Mar,
W. Zhou,
R. Oulton,
A. E. Program,
M. B. Bass,
I. Arruda, and M. O. Robinson.
1997.
A mammalian telomerase-associated protein.
Science
275:973-977[Abstract/Free Full Text].
|
| 20.
|
Harrington, L.,
W. Zhou,
T. McPhail,
R. Oulton,
D. S. K. Yeung,
V. Mar,
M. B. Bass, and M. O. Robinson.
1997.
Human telomerase contains evolutionarily conserved catalytic and structural subunits.
Genes Dev.
11:3109-3115[Abstract/Free Full Text].
|
| 21.
|
Holt, S. E.,
D. L. Aisner,
J. Bauer,
V. M. Tesmer,
M. Dy,
M. Ouellette,
J. B. Trager,
G. B. Morin,
D. O. Toft,
J. W. Shay,
W. E. Wright, and M. A. White.
1999.
Functional requirement of p23 and Hsp90 in telomerase complexes.
Genes Dev.
13:817-826[Abstract/Free Full Text].
|
| 22.
|
Kilian, A.,
D. D. Bowtell,
H. E. Abud,
G. R. Hime,
D. J. Venter,
P. K. Keese,
E. R. Duncan,
R. R. Reddel, and R. A. Jefferson.
1997.
Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.
Hum. Mol. Genet.
6:2011-2019[Abstract/Free Full Text].
|
| 23.
|
Kota, R. S., and K. W. Runge.
1998.
The yeast telomere length regulator TEL2 encodes a protein that binds to telomeric DNA.
Nucleic Acids Res.
26:1528-1535[Abstract/Free Full Text].
|
| 24.
|
Le, S.,
J. K. Moore,
J. E. Haber, and C. W. Greider.
1999.
RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase.
Genetics
152:143-152[Abstract/Free Full Text].
|
| 25.
|
Lendvay, T. S.,
D. K. Morris,
J. Sah,
B. Balasubramanian, and V. Lundblad.
1996.
Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes.
Genetics
144:1399-1412[Abstract].
|
| 26.
|
Lingner, J., and T. R. Cech.
1996.
Purification of telomerase from Euplotes aediculatis: requirement of a primer 3' overhang.
Proc. Natl. Acad. Sci. USA
93:10712-10717[Abstract/Free Full Text].
|
| 27.
|
Lingner, J.,
T. R. Cech,
T. R. Hughes, and V. Lundblad.
1997.
Three Ever Shorter Telomere (EST) genes are dispensable for in vitro yeast telomerase activity.
Proc. Natl. Acad. Sci. USA
94:11190-11195[Abstract/Free Full Text].
|
| 28.
|
Lingner, J.,
T. R. Hughes,
A. Shevchenko,
M. Mann,
V. Lundblad, and T. R. Cech.
1997.
Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science
276:561-567[Abstract/Free Full Text].
|
| 29.
|
Lue, N. F., and Y. Peng.
1998.
Negative regulation of yeast telomerase activity through an interaction with an upstream region of the DNA primer.
Nucleic Acids Res.
26:1487-1494[Abstract/Free Full Text].
|
| 30.
|
Lue, N. F., and J. Xia.
1998.
Species-specific and sequence-specific recognition of the dG-rich strand of telomeres by yeast telomerase.
Nucleic Acids Res.
26:1495-1502[Abstract/Free Full Text].
|
| 31.
|
Lundblad, V., and J. W. Szostak.
1989.
A mutant with a defect in telomere elongation leads to senescence in yeast.
Cell
57:633-643[CrossRef][Medline].
|
| 32.
|
Marcand, S.,
V. Brevet, and E. Gilson.
1999.
Progressive cis-inhibition of telomerase upon telomere elongation.
EMBO J.
18:3509-3519[CrossRef][Medline].
|
| 33.
|
Meyerson, M.,
C. M. Counter,
E. N. Eaton,
L. W. Ellisen,
P. Steiner,
S. D. Caddle,
L. Ziaugra,
R. L. Beijersbergen,
M. J. Davidoof, and Q. E. A. Liu.
1997.
hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization.
Cell
90:785-795[CrossRef][Medline].
|
| 34.
|
Mian, I.S.
1997.
Comparative sequence analysis of ribonucleases HII, III, II PH and D.
Nucleic Acids Res.
25:3187-3195[Abstract/Free Full Text].
|
| 35.
|
Mian, I. S.,
M. J. Moser,
W. R. Holley, and A. Chatterjee.
1998.
