Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5415-5424, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Precursors to the U3 Small Nucleolar RNA Lack Small
Nucleolar RNP Proteins but Are Stabilized by La Binding
Joanna
Kufel,1
Christine
Allmang,1
Guillaume
Chanfreau,2,
Elisabeth
Petfalski,1
Denis L. J.
Lafontaine,1 and
David
Tollervey1,*
Wellcome Trust Centre for Cell Biology, ICMB,
The University of Edinburgh, Edinburgh EH9 3JR,
Scotland,1 and GIM-Biotechnologies,
Institute Pasteur, 75724 Paris Cedex 15, France2
Received 10 March 2000/Returned for modification 10 April
2000/Accepted 2 May 2000
 |
ABSTRACT |
Almost all small eukaryotic RNAs are processed from transiently
stabilized 3'-extended forms. A key question is how and why such
intermediates are stabilized and how they can then be processed to the
mature RNA. Here we report that yeast U3 is also processed from a
3'-extended precursor. The major 3'-extended forms of U3 (U3-3'I and
-II) lack the cap trimethylation present in mature U3 and are not
associated with small nucleolar RNP (snoRNP) proteins that bind mature
U3, i.e., Nop1p, Nop56p, and Nop58p. Depletion of Nop58p leads to the
loss of mature U3 but increases the level of U3-3'I and -II, indicating
a requirement for the snoRNP proteins for final maturation. Pre-U3 is
cleaved by the endonuclease Rnt1p, but U3-3'I and -II do not extend to
the Rnt1p cleavage sites. Rather, they terminate at poly(U) tracts,
suggesting that they might be bound by Lhp1p (the yeast homologue of
La). Immunoprecipitation of Lhp1p fused to Staphylococcus
aureus protein A resulted in coprecipitation of both U3-3'I and
-II. Deletion of LHP1, which is nonessential, led to the
loss of U3-3'I and -II. We conclude that pre-U3 is cleaved by Rnt1p,
followed by exonuclease digestion to U3-3'I and -II. These species are
stabilized against continued degradation by binding of Lhp1p.
Displacement of Lhp1p by binding of the snoRNP proteins allows final
maturation, which involves the exosome complex of 3'
5' exonucleases.
 |
INTRODUCTION |
Eukaryotic cells contain a large
number of stable RNA species, nearly all of which are synthesized by
posttranscriptional processing from larger precursors. This has long
been known for the highly abundant cytoplasmic RNAs, tRNAs, and
rRNAs, but more recently it has become clear that is also the
case for the small nuclear RNAs (snRNAs), which participate in pre-mRNA
splicing, and the small nucleolar RNAs (snoRNAs), which participate in
rRNA processing and modification. It is a long-standing mystery why cells use such a strategy, rather than simply terminating transcription at the end of the mature RNA sequence. We will offer a potential explanation for this, at least in the case of the U3 snoRNA.
Analyses of the 3' end processing of the 5.8S rRNA in
Saccharomyces cerevisiae led to the identification of the
exosome complex, composed of 11 different 3'
5' exonucleases
(6, 36, 37; E. Petfalski and D. Tollervey,
unpublished data). Subsequent work showed that the exosome participates
in the 3' processing of other RNA substrates, including many
snRNAs and snoRNAs (5, 55), and also participates in
mRNA turnover (9). A homologous complex, designated the
PM-Scl complex, is present in human cells and is a target for
autoimmune antibodies (6).
In addition to the exosome, normal 3' processing of the U1, U2, U4, and
U5 snRNAs involves cleavage by the endonuclease Rnt1p (1, 5, 14,
45), the yeast homologue of Escherichia coli RNase III
(2). Rnt1p cleaves on both sides of extended stem-loop structures with closing AGNN tetraloops (15), and these
cleavages are likely to act as entry sites for the exosome complex,
with the final trimming performed by the Rex exonucleases and/or the exosome component Rrp6p (5, 54). Rnt1p also acts to separate the individual pre-snoRNAs from polycistronic precursors (15, 16) and processes the 3' external transcribed spacer of the yeast
pre-rRNA (2, 28).
