Previous Article | Next Article 
Molecular and Cellular Biology, July 2000, p. 5321-5329, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The C Terminus of the Saccharomyces cerevisiae
-Factor Receptor Contributes to the Formation of Preactivation
Complexes with Its Cognate G Protein
Mercedes
Dosil,1,
Kimberly A.
Schandel,2,
Ekta
Gupta,1
Duane D.
Jenness,2 and
James B.
Konopka1,*
Department of Molecular Genetics and
Microbiology, State University of New York, Stony Brook, New York
11794-5222,1 and Department of Molecular
Genetics and Microbiology, University of Massachusetts Medical
School, Worcester, Massachusetts 016552
Received 28 February 2000/Returned for modification 13 April
2000/Accepted 24 April 2000
 |
ABSTRACT |
Binding of the
-factor pheromone to its G-protein-coupled
receptor (encoded by STE2) activates the mating pathway in
MATa yeast cells. To investigate whether specific
interactions between the receptor and the G protein occur prior to
ligand binding, we analyzed dominant-negative mutant receptors that
compete with wild-type receptors for G proteins, and we analyzed the
ability of receptors to suppress the constitutive signaling activity of mutant G
subunits in an
-factor-independent manner. Although the
amino acid substitution L236H in the third intracellular loop of the
receptor impairs G-protein activation, this substitution had no
influence on the ability of the dominant-negative receptors to
sequester G proteins or on the ability of receptors to suppress the
GPA1-A345T mutant G
subunit. In contrast, removal of the cytoplasmic C-terminal domain of the receptor eliminated both of these
activities even though the C-terminal domain is unnecessary for
G-protein activation. Moreover, the
-factor-independent signaling activity of ste2-P258L mutant receptors was inhibited by
the coexpression of wild-type receptors but not by coexpression of
truncated receptors lacking the C-terminal domain. Deletion analysis
suggested that the distal half of the C-terminal domain is critical for
sequestration of G proteins. The C-terminal domain was also found to
influence the affinity of the receptor for
-factor in cells lacking
G proteins. These results suggest that the C-terminal cytoplasmic
domain of the
-factor receptor, in addition to its role in receptor
downregulation, promotes the formation of receptor-G-protein
preactivation complexes.
 |
INTRODUCTION |
In the yeast Saccharomyces
cerevisiae, the
-factor pheromone activates a cell-surface
receptor on MATa cells, leading to cell division
arrest and expression of genes necessary for conjugation (1, 16,
38). The
-factor receptor (encoded by STE2) belongs
to the large family of G-protein-coupled receptors (GPCRs), which
includes receptors for hormones, neurotransmitters, and sensory stimuli
(11, 57). GPCRs transduce their signal by activating a
heterotrimeric guanine nucleotide binding protein (G protein) that
results in the exchange of GDP for GTP in the G
subunit (6,
20). In the case of the yeast pheromone pathway, the GTP-bound
G
subunit releases the G
subunits, and the free G
complexes then mediate the subsequent events in the response pathway
(1, 16, 38). Although the yeast pheromone receptors and
other GPCRs respond to different extracellular signals and share no
significant sequence homology, they possess a common structural
topology composed of seven transmembrane domains connected by
intracellular and extracellular loops. In addition, these receptors exhibit a similar organization of functional domains. For example, as
in many GPCRs, the third intracellular loop of the
-factor receptor
functions in G-protein coupling (10, 58). Moreover, the
cytoplasmic C-terminal domain of both yeast and mammalian receptors
mediates ligand-induced endocytosis (46, 49) and plays a
role in desensitization (8). The fact that some mammalian GPCRs can activate the pheromone-responsive G protein when they are
expressed in yeast further underscores that distant members of this
receptor family activate G proteins by similar mechanisms (14, 31,
43, 44).
Ligand binding is thought to drive GPCRs from the inactive (R) state to
the active (R*) state (18). The ligand-bound R* forms a
ternary complex with a G protein that leads to guanine nucleotide
exchange on G
. Current models also predict that receptors in the R
state can associate with G proteins in the absence of ligand
(48). We will use the term "preactivation complex" to refer to the complex that forms between unliganded receptor and the G
protein (RG). Although this complex is not necessarily a direct
intermediate in the formation of the activated ternary complex, it has
been proposed that preactivation complexes may play an important role
in regulating the specificity and efficiency of G-protein signaling
(39, 40, 52). Although receptor-G-protein complexes have
been observed in a few cases (9, 35, 36, 41), the analysis
of preactivation and activated complexes has been hampered by the
technical limitations of the copurification methods used in these
experiments. Consequently, most studies have relied on indirect
criteria for evaluating the interaction between the R* state and
the G protein. These criteria include the ability of mutant
receptors to trigger G-protein activation, the ability of G proteins to
modulate the affinity of the receptor for its ligand, and the ability
of receptor-derived peptides to promote post-receptor signaling
events (6, 20, 40, 59). Although these approaches have
identified receptor sequences required for G-protein activation,
relatively little is known about receptor-G-protein complexes prior to
activation (i.e., RG preactivation complexes) (39, 40).
In yeast, several observations suggest the existence of RG
preactivation complexes. First, the basal level of signaling through the pheromone pathway is increased in cells lacking receptors (4,
23), consistent with a role for unoccupied receptors in
maintaining the G protein in its inactive heterotrimeric state. Second,
dominant-negative (DN) mutants of the
-factor receptor inhibit
signaling from coexpressed wild-type receptors, apparently by
sequestering G proteins (12, 37). Finally, inactive
-factor receptors inhibit the signaling activity of other GPCRs that
respond to different ligands or that signal in a ligand-independent
fashion (32, 33, 43, 45, 51, 55). In this study, we examine the structural basis for the formation of preactivation complexes between receptors and G proteins in yeast. Our results indicate that
sequences within the cytoplasmic C-terminal domain of the receptor are
required for the unoccupied receptors to sequester G proteins.
 |
MATERIALS AND METHODS |
Yeast strains and plasmids.
Yeast strains used in this study
are described in Table 1. Cells were
grown in media as described by Sherman (53). Cells were
grown in synthetic medium containing adenine and amino acid additives,
but lacking uracil to select for plasmid maintenance. High-copy-number
YEp vectors for STE2, STE2-Y266C,
STE2-F204S, and ste2-T326 and low-copy-number YCp
vectors for ste2-T326, ste2-
297-360, and
ste2-
297-391 that were derived from STE2
plasmid pJBK-008 have been described (8, 12). Plasmids with
STE2 DN and ste2-T326 alleles under the
galactose-inducible promoter were created by subcloning their
corresponding AatII-PstI fragments into pJK57. The ste2-L236H point mutant was constructed by using the
Quick Change Site-Directed Mutagenesis Kit (Stratagene), and the
ste2-T345 and ste2-T360 truncation mutations were
generated by PCR and cloned into STE2 plasmid pDB02
(13). To construct the STE2-
360-390 deletion
mutant, two oligonucleotides were designed with a BspEI site
immediately adjacent to the sequences encoding for Ser360
and Gly390 and were used to generate two DNA fragments
that, when ligated, resulted in the in-frame deletion of residues 360 to 390. Isolation of the GPA1-A345T mutant will be described
elsewhere (K. A. Schandel and D. D. Jenness, unpublished
data). The ste2-F423L and ste2-L287S mutations
were created by using PCR to amplify codons 195 through 431 of the
STE2 gene. The template was STE2 plasmid pDB02
(13), and the primers were 5'GATGTTAGTGCCACCCAAG 3'
and 5'GCATCTGATGAGCACCTGAATC 3'. The intact plasmid
was regenerated by using double-strand gap repair (34).
Strain DJ926-10-3 was transformed with the PCR product together with
plasmid pDB02 that had been digested with ClaI and
SalI. Ura+ transformants were screened for
fertility and for the inability to correct the 38°C growth defect
conveyed by mutation GPA1-A345T. The phenotype was shown to
be plasmid dependent by isolating the plasmid and retransforming strain
DJ926-10-3. DNA sequencing of the two mutant STE2 alleles
identified a single mutation (ste2-F423L) and a double
mutation (ste2-L287S,F394S). The
SalI-SacI fragment carrying the
ste2-F423L mutation was subcloned into pDB02 to eliminate other mutations that may have existed in the unsequenced portion of
plasmid. The ClaI-PstI fragment containing the
ste2-L287S mutation was subcloned into pDB02, and the
resulting plasmid conferred the same phenotype as the original double
mutation. When the PstI-SalI fragment containing
ste2-F394S was subcloned, the resulting plasmid conferred no
detectable phenotype.
Pheromone-induced responses.
Halo assays for
-factor-induced cell division arrest were performed by spreading
~3 × 105 cells from an overnight culture onto the
appropriate solid media. Sterile filter disks containing the indicated
amount of
-factor were placed on the cell lawns and then the plates
were incubated at 30°C for 2 days. Spot assays for
-factor-induced
cell division arrest were carried out by adjusting cells to
106 cells/ml, and then 5-µl aliquots from a 10-fold
dilution series were placed on solid medium plates containing the
indicated concentration of
-factor. The growth of the cells was
recorded after 2 days for strains incubated at 30°C. Similar results
were observed in at least two independent assays for both the spot
assays and halo assays for cell division arrest. FUS1-lacZ
induction was assayed in cells grown overnight to log phase in
selective medium, diluted to 4 × 106 cells/ml, and
then incubated with the indicated concentrations of
-factor for
2 h.
-Galactosidase assays were performed in duplicate by using
the colorimetric substrate
o-nitrophenyl-
-D-galactopyranoside as
described previously (33). The averaged value of at least two independent experiments was reported for each assay, and the standard deviation was always less than 10%.
-Factor receptor analysis.
For Western blot assays,
log-phase cells adjusted to 107 per ml were collected
directly or treated with
-factor (final concentration, 5 × 10
7 M) for the appropriate time, were poisoned with 10 mM
NaN3 and 10 mM KF to halt endocytosis, and were collected.
Analysis of protein production was carried out by lysing approximately
2.5 × 108 cells with glass beads in 250 µl of lysis
buffer (2% sodium dodecyl sulfate, 100 mM Tris [pH 6.8], 8 M urea).
Protein concentration was determined by using a Bio-Rad Protein Assay
kit, and equal amounts of extract were separated by sodium dodecyl
sulfate-9% polyacrylamide gel electrophoresis, were transferred to
nitrocellulose, and then were probed with rabbit anti-Ste2p antibodies
(32). For analysis of protein stability, exponentially
growing cells were incubated with 20 mg of cycloheximide per ml for 10 min, and
-factor was added to a final concentration of
10
7 M. Samples were withdrawn at various times from 15 to
60 min and were processed for Western blot analysis as described above. 35S-labeled
-factor was prepared and assayed for the
ability to bind whole cells as described previously (30, 33,
49). In brief, cells were incubated with radiolabeled
-factor,
collected on Whatman GF/C filters, and washed, and then the bound
radioactivity was determined by scintillation counting. Analysis of
-factor dissociation was performed with slight modifications to
previously described procedures (3). Briefly, membrane
fractions from cells expressing full-length or truncated Ste2p were
incubated with 15 nM 35S-labeled
-factor (60 Ci/mmol) in
a buffer containing 50 mM Tris acetate (pH 8.0), 500 mM potassium
acetate, 1 mM magnesium acetate, and 0.1 mM EDTA. After a 30-min
incubation at room temperature, the samples were diluted 100-fold in
the presence of unlabeled synthetic
-factor with or without 10 mM
GTP
S (Boehringer Mannheim). Aliquots were removed, filtered, and
washed through polyethyleneimine-presoaked GF/F filters (Whatman), and
then the bound radioactivity was quantified by scintillation counting.
 |
RESULTS |
The C-terminal domain is essential for DN mutant receptors to
interfere with signaling.
DN receptor mutants were used as a
starting point for defining specific interactions between the
-factor receptor and the G protein. DN mutants were previously
isolated based on their ability to inhibit the response to mating
pheromone in cells that express both the DN mutant and wild-type
receptors (12, 37). We identified 16 DN mutations that
mapped to the extracellular ends of transmembrane domains
(12), defining a region of the
-factor receptor that is
critical for ligand binding and signaling. These DN mutants apparently
form inactive RG complexes that limit the pool of free G proteins,
since the dominant negative phenotype is suppressed by overproducing
the three G-protein subunits. DN mutants also inhibit truncated
receptors that lack the cytoplasmic C-terminal domain. Receptors
truncated at residue 326 (T326), lacking the C-terminal region, exhibit
defects in endocytosis and adaptation to pheromone, whereas pheromone
binding and G-protein activation are unaffected (32, 45).
These T326 receptors do not signal when coexpressed with DN receptors
(not shown), suggesting that receptors lacking the C-terminal tail,
despite their greater stability and increased signaling activity, are
unable to compete effectively with DN receptors for G proteins.
In the present study, we tested whether the C-terminal domain of the
receptor plays a role in the formation of inactive RG
preactivation
complexes. Plasmids that encode truncated and full-length
versions of
the DN receptors were introduced into a strain that
carried a wild-type
STE2 gene and into a control strain that carried
the
ste2
allele. Consistent with previous results
(
12), both
the
STE2+ (Fig.
1A) and the
ste2
(Fig.
1B)
strains were resistant to pheromone-induced
cell division arrest when
they contained the plasmids encoding
the full-length versions of Y266C
or F204S DN receptors. In contrast,
STE2+ cells
expressing the truncated versions of the DN receptors (Y266C-T326
or
F204S-T326) were sensitive to

