Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 5300-5309, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
DNA Length Dependence of the Single-Strand Annealing Pathway
and the Role of Saccharomyces cerevisiae RAD59 in
Double-Strand Break Repair
Neal
Sugawara,
Grzegorz
Ira, and
James E.
Haber*
Rosenstiel Center and Department of Biology,
Brandeis University, Waltham, Massachusetts 02454-9110
Received 17 November 1999/Returned for modification 16 December
1999/Accepted 26 April 2000
 |
ABSTRACT |
A DNA double-strand break (DSB) created by the HO endonuclease in
Saccharomyces cerevisiae will stimulate recombination
between flanking repeats by the single-strand annealing (SSA) pathway, producing a deletion. Previously the efficiency of SSA, using homologous sequences of different lengths, was measured in competition with that of a larger repeat further from the DSB, which ensured that
nearly all cells would survive the DSB if the smaller region was not
used (N. Sugawara and J. E. Haber, Mol. Cell. Biol. 12:563-575, 1992). Without competition, the efficiency with which homologous segments of 63 to 205 bp engaged in SSA was significantly increased. A
sequence as small as 29 bp was used 0.2% of the time, and homology dependence was approximately linear up to 415 bp, at which size almost
all cells survived. A mutant with a deletion of RAD59, a
homologue of RAD52, was defective for SSA, especially when
the homologous-sequence length was short; however, even with 1.17-kb substrates, SSA was reduced fourfold. DSB-induced gene conversion also
showed a partial dependence on Rad59p, again being greatest when the
homologous-sequence length was short. We found that Rad59p plays a role
in removing nonhomologous sequences from the ends of single-stranded
DNA when it invades a homologous DNA template, in a manner similar to
that previously seen with srs2 mutants.
rad59 affected DSB-induced gene conversion differently
from msh3 and msh2, which are also defective in
removing nonhomologous ends in both DSB-induced gene conversion and
SSA. A msh3 rad59 double mutant was more severely defective
in SSA than either single mutant.
 |
INTRODUCTION |
DNA double-strand breaks (DSBs)
generated in the chromosomes of a G1 haploid cell are
lethal unless repaired. DSBs created within a sequence that is repeated
elsewhere in the genome can be repaired by gene conversion (for a
review, see reference 37). In contrast, a DSB
occurring within a unique sequence cannot be repaired in this manner
but can instead be repaired by nonhomologous joining of DNA ends
(10, 19, 56). A third pathway exists if the DSB lies in a
unique sequence between two repeated sequences, where it can stimulate
the formation of a deletion between the repeats by the single-strand
annealing (SSA) pathway (14, 22, 23, 27). DNA is resected by
a 5'-to-3' exonuclease on each side of the DSB, leaving 3'-ended
single-stranded tails, as diagrammed in Fig.
1. Annealing can take place between the
complementary sequences located on opposite sides of the DSB; this is
followed by nucleolytic removal of any remaining tails, DNA synthesis
to fill in the gaps, and ligation.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Single-strand annealing model. When a double-strand
break is created in vivo, one strand on each side of the DSB is
resected in the 5'-to-3' direction, leaving a 3' tail. When
complementary sequences on opposite sides are exposed, they can anneal,
forming a branched intermediate. The single-stranded tails are removed
by a nuclease, the gaps are filled in, and any remaining nicks are
ligated, finally resulting in a deletion product.
|
|
Certain fundamental properties of SSA have been documented in
Saccharomyces cerevisiae by creating a DSB in vivo, using
the HO endonuclease under the control of the GAL10 promoter.
Analysis of SSA both on plasmids and on the chromosome has confirmed
that 5'-to-3' resectioning occurs, creating 3' tails (14,
51). When a DSB is situated within one of the two repeats, it can
be repaired either by SSA or by gene conversion. Increasing the
distance between the two repeats decreases the efficiency of SSA in
competition with gene conversion, consistent with a need for more time
for 5'-to-3' resection to expose complementary homologies (14,
16).
The efficiency of SSA is strongly influenced by the length of the
flanking repeats and also by their degree of sequence identity (51, 53). The dependence of SSA on the homologous-sequence length was characterized by using repeats of differing lengths (51). A minimum size of between 63 and 89 bp was determined; however, in these measurements, we utilized substrates containing three
repeats of the URA3 sequence, with the more distant pair having 1.17 kb of homologous sequence and the middle repeat differing in length (Fig. 2) (51). The
1.17-kb repeats ensured that cells would survive the induction of a
DSB, since recombination between such large flanking repeats could
nearly always occur. It was possible, though, that the presence of the
1.17-kb repeat reduced the opportunity for cells to use the smaller
sequence as often as would occur in the absence of competition. In this
paper, we show that the ability of small sequences to engage in SSA
markedly increases when competition is absent. We have therefore
reinvestigated the dependence of SSA on the length of homologous
sequence and the minimum size requirements when only two repeats are
present.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Competition between repeated sequences. (A)
Strains that have two or three repeated sequences derived from the
HindIII restriction fragment containing URA3
were constructed (open boxes). The three-repeat substrate possesses the
ura3-52 sequence (a), a 205-bp sequence (b), and the
URA3 HindIII restriction fragment (c). Intervening sequences
are derived from pUC9, lambda phage, and the 117-bp HO cut site from
MATa (51). A DSB at the HO cut site
initiates SSA between the repeats and results in two deletion products,
a/c and b/c. In the two-repeat substrate, only the b/c product is
generated. Primers labeled d, e, and f were used to screen colonies
based on structure by PCR analysis (see text). Structures are oriented
from centromere distal to centromere proximal (left to right). (B) DNA
from tNS1379 (two-repeat strain) and tNS62 (three-repeat strain) was
prepared for Southern analysis before and 5 h after HO induction.
Locations of the probe and BglII sites used for the Southern
blots are shown in panel A. For the two-repeat strain, the Southern
blot shows the uncleaved DNA band before induction, the HO-cleaved band
(4.8 kb) at 0.5 h, and the product band (5.5 kb) 5 h after
induction. The three-repeat strain yielded the uncleaved DNA band (9.3 kb) and two product bands (2.9 and 6.6 kb).
|
|
We have also examined genes that influence the dependence of SSA on the
length of homologous sequences. Previous studies have shown that the
absence of Rad52p, a strand-annealing protein (31, 49),
nearly eliminates SSA when the homologous sequences are 1 to 2 kb in
length (14, 45, 51). However, when the DSB is induced within
much larger arrays, such as the CUP1 or rRNA gene arrays,
the events become RAD52 independent (36), since large regions of homology appear to compensate for the lack of Rad52p.
We have surveyed other members of the RAD52 epistasis group
and found that none of the others is nearly as important as
RAD52. Deletions of RAD50 and XRS2
delay but only partially reduce SSA (17, 51); moreover,
deletions of RAD51, RAD54, RAD55, and
RAD57 did not inhibit SSA between flanking repeated sequences of 1 to 2 kb in length (17). In this study we
examined the recA homolog RAD51, using short
(205-bp) repeats to show that SSA can truly be carried out
independently of Rad51p.
Another pair of proteins whose role exhibits homologous-sequence length
dependence during SSA comprises Msh2p and Msh3p (53). These proteins, along with the Rad1p-Rad10p excision endonuclease protein complex (13, 53), are involved in removing
nonhomologous 3'-ended DNA tails from annealed intermediates. However,
whereas Rad1p and Rad10p are required to clip off the tails regardless of the length of the annealed homologous regions, the requirement for
Msh2p and Msh3p decreases dramatically as the annealed regions increase
from 205 bp (at which size Msh2p and Msh3p are nearly as essential as
Rad52p) to 1.17 kb (at which size SSA is 80 to 90% as efficient as in
a wild-type strain). Msh2p and Msh3p are imagined to stabilize the
short, annealed heteroduplexes and allow the Rad1p-Rad10p complex to
cleave the single-stranded tail at the branched junctions on the ends
of the annealed regions (13, 53). As the annealed regions
become longer, and therefore more stable, the requirement for Msh2p and
Msh3p decreases.
Interestingly, Msh2p and Msh3p are also required for removal of
nonhomologous sequences from the ends of invading strands during
DSB-induced gene conversion even when the length of homologous sequence
shared by the donor and recipient is 2 kb (9, 38, 53). They
presumably act in a similar manner by binding to the junctions between
single-stranded DNA and double-stranded DNA, promoting the
Rad1p-Rad10p-mediated cleavage of the single-stranded nonhomologous
tail so that the 3' end of the invading DNA strand can be used as a
primer to initiate new DNA synthesis. The need for Msh2p and Msh3p in
gene conversion, even with long homologous regions adjacent to the
nonhomologous ends, presumably reflects the difference between the
instability of a strand invasion structure (involving an invading
single strand and a duplex template) and the more stable intertwinings
of two complementary single strands during SSA.
Continuing our survey of RAD genes, we have investigated the
role of RAD59 both in SSA and in DSB-induced gene
conversion. RAD59 was identified as a mutation that
eliminated RAD52-dependent spontaneous recombination in a
rad51 background (4). rad59 mutants
are defective in several spontaneous and DSB-induced recombination assays, and epistasis analysis has revealed that mutations in RAD59 and RAD51 can act synergistically in
recombination assays (3-5). RAD59 is a homolog
of RAD52, and overexpression of RAD52 will
relieve
-ray sensitivity in rad59 strains, which suggests a possible overlap of functions (4). This was also suggested by a synergistic defect observed in a rad59 rad52R70K double
mutant (3). In this study, we showed that SSA is impaired in
a rad59 background nearly as much as in a rad52
background and we further characterize RAD59's role in
DSB-induced gene conversion.
 |
MATERIALS AND METHODS |
Strains and plasmids.