Another 3' processing factor, the La phosphoprotein, was identified as
the target of human autoimmune antibodies and was shown to bind to the
poly(U) tracts located at the 3' ends of all RNA polymerase III
transcripts (42, 48). La also binds to 3' extended precursors to human U1 and the yeast snRNAs (34, 58) and to internal sequences of several viral RNAs, in some cases at sequences that lack poly(U) tracts (4, 23). The yeast homologue of La,
Lhp1p (La-homologous protein), is nonessential for viability but is
required for normal 3' processing of tRNAs (56, 59). In the
presence of Lhp1p, processing is endonucleolytic, whereas in the
absence of Lhp1p this cleavage is inhibited and an alternative, exonucleolytic pathway takes over tRNA 3' maturation (59).
Lhp1p also associates with the newly transcribed U6 snRNA, which is transcribed by RNA polymerase III (39).
Here we show how these factors collaborate in the 3' processing of the
U3 snoRNA.
 |
MATERIALS AND METHODS |
Strains.
Growth and handling of S. cerevisiae
were by standard techniques. The transformation procedure was as
described elsewhere (21). Yeast strains used and constructed
in this study are listed in Table 1.
Wild-type RNT1 and rnt1-
sister strains
(15) were used to prepare whole-cell extract. Strain
rat1-1 was kindly provided by C. Cole (7). The
nonessential gene LHP1 was disrupted and tagged with
Staphylococcus aureus protein A ("ProtA" in construct designations) at the carboxy-terminal end of Lhp1p by a PCR strategy (29) in the haploid strain YDL401, using the
Kluyveromyces lactis URA3 marker.
The oligonucleotides used to construct and test the gene disruption and
protein A tagging were 838 (5' LHP1::URA),
5'-TCTATTTGGTTCTACTGGAACTAAAGTAGCATCTGCAAAGAAGTAGAGAAGTTTGAGAGGGC;
839 (3' LHP1::URA),
5'-ATATGCTATGATAATGAGATACGAGAACCAGAAGAAACACAAGAACTGGGTAGAAGATCGGTC;
840 (5' LHP1 test), 5'-ACAGAGTCGCATCTCATCGC; 841 (3'
Kl URA),
5'-GGTAGAAGATCGGTC; 842 (5' LHP1::ProtA);
5'-GAGGACTCTTCTGCCATTGCCGATGACGATGAGGAGCACAAGGAGGGCGTGGACAACAAATTC;
and 843 (3' LHP1::ProtA),
5'-TCCATTTTAACCAGTAACGGTAATTTTTAATACTAATAAAAAAAGCTGGGTAGAAGATCGGTC.
RNA extraction, Northern hybridization, and primer
extension.
For depletion of Rrp41p and Rrp45p, cells were
harvested at intervals following the shift from RSG medium (2%
galactose, 2% sucrose, 2% raffinose) to medium containing 2%
glucose. Otherwise strains were grown in YPD medium. RNA was extracted
as described previously (52). Northern hybridization and
primer extension were as described previously (12, 51).
Standard 6 or 8% acrylamide gels were used to analyze
low-molecular-weight RNA species and primer extension reactions. For
RNA hybridization and primer extension, the following oligonucleotides
were used: 200 (U3), 5'-UUAUGGGACUUGUU; 203 (5'U3),
5'-CUAUAGAAAUGAUCCU; 218 (snR10), 5'-CUIUUAAAUUUICIUU; 230 (anti-U3sub6), 5'-GATTCCTATAGAAACACAG; 250 (scR1),
5'-ATCCCGGCCGCCTCCATCAC; 251 (3'Ex-U3),
5'-GTGGTTAACTTGTCA; 252 (U3ADS),
5'-TTTGTTTTCGCATCCGTCGCTC; 253 (U3DS),
5'-GGAGTCATACTATCAAGAAC; 254 (3'U3),
5'-CCAACTTGTCAGACTGCCATT; 260 (U3 intron),
5'-CAAAAGCTGCTGCAATGG; 261 (U6),
5'-AAAACGAAATAAATTCTTTGTAAAAC; and 310 (tRNATyrG
A-intron),
5'-AAGATTTCGTAGTGATAA.