-factor (Fig.
1A). Although
the
truncated DN receptors resulted in a moderate-to-slight increase
in

-factor responsiveness when expressed in the
ste2
strain
(Fig.
1B), the smaller and more turbid zones of growth
inhibition
in this strain (Fig.
1B) do not account for the wild-type
level
of responsiveness observed in the
STE2+
cells (Fig.
1A). Western blot analysis confirmed that the Y266C-T326
and F204S-T326 receptors were produced at normal levels (not shown).
Together, these results demonstrate that the C-terminal domain
is
required for the DN receptors to interfere with signaling.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of C-terminal truncation on the interfering
properties of DN mutant receptors. (A) Assays of pheromone-induced cell
division arrest performed with JKY25 cells (STE2) that
express wild-type receptors. The cells also contained multicopy
plasmids that carried the indicated full-length or T326-truncated
version of the following receptor genes: wild-type STE2, DN
STE2-Y266C, or DN STE2-F204S. (B) Halo assays
performed with YLG123 cells that lack an endogenous receptor gene
(ste2 ) but carried the same multicopy plasmids described
in panel A. Assays of -factor-induced growth arrest (halo assays)
were carried out by placing filter disks contained 0.6 or 0.1 nmol of
-factor on agar plates spread with a lawn of the indicated cells
derived from strains YLG123 or JKY25 and incubated for 48 h at
30°C to observe the zones of cell division arrest.
|
|
The idea that the C-terminal domain is dispensable for G-protein
activation yet important for sequestering G proteins suggests
that
different domains of the receptor control these two activities.
The
independence of these receptor functions was explored further
by
analyzing the effects of the
ste2-L236H mutation. This
mutation
causes an amino acid substitution in the third intracellular
loop
of the receptor and impairs G-protein activation, but it does
not
affect cell-surface expression, ligand binding, ligand-induced
internalization, or the ability to undergo