Yeast strains used in this study are
shown in Table 1. Yeast strains used for studying SSA
were derived from tNR85 (45) containing the
GAL10::HO TRP1 plasmid pFH800 (35).
Strains with two ura3 sequences were derived from strains
with three copies (Fig. 2A) (51) by deletion of the
ura3-52 allele via transplacement of pNSU196 cut with
PvuI. pNSU196 contains the THR4 gene as a selectable marker (HindIII fragment isolated from p323
provided by G. Simchen) cloned into the HindIII site of
pUC19. The downstream HindIII site was subsequently
filled in with the Klenow fragment of DNA polymerase. The sequence
upstream of URA3 (1.9-kb
SalI-to-HindIII sequence) was cloned between
the SalI site and the remaining HindIII site.
This upstream sequence was derived from a partial
HindIII digestion of pNSU133, which consists of the
BglII fragment of URA3-FL100 from pSK180 (M. Rose) cloned into the BglII site of plink 15-5 (26) modified by filling in the HindIII site.
PvuI cuts pNSU196 in the pUC19 vector sequence and in the
sequence upstream of ura3, which targets the fragment to the
homologous sequence in the strains with three repeats of the
ura3 sequence.
rad59,
msh3, and
srs2 deletions were
constructed by creating
rad59::
KanMX2,
msh3::KanMX2,
rad59::NatMX4,
or
srs2::KanMX2 disruption
PCR products in
accordance with the procedures of Wach et al.
(
57) and
Goldstein and McCusker (
15). pAM50 (
6) was used
to construct
rad51::LEU2 disruptions,
pmsh3::LEU2 (
46) was used
to construct
msh3::LEU2 disruptions, pmsh3::TRP1
(
34) was used
to construct
msh3::TRP1
disruptions, and p

2R (F. Fabre) was used
to create
srs2::LEU2 disruptions. These deletions remove all
or
most of the open reading
frames.
To study the homology dependence of DSB-induced gene conversion,
pNSU216 (
52), pGI9, pGI1, pGI7, and pGI19 were individually
transformed into JKM146 or tNS1703. pNSU216 consists of the 3,845-bp
EcoRI-to-
HindIII sequence of
MAT
inserted between the
EcoRI and
HindIII sites of YCp50 and the
MAT
-
inc EcoRI-to-
HindIII
sequence
blunt-end ligated into the
SmaI site in an inverted
orientation.
In pGI9, pGI1, pGI7, and pGI19, the
MAT
sequence was replaced
with shorter
MAT
sequences derived
from PCR-amplified
DNA.
Strains used for assaying the removal of nonhomologous DNA ends during
DSB-induced gene conversion were constructed by individually
transforming plasmids pFP122, pFP121, pFP118, pFP140, and pFP120
(
38), which respectively contain 0, 10, 20, and 30 bp on
each
side and a combination of 308 and 610 bp of nonhomologous
sequences
adjacent to the DSB, into derivatives of JKM146
containing the
mutations
msh3::LEU2
(YFP259),
rad59::KanMX2 (tNS1703),
srs2::LEU2 (YFP218),
msh3::LEU2
rad59::KanMX2 (tNS1706), and
srs2::LEU2
rad59::KanMX2 (tNS1853).
Media.
Selective and rich media were described by Sherman et
al. (48). YP-lactate, YP-glycerol, and YP-galactose were
described previously (38, 45). YEPEG consists of 1%
(wt/vol) yeast extract, 2% (wt/vol) peptone, 2.6% (wt/vol) glycerol,
2.6% (wt/vol) ethanol, and 1% (wt/vol) succinic acid.
Galactose inductions.
Galactose inductions were carried out
as described previously (45). Cultures were grown in liquid
YP-lactate medium at 30°C and induced with 2% galactose. Aliquots
were taken at appropriate time points, and DNA was extracted by a glass
bead-phenol-sodium dodecyl sulfate protocol (45). Southern
blotting was carried out in accordance with the procedure of Church and
Gilbert (8), and blots were analyzed by using a Molecular
Dynamics PhosphorImager. The level of SSA was calculated by dividing
the intensity of the product band by the intensity of the 0-h band and
normalizing both signals to LEU2 bands that appeared when
the blot was reprobed with the HpaI-SalI
LEU2 sequence. This value was also divided by the fraction
of cells containing pFH800 (GAL::HO) prior to induction to normalize for the fraction of cells able to induce the
HO gene.
To determine the frequency with which a 29-bp sequence recombined by
SSA, which was too low to measure accurately by densitometry,
tNS709,
tNS1984, and tNS1990 were individually induced in liquid
culture with
2% galactose at 30°C and cells were plated on yeast
peptone dextrose
(YPD) and synthetic dextrose agar (SD)-Trp media
before and after a 3-h
induction. Colonies grown on YPD were replica
plated to SD-Trp plates
to assess retention of pFH800. Colonies
grown on SD-Trp selective
medium were counted to give an overall
frequency of survivors retaining
pFH800. To distinguish between
colonies with recombined product and
those that either had not
been cleaved by HO endonuclease or had
precisely or imprecisely
ligated the cleaved fragments back together,
we first induced
the colonies again with galactose to determine whether
they possessed
an intact HO cut site. Colonies were patched onto YEPEG
plates,
replica plated to YP-galactose plates, and incubated for 6 to
18 h at 30°C. Cells with an intact HO cut site were unable to
grow when replica plated to SD-Trp, which scores for retention
of the
GAL::HO plasmid. The colonies that were
insensitive to
galactose were further analyzed by PCR using the distal
primer
d (GCACCATATGCGGTGTG) and the proximal primers e
(TGGCCAAATCGATTAGCCGA)
and f (TGAGTAGCAGCACGTTCC)
(Fig.
2), resulting in a 196-bp product
(primers d and e) if an
SSA deletion event occurred or a 334-bp
product (primers d and f) if
the original structure was retained.
Colonies that failed to yield a
PCR product were analyzed by Southern
blotting as described in the
legend to Fig.
2.
The dependence of DSB-induced gene conversion on sequence homology was
assayed by growing cultures in liquid YP-lactate overnight
at 30°C
and then plating the cells on YPD and YP-galactose plates.
Colonies
were scored for retention of plasmids (Ura
+), and the
frequency of retention was calculated as the fraction
of colonies grown
on galactose medium that retained the plasmid,
on which
HO
was induced, divided by the fraction of plasmid retention
by colonies
grown on YPD. The efficiency of removal of nonhomologous
sequence from
the single-stranded tails during DSB-induced gene
conversion was
assayed by the same procedure except that YP-glycerol
was used in place
of YP-lactate as described by Pâques and Haber
(
38).
Normally two genotypes (10 strains) were tested in
parallel.
 |
RESULTS |
Competition between homologous sequences during SSA.
To
characterize the effect of competition in SSA, we constructed pairs of
strains with the SSA substrates shown in Fig. 2A. Each construct
possessed an HO cut site situated between two homologous ura3 sequences, but the three-repeat construct contained an
additional homologous sequence on the centromere-distal side. We
compared these two strains to determine how the presence of the 1.17-kb distal sequence influences the frequency with which the more proximal segments participate in SSA. In the example shown in Fig. 2, the proximal sequence was 205 bp in length.
Cultures of each strain were grown in YP-lactate medium and induced for
5 h with galactose to express the galactose-regulated
HO
endonuclease. Aliquots were obtained prior to induction and
at various
time points after addition of galactose. DNA samples
were extracted and
prepared for Southern analysis (Fig.
2B). The
Southern blot in Fig.
2B
shows the uncut DNA before induction,
at 0 h, and the product
present in the 5-h lane. The strain with
three homologous sequences had
two products, resulting from recombination
with either the 205-bp
region b in Fig.
2A or the 830-bp region
a of the
ura3-52
locus, proximal to a Ty1 insertion. Previous
studies have shown that
recombination with the 335 bp distal to
the Ty1 insertion in
ura3-52 occurs only very rarely (
45,
51).
What is
apparent from examination of this blot is that the quantity
of product
in the two-repeat strain was much larger than that
of the equivalent
product, b/c, in the three-repeat strain. Quantitation
of the bands in
these blots (see Materials and Methods) revealed
that there was about
fivefold more of this product in the two-repeat
strain than in the
three-repeat strain (79% vs. 16% product relative
to the amount of
the original, uncut DNA). In the three-repeat
strain, the distal
ura3-52 sequence appears to have been in competition
with
the middle sequence, causing an underestimation of the efficiency
with
which a 205-bp homologous segment participated in
SSA.
Dependence of SSA on the length of homologous sequence in the
absence of competition.