Oligonucleotides 200, 203, and 218 are largely composed of
2'-
O-methyl
RNA.
Expression of the U3 cDNA.
The synthesis of U3A from cDNA
constructs was analyzed by expression of the ARS-CEN pU3-wt plasmid
carrying an ADE2 marker (11). This U3 intronless
construct is under the control of the natural promoter and terminator
regions. Expression was analyzed in the
GAL::snr17A strain JH84 (24; J. Hughes, personal communication), from which the endogenous U3A was
depleted by growth on glucose medium. Alternatively, the pU3 sub6-CBS1
plasmid, which carries the viable mutations U3sub6 and CBS1 (11,
47), was expressed in wild-type yeast strains. U3 synthesized
from the cDNA construct was detected by hybridization with a probe
specific for the sub6 mutation (47).
In vitro processing reactions.
Synthetic U3-3' RNAs were
obtained by in vitro transcription as described elsewhere
(16), using a PCR product as template. The PCR product was
generated from genomic DNA using a forward primer carrying a T7
promoter (T7U3DS;
5'-GCGAATTCTAATACGACTCACTATAGGTACTTCTTTTTTGAAGGGAT) and
reverse primers 252 (U3ADS) for a longer U3(
60/+177) transcript or
253 (U3DS) for a shorter U3(
60/+139) transcript. Whole-cell extracts
were prepared from wild-type and rnt1-
sister strains as
described previously (16), and recombinant
His6-Rnt1p was purified as described previously (5,
16).
In vitro processing of U3-3' RNA in cell extracts or with recombinant
His
6-Rnt1p and mapping of the cleavage sites using primer
extension were performed as described elsewhere (
16). Prior
to the reaction, gel-purified RNA substrates (2 nM) were denatured
for
2 min at 85°C in Rnt1p buffer (50 mM Tris-HCl [pH 7.6], 200
mM KCl,
0.1 mg of wheat-germ tRNA/ml, 5 mM MgCl
2) and cooled to
23°C. The cleavage reaction was performed at 23°C using 100 fmol
of
recombinant His
6-Rnt1 or by incubation in the whole-cell
extracts.
RNase A/T1 mapping.
RNase A/T1
mapping was performed as described elsewhere (22). The
32P-labeled antisense probe was transcribed in vitro with
T7 polymerase using a PCR template as described above. The PCR product
was generated from genomic DNA using forward primer T7antiU3, carrying
a T7 promoter
(5'-GCGAATTCTAATACGACTCACTATAGGTTTTAAACAATTTAGAAAAGG), and
reverse primer 3'antiU3 (5'-GGGCTCTATGGGTGGGTAC). The RNA transcript was gel purified and hybridized to 8 µg of total RNA in 30 µl of piperazine-N,N'-bis(2-ethanesulfonic
acid) (PIPES) buffer (40 mM PIPES) [pH 6.7], 400 mM NaCl, 1 mM EDTA)
and 50% formamide. Annealing was performed by heating at 95°C for 2 min followed by incubation at 48°C for several hours. Digestion in RNase buffer (10 mM Tris-HCl [pH 7.5], 300 mM NaCl, 1 mM EDTA) was
performed with 5 to 15 U of RNase T2, 0.4 to 2.5 units of RNase T1, and 0.1 to 0.5 µg of RNase A (RNase
T2 from GibcoBRL; RNases T1 and A from
Boehringer) for 30 min at 25°C. Protected products were recovered by
guanidium thiocyanate-phenol-chloroform extraction and separated on an
10% polyacrylamide gel.
RNase H treatment.
Deadenylation was performed essentially
as described elsewhere (18). Samples of 30 µg of RNA were
annealed with 750 ng of oligo(dT) at 65°C for 1 h and digested
with 6 U of RNase H at 30°C for 1 h. The control samples were
treated identically except that the oligo(dT) was omitted.
Immunoprecipitation.