-factor-induced changes
in conformation (
7,
49,
58). These properties suggest that
the L236H mutant receptors are similar to rhodopsin mutants that
acquire the R* state without catalyzing guanine-nucleotide exchange
on
G

(
15). The L236H receptors did not result in a DN
phenotype
when coexpressed with wild-type receptors (Fig.
2A). The L236H
receptors differ from the
DN receptors in that they bind

-factor
and undergo the
ligand-induced conformational change. The effect
of the L236H amino
acid substitution on the DN mutant receptors
was tested by transforming
wild-type cells with a plasmid containing
a
ste2 allele with
both mutations (
L236H and
Y266C, or
L236H and
F204S). Growth of the transformed cells
on plates containing

-factor
(Fig.
2A) indicated that the defect in
the third intracellular
loop (
L236H) did not impair the
dominant inhibitory activity of
the DN mutants (
Y266C and
F204S). Control studies showed that
all L236H mutants were
defective for signaling when present as
the only receptors in the cell
(Fig.
2B). Altogether, these results
indicate that the structural
determinants involved in sequestration
of G proteins differ from those
involved in G-protein activation.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of the L236H mutation in the third intracellular
loop on the interfering properties of DN receptors. Growth of (A) JKY25
(STE2) or (B) YLG123 (ste2 ) cells carrying the
indicated STE2 alleles on multicopy vector YEplac195. Serial
dilutions of cells were spotted on plates in the presence or absence of
10 7 M -factor and were incubated for 48 h at
30°C.
|
|
Signal inhibition by unoccupied receptors requires the C-terminal
domain.
The ability of DN receptors to interfere with signaling
does not appear to reflect a novel gain of function, as unoccupied wild-type receptors also inhibit postreceptor signals under certain conditions. For example, wild-type
-factor receptors inhibit signaling in yeast cells that express constitutively active
-factor receptors (33, 55), a-factor receptors
(26), or mammalian hormone receptors (43). We
tested whether the C-terminal domain is important for wild-type
-factor receptors to inhibit the signal exhibited by the
constitutively active ste2-P258L mutant. The test strain for
these assays carried a far1 mutation that prevented cell
division arrest in the ste2-P258L mutant background and
contained a pheromone-responsive FUS1-lacZ reporter gene for
monitoring the basal level of postreceptor signal. Interestingly, the
high FUS1-lacZ activity exhibited by the
ste2-P258L mutant was reversed when wild-type, Y266C, or
F204S receptors were coexpressed (Fig. 3A). Thus, in the absence of
-factor,
wild-type receptors are similar to DN receptors in that they inhibit
the postreceptor signal. The unoccupied L236H mutant receptors also
inhibited the constitutive signal of the ste2-P258L mutant,
indicating that the inability to activate G proteins does not reflect
an inability to sequester G proteins.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of coexpressed receptor genes on the basal
signaling levels of constitutively active receptors. Strain JKY136 that
carries the constitutive receptor gene ste2-P258L in the
genome (A and C) and strain JKY131 that lacks the chromosomal receptor
gene (ste2 ) (13) were transformed with a
low-copy-number vector carrying the indicated STE2 alleles.
The basal levels of signaling of the pheromone-responsive
FUS1-lacZ reporter gene in the absence of -factor were
assayed by measuring -galactosidase activity.
|
|
In contrast to the full-length receptors, T326 truncated receptors did
not affect the basal signal in the
ste2-P258L mutant
(Fig.
3A), even when the T326 receptors were overproduced (not
shown). The
failure of the T326 receptors to reduce the basal
signal in the
ste2-P258L mutant was not due to the truncated receptors
directing an additional constitutive signal. Cells producing T326
receptors in the absence of the
ste2-P258L mutant receptors
showed
a relatively low basal level of signaling that was similar to
the
ste2
control cells (Fig.
3B). Interestingly, the
basal signaling
levels for both the
ste2
control cells
and the
ste2-T326 cells
were consistently twofold higher
than for cells producing wild-type
receptors. Thus, the C-terminal
domain also specifies reduced
basal signaling, a property previously
attributed to a role of
the receptor in stabilizing the inactive
heterotrimeric form of
the G protein (
4,
23).
Synthetic lethal interaction between alleles encoding the receptor
and the G
subunit.
As a second method for detecting receptor-G
protein preactivation complexes, we exploited synthetic lethal
interactions that occur between alleles of the STE2 and
GPA1 loci. The advantage of this approach is that the
genetic interaction between STE2 and GPA1 is
evaluated directly, instead of relying on the ability of G proteins to
influence the genetic interaction between two alleles of the
STE2 gene. The GPA1-A345T mutation was identified originally based on its ability to suppress the mating defect of the
ste2-L236H mutant (K. A. Schandel and D. D. Jenness, unpublished data). The suppressor phenotype was dominant. Halo
assays and FUS1-lacZ transcriptional induction assays showed
that the GPA1-A345T mutation resulted in an essentially
wild-type level of pheromone responsiveness of STE2 control
cells. Presumably, the Gpa1-A345T protein is activated more easily than
the wild-type Gpa1 protein, thus the weaker signaling activity of the
ste2-L236H mutant receptors may be sufficient to cause
G-protein activation in the GPA1-A345T mutant.
A second phenotype of
GPA1-A345T pertains to the physical
association of receptor and G protein. At 38°C, the combination
of
GPA1-A345T and
ste2
resulted in a synthetic
lethal phenotype.
As shown in Fig.
4A,
GPA1-A345T ste2
cells grow normally at 30°C,
but fail
to form colonies at 38°C. Microscopic images of cells
grown at 30°C
and then shifted to 37°C (Fig.
4B) revealed that
GPA1-A345T
ste2
cells were larger than wild-type cells. In addition,
at
37°C, the double mutant formed cell surface projections similar
to
the cell surface projections that appear in wild-type
MATa cells exposed to

-factor or in
gpa1
cells without

-factor.
The inhibition of growth
in the double mutant at 37°C does not
appear to be a consequence of
G

degradation since the steady-state
level of the mutant G

protein in an immunoblot assay was slightly
higher than that of the
wild-type protein at 37°C (not shown).
As
GPA1
transcription is stimulated by pheromone, the increased
amount of
Gpa1-A345T protein is consistent with partial activation
of the
pheromone response pathway.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
Synthetic phenotypes of the GPA1-A345T and
ste2 mutations. (A) Growth was assessed at 30 and 38°C
for the GPA1+ ste2 and
GPA1-A345T ste2 cells that carried the vector control or
carried GPA1 or a STE2 allele on a plasmid.
Tenfold serial dilutions of each culture were spotted onto selective
medium, and duplicate plates were incubated at 30°C for 36 h or
at 38°C for 72 h. (B) Microscopic images were obtained for the
same strains grown at 30 and 37°C. The cells were cultured in
selective liquid medium for 16 h at 30°C and then for an
additional 18 h at either 30 or 37°C. GPA1 and
GPA1-A345T shown at the top of each panel indicate the
chromosomal allele (strains DJ925-1-3 and DJ926-10-3, respectively).
Vector, GPA1, STE2, and ste2-T326
indicate the gene present on the plasmid (pJK67, YCpC3, pDB02, and
pJBK023, respectively).
|
|
Introduction of a plasmid-borne copy of
GPA1 reversed the
growth defect of
GPA1-A345T ste2
cells at 38°C (Fig.
4A). The synthetic
lethal phenotype associated with
GPA1-A345T was completely recessive
to
GPA1 as
GPA1 restored viability (Fig.
4A) and normal cellular
morphology at 37°C (Fig.
4B). Significantly, the introduction
of
STE2 on a plasmid also suppressed the lethality of the
GPA1-A345T ste2
mutant cells. The suppression by
STE2 was, however, incomplete,
as many cells still exhibited
morphological defects (Fig.
4B).
Thus, the receptor partially corrected
a phenotypic defect associated
with a mutant G