We then examined the dependence of SSA on
the length of homologous sequences in the absence of competition, using
strains with the 1.17-kb URA3 sequence to the right of the
HO cut site and with various lengths of ura3 sequence
homology to the left. Each strain was induced as described above, and
the effectiveness of SSA was evaluated by densitometry after Southern
analysis (Fig. 3). As the
homologous-sequence length increased, the amount of product also
increased until it reached a plateau at approximately 400 bp, at which
point nearly all cells survived by forming a deletion.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Homologous-sequence length dependence of SSA. Strains
containing the two-repeat substrate (Fig. 2A) were constructed with
various amounts of homologous DNA. The sizes tested were 29, 63, 89, 205, 235, 415, and 1,170 bp. The frequency of SSA was determined, as
described in detail in Materials and Methods, by quantitating the
product band and dividing by the quantity of uncut uninduced band and
normalizing to an independent band (after reprobing with
leu2) and to the number of cells containing the
GAL::HO plasmid. Strain tNS709, with 29-bp
repeats, was analyzed separately to exclude NHEJ and religation events
as well as uninduced cells (wild type [WT]) as described in the
text.
|
|
We were also interested in determining the smallest amount of
homologous sequence that could be used in SSA. Previously, using
the
three-repeat substrates, we found that a sequence of between
63 and 89 bp in length was required (
51); however, competition
may
have minimized the recombination potential of the middle repeat.
By
testing two-repeat strains with 29-, 63-, and 89-bp repeats,
we were
able to establish that SSA could use homologous sequences
as small as
29 bp, although at a very low frequency. Upon HO induction,
only a
small fraction of cells (0.4%) are capable of forming colonies.
In
addition to SSA deletion events, several other outcomes can
arise by
nonhomologous end joining (NHEJ). First, ends at a DSB
can be religated
to recreate the HO cut site. These sites will
be cleaved again by HO
endonuclease, but nevertheless, these events
will give rise to a small
but detectable subpopulation in our
experiments. Second, it is possible
to recover mutations of the
HO cut site arising by NHEJ events such
that the HO cut site is
no longer cleavable (
20,
30). These
mutations, including deletions,
small base pair insertions, and events
that capture small segments
of Ty1 elements or mitochondrial DNA, have
been documented in
previous studies (
20,
29,
30,
42,
55,
59). To identify
the large-deletion events that arose from SSA,
survivors were
analyzed for the ability to be recut by HO
endonuclease and then
analyzed by PCR and/or by Southern
hybridizations (see Materials
and Methods). With 29-bp repeats, bona
fide SSA deletion events
occurred at a frequency of 0.17%. Survivors
retaining the HO cut
site arose at a frequency of 0.31%, and those
resulting from other
NHEJ events arose at a frequency of 0.04%.
Shen and Huang (
47) first showed that as the length of
homologous sequence falls below the minimum effective processing
segment (MEPS), the homology dependence becomes nonlinear. This
could
be the result of an alternate pathway acting on substrates
too short
for the principal pathway. We calculated the MEPS to
be 33 bp for SSA
by linear regression according to the method
described by Shen and
Huang, using data points that fell well
within the linear range (63 to
235 bp). Given that the 29-bp-repeat
substrates that we studied are
close to or slightly below the
MEPS, we asked whether formation of
these deletions still required
RAD52, since we had shown
that SSA between longer repeats is highly
dependent on Rad52p (
45,
51). This is also of interest since
NHEJ events sometimes appear
to join microhomologies of 1 to 5
bp in a manner that is independent of
RAD52 (
20,
30). Hence,
we also wanted to explore
whether recombination between 29-bp
repeats was
RAD52
dependent, as in SSA, or
RAD52 independent,
as in NHEJ. A
similar analysis in a
rad52 derivative showed that
the
29-bp repeats formed the specific deletion expected by SSA
at a
frequency 26-fold lower than that of the wild type (0.006%),
indicating that Rad52p indeed plays an important role in recombination
of short deletions of 29 bp, as it does in SSA involving longer
regions
of homology. The total frequency of survivors in the
rad52 strain, 0.7%, was comparable to the wild
type-frequency (0.5%),
consistent with the idea that the non-SSA
survivors arose by the
NHEJ pathway, which is
RAD52 independent.
Role of RAD51 and RAD59 in SSA.
Two
RAD52-dependent pathways of spontaneous mitotic
recombination have been identified; one depends on Rad51p and the other depends on Rad59p (3-5). Previously we demonstrated that
SSA can be carried out independently of Rad51p (17). Those
experiments, however, utilized repeats that were greater than 1 kb in
length, and SSA deficiencies in some mutants are only observed when the homologous-sequence length is shorter (53). Because of this, we reexamined the effect of rad51 on SSA in a strain with
the 205-bp repeats. As much product was made in a rad51
strain as in the wild type, confirming that SSA can proceed
independently of the RAD51 pathway (Fig.
4).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of rad51 and rad59
mutations on SSA. SSA was initiated in wild-type (WT; tNS1379),
rad51 (tNS1597), and rad59 (tNS1573) backgrounds,
using the two-repeat substrates with 205-bp repeated ura3
sequences (black boxes). Cultures were induced for 5 h with 2%
galactose. DNA samples were digested with BglII and probed
with a sequence adjacent to ura3 (cross-hatched box),
revealing the uncleaved sequence (8.4 kb), the HO cut sequence (4.8 kb), and the product band (5.5 kb).
|
|
In contrast, SSA exhibited a significant dependence on
RAD59. For a two-repeat strain with 205-bp repeats on each
side of
the HO cut site, only 2% of the
rad59 mutant cells
were capable
of giving rise to viable colonies bearing the
GAL::HO plasmid
(compared with 98% for the
wild-type strain). Viable colonies
may possess an SSA product, or they
may represent uninduced cells
or the product of the religation of DNA
ends. This reduction was
also seen when the process was visualized on a
Southern blot (Fig.
4), on which only a very faint product band was
present. Densitometric
analysis (see Materials and Methods) also showed
that the level
of product formation fell to approximately 2%. To
assess whether
the function of
RAD59 depends on the amount
of homologous sequence,
two other strains, differing only in the length
of homologous
sequence (0.415 or 1.17 kb), were constructed. Increasing
the
amount of homologous sequence increased the amount of product,
but
only up to 24% of the level seen in wild-type strains (Fig.
3). We
also examined the frequency of deletion events by using
the 29-bp
repeats as described earlier. We found that deletion
events occurred at
a frequency of 0.02%, a rate approximately
eightfold lower than that
of the wild-type strain, indicating
that Rad59p is also required for
SSA between short
repeats.
Msh2p and Msh3p play important roles in SSA because they appear
to stabilize the junctions between the double- and single-stranded
DNA
of the annealed intermediate and/or because they target the
Rad1p-Rad10p endonuclease to the single-stranded tails (
13,
53). To investigate whether Rad59p plays a role in this process,
a
rad59 msh3 double mutant was constructed. The effect on
SSA
was measured by using flanking repeats with 0.415 kb of homologous
sequence, based on Southern and densitometric analysis, as shown
in
Fig.
5. Compared with the wild type,
which showed little or
no impairment of SSA (Fig.
3),
msh3
and
rad59 reduced SSA product
formation to 13 and
15%, respectively, of the wild-type level,
while the double mutant
yielded approximately 2% of the wild-type
product level. Hence,
Rad59p's role is distinct from that of Msh2p
and Msh3p.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
SSA in a rad59 msh3 double mutant. (A) HO
endonuclease initiates SSA by cleaving between 415-bp sequences (black
boxes) of ura3, resulting in a deletion product. (B)
Wild-type (WT; tNS759), msh3 (tNS1551), rad59
(tNS1789), and msh3 rad59 (tNS1967) strains were induced for
5 h with galactose. At 0 and 5 h, DNA samples were obtained,
digested with BglII, and probed with a sequence adjacent to
ura3 (cross-hatched box in panel A), revealing the uncut
band (8.6 kb), the HO-cut fragment (4.8 kb), and the product band (5.5 kb).
|
|
Role of RAD59 in HO-induced gene conversion.
We
also investigated whether Rad59p plays a role in DSB-induced gene
conversion by using a set of centromeric plasmids containing inverted copies of the MAT locus (Fig.
6). An HO-induced DSB at MAT
can be repaired by using a MAT
-inc
donor sequence, either on the plasmid or on chromosome III, that cannot
be cleaved by HO endonuclease. To explore the dependence of DSB-induced
gene conversion on homologous-sequence length in wild-type and
rad59 backgrounds, a series of such plasmids with various
amounts of homologous sequence flanking the HO cut site was
constructed. Cells were plated on medium containing either
galactose or glucose, and the relative plasmid stability frequencies
were determined. At all homologous-sequence lengths examined,
DSB-induced gene conversion was reduced in rad59 mutants,
with the greatest dependence being seen when the lengths of homologous
sequence were smallest. This is reminiscent of what we observed in SSA
studies, where the effect of rad59
was reduced as the
length of homologous sequence increased.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Rad59p plays a role in DSB-induced gene conversion. A
series of five plasmids containing different lengths of homologous
sequences derived from MAT was cleaved in vivo with HO
endonuclease; the cut ends used a donor MAT -inc sequence
to repair the DSB. Cells that cannot repair the DSB due to limited
homology or due to the rad59 mutation will lose the plasmid.
Cells were grown in YP-lactate medium and plated on medium containing
galactose or glucose, and the colonies were scored for retention of the
(Ura+) plasmid. Frequencies (see Materials and Methods)
with 1 standard deviation (error bars) were plotted against the total
homologous-sequence length.
|
|
We also asked whether Rad59p is involved in the removal of
nonhomologous sequences present at the ends of the invading strands
created by a DSB. We investigated this by using a plasmid substrate,
containing two copies of the
lacZ sequence (2.8 kb), in
which
gene conversion is initiated by a DSB in one copy that is
repaired
by using the second copy as a donor template (
38).
A series
of such plasmids with various lengths of nonhomologous tail
adjacent
to the DSB was constructed (Fig.