For immunoprecipitation of ProtA-Nop1p,
ProtA-Nop58p, ProtA-Nop56p, Lhp1p-ProtA, and
m32,2,7G-capped RNAs, yeast whole-cell extracts were
prepared as described elsewhere (46) except that for
immunoprecipitation of m32,2,7G-capped RNAs, cells were
resuspended in buffer A (150 mM potassium acetate [KAc; pH 7.5], 20 mM Tris-Ac, 5 mM MgAc) with 1 mM dithiothreitol, 0.5% Triton X-100,
and 5 mM phenylmethylsulfonyl fluoride. Immunoprecipitation of
ProtA-Nop1p, ProtA-Nop58p, ProtA-Nop56p, and Lhp1p-ProtA with rabbit
immunoglobulin G (IgG) agarose beads (Sigma) was performed as
previously described (33) at 150 mM salt (KAc)
concentration. For immunoprecipitation with
m32,2,7G-cap-specific serum (R1131; kindly provided by
R. Lührmann), 30 µl of suspension of protein G-Sepharose was
washed with phosphate-buffered saline buffer and incubated on a
rotating wheel with extract equivalent to 4 units of optical density at
600 nm of cells in 120 µl of buffer A for 2 h at 4°C. After
the pellet was washed in buffer A, bound
m32,2,7G-capped RNAs were eluted with 10 mM
m7G(5')ppp(5')G (Pharmacia) in 30 µl of buffer A. The
RNAs were extracted with GTC/phenol-chloroform and ethanol precipitated.
 |
RESULTS |
Yeast cells contain 3'-extended forms of U3.
Yeast U3 is
encoded by two genes, SNR17A, encoding U3A, and
SNR17B, encoding U3B (25). U3A is approximately
10-fold more abundant than U3B (25), and all analyses have
been performed for U3A. On Northern hybridization, probe 200, to mature
U3A, was observed to hybridize to two RNA species of slower gel
mobility (U3-3'I and U3-3'II) in total yeast RNA preparations (Fig.
1A, lane
1) that were estimated to be approximately 10 and 20 nucleotides (nt),
respectively, longer than the mature U3 (333 nt). A probe complementary
to the sequence across the 3' end of the mature U3A (probe 251), which
hybridizes specifically to 3'-extended species, also detected these
RNAs as well as a longer species (U3-int 3') of approximately 470 nt.
Both SNR17A and SNR17B contain introns that are
excised by the pre-mRNA splicing machinery (38). The size
and hybridization pattern of U3-int 3' indicates that it corresponds to
a 3'-extended precursor that retains the intron (Fig. 1D and 6B). It is
not clear whether U3-int 3' has 3' ends identical to those of U3-3'I
and U3-3'II. Synthesis of the U3-3'I and U3-3'II RNAs was not affected
by the presence or absence of the intron in the pre-snoRNA, since
identical species were observed in strains expressing U3 cDNA
constructs (see Materials and Methods) (data not shown).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Northern analysis of 3'-extended forms of U3 snoRNA.
Probes (indicated in parentheses): 251, complementary to the region
across the 3' end of the mature U3A; 200, complementary to mature U3;
260, complementary to the U3A intron; 250, complementary to the scR1
RNA. For panels A and B, input lysates were estimated to contain
comparable amounts of U3 snoRNA, and equal fractions of the preparation
were loaded for each lane; panels C and D, constant amounts of total
RNA were loaded in each lane. (A) Immunoprecipitation with
m32,2,7G cap-specific antibody (R1131) on lysates from
the wild-type D150 strain. (B) Immunoprecipitation of lysates from
strains expressing epitope-tagged fusion proteins ProtA-Nop1p,
ProtA-Nop58p, and ProtA-Nop56p. (C) Stability of mature and 3'-extended
U3 upon depletion of Nop58p. RNA was extracted from the GAL::nop58 and
wild-type (WT) strains following transfer from permissive, galactose
medium to repressive, glucose medium for the times indicated. (D)
Effects of rnt1- on 3'-extended U3. The level of scR1 RNA
is shown as a control for loading. T, total cell lysate; S, immune
supernatant; P, immunoprecipitate.
|
|
The mature U3 carries a 5' trimethyl guanosine (TMG) cap structure
(
25) and was precipitated with anti-TMG antibodies (Fig.