Statistical modelling and phylogenetic analysis of a deaminase domain.
J. Comput. Biol.
5:57-72[Medline].
|
| 36.
|
Morrow, D. M.,
D. A. Tagle,
Y. Shiloh,
F. S. Collins, and P. Hieter.
1995.
TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1.
Cell
82:831-840[CrossRef][Medline].
|
| 37.
|
Moser, M. J.,
W. R. Holley,
A. Chatterjee, and I. S. Mian.
1997.
The proofreading domain of Escherichia coli DNA polymerase I and other DNA and/or RNA exonuclease domains.
Nucleic Acids Res.
25:5110-5118[Abstract/Free Full Text].
|
| 38.
|
Nakamura, T. M.,
G. B. Morin,
K. B. Chapman,
S. L. Weinrich,
W. H. Andrews,
J. Lingner,
C. B. Harley, and T. R. Cech.
1997.
Telomerase catalytic subunit homologs from fission yeast and human.
Science
277:955-959[Abstract/Free Full Text].
|
| 39.
|
Nakayama, J.-I.,
M. Saito,
H. Nakamura,
A. Matsuura, and F. Ishikawa.
1997.
TLP1: a gene encoding a protein component of mammalian telomerase is a novel member of WD repeats family.
Cell
88:875-884[CrossRef][Medline].
|
| 40.
|
Nugent, C. I.,
G. Bosco,
L. O. Ross,
S. K. Evans,
A. P. Salinger,
J. K. Moore,
J. E. Haber, and V. Lundblad.
1998.
Telomere maintenance is dependent on activities required for end repair of double-strand breaks.
Curr. Biol.
8:657-660[CrossRef][Medline].
|
| 41.
|
Nugent, C. I., and V. Lundblad.
1998.
The telomerase reverse transcriptase: components and regulation.
Genes Dev.
12:1073-1085[Free Full Text].
|
| 42.
|
Oguchi, K.,
H. Liu,
K. Tamura, and H. Takahashi.
1999.
Molecular cloning and characterization of AtTERT, a telomerase reverse transcriptase homolog in Arabidopsis thaliana.
FEBS Lett.
457:465-469[CrossRef][Medline].
|
| 43.
|
Prescott, J., and E. H. Blackburn.
1997.
Functionally interacting telomerase RNAs in the yeast telomerase complex.
Genes Dev.
11:2790-2800[Abstract/Free Full Text].
|
| 44.
|
Ritchie, K. B.,
J. C. Mallory, and T. D. Petes.
1999.
Interactions of TLC1 (which encodes the RNA subunit of telomerase), TEL1, and MEC1 in regulating telomere length in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:6065-6075[Abstract/Free Full Text].
|
| 45.
|
Runge, K. W., and V. A. Zakian.
1996.
TEL2, an essential gene required for telomere length regulation and telomere position effect in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:3094-3105[Abstract].
|
| 46.
|
Schneider, B. L.,
W. Seufert,
B. Steiner,
Q. H. Yang, and A. B. Futcher.
1995.
Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae.
Yeast
11:1265-1274[CrossRef][Medline].
|
| 47.
|
Seto, A. G.,
A. J. Zaug,
S. G. Sobel,
S. L. Wolin, and T. R. Cech.
1999.
Saccharomyces cerevisiae telomerase is an Sm sn-RNP.
Nature
401:177-180[CrossRef][Medline].
|
| 48.
|
Singer, M. S., and D. E. Gottschling.
1994.
TLC1:template RNA component of Saccharomyces cerevisiae telomerase.
Science
266:404-409[Abstract/Free Full Text].
|
| 49.
|
Virta-Pearlman, V.,
D. K. Morris, and V. Lundblad.
1996.
Est1 has the properties of a single-stranded telomere end-binding protein.
Genes Dev.
10:3094-3104[Abstract/Free Full Text].
|
| 50.
|
Weinrich, S. L.,
R. Pruzan,
L. Ma,
M. Ouellette,
V. M. Tesmer,
S. E. Holt,
A. G. Bodnar,
S. Lichtsteiner,
N. W. Kim,
J. B. Trager,
R. D. Taylor,
R. Carlos,
W. H. Andrews,
W. E. Wright,
J. W. Shay,
C. B. Harley, and G. B. Morin.
1997.
Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT.
Nat. Genet.