7A). The inability to remove
the
nonhomologous tail results in the loss of the plasmid. Figure
7B shows
that wild-type strains were very efficient in repairing
DSBs when there
was 0 or 10 nucleotides (nt) of nonhomologous
sequence present.
Consistent with our results obtained while examining
DSB-induced gene
conversion between
MAT sequences,
rad59 mutants
were defective even when the ends of the DSB were homologous to
the
donor. However, when longer, nonhomologous tails were used,
the
rad59 mutation had a greater effect. For example, when the
ends of the DSB were completely homologous to the donor sequence,
the
ratio of successful gene conversions between
rad59 and the
wild type was 0.74; this decreased to 0.36 with nonhomologous
tails on
either side of the DSB of 30 nt and to 0.18 when the
two lengths of
nonhomologous sequence were 308 and 610 nt. This
indicates that Rad59p
is important for the removal of nonhomologous
tails.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of rad59 mutation on removal of
nonhomologous tails in DSB-induced gene conversion. (A) Plasmid pFP122
contains two copies of the lacZ sequence with embedded
117-bp HO cut sites derived from MATa. The lower HO
cut site contains a single point mutation making it uncleavable and
allowing it to serve as a donor sequence. pFP121, pFP118, pFP140, and
pFP120 were designed to generate various amounts of nonhomologous
single-stranded tails on both sides, after DSB induction. Black bars
show the extents of deletions of the lacZ and HO cut site
sequences (labeled in nucleotides). (B) Cultures containing pFP122,
pFP121, pFP118, pFP140, or pFP120 were plated on rich medium (YPD) and
galactose medium (YP-galactose), allowed to grow into colonies, and
scored for retention of the plasmid (Ura+ colonies). The
frequency of plasmid retention was calculated as described in Materials
and Methods. WT, wild type.
|
|
In view of this involvement with nonhomologous-tail removal, we
compared
RAD59 with
MSH3, which is involved,
along with
MSH2,
RAD1, and
RAD10, in
the nucleolytic removal of the nonhomologous
single-stranded tails in
DSB-induced gene conversion. As seen
in Fig.
7,
rad59
mutants differ from
msh3 mutants in having an
effect when
the nonhomologous tails are 10 nt in length or less.
The
rad59
msh3 double mutant was also examined; it behaved similarly
to
rad59 for the 0- and 10-nt substrates, as was expected since
msh3 has little effect on these substrates by itself. With
20
nt on either side of the DSB, or with a combination of 308- and
610-nt nonhomologous tails, there is no evidence of an additive
effect,
and there is only a small effect with the 30-nt tails.
Overall, it
appears that the
rad59 and
msh3 mutants behave
similarly
when nonhomologous tails of 20 nt or more must be
removed.
We observed, though, that in this assay the
rad59 mutant
behaved similarly to a strain deficient in the Srs2p helicase
(
38).
To examine this, we constructed and tested an
srs2 mutant as well
as a
rad59 srs2 double mutant
(Fig.
7B). Both single mutants inhibited
recombination when nonhomology
was absent from the ends next to
the DSB, and the double mutant was
statistically indistinguishable
from either single-deletion mutant.
When tails were removed,
rad59 and
rad59 srs2
mutants exhibited a phenotype slightly more defective
than that evident
for
srs2 alone, shown in Fig.
7, but almost
identical to the
phenotype for
srs2 previously published (
38).
Our
observations of the
rad59,
srs2, and
msh3 mutants suggest
that the
rad59 mutant
exhibits characteristics of both
srs2 and
msh3
mutants, which we consider further below (see
Discussion).
Since the behavior of the
rad59 mutant in the nonhomologous
tail assay was very similar to results observed for
srs2
(
38),
we also tested the effect of the
srs2
deletion on SSA. Southern
analysis showed that
srs2 also
caused an approximately 3-fold
reduction in SSA (Fig.
8), but this was not as drastic as the
50-fold effect of the
rad59 mutation. Srs2p and Rad59p
appear
to play different roles in SSA.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of the srs2 mutation on SSA. SSA was
initiated in the wild type (WT; tNS1379) and the srs2 mutant
(tNS1585) by using the two-repeat substrates with 205-bp repeated
ura3 sequences as described in the legend to Fig. 4. HO
endonuclease gene expression was induced for 5 h with galactose,
and DNA samples were subjected to Southern analysis as described in the
legend to Fig. 4, revealing the uncleaved sequence (8.4 kb), the HO cut
sequence (4.8 kb), and the product band (5.5 kb).
|
|
 |
DISCUSSION |
An important observation made in this study was that the level of
SSA between two repeats can be influenced by the presence of a third
homologous repeat. When the third repeat is present, SSA between the
other two copies is reduced. This indicates that there is a competition
between the two copies on one side of the DSB for the repeat on the
other side. We also showed that in the absence of competition, SSA can
utilize repeats as small as 29 bp in a manner that is RAD52
and RAD59 dependent.
The fact that the presence of a third, distal competing sequence
reduces the use of the proximal homologous segment suggests that SSA
does not occur by an irreversible sliding mechanism by which the two
single-stranded tails encounter each other at their ends and then slide
by each other. If this process were irreversible, such that sliding
occurred in only one direction, then there would exist only a
single opportunity for the two complementary strands to initiate
annealing, and therefore it would not matter if there were a third
repeat further down the DNA strand. The opportunity to recognize
the middle copy in the three-repeat strain would be the same as the
total opportunity in the two-repeat strain, and hence the SSA levels
would be similar. Our observations are not consistent with this model
(Fig. 2). Instead, we favor the idea that the two copies on the same
side of the DSB compete with each other, based on their relative sizes
and proximity to the DSB, by a collision mechanism. We suggest that
single-stranded DNA tails randomly collide with each other until they
find their complementary strands. A collision model would be a
straightforward interpretation of observations made by Haber and Leung
(16), who found that DSBs on two different chromosomes, each
containing the same flanking homologous sequences, gave rise to a
reciprocal translocation by SSA as often as they led to a pair of
intrachromosomal deletions. All of these results can also be explained
by a two-step mechanism in which the DNA strands collide with each
other and then engage in a homology search mechanism, such as
reversible sliding (7).
This competition may also be influenced by the sequence closer to the
DSB being made single stranded before the distal sequence. Hence, when
the two sequences are both 1.17 kb, there is a strong preference for
the copy closer to the DSB, an observation we previously termed the
proximity effect (51). If the closer sequence is short, it
may fail to recombine before the larger, more distal sequence becomes
single stranded, but once available, this region will be preferred
given its greater homology. The 205-bp repeats recombine at a higher
rate in the two-repeat strains due to the lack of the competing distal copy.
An alternative view of homology searching in the three-repeat context
proposes that the most distal copy acts as a default substrate. Instead
of freely competing in recombination, the default copy is utilized only
when the copy closest to the DSB is too small to efficiently recombine.
The absence of the default copy in the two-repeat strains would force
the sequences to repeatedly attempt to recombine, ultimately yielding a
higher level of recombination. Multiple attempts make it necessary to
postulate that there is a window of opportunity during which
recombination must be completed or the cell dies. For example, cells in
which the DSB is not repaired could adapt from DSB-induced cell cycle
arrest and fatally resume growth (21). It is also possible
that 5'-to-3' resectioning of DNA will interfere with the expression of
a short-lived and essential gene product.
Our results can also be explained by the Ty1 element in the
ura3-52 allele, in some unexplained manner, causing the
ura3-52 allele to preferentially recombine with the
wild-type copy. This is unlikely, though, in view of an earlier
observation (51). When the middle copy was the full-length
1.17-kb URA3 sequence, it recombined more frequently than
the ura3-52 allele, at a ratio of 9:1. When the Ty1 was
replaced by a wild-type URA3 sequence, the ratio dropped to
3:1. Hence, the Ty1 element does not increase recombination with the
ura3-52 allele but instead decreases it. This may be because
the Ty1 element moves part of the ura3 sequence an
additional 6.1 kb away from the DSB.
Homologous-sequence length dependence in SSA.
Shen and Huang
(47) proposed that a single MEPS possesses the ability to
recombine at a characteristic rate. Accumulation of MEPS with larger
lengths would result in a proportional increase in recombination rates,
with the overall result being a linear relationship between the
recombination rate and the length of homologous sequence. Our
measurements of SSA show that the relationship of MEPS to successful
recombination is initially linear but levels off as the maximum level
of SSA is approached. When the SSA rate becomes high, as in this study,
then multiple MEPS may initiate recombination simultaneously. This
possibility increases with longer homologous sequences, and
consequently the curve levels off.
Using a variety of recombination assays, both linear and nonlinear size
dependencies have been observed in other organisms,
and minimum size
requirements range from approximately 23 to 300
bp (
1,
2,
18,
24,
25,
44,
47,
50,
58). For
the purpose of comparing SSA to
spontaneous recombination in
S. cerevisiae, we consider a
study by Jinks-Robertson et al. (
18),
who showed that
spontaneous recombination exhibited a linear dependence
and a MEPS of
approximately 250 bp, using either direct or inverted
ura3
sequences. SSA is similar to spontaneous recombination in
the sense
that for sizes greater than its MEPS, it exhibits approximate
linearity
from 29 to 415 bp. The two processes differ, however,
in that SSA can
utilize homologous-sequence lengths much smaller
than the MEPS of 250 bp. This suggests that spontaneous recombination
between direct repeats
may occur by a mechanism other than SSA
or that there are
assay-specific differences involved that lead
to differing
observations. Two other studies have examined the
homology dependence
of spontaneous recombination in
S. cerevisiae.
Using
inverted
his3 sequences in a plasmid-based gene conversion
assay, Ahn et al. (
1) documented a logarithmic relationship.