1A,
lane 3) (generously provided by R. Lührmann, University of
Marburg). In contrast, the U3-3'I, U3-3'II, and U3-int 3' RNAs
were not
precipitated with anti-TMG and were recovered exclusively
in the immune
supernatant (Fig.
1A, lane 2). Mature yeast U3,
like all box C+D
snoRNAs, is associated with Nop1p, Nop56p, and
Nop58p (
30,
31,
44) and was coprecipitated with protein
A-tagged fusion proteins
(Fig.
1B, lanes 3, 6, and 9). No association
of U3-3'I, U3-3'II, or
U3-int 3' with these proteins was observed,
and the RNAs were again
recovered exclusively in the immune supernatants
(Fig.
1B, lanes 2, 5, and
8).
Genetic depletion of Nop58p leads to the loss of all tested box C+D
snoRNAs including U3 (
30). The
GAL::nop58 strain was
pregrown on permissive,
galactose medium (0-h sample) and then
transferred to glucose to
repress synthesis of Nop58p (Fig.
1C).
Mature U3 was codepleted with
Nop58p, whereas the levels of the
U3-3'I and U3-3'II RNAs were
increased. The U3-int 3' species
was
unaffected.
We conclude that the U3 snoRNA is synthesized from 3' extended
precursors that lack the TMG cap structure. The pre-U3 species
are not
associated with snoRNP proteins and, unlike the mature
snoRNA, do not
require Nop58p for stability. Indeed, the accumulation
of U3-3'I and
U3-3'II in strains depleted of Nop58p indicates
that their normal
maturation to U3 requires Nop58p
binding.
3' processing of U3 involves cleavage by Rnt1p.
Rnt1p cleaves
3'-extended precursors to the U1, U2, U4, and U5 snRNAs and processes
polycistronic pre-snoRNAs. We therefore determined whether it is also
involved in the 3' processing of pre-U3 species. In strains carrying a
complete deletion of the RNT1 gene, the level of mature U3
was reduced approximately threefold (Fig. 1D, I; see also Table 2).
Strains carrying rnt1-
lacked the U3-3'I and U3-3'II RNAs
(Fig. 1D, II) and we observed a heterogeneous group of RNAs extending
to approximately 600 nt (see Fig. 6A, lane 16, where more RNA is
loaded). In addition, the intron-containing precursor was found to be
3' processed in the rnt1-
strain, in contrast to the
3'-extended form seen in the wild type (Fig. 1D, III, lane 2; see also
Fig. 6C, lanes 12 to 14). The reduced levels of U3 in the
rnt1-
strain were initially postulated to be due to
impaired splicing (15). However, subsequent work indicated that splicing was not defective in the rnt1-
strain
(45) and, as shown in Fig. 1D, there is no overall
accumulation of intron-containing forms of U3.
We conclude that 3' processing of U3 normally involves cleavage by
Rnt1p. In the absence of cleavage, long 3'-extended forms
are
synthesized. The time required for these to be synthesized
and then
processed may allow assembly of the mature snoRNP proteins,
and
processing proceeds directly to the 3' end of the mature snoRNA.
This
processing is, however, inefficient since mature U3 levels
are strongly
reduced (Fig.
1D; see also Table
2).
Rnt1p cleaves on both sides of extended stem-loop structures with a
closing AGNN tetraloop (
15). Inspection of the 3' flanking
sequences revealed the presence of good matches to consensus Rnt1p
cleavage sites 3' to both
SNR17A and
SNR17B, the
genes encoding
U3A and U3B, respectively (shown for
SNR17A
in Fig.
2D).
To confirm
that these are authentic
cleavage sites, the cleavage of the
SNR17A site was tested
in vitro. The U3(

60/+139) in vitro transcript,
which spans the region
between positions

60 and +139 with respect
to the mature U3 3' end
including the predicted stem-loop structure,
was used to map the
cleavage site by primer extension (Fig.
2A).
Incubation with
recombinant His
6-Rnt1p (Fig.
2A, lane 5) resulted
in the
appearance of two primer extension stops that were not
detected after
incubation in the absence of Rnt1p (Fig.
2A, lane
6). The primer
extension stops were at nt +22 and +59, corresponding
to cleavage
between nt +21/22 and +58/+59, and are in good agreement
with the
consensus sites of Rnt1p cleavage (Fig.