protein, providing
additional evidence that the
receptor forms a complex with the G
protein in the absence of
pheromone.
To determine whether the C-terminal domain of the receptor is required
to stabilize the mutant G protein, we expressed T326
receptors in
GPA1-A345T ste2
cells and then assayed the cells
for
their ability to grow at 38°C. The truncated receptors could
not
suppress the growth defect at elevated temperature (Fig.
4A)
or
suppress the morphological defects (Fig.
4B), implicating the
C-terminal domain in preactivation complex formation. Consistent
with
the results obtained in the receptor competition assays,
ste2-L236H GPA1-A345T cells were able to grow at 38°C
(data not
shown), indicating that the receptor domain required for
G-protein
activation is distinct from the receptor domain involved in
precoupling
to the G
protein.
Mutational analysis of the C-terminal domain.
Mutational
analyses of the C-terminal domain of the
-factor receptor (residues
297 to 431) have identified sequence elements important for pheromone
desensitization and for ligand-induced endocytosis. A
well-characterized sequence encompassing amino acids 331 to 339 (SINNDAKSS) undergoes ligand-stimulated ubiquitination (24)
and is sufficient to mediate ligand-induced endocytosis and degradation
of receptors when added back to truncated receptors that lack the
entire C-terminal domain (46). Sequences distal to amino
acid 345 have not been tested for their ability to promote internalization (46) but may encode redundant signals for
endocytosis (Fig. 5). The sequences that
mediate receptor desensitization are not restricted to a single motif.
Four phosphorylation sites located within 33 amino acids of the C
terminus are partially responsible for regulation of receptor
sensitivity (8), and phosphorylation sites in other portions
of the C-terminal domain may also contribute to desensitization as well
as to ubiquitination (25, 45). The present study focused on
deletion mutants that affect the C-terminal domain in order to
delineate regulatory elements that control endocytosis,
desensitization, and the formation of RG preactivation complexes.
Consistent with previous reports, cells containing receptors truncated
at positions 391, 360, 345, and 326 (T391, T360, T345, and T326,
respectively) were more sensitive to
-factor than wild-type cells
(Fig. 5). In contrast, a receptor missing amino acids 297 to 391 (designated
297-391) led to nearly normal sensitivity, indicating
that residues 392 to 431 are sufficient to mediate some aspects of
pheromone sensitivity. Also consistent with previously published
studies (8, 46), T345, T360, and T391 receptors were subject
to ligand-induced internalization, whereas T326 and
297-391
receptors were not.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Functional analysis of the C-terminal domain. The length
of the C-terminal domain and a diagram of the structure for each mutant
receptor are shown on the left. The sensitivity to -factor and the
ability to undergo -factor-induced endocytosis were analyzed in
YLG123 (ste2 ) cells that expressed the indicated
truncation or in-frame deletion receptors. Sensitivity to -factor
was determined from halo assays and normalized to that of wild-type
receptors. -factor-induced endocytosis was determined by analysis of
receptor stability after treatment with -factor. Suppression of
GPA1-A345T lethality was assayed as described in the legend
to Fig. 4. Suppression of the high basal signaling activity of
ste2-P258L cells was assayed as described in the legend to
Fig. 3 and was normalized to 100% inhibition for full-length wild-type
receptors. Shown in the far right column are the effects of the
indicated C-terminal deletions or truncations on the dominant-negative
properties of F204S receptors. Receptors containing both the F204S
mutation and the indicated deletion or truncation were coexpressed with
wild-type receptors in JKY25 cells and were assayed for their ability
to interfere with signaling by wild-type receptors in halo assays (+ indicates that receptors are DN, indicates that receptors are not
DN, ± indicates that receptors are DN only when overexpressed).
|
|
As judged by the three genetic assays described in this paper, the
specific sequences within the C-terminal domain that are
important for
G protein interaction differ from the sequences
that control
endocytosis. In the first assay, the T391, T360,
T345, and

297-360
receptors were unable to suppress the lethality
associated with the
GPA1-A345T mutation at 38°C, even though they
were
proficient for endocytosis (Fig.
5). Only full-length and

360-390
receptors resulted in suppression, suggesting that stabilization
of the
mutant Gpa1 protein requires the intact C-terminal domain
of the
receptor. The second and third assays, based on receptor
competition,
proved to be less stringent and identified partially
functional
mutants. Although the T360 receptors were proficient
for endocytosis,
they failed to diminish the constitutive signal
in cells containing
P258L mutant receptors (Fig.
3C and
5). In
contrast, the

297-391
receptors failed to undergo endocytosis,
even though they partially
inhibited the constitutive signal.
The third assay, that tested whether
F204S mutant receptors containing
defects in the C-terminal domain
cause a DN phenotype when expressed
in cells containing wild-type
receptors, yielded qualitatively
similar results. Interestingly, cells
expressing

297-360 receptors
were indistinguishable from wild-type
cells in both competition
assays, indicating that residues 360 to 431 are sufficient for
the formation of preactivation
complexes.
Random mutagenesis of the
STE2 gene led to the
identification of single residues that influence RG preactivation
complexes.
STE2 mutants were isolated that were unable to
support the growth
of
GPA1-A345T cells at 38°C, and the
isolates were screened for
pheromone sensitivity and for accumulation
of cell-surface receptor
protein. Two point mutations were identified,
one causing a Leu-to-Phe
substitution at position 287 (L287F) and the
other causing a Phe-to-Leu
substitution at position 423 (F423L). These
L287F and F423L receptors
were also partially impaired in their ability
to inhibit the constitutive
signal in
ste2-P258L cells (Fig.
3C and
5). The L287F substitution
affects a residue within the seventh
transmembrane domain and
may, therefore, influence the C-terminal
domain indirectly. The
defects in F423L receptors are consistent with a
role for residues
360 to 431 in RG preactivation complexes. Taken
together, our
results indicate that RG preactivation complexes are
largely governed
by distal sequences in the receptor C-terminal tail
(residues
360 to 431). This region of the receptor plays no essential
role
in ligand-induced endocytosis. However, it overlaps with sequences
that regulate pheromone sensitivity, suggesting that these functions
may be
interrelated.
The C-terminal domain of the receptor influences affinity for
ligand.
For many GPCRs, including the
-factor receptor, the
affinity for the ligand is greater when the receptor is bound to the G
protein (3). We wished to determine whether the C-terminal domain plays a role in this aspect of G-protein-receptor coupling in
addition to its role in the preactivation complex. Two methods were
used for judging the effect of the G protein on
-factor affinity.
The first method tested whether GTP
S stimulates release of
-factor from crude membranes containing either wild-type or truncated receptors. Consistent with the original findings of Blumer
and Thorner (3), the complexes containing
-factor and full-length receptors dissociated more rapidly when GTP
S was present
(Fig. 6A). In contrast, the complexes
containing truncated receptors dissociated at a slow rate that was
independent of GTP
S (Fig. 6B). Thus, the C-terminal domain
apparently leads to a reduction in
-factor affinity when GTP
S is
present.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of GTP-promoted dissociation of
35S- -factor from wild-type and truncated receptors.
Membrane preparations from (A) STE2 strain DJ211-5-3 and (B)
ste2-T326 strain JK7441-4-2 were incubated with
35S- -factor and then assayed for the -factor that
remained bound in the presence or absence of 10 µM GTP S after the
indicated periods of time. Values given are the averages with standard
deviations of three independent determinations carried out in
duplicate.
|
|
The second method employed equilibrium binding assays to evaluate the
effect of G proteins on

-factor affinity (Fig.
7).
As previously reported (
32,
45), wild-type cells that produce
either full-length
(
STE2) or truncated (
ste2-T326) receptors bind

-factor with similar affinity (
Kd = 4.2
and 4.0 nM, respectively).
The fivefold increase in