In a different study, Datta et al. (
11) arrived at an MEPS
of
28 bp by introducing mismatches in inverted repeats to study
homology
dependence. These differing observations may be due to
assay-specific
properties or to differences in recombination
mechanisms.
We showed that SSA can occur with flanking homologous sequences as
small as 29 bp. NHEJ events induced by a DSB also yield
deletion events
that use regions of microhomology as small as
1 to 5 bp
(
20). Although these events may involve the annealing
of
strands, it is clear that they arise from a genetic pathway
different
from SSA since they are
RAD52 and
RAD1
independent (
20,
30). This suggests that there is a lower
limit for SSA of between
5 and 29
bp.
Role of Rad51p and Rad59p in SSA.
We have extended our
previous studies to show that Rad51p plays no significant role in SSA,
even with sequence homologies as small as 205 bp. On the other hand,
Rad59p is required for SSA. This is consistent with the observations
that Rad59p is a homolog of Rad52p, which itself has the ability to
anneal DNA strands in vitro (31, 49), and that
overexpression of RAD52 can overcome at least some
deficiencies of rad59 mutants (4). These
observations led to the conjecture that Rad59p might also possess or
promote strand-annealing activity. This is supported by in vitro
studies showing that Rad59p can anneal complementary strands
(40). There are two aspects of SSA in which Rad59p may participate: in strand annealing itself, and in the stabilization of
annealed intermediates to allow the clipping off of nonhomologous tails. Tail removal requires Rad1p-Rad10p regardless of the size of the
annealed regions, whereas the role for Msh2p-Msh3p is much larger when
the regions are only a few hundred base pairs in length. Rad59p's role
in SSA also has a larger impact when the sequences are short. The very
severe effect of a
msh3
rad59 strain with 415-bp
flanking homologous sequences suggests that their roles are
nonoverlapping. This does not preclude Rad59p playing a role in tail
removal, but it would appear from these data that its principal
phenotype reflects a defect in annealing per se.
Although there may be some overlap in function, both Rad52p and Rad59p
are required for efficient SSA. A contemporaneous study
by Bai et al.
(
3) also concluded that Rad59p plays a role in
SSA and
further found that a hypomorphic
rad52-R70K allele exhibited
a similar defect in
recombination.
We also have shown that Srs2p plays a relatively minor role in SSA,
compared to its more significant involvement in gene conversion.
This
is consistent with the idea that a helicase, such as Srs2p,
is not
required to assist complementary single strands in annealing,
whereas
it seems to be important in the invasion of a single-stranded
DNA into
a duplex homologous sequence (see
below).
Role of Rad59p in DSB-induced gene conversion.
We have also
shown that Rad59p is important for efficient DSB-induced gene
conversion, both when the DSB ends are completely homologous and, even
more so, when the ends are nonhomologous. This seems to point to two
distinctive processes that require Rad59p. One process is the
Rad1p-Rad10p-, Msh2p-Msh3p-dependent removal of nonhomologous tails
during DSB-induced gene conversion. The participation of Rad59p in this
step could account for the ninefold-detrimental effect of
rad59 in the DSB-induced gene conversion assay reported by
Bai and Symington (4), in which tails of 47 and 74 bp must
be removed.
The second role of Rad59p is seen even when the ends of DSB are
perfectly matched to the donor template. This can be explained
by the
ability of Rad59p to carry out or promote strand annealing.
Annealing
of DNA strands is an integral step of several models
of DSB-induced
gene conversion (
41,
54), including the synthesis-dependent
strand-annealing model (
12,
28,
32,
33,
39). For example,
in
the latter model, the two newly synthesized DNA strands must
dissociate
from their respective templates and be annealed. Rad59p
may be
important at this step for the completion of gene
conversion.
Another way to explain the two roles of Rad59p in DSB-induced gene
conversion is in terms of the formation and stabilization
of a D loop
during strand invasion. The first step in gene conversion
is the
identification of a duplex DNA homologous to the single-stranded
end of
the DSB that has been produced by 5'-to-3' resection. The
first
encounter, mediated by recombination proteins such as Rad51p,
is
presumed to result in an unstable paranemic joint which can
then be
converted into a plectonemic joint (Fig.
9A). When the
end of the single-stranded
tail is not homologous to the double-stranded
DNA, it may be difficult
or even impossible for the transition
from paranemic to plectonemic
joint to occur (
43). We suggest
that Rad59p may act by
catalyzing the formation of a paranemic
joint by stabilizing these
interactions. This would be important
for any strand invasion, even
those in which the ends of the DNA
are completely homologous to the
template, but it would become
even more important when there are
nonhomologous tails.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 9.
Models demonstrating how nonhomologous tails might
impede DSB-induced gene conversion in rad59 mutants. (A)
During DSB-induced gene conversion, a single-stranded DNA intermediate
searches duplex DNA for a homologous sequence and initially forms a
paranemic joint that is converted to a plectonemic joint. The presence
of nonhomologous sequences at the end of the invading strand
destabilizes the paranemic joint or impedes the conversion to a
plectonemic joint (43). Rad59p (closed ellipses) facilitates
the process by annealing the strands and stabilizing the joint. A
stable paranemic joint in turn provides the opportunity for the tail to
be removed or for a topoisomerase to act. In the absence of Rad59p,
longer tails pose a greater impediment to the formation of a
plectonemic joint. This is consistent with a previous interpretation of
the srs2 mutation, which behaves similarly in the
DSB-induced gene conversion assay (38). Srs2p (black
triangle) is proposed to stabilize the same structure by unwinding the
donor duplex, allowing easier formation of a paranemic joint and,
later, a plectonemic joint. (B) When nonhomologous tails become long,
they may impede SSA or DSB-induced gene conversion by forming secondary
structures in a process mediated by the annealing of microhomologous
sequences. The single-stranded DNA binding protein RPA (open ellipses)
may reduce secondary structures by forming complexes with
single-stranded DNA. These complexes likely lie in equilibrium with the
unbound state as the single-stranded tail searches for homologous
sequence. As such, the secondary structures remain competitors to
successful SSA or gene conversion. A mutation such as rad59
or srs2 that cripples SSA or gene conversion will shift the
equilibrium toward the secondary structures, eventually leading to cell
death. Substrates with short tails or no tails do not have this
competing pathway, and hence it only reveals itself with structures
with long tails in a mutant background. Mutations in srs2
decrease SSA to a lesser extent than do rad59 mutations,
which is consistent with the likelihood that a helicase is not required
for annealing of complementary strands. Srs2p may promote SSA
indirectly by unwinding microhomology-based secondary structures or by
aiding in the homology search process by unwinding improperly annealed
single-stranded tails.
|
|
We favor this interpretation in part because
rad59 mutants
behave in a manner similar to
srs2 mutants in the
DSB-induced gene
conversion assay in the absence of nonhomologous
tails. Because
Srs2p is a helicase, Pâques and Haber
(
38) have proposed that
Srs2p promotes strand invasion by
unwinding the donor duplex to
facilitate formation of a longer
plectonemic joint (Fig.
9A).
Pâques and Haber further have
proposed that this will stabilize
the junction and facilitate the
removal of any nonhomologous tails
of the invading strand. Thus, both
srs2 and
rad59 mutants would
be defective in
stabilizing the paranemic joint and in the removal
of nonhomologous
tails.
In addition to this proposed role in strand invasion and strand
annealing, Rad59p may also participate directly in the tail
removal
pathway mediated by Msh2p, Msh3p, and Rad1p-Rad10p, given
the
phenotypic similarity of
rad59 and
msh3 mutants
in the removal
of nonhomologous tails that are 20 nt or longer. With
respect
to SSA, the
rad59 msh3 double mutant may be more
severely defective
than either single mutant if
rad59 and
msh3 are each partially
defective at two separate steps in
the tail removal
process.
One other question that intrigues us is why, as they get longer,
nonhomologous tails apparently impede gene conversion. As
single-stranded tails form, they can become entangled in secondary
structures mediated by microhomologies which in turn may prevent
longer
homologous sequences from finding each other (Fig.
9B).
This pathway
would compete with the DSB-induced gene conversion
pathway, especially
if gene conversion were impeded by a mutation
in a gene such as
rad59 or
srs2. When tails are absent or short,
this pathway no longer competes with gene conversion, and hence
the
effect is seen only with longer tails. A similar inhibition
of SSA may
also occur, and the effect of
srs2 on SSA, albeit small
compared to that of
rad59 or
msh3, may reflect
its role in this
process.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant GM20056.
We thank members of the Haber lab and three anonymous reviewers for
helpful comments regarding this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rosenstiel
Center and Department of Biology, Brandeis University, Waltham, MA
02454-9110. Phone: (781) 736-2462. Fax: (781) 736-2405. E-mail:
haber{at}brandeis.edu.
 |
REFERENCES |
| 1.
|
Ahn, B. Y.,
K. J. Dornfeld,
T. J. Fagrelius, and D. M. Livingston.
1988.
Effect of limited homology on gene conversion in a Saccharomyces cerevisiae plasmid recombination system.
Mol. Cell. Biol.
8:2442-2448[Abstract/Free Full Text].
|
| 2.
|
Ayares, D.,
L. Chekuri,
K.-Y. Song, and R. Kucherlapati.