2D). To demonstrate
that in
vitro processing is by endonuclease cleavage, a longer
transcript was
labeled internally; U3(

60/+177) spans the 3' region
of the U3A
precursor between positions

60 and +177. Incubation
with either
recombinant His
6-Rnt1p (Fig.
2B, lanes 3 to 5) or
an
extract from a wild-type (
RNT1+) strain of yeast
(Fig.
2B, lane 6) led to the appearance of a
set of discrete cleavage
products that were not observed with
the no-enzyme control reaction
(Fig.
2B, lane 2) or with an extract
from an
rnt1-

strain
of yeast (Fig.
2B, lane 7). The substrate
is 237 nt, and comparison to
size markers (Fig.
2B, lanes 1 and
8) indicated that the sizes of the
three smaller species were
in good agreement with the predicted
cleavage products: from +59
to the 3' end of the transcript (predicted
size, 119 nt) (band
a), from the 5' end to +21 (predicted size, 81 nt)
(band b), and
from +22 to +58 (predicted size, 37 nt) (band c).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Rnt1p cleaves the 3' end of the U3 precursor. (A)
Mapping of the in vitro Rnt1p cleavage sites. Primer extension was
performed with probe 253 on the model U3( 60/+139) RNA incubated with
buffer (lane 6) or recombinant His6-Rnt1p (lane 5) as
described in Materials and Methods. DNA sequencing reaction on a PCR
product encompassing the 3' end of U3 from positions 60 to +139,
using the same primer, was run in parallel (lanes 1 to 4). The primer
extension stops at positions +22 and +59 are indicated. (B) In vitro
cleavage of an internally labeled model U3( 60/+177) RNA substrate by
Rnt1p. 32P-labeled U3( 60/+177) RNA was incubated at
23°C in the following conditions: lane 2, Rnt1p buffer; lanes 3 to 5, Rnt1p buffer with 10 ng of recombinant His6-Rnt1p for the
times indicated; lane 6, with whole-cell extract from a wild-type (WT)
strain of yeast; lane 7, with whole-cell extract from an
rnt1- strain. Lanes 1 and 8, RNA size markers. The
positions of DNA size markers are indicated on the right in
nucleotides. The obtained cleavage products are labeled a to c on the
left, and the predicted origins of these species are as follows: S,
substrate (237 nt); a, 3' end of transcript to position +21/+22 (119 nt); b, 5' end of transcript to position +58/+59 (81 nt); c, positions
+21/+22 to +58/+59 (37 nt). Since in vitro cleavages of U3( 60/+177)
are complete (100%), no intermediate cleav- age products are visible. (C) Mapping of the Rnt1p 5'
cleavage site in vitro. Primer extension analysis through the 3' end of
the pre-U3 was performed with primer 252, hybridizing downstream of
position +177. RNA was extracted from wild-type (lane 7) and
rnt1- (lane 6) strains grown at 30°C and from a
rat1-1 strain following transfer to 37°C for 2 h
(lane 5). DNA sequencing reactions were run in parallel (lanes 1 to 4).
The primer extension stops at positions +59, +22, and +1 (3' end of U3)
are indicated. (D) Computer-predicted RNA structure in the U3 3'
flanking region that contains the Rnt1p cleavage sites. The cleavage
sites between nt +21 and +22 and between nt +58 and +59 are indicated
by arrows. The 3' end of mature U3 is underlined.
|
|
The 3' fragments generated by Rnt1p cleavage of the pre-U4 snRNA and
the pre-rRNA are strongly stabilized by mutation of the
nuclear 5'

3'
exonuclease Rat1p (
5,
28), indicating that
it normally
degrades these regions. The sites of in vivo cleavage
of pre-U3 were
identified by primer extension using probe 252,
which hybridizes in the
SNR17A flanking sequence 3' to the stem-loop
structure. In
the
rat1-1 strain (Fig.
2C, lane 5), primer extension
stops
were observed at +22 and +59, identical to the in vitro
cleavage sites.
These were absent from RNA extracted from the
rnt1-

strain (Fig.