-factor binding
sites observed for the
ste2-T326 mutant is consistent with
its endocytosis defect (
46,
49). Cells containing wild-type
receptors exhibited reduced

-factor affinity
(
Kd = 9.1 nM) and fewer

-factor binding
sites
when the G

and G

subunits were absent (
STE2 gpa1
ste4
), consistent
with earlier studies on
ste4
mutant cells (
29). In contrast,
cells containing truncated
receptors showed no reduction in

-factor
affinity
(
Kd = 2.7 nM) when G

and G

were
absent (
ste2-T326 gpa1
ste4
). These results indicate
that the C-terminal domain of the
receptor promotes a low affinity form
of the receptor in the absence
of G protein.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
Equilibrium binding of 35S- -factor to
wild-type or truncated receptors in the presence or absence of G
proteins. Scatchard plot analysis of wild-type (A) and truncated (B)
T326 receptors in yeast cells that contain G proteins and of wild-type
(C) and T326 (D) receptors in strains deleted for both the G
(gpa1 ) and G (ste4 ) subunit genes. The
strains for these analyses were DJ211-5-3, JK7441-4-2, MDY3, and MDY2.
The concentrations of cells in the assays were 5 × 108/ml (for assays in panels A, C, and D) and 1 × 108/ml (for assays in panel B) in a final volume of 100 µl.
|
|
 |
DISCUSSION |
Several observations suggest that the yeast pheromone receptors
form preactivation complexes with G proteins (4, 12, 23, 33, 37,
55). In the present study, we used three genetic assays that
yielded strong support for the ability of unoccupied receptors to
interact with G proteins, and we showed for the first time that the
C-terminal tail of the receptor facilitates this interaction. First, DN
mutant receptors, which are defective in ligand binding, required their
C-terminal domain to inhibit signaling from wild-type receptors.
Second, the C terminus was required for unoccupied wild-type receptors
to interfere with signaling from constitutively active receptors.
Lastly, the temperature-sensitive lethal phenotype that resulted from a
mutant form of the G
subunit was alleviated by unoccupied
full-length receptors but not by unoccupied truncated receptors.
The three genetic assays employed different criteria in defining
preactivation complexes. In the first two assays, mutant and wild-type
receptors competed for a common pool of G proteins, providing indirect
evidence for receptor-G-protein interactions. Since overexpression of
the G proteins overcomes the inhibitory activity of DN receptors
(12), these two assays apparently measure the ability of the
DN receptors to sequester G proteins. A caveat of the first assay is
that the apparent sequestration of G proteins by DN receptors may be a
unique property of the mutant receptors. However, in the second assay,
unoccupied wild-type receptors interfere with the signaling from
constitutively active receptors, thus suggesting that precoupling is a
function of normal receptors. The third assay provides a more direct
genetic test for receptor-G protein precoupling in that it detects
interactions between STE2 and GPA1 alleles,
whereas in the first two assays, G-protein sequestration is inferred
from interactions between different STE2 alleles. Although
it could be argued that all three assays measure the ability of
unoccupied receptors to dampen the signaling pathway at a point
downstream of the G protein, two results are inconsistent with this
alternative hypothesis: G-protein overexpression reverses the DN
phenotype, and DN receptors do not overcome signaling in gpa1
cells (12). In sum, our results, together
with the results of others (23, 37, 55), strongly suggest
that unoccupied
-factor receptors precouple with G proteins. It
remains to be determined, however, whether the C terminus of the
-factor receptor interacts directly with its cognate G protein.
Interestingly, the C terminus of Gpr1p, a putative G-protein-coupled
receptor involved in nutritional sensing in yeast, interacts with its
G
subunit (Gpa2p) in the two-hybrid assay (60). In the
case of the
-factor receptor, the two-hybrid assay has failed to
detect interactions with any of the G-protein subunits (unpublished
data); other assays will have to be developed for determining the
mechanism by which the C-terminal domain regulates the formation of
preactivation complexes.
In interpreting our results, we also considered the possibility that
receptor oligomerization plays a role in the genetic interactions that
we observed. This phenomenon has been reported for the
-factor
receptor (42) and is often invoked to explain interactions
observed when different mutant forms of a protein are coexpressed. In
particular, oligomerization of wild-type and mutant receptors was
previously suggested as a possible explanation for the recessive
phenotype of the ste2-T326 allele (32, 45). The
ste2-T326 cells are supersensitive to pheromone, but cells that contain both truncated ste2-T326 and full-length
STE2+ receptors show normal sensitivity.
However, based on the information presented in this paper, the
recessive nature of the ste2-T326 allele is also consistent
with the C-terminal domain of the wild-type receptors being involved in
the sequestration of G proteins in preactivation complexes. It could
also be argued that protein oligomerization underlies the dominant
nature of the DN mutant alleles of STE2. However, for this
hypothesis to be viable, one must also propose that G protein
overproduction blocks the ability of the receptors to interact
effectively. Moreover, receptor oligomerization does not readily
account for the ability of wild-type receptors to reverse the growth
defect of the GPA1-A345T mutant cells since these cells
express only one form of the receptor. Thus, although oligomerization
of receptors may occur, it is unnecessary to invoke this phenomenon to
explain the interactions among STE2 alleles, and it fails to
explain the interactions between STE2 and GPA1 alleles.
As for other GPCRs, the C-terminal domain of the
-factor receptor
functions in signal downregulation by promoting ligand-induced endocytosis (46, 49) and by mediating desensitization of the receptors that remain at the cell surface (8, 32, 45). The
relationships between these regulatory functions and preactivation complex formation were, therefore, explored by using deletion mutagenesis. The ability of the receptors to undergo endocytosis was
not sufficient for G-protein sequestration. Moreover, the distal
C-terminal region of the tail required for sequestration does not
coincide with the well-defined endocytosis domain spanning residues 331 to 339, suggesting that endocytosis and sequestration of G proteins are
separate and distinct functions. In contrast, the desensitization
mechanism that is mediated by phosphorylation requires sequences that
are dispersed throughout the C-terminal domain, and these sequences
partially overlap the regions of the C-terminal domain that are
required for sequestering G proteins. Thus, it is conceivable that
desensitization and sequestration are linked in some way. For example,
receptor desensitization could be mediated, in part, by
-factor-induced modifications in the C-terminal domain that prevent
the receptor from interacting with the G protein.