1986.
Sequence homology requirements for intermolecular recombination in mammalian cells.
Proc. Natl. Acad. Sci. USA
83:5199-5203[Abstract/Free Full Text].
|
| 3.
|
Bai, Y.,
A. P. Davis, and L. S. Symington.
1999.
A novel allele of RAD52 that causes severe DNA repair and recombination deficiencies only in the absence of RAD51 or RAD59.
Genetics
153:1117-1130[Abstract/Free Full Text].
|
| 4.
|
Bai, Y., and L. S. Symington.
1996.
A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.
Genes Dev.
10:2025-2037[Abstract/Free Full Text].
|
| 5.
|
Bartsch, S.,
L. E. Kang, and L. S. Symington.
2000.
RAD51 is required for the repair of plasmid double-stranded DNA gaps from either plasmid or chromosomal templates.
Mol. Cell. Biol.
20:1194-1205[Abstract/Free Full Text].
|
| 6.
|
Basile, G.,
M. Aker, and R. K. Mortimer.
1992.
Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.
Mol. Cell. Biol.
12:3235-3246[Abstract/Free Full Text].
|
| 7.
|
Berg, O. G.,
R. B. Winter, and P. H. Von Hippel.
1981.
Diffusion-driven mechanisms of protein translocation on nucleic acids. 1. Models and theory.
Biochemistry
20:6929-6948[CrossRef][Medline].
|
| 8.
|
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995[Abstract/Free Full Text].
|
| 9.
|
Colaiácovo, M. P.,
F. Pâques, and J. E. Haber.
1999.
Removal of one nonhomologous DNA end during gene conversion by a RAD1- and MSH2-independent pathway.
Genetics
151:1409-1423[Abstract/Free Full Text].
|
| 10.
|
Critchlow, S. E., and S. P. Jackson.
1998.
DNA end-joining: from yeast to man.
Trends Biochem. Sci.
23:394-398[CrossRef][Medline].
|
| 11.
|
Datta, A.,
M. Hendrix,
M. Lipsitch, and S. Jinks-Robertson.
1997.
Dual roles for DNA sequence identity and the mismatch repair system in the regulation of mitotic crossing-over in yeast.
Proc. Natl. Acad. Sci. USA
94:9757-9762[Abstract/Free Full Text].
|
| 12.
|
Ferguson, D. O., and W. K. Holloman.
1996.
Recombinational repair of gaps in DNA is asymmetric in Ustilago maydis and can be explained by a migrating D-loop model.
Proc. Natl. Acad. Sci. USA
93:5419-5424[Abstract/Free Full Text].
|
| 13.
|
Fishman-Lobell, J., and J. E. Haber.
1992.
Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.
Science
258:480-484[Abstract/Free Full Text].
|
| 14.
|
Fishman-Lobell, J.,
N. Rudin, and J. E. Haber.
1992.
Two alternative pathways of double-strand break repair that are kinetically separable and independently modulated.
Mol. Cell. Biol.
12:1291-1303.
|
| 15.
|
Goldstein, A. L., and J. H. McCusker.
1999.
Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.
Yeast
15:1541-1553[CrossRef][Medline].
|
| 16.
|
Haber, J. E., and W. Y. Leung.
1996.
Lack of chromosome territoriality in yeast: promiscuous rejoining of broken chromosome ends.
Proc. Natl. Acad. Sci. USA
93:13949-13954[Abstract/Free Full Text].
|
| 17.
|
Ivanov, E. L.,
N. Sugawara,
J. Fishman-Lobell, and J. E. Haber.
1996.
Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae.
Genetics
142:693-704[Abstract].
|
| 18.
|
Jinks-Robertson, S.,
M. Michelitch, and S. Ramcharan.
1993.
Substrate length requirements for efficient mitotic recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:3937-3950[Abstract/Free Full Text].
|
| 19.
|
Kanaar, R.,
J. H. Hoeijmakers, and D. C. van Gent.
1998.
Molecular mechanisms of DNA double strand break repair.
Trends Cell Biol.
8:483-489[CrossRef][Medline].
|
| 20.
|
Kramer, K. M.,
J. A. Brock,
K. Bloom,
J. K. Moore, and J. E. Haber.
1994.
Two different types of double-strand breaks in Saccharomyces cerevisiae are repaired by similar RAD52-independent, nonhomologous recombination events.
Mol. Cell. Biol.
14:1293-1301[Abstract/Free Full Text].
|
| 21.
|
Lee, S. E.,
J. K. Moore,
A. Holmes,
K. Umezu,
R. D. Kolodner, and J. E. Haber.
1998.
Saccharomyces Ku70, Mre11/Rad50, and RPA proteins regulate adaptation to G2/M arrest after DNA damage.
Cell
94:399-409[CrossRef][Medline].
|
| 22.
|
Lin, F.-L.,
K. Sperle, and N. Sternberg.
1984.
Model for homologous recombination during transfer of DNA into mouse L cells: role for DNA ends in the recombination process.
Mol. Cell. Biol.
4:1020-1034[Abstract/Free Full Text].
|
| 23.
|
Lin, F.-L. M.,
K. Sperle, and N. Sternberg.
1990.
Repair of double-stranded DNA breaks by homologous DNA fragments during transfer of DNA into mouse L cells.
Mol. Cell. Biol.
10:113-119[Abstract/Free Full Text].
|
| 24.
|
Liskay, R. M.,
A. Letsou, and J. L. Stachelek.
1987.
Homology requirement for efficient gene conversion between duplicated chromosomal sequences in mammalian cells.
Genetics
115:161-168[Abstract/Free Full Text].
|
| 25.
|
Liskay, R. M.,
J. L. Stachelek, and A. Letsou.
1984.
Homologous recombination between repeated chromosomal sequences in mouse cells.
Cold Spring Harbor Symp. Quant. Biol.
49:183-189[Abstract/Free Full Text].
|
| 26.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1983.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 27.
|
Maryon, E., and D. Carroll.
1991.
Characterization of recombination intermediates from DNA injected into Xenopus laevis oocytes: evidence for a nonconservative mechanism of homologous recombination.
Mol. Cell. Biol.
11:3278-3287[Abstract/Free Full Text].
|
| 28.
|
McGill, C.,
B. Shafer, and J. Strathern.
1989.
Coconversion of flanking sequences with homothallic switching.
Cell
57:459-467[CrossRef][Medline].
|
| 29.
|
Moore, J. K., and J. E. Haber.
1996.
Capture of retrotransposon DNA at the sites of chromosomal double-strand breaks.
Nature
383:644-646[CrossRef][Medline].
|
| 30.
|
Moore, J. K., and J. E. Haber.
1996.
Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:2164-2173[Abstract].
|
| 31.
|
Mortensen, U. H.,
C. Bendixen,
I. Sunjevaric, and R. Rothstein.
1996.
DNA strand annealing is promoted by the yeast Rad52 protein.
Proc. Natl. Acad. Sci. USA
93:10729-10734[Abstract/Free Full Text].
|
| 32.
|
Nasmyth, K. A.
1982.
Molecular genetics of yeast mating type.
Annu. Rev. Genet.
16:439-500[CrossRef][Medline].
|
| 33.
|
Nassif, N.,
J. Penney,
S. Pal,
W. R. Engels, and G. B. Gloor.
1994.
Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair.
Mol. Cell. Biol.
14:1613-1625[Abstract/Free Full Text].
|
| 34.
|
New, L.,
K. Liu, and G. F. Crouse.
1993.
The yeast gene MSH3 defines a new class of eukaryotic MutS homologues.
Mol. Gen. Genet.
239:97-108[CrossRef][Medline].
|
| 35.
|
Nickoloff, J. A.,
J. D. Singer,
M. F. Hoekstra, and F. Heffron.
1989.
Double-strand breaks stimulate alternative mechanisms of recombination repair.
J. Mol. Biol.
207:527-541[CrossRef][Medline].
|
| 36.
|
Ozenberger, B. A., and G. S. Roeder.
1991.
A unique pathway of double-strand break repair operates in tandemly repeated genes.
Mol. Cell. Biol.
11:1222-1231[Abstract/Free Full Text].
|
| 37.
|
Pâques, F., and J. E. Haber.
1999.
Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.
Microbiol. Mol. Biol. Rev.
63:349-404[Abstract/Free Full Text].
|
| 38.
|
Pâques, F., and J. E. Haber.
1997.
Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:6765-6771[Abstract].
|
| 39.
|
Pâques, F.,
W. Y. Leung, and J. E. Haber.
1998.
Expansions and contractions in a tandem repeat induced by double-strand break repair.
Mol. Cell. Biol.
18:2045-2054[Abstract/Free Full Text].
|
| 40.
|
Petukhova, G.,
S. A. Stratton, and P. Sung.
1999.
Single strand DNA binding and annealing activities in the yeast recombination factor Rad59.
J. Biol. Chem.
274:33839-33842[Abstract/Free Full Text].
|
| 41.
|
Resnick, M. A.
1975.
The repair of double strand breaks in DNA: a model involving recombination.
J. Theor. Biol.
59:97-106.
|
| 42.
|
Ricchetti, M.,
C. Fairhead, and B. Dujon.
1999.
Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.
Nature
402:96-100[CrossRef][Medline].
|
| 43.
|
Riddles, P. W., and I. R. Lehman.
1985.
The formation of paranemic and plectonemic joints between DNA molecules by the recA and single-stranded DNA-binding proteins of Escherichia coli.