2C, lane 6) but were also not detectable in
the wild-type
strain (Fig.
2C, lane 7). The stop corresponding
to the position of the
3' end of mature U3 may be a consequence
of the stem structure at this
position. The level of this stop
is unaltered in the
rat1-1
strain, suggesting that it is not a
cleavage site. We cannot, however,
exclude the possibility that
a fraction of U3 is processed by
endonucleolytic cleavage at the
mature 3' end. RNase MRP was shown not
to be involved in this
process (data not
shown).
We conclude that Rnt1p cleaves the 3' extended pre-U3 at +21/+22 and
+58/+59. Following cleavage the 3' fragment is degraded
by Rat1p. The
level of the mature U3 is reduced in strains lacking
Rnt1p, indicating
that this is normally the major synthesis
pathway.
The major 3'-extended forms of U3 do not extend to the Rnt1p
cleavage sites.
High-resolution Northern hybridization showed that
the U3-3'I band was too small to extend to the Rnt1p cleavage sites,
and even the larger U3-3' II species appeared to be slightly smaller than expected. The 3' ends of these species were therefore determined by RNase protection. For this, the region of SNR17A from 295 to +36 was amplified by PCR using a primer that incorporated a T7 promoter (see Materials and Methods). In addition to the band corresponding to the mature 3' end of U3, two major protected fragments
were detected in RNA from the wild-type strain (Fig. 3A, lane 3) but were absent from the
rnt1-
strain (Fig. 3A, lane 4). The sizes to these bands
correspond to species that extend to U3+12 and U3+18, in good agreement
with the gel mobilities of the U3-3'I and U3-3'II RNAs, respectively.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 3.
Mapping of the 3'-extended forms of U3 by RNase
protection. (A) RNA was extracted from wild-type (WT),
rnt1- , and lhp1- strains grown at 30°C
and from GAL::rrp41 and
GAL::rrp41/rnt1- strains following transfer
from permissive, RSG medium to repressive, glucose medium at 30°C for
24 and 48 h, respectively. Total E. coli tRNA was used
as a control RNA. Positions of the Rnt1p-dependent protected species at
+12 and +18 are indicated. (B) Schematic of the U3 3' flanking region
showing the ends of the protected regions and the Rnt1p cleavage
sites.
|
|
We conclude that following Rnt1p cleavage, the pre-U3 undergoes rapid
trimming back to +12 and +18.
The major 3'-extended forms of U3 are stabilized by Lhp1p.
It
seemed very likely that some RNA binding factor was responsible for
stabilizing the 3' ends of the U3-3'I and -II species. Inspection of
the sequence showed that these RNAs possessed 3' poly(U) tracts (Fig.
3B). The 3' poly(U) tracts of RNAs transcribed by RNA polymerase III
are bound by the La protein (42, 48), as are the 3' extended
precursors to human U1 (34) and yeast (58)
snRNAs. We therefore tested whether the U3-3'I and -II RNAs were being
stabilized by binding to Lhp1p, the yeast homologue of La (39,
59).
The
LHP1 gene is nonessential (
59), and a gene
disruption was performed by a one-step PCR approach (
10)
using the
K. lactis URA3 marker (see Materials and Methods).
RNase protection analysis
of RNA from the
lhp1-

strain
showed the loss of the major 3'-extended
ends at +18 and +12 and the
appearance of shorter, heterogeneous
protected fragments corresponding
to RNAs from U3+8 to U3+11 (Fig.
3A, lane 7). This result was confirmed
by Northern hybridization
(Fig.
4). The
U3-3'II and U3-3'I species were absent from the
lhp1-

strain (Fig.
4A), and a species slightly shorter than U3-3'I
was
detected. The level of mature U3 was unaffected in the
lhp1-
strain (Figs.
3A and
4B), as were the levels of the
truncated
U3 degradation intermediates seen in wild-type cells (see
Fig.