17:498-502[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2000, p. 5196-5207, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Oh, W., Ghim, J., Lee, E.-W., Yang, M.-R., Kim, E. T., Ahn, J.-H., Song, J.
(2009). PML-IV functions as a negative regulator of telomerase by interacting with TERT. J. Cell Sci.
122: 2613-2622
[Abstract]
[Full Text]
-
Gunisova, S., Elboher, E., Nosek, J., Gorkovoy, V., Brown, Y., Lucier, J.-F., Laterreur, N., Wellinger, R. J., Tzfati, Y., Tomaska, L.
(2009). Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA
15: 546-559
[Abstract]
[Full Text]
-
Finger, S. N., Bryan, T. M.
(2008). Multiple DNA-binding sites in Tetrahymena telomerase. Nucleic Acids Res
36: 1260-1272
[Abstract]
[Full Text]
-
Subramanian, L., Moser, B. A., Nakamura, T. M.
(2008). Recombination-Based Telomere Maintenance Is Dependent on Tel1-MRN and Rap1 and Inhibited by Telomerase, Taz1, and Ku in Fission Yeast. Mol. Cell. Biol.
28: 1443-1455
[Abstract]
[Full Text]
-
Rossignol, P., Collier, S., Bush, M., Shaw, P., Doonan, J. H.
(2007). Arabidopsis POT1A interacts with TERT-V(I8), an N-terminal splicing variant of telomerase. J. Cell Sci.
120: 3678-3687
[Abstract]
[Full Text]
-
Lue, N. F., Li, Z.
(2007). Modeling and structure function analysis of the putative anchor site of yeast telomerase. Nucleic Acids Res
0: gkm531v1-10
[Abstract]
[Full Text]
-
Hsu, M., Yu, E. Y., Singh, S. M., Lue, N. F.
(2007). Mutual Dependence of Candida albicans Est1p and Est3p in Telomerase Assembly and Activation. Eukaryot Cell
6: 1330-1338
[Abstract]
[Full Text]
-
Hsu, M., McEachern, M. J., Dandjinou, A. T., Tzfati, Y., Orr, E., Blackburn, E. H., Lue, N. F.
(2007). Telomerase core components protect Candida telomeres from aberrant overhang accumulation. Proc. Natl. Acad. Sci. USA
104: 11682-11687
[Abstract]
[Full Text]
-
Mizuno, H., Khurts, S., Seki, T., Hirota, Y., Kaneko, S., Murakami, S.
(2007). Human Telomerase Exists in Two Distinct Active Complexes In Vivo. J Biochem
141: 641-652
[Abstract]
[Full Text]
-
Wyatt, H. D. M., Lobb, D. A., Beattie, T. L.
(2007). Characterization of Physical and Functional Anchor Site Interactions in Human Telomerase. Mol. Cell. Biol.
27: 3226-3240
[Abstract]
[Full Text]
-
Xin, Z.-T., Beauchamp, A. D., Calado, R. T., Bradford, J. W., Regal, J. A., Shenoy, A., Liang, Y., Lansdorp, P. M., Young, N. S., Ly, H.
(2007). Functional characterization of natural telomerase mutations found in patients with hematologic disorders. Blood
109: 524-532
[Abstract]
[Full Text]
-
Robertson, H. M., Gordon, K. H.J.
(2006). Canonical TTAGG-repeat telomeres and telomerase in the honey bee, Apis mellifera. Genome Res
16: 1345-1351
[Abstract]
[Full Text]
-
Wu, Y.-L., Dudognon, C., Nguyen, E., Hillion, J., Pendino, F., Tarkanyi, I., Aradi, J., Lanotte, M., Tong, J.-H., Chen, G.-Q., Segal-Bendirdjian, E.
(2006). Immunodetection of human telomerase reverse-transcriptase (hTERT) re-appraised: nucleolin and telomerase cross paths. J. Cell Sci.
119: 2797-2806
[Abstract]
[Full Text]
-
Goldkorn, A., Blackburn, E. H.
(2006). Assembly of Mutant-Template Telomerase RNA into Catalytically Active Telomerase Ribonucleoprotein That Can Act on Telomeres Is Required for Apoptosis and Cell Cycle Arrest in Human Cancer Cells. Cancer Res.
66: 5763-5771
[Abstract]
[Full Text]
-
Middleman, E. J., Choi, J., Venteicher, A. S., Cheung, P., Artandi, S. E.