J. Biol. Chem.
260:165-169[Abstract/Free Full Text].
|
| 44.
|
Rubnitz, J., and S. Subramani.
1984.
The minimum amount of homology required for homologous recombination in mammalian cells.
Mol. Cell. Biol.
4:2253-2258[Abstract/Free Full Text].
|
| 45.
|
Rudin, N., and J. E. Haber.
1988.
Efficient repair of HO-induced chromosomal breaks in Saccharomyces cerevisiae by recombination between flanking homologous sequences.
Mol. Cell. Biol.
8:3918-3928[Abstract/Free Full Text].
|
| 46.
|
Selva, E. M.,
L. New,
G. F. Crouse, and R. S. Lahue.
1995.
Mismatch correction acts as a barrier to homeologous recombination in Saccharomyces cerevisiae.
Genetics
139:1175-1188[Abstract].
|
| 47.
|
Shen, P., and H. V. Huang.
1986.
Homologous recombination in Escherichia coli: dependence on substrate length and homology.
Genetics
112:441-457[Abstract/Free Full Text].
|
| 48.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1983.
Methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 49.
|
Shinohara, A.,
M. Shinohara,
T. Ohta,
S. Matsuda, and T. Ogawa.
1998.
Rad52 forms ring structures and co-operates with RPA in single-strand DNA annealing.
Genes Cells
3:145-156[Abstract].
|
| 50.
|
Singer, B. S.,
L. Gold,
P. Gauss, and D. H. Doherty.
1982.
Determination of the amount of homology required for recombination in bacteriophage T4.
Cell
31:25-33[CrossRef][Medline].
|
| 51.
|
Sugawara, N., and J. E. Haber.
1992.
Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation.
Mol. Cell. Biol.
12:563-575[Abstract/Free Full Text].
|
| 52.
|
Sugawara, N.,
E. L. Ivanov,
J. Fishman-Lobell,
B. L. Ray,
X. Wu, and J. E. Haber.
1995.
DNA structure-dependent requirements for yeast RAD genes in gene conversion.
Nature
373:84-86[CrossRef][Medline].
|
| 53.
|
Sugawara, N.,
F. Pâques,
M. Colaiácovo, and J. E. Haber.
1997.
Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination.
Proc. Natl. Acad. Sci. USA
94:9214-9219[Abstract/Free Full Text].
|
| 54.
|
Szostak, J. W.,
T. L. Orr-Weaver,
R. J. Rothstein, and F. W. Stahl.
1983.
The double-strand-break repair model for recombination.
Cell
33:25-35[CrossRef][Medline].
|
| 55.
|
Teng, S. C.,
B. Kim, and A. Gabriel.
1996.
Retrotransposon reverse-transcriptase-mediated repair of chromosomal breaks.
Nature
383:641-644[CrossRef][Medline].
|
| 56.
|
Tsukamoto, Y., and H. Ikeda.
1998.
Double-strand break repair mediated by DNA end-joining.
Genes Cells
3:135-144[Abstract].
|
| 57.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[CrossRef][Medline].
|
| 58.
|
Watt, V. M.,
C. J. Ingles,
M. S. Urdea, and W. J. Rutter.
1985.
Homology requirements for recombination in Escherichia coli.
Proc. Natl. Acad. Sci. USA
82:4768-4772[Abstract/Free Full Text].
|
| 59.
|
Yu, X., and A. Gabriel.
1999.
Patching broken chromosomes with extranuclear cellular DNA.
Mol. Cell
4:873-881[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2000, p. 5300-5309, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Carter, S. D., Vigasova, D., Chen, J., Chovanec, M., Astrom, S. U.
(2009). Nej1 recruits the Srs2 helicase to DNA double-strand breaks and supports repair by a single-strand annealing-like mechanism. Proc. Natl. Acad. Sci. USA
106: 12037-12042
[Abstract]
[Full Text]
-
Jain, S., Sugawara, N., Lydeard, J., Vaze, M., Tanguy Le Gac, N., Haber, J. E.
(2009). A recombination execution checkpoint regulates the choice of homologous recombination pathway during DNA double-strand break repair. Genes Dev.
23: 291-303
[Abstract]
[Full Text]
-
Rothenberg, E., Grimme, J. M., Spies, M., Ha, T.
(2008). Human Rad52-mediated homology search and annealing occurs by continuous interactions between overlapping nucleoprotein complexes. Proc. Natl. Acad. Sci. USA
105: 20274-20279
[Abstract]
[Full Text]
-
Mansour, W. Y., Schumacher, S., Rosskopf, R., Rhein, T., Schmidt-Petersen, F., Gatzemeier, F., Haag, F., Borgmann, K., Willers, H., Dahm-Daphi, J.
(2008). Hierarchy of nonhomologous end-joining, single-strand annealing and gene conversion at site-directed DNA double-strand breaks. Nucleic Acids Res
36: 4088-4098
[Abstract]
[Full Text]
-
Wu, Y., Kantake, N., Sugiyama, T., Kowalczykowski, S. C.
(2008). Rad51 Protein Controls Rad52-mediated DNA Annealing. J. Biol. Chem.
283: 14883-14892
[Abstract]
[Full Text]
-
Coic, E., Feldman, T., Landman, A. S., Haber, J. E.
(2008). Mechanisms of Rad52-Independent Spontaneous and UV-Induced Mitotic Recombination in Saccharomyces cerevisiae. Genetics
179: 199-211
[Abstract]
[Full Text]
-
Cortes-Ledesma, F., Tous, C., Aguilera, A.
(2007). Different genetic requirements for repair of replication-born double-strand breaks by sister-chromatid recombination and break-induced replication. Nucleic Acids Res
35: 6560-6570
[Abstract]
[Full Text]
-
Wei, D. S., Rong, Y. S.
(2007). A Genetic Screen For DNA Double-Strand Break Repair Mutations in Drosophila. Genetics
177: 63-77
[Abstract]
[Full Text]
-
Chan, C. Y., Kiechle, M., Manivasakam, P., Schiestl, R. H.
(2007). Ionizing radiation and restriction enzymes induce microhomology-mediated illegitimate recombination in Saccharomyces cerevisiae. Nucleic Acids Res
35: 5051-5059
[Abstract]
[Full Text]
-
Lee, K., Lee, S. E.
(2007). Saccharomyces cerevisiae Sae2- and Tel1-Dependent Single-Strand DNA Formation at DNA Break Promotes Microhomology-Mediated End Joining. Genetics
176: 2003-2014
[Abstract]
[Full Text]
-
Decottignies, A.
(2007). Microhomology-Mediated End Joining in Fission Yeast Is Repressed by Pku70 and Relies on Genes Involved in Homologous Recombination. Genetics
176: 1403-1415
[Abstract]
[Full Text]
-
Shell, S. S., Putnam, C. D., Kolodner, R. D.
(2007). Chimeric Saccharomyces cerevisiae Msh6 protein with an Msh3 mispair-binding domain combines properties of both proteins. Proc. Natl. Acad. Sci. USA
104: 10956-10961
[Abstract]
[Full Text]
-
Wu, Y., Siino, J. S., Sugiyama, T., Kowalczykowski, S. C.
(2006). The DNA Binding Preference of RAD52 and RAD59 Proteins: IMPLICATIONS FOR RAD52 AND RAD59 PROTEIN FUNCTION IN HOMOLOGOUS RECOMBINATION. J. Biol. Chem.
281: 40001-40009
[Abstract]
[Full Text]
-
Kosmider, B., Wells, R. D.
(2006). Double-strand breaks in the myotonic dystrophy type 1 and the fragile X syndrome triplet repeat sequences induce different types of mutations in DNA flanking sequences in Escherichia coli. Nucleic Acids Res
34: 5369-5382
[Abstract]
[Full Text]
-
Wu, Y., Sugiyama, T., Kowalczykowski, S. C.
(2006). DNA Annealing Mediated by Rad52 and Rad59 Proteins. J. Biol. Chem.
281: 15441-15449
[Abstract]
[Full Text]
-
Preston, C. R., Flores, C. C., Engels, W. R.
(2006). Differential Usage of Alternative Pathways of Double-Strand Break Repair in Drosophila. Genetics
172: 1055-1068
[Abstract]
[Full Text]
-
Phadnis, N., Sia, R. A., Sia, E. A.
(2005). Analysis of Repeat-Mediated Deletions in the Mitochondrial Genome of Saccharomyces cerevisiae. Genetics
171: 1549-1559
[Abstract]
[Full Text]
-
Yan, H., McCane, J., Toczylowski, T., Chen, C.
(2005). Analysis of the Xenopus Werner syndrome protein in DNA double-strand break repair. JCB
171: 217-227
[Abstract]
[Full Text]
-
Subramanian, J., Vijayakumar, S., Tomkinson, A. E., Arnheim, N.
(2005). Genetic Instability Induced by Overexpression of DNA Ligase I in Budding Yeast. Genetics
171: 427-441
[Abstract]
[Full Text]
-
Liang, L., Deng, L., Chen, Y., Li, G. C., Shao, C., Tischfield, J. A.
(2005). Modulation of DNA End Joining by Nuclear Proteins. J. Biol. Chem.
280: 31442-31449
[Abstract]
[Full Text]
-
Schildkraut, E., Miller, C. A., Nickoloff, J. A.
(2005). Gene conversion and deletion frequencies during double-strand break repair in human cells are controlled by the distance between direct repeats. Nucleic Acids Res
33: 1574-1580
[Abstract]
[Full Text]
-
Daley, J. M., Wilson, T. E.