The third intracellular loop rather than the C-terminal domain of the
-factor receptor is thought to play the major role in G-protein
activation (7, 10, 49, 54). Thus, occupied and unoccupied
receptors may utilize different structural regions to make the relevant
contacts with the G protein. Conformational differences in occupied and
unoccupied receptors reflect ligand-mediated changes in both the third
intracellular loop and the C-terminal domain. The third intracellular
loop is more accessible to trypsin cleavage in the occupied receptors,
whereas sites in the C-terminal domain are more accessible in
unoccupied receptors (7). Behavior of the L236H mutant
receptors is also consistent with a role for the third intracellular
loop in G-protein activation. The amino acid substitution in this loop
inhibits G-protein activation, yet, as reported here, it has no
detectable effect on preactivation complexes. Since trypsin cleavage of
the third loop in L236H receptors remains sensitive to
-factor
(7), the loss of G-protein activation apparently reflects a
defect in the receptor-G-protein contact site rather than a failure of
this receptor to undergo the conformational change. However, other
changes in the third intracellular loop apparently influence
preactivation complexes, since the L236R substitution blocks the
ability of wild-type receptors to inhibit constitutive receptor
signaling (55) and since the
ste2-R233K,G237S gpa1-A345T double mutant
exhibits a synthetic lethal phenotype (K. A. Schandel and D. D. Jenness, unpublished data). The differences between these mutant
receptors and the L236H mutant may reflect a role for the third loop in
preactivation complexes, or it is possible that the L236R mutant
receptors may assume a conformational state inconsistent with G-protein
binding. Although the third intracellular loop of the yeast
-factor
receptor plays a prominent role in G-protein activation, other GPCR
proteins use additional regions of the receptor. In some cases, the
second intracellular loop or the C-terminal domain has been implicated
in G-protein activation in vitro (6, 40, 59).
Pheromone binding studies were used to determine whether the C-terminal
domain, in addition to its role in precoupling, also mediates
interactions between the G protein and occupied receptors. The
-factor receptor, like many other GPCRs, shows higher affinity for
ligand when complexed with G protein (2, 29). Truncated T326
receptors possess the same affinity for
-factor as wild-type receptors in the presence of G proteins (32); however, when expressed in cells that lack G proteins, these truncated receptors did
not undergo the distinctive shift in affinity that is observed for
wild-type receptors (Fig. 7). Apparently, the cytoplasmic tail
modulates the conformation of the ligand-binding pocket. These results
suggest that the C-terminal domain of the
-factor receptor plays a
role in the transition of the inactive RG complex to the activated
state after ligand binding. The C-terminal domains of rhodopsin,
adrenergic receptors, and other GPCRs have also been implicated in
coupling to the G protein (6, 40, 59). Moreover, truncations
affecting the C-terminal tail of the prostaglandin EP3 receptor have
been shown to confer ligand-independent activity (22),
indicating that, in this case, the C-terminal domain plays a crucial
role in constraining the receptor in its inactive conformation. Thus,
although the C-terminal regions of many GPCRs are not essential for
G-protein activation, these regions appear to play an important role in
the normal transition to the activated state upon ligand binding.
Altogether, the results of this study have uncovered novel functions
for the C-terminal domain of the
-factor receptor in regulating the
ability of receptors to interact with the G protein. These results
indicate that the receptor has two opposing roles in governing the
intensity of signaling in the pheromone response pathway and that
distinct regions of the receptor are required for these functions. On
one hand, unoccupied receptors, via their C-terminal domains, form
preactivation complexes with G proteins and stabilize the
heterotrimeric G proteins to ensure low basal levels of signaling
(i.e., a negative role in signaling). On the other hand, occupied
receptors, through sequences involving the third intracellular loop,
stimulate G-protein signaling to promote signal transduction (i.e., a
positive role in signaling). Additionally, the formation of
preactivation complexes by unoccupied receptors may contribute to the
spatial regulation of signaling that enables yeast cells to locate the
position of mating partners. Yeast cells locate potential mating
partners by polarizing their growth towards the strongest source of
incoming pheromone signal (27, 50). Consistent with this,
truncated receptor strains display defects in mating partner selection
(28) and in mating under suboptimal conditions (17,
19) that may result from a defect in precoupling in combination
with their defect in receptor desensitization. Interestingly, the fact
that some mammalian GPCRs appear to sequester G proteins suggests that
they form preactivation complexes (5, 39, 47, 56). It has
been proposed that these preactivation complexes could be involved in
enhancing the rate of G-protein activation, in determining G-protein
specificity, and in regulating the balance of signaling between the
different types of GPCRs present in mammalian cells (39, 40,
52). In view of the high degree of conservation among GPCRs, it
will be interesting to determine whether the C-terminal domains of
other receptors are required for the formation of preactivation complexes.
 |
ACKNOWLEDGMENTS |
We thank our colleagues for advice and Colleen Davis for
technical assistance with the early phases of this project.
This work was supported by NIH grant GM55107, awarded to J.B.K., and by
NIH grant GM34719, awarded to D.D.J. K.A.S. was supported, in
part, by a Faculty Development Grant from Assumption College.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics and Microbiology, State University of New York,
Stony Brook, NY 11794-5222. Phone: (631) 632-8715. Fax: (631) 632-9797. E-mail: james.konopka{at}sunysb.edu.
Present address: Departamento de Bioquímica y
Biología Molecular, Universidad de Salamanca, Campus
Unamuno, 37007 Salamanca, Spain.
Permanent address: Department of Natural Sciences, Assumption
College, Worcester, MA 01615.
 |
REFERENCES |
| 1.
|
Bardwell, L.,
J. G. Cook,
C. J. Inouye, and J. Thorner.
1994.
Signal propagation and regulation in the mating pheromone response pathway of the yeast Saccharomyces cerevisiae.
Dev. Biol.
166:363-379[CrossRef][Medline].
|
| 2.
|
Blumer, K. J.,
J. E. Reneke,
W. E. Courchesne, and J. Thorner.
1988.
The -factor receptor (STE2 gene product) of yeast Saccharomyces cerevisiae.
Cold Spring Harbor Symp. Quant. Biol.
53:591.
|
| 3.
|
Blumer, K. J., and J. Thorner.
1990.
and subunits of a yeast guanine nucleotide-binding protein are not essential for membrane association of the subunit but are required for receptor coupling.
Proc. Natl. Acad. Sci. USA
87:4363-4367[Abstract/Free Full Text].
|
| 4.
|
Boone, C.,
N. G. Davis, and G. F. Sprague, Jr.
1993.