(2006). Regulation of Cellular Immortalization and Steady-State Levels of the Telomerase Reverse Transcriptase through Its Carboxy-Terminal Domain.. Mol. Cell. Biol.
26: 2146-2159
[Abstract]
[Full Text]
-
Ji, H., Platts, M. H., Dharamsi, L. M., Friedman, K. L.
(2005). Regulation of Telomere Length by an N-Terminal Region of the Yeast Telomerase Reverse Transcriptase. Mol. Cell. Biol.
25: 9103-9114
[Abstract]
[Full Text]
-
MORIARTY, T. J., MARIE-EGYPTIENNE, D. T., AUTEXIER, C.
(2005). Regulation of 5' template usage and incorporation of noncognate nucleotides by human telomerase. RNA
11: 1448-1460
[Abstract]
[Full Text]
-
Lue, N. F.
(2005). A Physical and Functional Constituent of Telomerase Anchor Site. J. Biol. Chem.
280: 26586-26591
[Abstract]
[Full Text]
-
Moriarty, T. J., Ward, R. J., Taboski, M. A.S., Autexier, C.
(2005). An Anchor Site-Type Defect in Human Telomerase That Disrupts Telomere Length Maintenance and Cellular Immortalization. Mol. Biol. Cell
16: 3152-3161
[Abstract]
[Full Text]
-
Fragnet, L., Kut, E., Rasschaert, D.
(2005). Comparative Functional Study of the Viral Telomerase RNA Based on Natural Mutations. J. Biol. Chem.
280: 23502-23515
[Abstract]
[Full Text]
-
O'Connor, C. M., Lai, C. K., Collins, K.
(2005). Two Purified Domains of Telomerase Reverse Transcriptase Reconstitute Sequence-specific Interactions with RNA. J. Biol. Chem.
280: 17533-17539
[Abstract]
[Full Text]
-
LEEPER, T. C., VARANI, G.
(2005). The structure of an enzyme-activating fragment of human telomerase RNA. RNA
11: 394-403
[Abstract]
[Full Text]
-
Figueiredo, L. M., Rocha, E. P. C., Mancio-Silva, L., Prevost, C., Hernandez-Verdun, D.čl., Scherf, A.
(2005). The unusually large Plasmodium telomerase reverse-transcriptase localizes in a discrete compartment associated with the nucleolus. Nucleic Acids Res
33: 1111-1122
[Abstract]
[Full Text]
-
Banik, S. S. R., Counter, C. M.
(2004). Characterization of Interactions between PinX1 and Human Telomerase Subunits hTERT and hTR. J. Biol. Chem.
279: 51745-51748
[Abstract]
[Full Text]
-
Moriarty, T. J., Marie-Egyptienne, D. T., Autexier, C.
(2004). Functional Organization of Repeat Addition Processivity and DNA Synthesis Determinants in the Human Telomerase Multimer. Mol. Cell. Biol.
24: 3720-3733
[Abstract]
[Full Text]
-
Armbruster, B. N., Linardic, C. M., Veldman, T., Bansal, N. P., Downie, D. L., Counter, C. M.
(2004). Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1. Mol. Cell. Biol.
24: 3552-3561
[Abstract]
[Full Text]
-
Lin, J., Blackburn, E. H.
(2004). Nucleolar protein PinX1p regulates telomerase by sequestering its protein catalytic subunit in an inactive complex lacking telomerase RNA. Genes Dev.
18: 387-396
[Abstract]
[Full Text]
-
Bosoy, D., Lue, N. F.
(2004). Yeast telomerase is capable of limited repeat addition processivity. Nucleic Acids Res
32: 93-101
[Abstract]
[Full Text]
-
Lee, S. R., Wong, J. M. Y., Collins, K.
(2003). Human Telomerase Reverse Transcriptase Motifs Required for Elongation of a Telomeric Substrate. J. Biol. Chem.
278: 52531-52536
[Abstract]
[Full Text]
-
Huard, S., Moriarty, T. J., Autexier, C.
(2003). The C terminus of the human telomerase reverse transcriptase is a determinant of enzyme processivity. Nucleic Acids Res
31: 4059-4070
[Abstract]
[Full Text]
-
Armbruster, B. N., Etheridge, K. T., Broccoli, D., Counter, C. M.
(2003). Putative Telomere-Recruiting Domain in the Catalytic Subunit of Human Telomerase. Mol. Cell. Biol.