(2005). Rejoining of DNA Double-Strand Breaks as a Function of Overhang Length. Mol. Cell. Biol.
25: 896-906
[Abstract]
[Full Text]
-
Hansen, J. E., Dill, A. C., Grogan, D. W.
(2005). Conjugational Genetic Exchange in the Hyperthermophilic Archaeon Sulfolobus acidocaldarius: Intragenic Recombination with Minimal Dependence on Marker Separation. J. Bacteriol.
187: 805-809
[Abstract]
[Full Text]
-
Sugawara, N., Goldfarb, T., Studamire, B., Alani, E., Haber, J. E.
(2004). Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. Sci. USA
101: 9315-9320
[Abstract]
[Full Text]
-
Soustelle, C., Vernis, L., Freon, K., Reynaud-Angelin, A., Chanet, R., Fabre, F., Heude, M.
(2004). A New Saccharomyces cerevisiae Strain with a Mutant Smt3-Deconjugating Ulp1 Protein Is Affected in DNA Replication and Requires Srs2 and Homologous Recombination for Its Viability. Mol. Cell. Biol.
24: 5130-5143
[Abstract]
[Full Text]
-
Torres, J. Z., Schnakenberg, S. L., Zakian, V. A.
(2004). Saccharomyces cerevisiae Rrm3p DNA Helicase Promotes Genome Integrity by Preventing Replication Fork Stalling: Viability of rrm3 Cells Requires the Intra-S-Phase Checkpoint and Fork Restart Activities. Mol. Cell. Biol.
24: 3198-3212
[Abstract]
[Full Text]
-
Maringele, L., Lydall, D.
(2004). EXO1 Plays a Role in Generating Type I and Type II Survivors in Budding Yeast. Genetics
166: 1641-1649
[Abstract]
[Full Text]
-
Davis, A. P., Symington, L. S.
(2004). RAD51-Dependent Break-Induced Replication in Yeast. Mol. Cell. Biol.
24: 2344-2351
[Abstract]
[Full Text]
-
Yu, J., Marshall, K., Yamaguchi, M., Haber, J. E., Weil, C. F.
(2004). Microhomology-Dependent End Joining and Repair of Transposon-Induced DNA Hairpins by Host Factors in Saccharomyces cerevisiae. Mol. Cell. Biol.
24: 1351-1364
[Abstract]
[Full Text]
-
Ma, J.-L., Kim, E. M., Haber, J. E., Lee, S. E.
(2003). Yeast Mre11 and Rad1 Proteins Define a Ku-Independent Mechanism To Repair Double-Strand Breaks Lacking Overlapping End Sequences. Mol. Cell. Biol.
23: 8820-8828
[Abstract]
[Full Text]
-
Spell, R. M., Jinks-Robertson, S.
(2003). Role of Mismatch Repair in the Fidelity of RAD51- and RAD59-Dependent Recombination in Saccharomyces cerevisiae. Genetics
165: 1733-1744
[Abstract]
[Full Text]
-
Yu, X., Gabriel, A.
(2003). Ku-Dependent and Ku-Independent End-Joining Pathways Lead to Chromosomal Rearrangements During Double-Strand Break Repair in Saccharomyces cerevisiae. Genetics
163: 843-856
[Abstract]
[Full Text]
-
Fabre, F., Chan, A., Heyer, W.-D., Gangloff, S.
(2002). Alternate pathways involving Sgs1/Top3, Mus81/ Mms4, and Srs2 prevent formation of toxic recombination intermediates from single-stranded gaps created by DNA replication. Proc. Natl. Acad. Sci. USA
99: 16887-16892
[Abstract]
[Full Text]
-
Symington, L. S.
(2002). Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair. Microbiol. Mol. Biol. Rev.
66: 630-670
[Abstract]
[Full Text]
-
Dolle, M. E.T., Vijg, J.
(2002). Genome Dynamics in Aging Mice. Genome Res
12: 1732-1738
[Abstract]
[Full Text]
-
Vance, J. R., Wilson, T. E.
(2002). Yeast Tdp1 and Rad1-Rad10 function as redundant pathways for repairing Top1 replicative damage. Proc. Natl. Acad. Sci. USA
99: 13669-13674
[Abstract]
[Full Text]
-
Gonzalez-Barrera, S., Garcia-Rubio, M., Aguilera, A.
(2002). Transcription and Double-Strand Breaks Induce Similar Mitotic Recombination Events in Saccharomyces cerevisiae. Genetics
162: 603-614
[Abstract]
[Full Text]
-
Wilson, T. E.
(2002). A Genomics-Based Screen for Yeast Mutants With an Altered Recombination/End-Joining Repair Ratio. Genetics
162: 677-688
[Abstract]
[Full Text]
-
Ira, G., Haber, J. E.
(2002). Characterization of RAD51-Independent Break-Induced Replication That Acts Preferentially with Short Homologous Sequences. Mol. Cell. Biol.
22: 6384-6392
[Abstract]
[Full Text]
-
Karathanasis, E., Wilson, T. E.
(2002). Enhancement of Saccharomyces cerevisiae End-Joining Efficiency by Cell Growth Stage but Not by Impairment of Recombination. Genetics
161: 1015-1027
[Abstract]
[Full Text]
-
Butler, D. K., Gillespie, D., Steele, B.
(2002). Formation of Large Palindromic DNA by Homologous Recombination of Short Inverted Repeat Sequences in Saccharomyces cerevisiae. Genetics
161: 1065-1075
[Abstract]
[Full Text]
-
Preston, C. R., Engels, W., Flores, C.
(2002). Efficient Repair of DNA Breaks in Drosophila: Evidence for Single-Strand Annealing and Competition With Other Repair Pathways. Genetics
161: 711-720
[Abstract]
[Full Text]
-
van den Bosch, M., Zonneveld, J. B. M., Vreeken, K., de Vries, F. A. T., Lohman, P. H. M., Pastink, A.
(2002). Differential expression and requirements for Schizosaccharomyces pombeRAD52 homologs in DNA repair and recombination. Nucleic Acids Res
30: 1316-1324
[Abstract]
[Full Text]
-
Mankouri, H. W., Craig, T. J., Morgan, A.
(2002). SGS1 is a multicopy suppressor of srs2: functional overlap between DNA helicases. Nucleic Acids Res
30: 1103-1113
[Abstract]
[Full Text]
-
Davis, A. P., Symington, L. S.
(2001). The Yeast Recombinational Repair Protein Rad59 Interacts With Rad52 and Stimulates Single-Strand Annealing. Genetics
159: 515-525
[Abstract]
[Full Text]
-
Tsutsui, Y., Khasanov, F. K., Shinagawa, H., Iwasaki, H., Bashkirov, V. I.
(2001). Multiple Interactions Among the Components of the Recombinational DNA Repair System in Schizosaccharomyces pombe. Genetics
159: 91-105
[Abstract]
[Full Text]
-
Yao, X.-D., Evans, D. H.
(2001). Effects of DNA Structure and Homology Length on Vaccinia Virus Recombination. J. Virol.
75: 6923-6932
[Abstract]
[Full Text]
-
Sonoda, E., Takata, M., Yamashita, Y. M., Morrison, C., Takeda, S.
(2001). Homologous DNA recombination in vertebrate cells. Proc. Natl. Acad. Sci. USA
98: 8388-8394
[Abstract]
[Full Text]
-
Malagon, F., Aguilera, A.
(2001). Yeast spt6-140 Mutation, Affecting Chromatin and Transcription, Preferentially Increases Recombination in Which Rad51p-Mediated Strand Exchange Is Dispensable. Genetics
158: 597-611
[Abstract]
[Full Text]
-
Pâques, F., Richard, G.-F., Haber, J. E.
(2001). Expansions and Contractions in 36-bp Minisatellites by Gene Conversion in Yeast. Genetics
158: 155-166
[Abstract]
[Full Text]
-
McVey, M., Kaeberlein, M., Tissenbaum, H. A., Guarente, L.
(2001). The Short Life Span of Saccharomyces cerevisiae sgs1 and srs2 Mutants Is a Composite of Normal Aging Processes and Mitotic Arrest Due to Defective Recombination. Genetics
157: 1531-1542
[Abstract]
[Full Text]
-
Signon, L., Malkova, A., Naylor, M. L., Klein, H., Haber, J. E.
(2001). Genetic Requirements for RAD51- and RAD54-Independent Break-Induced Replication Repair of a Chromosomal Double-Strand Break. Mol. Cell. Biol.
21: 2048-2056
[Abstract]
[Full Text]
-
Chen, Q., Ijpma, A., Greider, C. W.
(2001). Two Survivor Pathways That Allow Growth in the Absence of Telomerase Are Generated by Distinct Telomere Recombination Events. Mol. Cell. Biol.
21: 1819-1827
[Abstract]
[Full Text]
-
Kang, L. E., Symington, L. S.
(2000). Aberrant Double-Strand Break Repair in rad51 Mutants of Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 9162-9172
[Abstract]
[Full Text]
-
LEE, S.E., PELLICIOLI, A., DEMETER, J., VAZE, M.P., GASCH, A.P., MALKOVA, A., BROWN, P.O., BOTSTEIN, D., STEARNS, T., FOIANI, M., HABER, J.E.
(2000). Arrest, Adaptation, and Recovery following a Chromosome Double-strand Break in Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol
65: 303-314
[Abstract]