Mutations that alter the third cytoplasmic loop of the a-factor receptor lead to a constitutive and hypersensitive phenotype.
Proc. Natl. Acad. Sci. USA
90:9921-9925[Abstract/Free Full Text].
|
| 5.
|
Bouaboula, M.,
S. Perrachon,
L. Milligan,
X. Canat,
M. Rinaldi-Carmona,
M. Portier,
F. Barth,
B. Calandra,
F. Pecceu,
J. Lupker,
J. P. Maffrand,
G. Le Fur, and P. Casellas.
1997.
A selective inverse agonist for central cannabinoid receptor inhibits mitogen-activated protein kinase activation stimulated by insulin or insulin-like growth factor 1. Evidence for a new model of receptor/ligand interactions.
J. Biol. Chem.
272:22330-22339[Abstract/Free Full Text].
|
| 6.
|
Bourne, H. R.
1997.
How receptors talk to trimeric G proteins.
Curr. Opin. Cell Biol.
9:134-142[CrossRef][Medline].
|
| 7.
|
Bukusoglu, G., and D. D. Jenness.
1996.
Agonist-specific conformational changes in the yeast -factor pheromone receptor.
Mol. Cell. Biol.
16:4818-4823[Abstract].
|
| 8.
|
Chen, Q., and J. B. Konopka.
1996.
Regulation of the G protein-coupled -factor pheromone receptor by phosphorylation.
Mol. Cell. Biol.
16:247-257[Abstract].
|
| 9.
|
Chidiac, P.
1998.
Rethinking receptor-G protein-effector interactions.
Biochem. Pharmacol.
55:549-556[CrossRef][Medline].
|
| 10.
|
Clark, C. D.,
T. Palzkill, and D. Botstein.
1994.
Systematic mutagenesis of the yeast mating pheromone receptor third intracellular loop.
J. Biol. Chem.
269:8831-8841[Abstract/Free Full Text].
|
| 11.
|
Dohlman, H. G.,
J. Thorner,
M. G. Caron, and R. J. Lefkowitz.
1991.
Model systems for the study of 7-transmembrane-segment receptors.
Annu. Rev. Biochem.
60:653-688[CrossRef][Medline].
|
| 12.
|
Dosil, M.,
L. Giot,
C. Davis, and J. B. Konopka.
1998.
Dominant-negative mutations in the G protein-coupled -factor receptor map to the extracellular ends of the transmembrane segments.
Mol. Cell. Biol.
18:5981-5991[Abstract/Free Full Text].
|
| 13.
|
Dube, P., and J. B. Konopka.
1998.
Identification of a polar region in transmembrane domain 6 that regulates the function of the G protein-coupled -factor receptor.
Mol. Cell. Biol.
18:7205-7215[Abstract/Free Full Text].
|
| 14.
|
Erickson, J. R.,
J. J. Wu,
J. G. Goddard,
G. Tigyi,
K. Kawanishi,
L. D. Tomei, and M. C. Kiefer.
1998.
Edg-2/Vzg-1 couples to the yeast pheromone response pathway selectively in response to lysophosphatidic acid.
J. Biol. Chem.
273:1506-1510[Abstract/Free Full Text].
|
| 15.
|
Ernst, O. P.,
K. P. Hofmann, and T. P. Sakmar.
1995.
Characterization of rhodopsin mutants that bind transducin but fail to induce GTP nucleotide uptake. Classification of mutant pigments by fluorescence, nucleotide release, and flash-induced light-scattering assays.
J. Biol. Chem.
270:10580-10586[Abstract/Free Full Text].
|
| 16.
|
Ferguson, B.,
J. Horecka,
J. Printen,
J. Schultz,
B. J. Stevenson, and G. F. Sprague, Jr.
1994.
The yeast pheromone response pathway: new insights into signal transmission.
Cell. Mol. Biol. Res.
40:223-228[Medline].
|
| 17.
|
Gehrung, S., and M. Snyder.
1990.
The SPA2 gene of Saccharomyces cerevisiae is important for pheromone-induced morphogenesis and efficient mating.
J. Cell. Biol.
111:1451-1464[Abstract/Free Full Text].
|
| 18.
|
Gether, U., and B. K. Kobilka.
1998.
G protein-coupled receptors. II. Mechanism of agonist activation.
J. Biol. Chem.
273:17979-17982[Free Full Text].
|
| 19.
|
Giot, L.,
C. DeMattei, and J. B. Konopka.
1999.
Combining mutations in the incoming and outgoing pheromone signal pathways causes a synergistic mating defect in Saccharomyces cerevisiae.
Yeast
15:765-780[CrossRef][Medline].
|
| 20.
|
Hamm, H. E.
1998.
The many faces of G protein signaling.
J. Biol. Chem.
273:669-672[Free Full Text].
|
| 21.
|
Hartwell, L. H.
1980.
Mutants of Saccharomyces cerevisiae unresponsive to cell division control by polypeptide mating hormone.
J. Cell Biol.
85:811-822[Abstract/Free Full Text].
|
| 22.
|
Hasegawa, H.,
M. Negishi, and A. Ichikawa.
1996.
Two isoforms of the prostaglandin E receptor EP3 subtype different in agonist-independent constitutive activity.
J. Biol. Chem.
271:1857-1860[Abstract/Free Full Text].
|
| 23.
|
Hasson, M. S.,
D. Blinder,
J. Thorner, and D. D. Jenness.
1994.
Mutational activation of the STE5 gene product bypasses the requirement for G protein and in the yeast pheromone response pathway.
Mol. Cell. Biol.
14:1054-1065[Abstract/Free Full Text].
|
| 24.
|
Hicke, L., and H. Riezman.
1996.
Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis.
Cell
84:277-287[CrossRef][Medline].
|
| 25.
|
Hicke, L.,
B. Zanolari, and H. Riezman.
1998.
Cytoplasmic tail phosphorylation of the -factor receptor is required for its ubiquitination and internalization.
J. Cell Biol.
141:349-358[Abstract/Free Full Text].
|
| 26.
|
Hirsch, J. P., and F. P. Cross.
1993.
The pheromone receptors inhibit the pheromone response pathway in Saccharomyces cerevisiae by a process that is independent of their associated G protein.
Genetics
135:943-953[Abstract].
|
| 27.
|
Jackson, C. L., and L. H. Hartwell.
1990.
Courtship in Saccharomyces cerevisiae: both cell types choose mating partners by responding to the strongest pheromone signal.
Cell
63:1039-1051[CrossRef][Medline].
|
| 28.
|
Jackson, C. L.,
J. B. Konopka, and L. H. Hartwell.
1991.
S. cerevisiae -pheromone receptors activate a novel signal transduction pathway for mating partner discrimination.
Cell
67:389-402[CrossRef][Medline].
|
| 29.
|
Jenness, D. D.,
B. S. Goldman, and L. H. Hartwell.
1987.
Saccharomyces cerevisiae mutants unresponsive to -factor pheromone: -factor binding and extragenic suppression.
Mol. Cell. Biol.
7:1311-1319[Abstract/Free Full Text].
|
| 30.
|
Jenness, D. D., and P. Spatrick.
1986.
Down regulation of the -factor pheromone receptor in Saccharomyces cerevisiae.
Cell
46:345-353[CrossRef][Medline].
|
| 31.
|
Klein, C.,
J. I. Paul,
K. Sauve,
M. M. Schmidt,
L. Arcangeli,
J. Ransom,
J. Trueheart,
J. P. Manfredi,
J. R. Broach, and A. J. Murphy.
1998.
Identification of surrogate agonists for the human FPRL-1 receptor by autocrine selection in yeast.
Nat. Biotechnol.
16:1334-1337[CrossRef][Medline].
|
| 32.
|
Konopka, J. B.,
D. D. Jenness, and L. H. Hartwell.
1988.
The C terminus of the Saccharomyces cerevisiae -pheromone receptor mediates an adaptive response to pheromone.
Cell
54:609-620[CrossRef][Medline].
|
| 33.
|
Konopka, J. B.,
M. Margarit, and P. Dube.
1996.
Mutation of pro-258 in transmembrane domain 6 constitutively activates the G protein-coupled -factor receptor.
Proc. Natl. Acad. Sci. USA
93:6764-6769[Abstract/Free Full Text].
|
| 34.
|
Kunes, S.,
H. Ma,
K. Overbye,
M. S. Fox, and D. Botstein.
1987.
Fine structure recombinational analysis of cloned genes using yeast transformation.
Genetics
115:73-81[Abstract/Free Full Text].
|
| 35.
|
Law, S. F., and T. Reisine.
1997.
Changes in the association of G protein subunits with the cloned mouse delta opioid receptor on agonist stimulation.
J. Pharmacol. Exp. Ther.
281:1476-1486[Abstract].
|
| 36.
|
Law, S. F.,
K. Yasuda,
G. I. Bell, and T. Reisine.
1993.
G1 3 and Go selectively associate with the cloned somatostatin receptor subtype SSTR2.
J. Biol. Chem.
268:10721-10727[Abstract/Free Full Text].
|
| 37.
|
Leavitt, L. M.,
C. R. Macaluso,
K. S. Kim,
N. P. Martin, and M. E. Dumont.