23: 3237-3246
[Abstract]
[Full Text]
-
Bosoy, D., Peng, Y., Mian, I. S., Lue, N. F.
(2003). Conserved N-terminal Motifs of Telomerase Reverse Transcriptase Required for Ribonucleoprotein Assembly in Vivo. J. Biol. Chem.
278: 3882-3890
[Abstract]
[Full Text]
-
Friedman, K. L., Heit, J. J., Long, D. M., Cech, T. R.
(2003). N-terminal Domain of Yeast Telomerase Reverse Transcriptase: Recruitment of Est3p to the Telomerase Complex. Mol. Biol. Cell
14: 1-13
[Abstract]
[Full Text]
-
Singh, S. M., Steinberg-Neifach, O., Mian, I. S., Lue, N. F.
(2002). Analysis of Telomerase in Candida albicans: Potential Role in Telomere End Protection. Eukaryot Cell
1: 967-977
[Abstract]
[Full Text]
-
Hossain, S., Singh, S., Lue, N. F.
(2002). Functional Analysis of the C-terminal Extension of Telomerase Reverse Transcriptase. A PUTATIVE "THUMB" DOMAIN. J. Biol. Chem.
277: 36174-36180
[Abstract]
[Full Text]
-
Cong, Y.-S., Wright, W. E., Shay, J. W.
(2002). Human Telomerase and Its Regulation. Microbiol. Mol. Biol. Rev.
66: 407-425
[Abstract]
[Full Text]
-
Banik, S. S. R., Guo, C., Smith, A. C., Margolis, S. S., Richardson, D. A., Tirado, C. A., Counter, C. M.
(2002). C-Terminal Regions of the Human Telomerase Catalytic Subunit Essential for In Vivo Enzyme Activity. Mol. Cell. Biol.
22: 6234-6246
[Abstract]
[Full Text]
-
Etheridge, K. T., Banik, S. S. R., Armbruster, B. N., Zhu, Y., Terns, R. M., Terns, M. P., Counter, C. M.
(2002). The Nucleolar Localization Domain of the Catalytic Subunit of Human Telomerase. J. Biol. Chem.
277: 24764-24770
[Abstract]
[Full Text]
-
Miller, M. C., Collins, K.
(2002). Telomerase recognizes its template by using an adjacent RNA motif. Proc. Natl. Acad. Sci. USA
99: 6585-6590
[Abstract]
[Full Text]
-
Arai, K., Masutomi, K., Khurts, S., Kaneko, S., Kobayashi, K., Murakami, S.
(2002). Two Independent Regions of Human Telomerase Reverse Transcriptase Are Important for Its Oligomerization and Telomerase Activity. J. Biol. Chem.
277: 8538-8544
[Abstract]
[Full Text]
-
Moriarty, T. J., Huard, S., Dupuis, S., Autexier, C.
(2002). Functional Multimerization of Human Telomerase Requires an RNA Interaction Domain in the N Terminus of the Catalytic Subunit. Mol. Cell. Biol.
22: 1253-1265
[Abstract]
[Full Text]
-
Bosoy, D., Lue, N. F.
(2001). Functional Analysis of Conserved Residues in the Putative "Finger" Domain of Telomerase Reverse Transcriptase. J. Biol. Chem.
276: 46305-46312
[Abstract]
[Full Text]
-
Armbruster, B. N., Banik, S. S. R., Guo, C., Smith, A. C., Counter, C. M.
(2001). N-Terminal Domains of the Human Telomerase Catalytic Subunit Required for Enzyme Activity in Vivo. Mol. Cell. Biol.
21: 7775-7786
[Abstract]
[Full Text]
-
Beattie, T. L., Zhou, W., Robinson, M. O., Harrington, L.
(2001). Functional Multimerization of the Human Telomerase Reverse Transcriptase. Mol. Cell. Biol.
21: 6151-6160
[Abstract]
[Full Text]
-
Bachand, F., Autexier, C.
(2001). Functional Regions of Human Telomerase Reverse Transcriptase and Human Telomerase RNA Required for Telomerase Activity and RNA-Protein Interactions. Mol. Cell. Biol.
21: 1888-1897
[Abstract]
[Full Text]
-
Lai, C. K., Mitchell, J. R., Collins, K.
(2001). RNA Binding Domain of Telomerase Reverse Transcriptase. Mol. Cell. Biol.
21: 990-1000
[Abstract]
[Full Text]