1999.
Dominant negative mutations in the -factor receptor, a G protein-coupled receptor encoded by the STE2 gene of the yeast Saccharomyces cerevisiae.
Mol. Gen. Genet.
261:917-932[CrossRef][Medline].
|
| 38.
|
Leberer, E.,
D. Y. Thomas, and M. Whiteway.
1997.
Pheromone signalling and polarized morphogenesis in yeast.
Curr. Opin. Genet. Dev.
7:59-66[CrossRef][Medline].
|
| 39.
|
Neubig, R. R.
1994.
Membrane organization in G-protein mechanisms.
FASEB J.
8:939-946[Abstract].
|
| 40.
|
Neubig, R. R.
1998.
Specificity of receptor-G protein coupling: protein structure and cellular determinants.
Semin. Neurosci.
9:189-197[CrossRef].
|
| 41.
|
Osawa, S., and E. R. Weiss.
1995.
The effect of carboxyl-terminal mutagenesis of Gt on rhodopsin and guanine nucleotide binding.
J. Biol. Chem.
270:31052-31058[Abstract/Free Full Text].
|
| 42.
|
Overton, M. C., and K. J. Blumer.
2000.
G-protein-coupled receptors function as oligomers in vivo.
Curr. Biol.
10:341-344[CrossRef][Medline].
|
| 43.
|
Pausch, M. H.
1997.
G protein-coupled receptors in Saccharomyces cerevisiae: high-throughput screening assays for drug discovery.
Trends Biotechnol.
15:487-494[CrossRef][Medline].
|
| 44.
|
Price, L. A.,
J. Strnad,
M. Pausch, and J. R. Hadcock.
1996.
Pharmacological characterization of the rat A2A-adenosine receptor functionally coupled to the yeast pheromone response pathway.
Mol. Pharmacol.
50:829-837[Abstract].
|
| 45.
|
Reneke, J. E.,
K. J. Blumer,
W. E. Courchesne, and J. Thorner.
1988.
The carboxyl terminal domain of the -factor receptor is a regulatory domain.
Cell
55:221-234[CrossRef][Medline].
|
| 46.
|
Rohrer, J.,
H. Benedetti,
B. Zanolari, and H. Riezman.
1993.
Identification of a novel sequence mediating regulated endocytosis of the G protein-coupled -pheromone receptor in yeast.
Mol. Biol. Cell
4:511-521[Abstract].
|
| 47.
|
Roka, F.,
L. Brydon,
M. Waldhoer,
A. D. Strosberg,
M. Freissmuth,
R. Jockers, and C. Nanoff.
1999.
Tight association of the human Mel1a-melatonin receptor and Gi: precoupling and constitutive activity.
Mol. Pharmacol.
56:1014-1024[Abstract/Free Full Text].
|
| 48.
|
Samama, P.,
S. Cotecchia,
T. Costa, and R. J. Lefkowitz.
1993.
A mutation-induced activated state of the 2-adrenergic receptor. Extending the ternary complex model.
J. Biol. Chem.
268:4625-4636[Abstract/Free Full Text].
|
| 49.
|
Schandel, K. A., and D. D. Jenness.
1994.
Direct evidence for ligand-induced internalization of the yeast -factor pheromone receptor.
Mol. Cell. Biol.
14:7245-7255[Abstract/Free Full Text].
|
| 50.
|
Segall, J. E.
1993.
Polarization of yeast cells in spatial gradients of -mating factor.
Proc. Natl. Acad. Sci. USA
90:8332-8336[Abstract/Free Full Text].
|
| 51.
|
Shah, A., and L. Marsh.
1996.
Role of SST2 in modulating G protein-coupled receptor signaling.
Biochem. Biophys. Res. Commun.
226:242-246[CrossRef][Medline].
|
| 52.
|
Shea, L., and J. J. Linderman.
1997.
Mechanistic model of G-protein signal transduction. Determinants of efficacy and effect of precoupled receptors.
Biochem. Pharmacol.
53:519-530[CrossRef][Medline].
|
| 53.
|
Sherman, F.
1991.
Getting started with yeast.
Methods Enzymol.
194:3-21[CrossRef][Medline].
|
| 54.
|
Stefan, C. J., and K. J. Blumer.
1994.
The third cytoplasmic loop of a yeast G-protein-coupled receptor controls pathway activation, ligand discrimination, and receptor internalization.
Mol. Cell. Biol.
14:3339-3349[Abstract/Free Full Text].
|
| 55.
|
Stefan, C. J.,
M. C. Overton, and K. J. Blumer.
1998.
Mechanisms governing the activation and trafficking of yeast G protein-coupled receptors.
Mol. Biol. Cell
9:885-899[Abstract/Free Full Text].
|
| 56.
|
Vasquez, C., and D. L. Lewis.
1999.
The CB1 cannabinoid receptor can sequester G-proteins, making them unavailable to couple to other receptors.
J. Neurosci.
19:9271-9280[Abstract/Free Full Text].
|
| 57.
|
Watson, S., and S. Arkinstall.
1994.
The G-protein linked receptor FactsBook.
Academic Press Limited, London, England.
|
| 58.
|
Weiner, J. L.,
S. Guttierez-Steil, and K. J. Blumer.
1993.
Disruption of receptor-G protein coupling in yeast promotes the function of as SST2-dependent adaptation pathway.
J. Biol. Chem.
268:8070-8077[Abstract/Free Full Text].
|
| 59.
|
Wess, J.
1997.
G-protein-coupled receptors: molecular mechanisms involved in receptor activation and selectivity of G-protein recognition.
FASEB J.
11:346-354[Abstract].
|
| 60.
|
Xue, Y.,
M. Batlle, and J. P. Hirsch.
1998.
GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p G subunit and functions in a Ras-independent pathway.
EMBO J.
17:1996-2007[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2000, p. 5321-5329, Vol. 20, No. 14
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gehret, A. U., Bajaj, A., Naider, F., Dumont, M. E.
(2006). Oligomerization of the Yeast {alpha}-Factor Receptor: IMPLICATIONS FOR DOMINANT NEGATIVE EFFECTS OF MUTANT RECEPTORS. J. Biol. Chem.
281: 20698-20714
[Abstract]
[Full Text]
-
Lee, Y.-H., Naider, F., Becker, J. M.
(2006). Interacting Residues in an Activated State of a G Protein-coupled Receptor. J. Biol. Chem.
281: 2263-2272
[Abstract]
[Full Text]
-
Overton, M. C., Chinault, S. L., Blumer, K. J.
(2005). Oligomerization of G-Protein-Coupled Receptors: Lessons from the Yeast Saccharomyces cerevisiae. Eukaryot Cell
4: 1963-1970
[Full Text]
-
Harashima, T., Heitman, J.
(2005). G{alpha} Subunit Gpa2 Recruits Kelch Repeat Subunits That Inhibit Receptor-G Protein Coupling during cAMP-induced Dimorphic Transitions in Saccharomyces cerevisiae. Mol. Biol. Cell
16: 4557-4571
[Abstract]
[Full Text]
-
Chinault, S. L., Overton, M. C., Blumer, K. J.
(2004). Subunits of a Yeast Oligomeric G Protein-coupled Receptor Are Activated Independently by Agonist but Function in Concert to Activate G Protein Heterotrimers. J. Biol. Chem.
279: 16091-16100
[Abstract]
[Full Text]
-
Lin, J. C., Duell, K., Konopka, J. B.
(2004). A Microdomain Formed by the Extracellular Ends of the Transmembrane Domains Promotes Activation of the G Protein-Coupled {alpha}-Factor Receptor. Mol. Cell. Biol.
24: 2041-2051
[Abstract]
[Full Text]
-
Chinault, S. L., Blumer, K. J.
(2003). The C-terminal Tail Preceding the CAAX Box of a Yeast G Protein {gamma} Subunit Is Dispensable for Receptor-mediated G Protein Activation in Vivo. J. Biol. Chem.
278: 20638-20644
[Abstract]
[Full Text]
-
Akal-Strader, A., Khare, S., Xu, D., Naider, F., Becker, J. M.
(2002). Residues in the First Extracellular Loop of a G Protein-coupled Receptor Play a Role in Signal Transduction. J. Biol. Chem.
277: 30581-30590
[Abstract]
[Full Text]
-
Rudner, D. Z., Losick, R.
(2002). A sporulation membrane protein tethers the pro-sigma K processing enzyme to its inhibitor and dictates its subcellular localization. Genes Dev.
16: 1007-1018
[Abstract]
[Full Text]
-
Parrish, W., Eilers, M., Ying, W., Konopka, J. B.
(2002). The Cytoplasmic End of Transmembrane Domain 3 Regulates the Activity of the Saccharomyces cerevisiae G-Protein-Coupled {alpha}-Factor Receptor. Genetics
160: 429-443
[Abstract]
[Full Text]
-
Yesilaltay, A., Jenness, D. D.
(2000). Homo-oligomeric Complexes of the Yeast alpha -Factor Pheromone Receptor Are Functional Units of Endocytosis. Mol. Biol. Cell
11: 2873-2884
[Abstract]
[Full Text]