6; data not shown). These data suggested that both U3-3'I and
U3-3'II were stabilized by binding Lhp1p.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
3'-extended forms of U3 are stabilized by Lhp1p. Lane 1, LHP1 strain; lane 2, lhp1- strain. Total RNA
was analyzed by Northern hybridization with probe 251, specific for the
3'-extended U3 (A), probe 200, which hybridizes to the mature U3 (B),
and probe 250, which hybridizes to scR1 RNA (C).
|
|
To confirm this, a C-terminal fusion between Lhp1p and two copies of
the Z domain of
S. aureus protein A was constructed and
integrated at the chromosomal
LHP1 locus by a one-step PCR
approach
(
29) (see Materials and Methods). Western blotting
confirmed
that the fusion protein was expressed and could be
efficiently
immunoprecipitated with IgG agarose (data not shown).
Immunoprecipitation
was performed on two independently isolated
Lhp1p-ProtA strains;
data are presented for only one strain in Fig.
5. Processing of
pre-tRNA
Tyr
appeared to be the same in the strain expressing only Lhp1p-ProtA
and
the wild type (Fig.
5D); however, some accumulation of the
shorter
3'-extended pre-U3 species was visible (Fig.
5A), suggesting
that the
Lhp1p-ProtA fusion protein is underexpressed or otherwise
not fully
functional.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
3'-extended forms of U3 are coprecipitated with
Lhp1p-ProtA. Lysates from the LHP1+ and
LHP1::ProtA strains were immunoprecipitated using
IgG agarose. RNA was recovered from the total cell lysate (T), immune
supernatant (S), and immunoprecipitate (P) and analyzed by Northern
hybridization. Probes are indicated in parentheses and described in
Materials and Methods. On prolonged exposure, background precipitation
of mature U3 is seen for both the wild-type and Lhp1-ProtA strains
(lanes 7 and 8). In panel B, the total and supernatant lanes were
heavily overexposed at the exposure needed to visualize the U3-int 3'
and U3-3'III RNAs and were omitted. Approximately fourfold more cell
equivalents are loaded for the bound material.
|
|
As expected, the tRNA
Tyr primary transcript (Fig.
5D) and
the U6 snRNA (Fig.
5E) were immunoprecipitated on IgG agarose from
the
strain expressing Lhp1p-ProtA (lane 6) but not from the wild
type (lane
3). Both U3-3'I and U3-3'II were coprecipitated with
Lhp1p-ProtA (Fig.
5A), as were U3-int 3' and a species of approximately
800 nt designated
U3-3'III (Fig.
5B). The species shorter than
U3-3'I seen in the
Lhp1p-ProtA strain was not coprecipitated and
remained in the immune
supernatant (Fig.
5A, lane 5). Mature U3
(Fig.
5B and C) and the 3'
processed, intron-containing pre-tRNA
Tyr (Fig.
5D) were
recovered at the same low levels in the wild-type
and Lhp1-ProtA
precipitates. The pre-U3 and pre-tRNA species were
more efficiently
precipitated than U6, presumably because only
the newly synthesized U6
is associated with Lhp1p (
35,
39).
We conclude that Lhp1p binds and stabilizes the major 3'-extended forms
of
U3.
The exosome participates in 3' processing of U3.
The levels of
3'-extended precursors to other snoRNAs and snRNAs are elevated in
strains carrying mutations in the exosome complex (5, 55).
To assess the effects of genetic depletion of exosome components on the
3'-extended forms of U3, Rrp41p and Rrp45p were depleted by transfer of
GAL::rrp41 and GAL::rrp45 strains
(6, 36) from permissive RSG medium (0-h samples) to
repressive, glucose medium for the times indicated. A strain deleted
for the gene encoding the Rrp6p component of the exosome (6)
was also analyzed. In the strains lacking Rrp41p (Fig. 6A and
C, lanes 5), Rrp45p (lanes 10), or Rrp6p
(lanes 2), the levels of U3-3'I and U3-3'II were higher than in the
isogenic wild-type control strains (lanes 3 and 14); these results are quantitated in Table 2. For the GAL::rrp41 strain,
this increase was confirmed by RNase protection (Fig. 3A, lane 4),
which showed that the accumulated precursors were identical to U3-3'I
and -II. Rrp41p is underexpressed in the
GAL::rrp41 strain in RSG medium and therefore
shows some accumulation of the extended species in the 0-h sample
(6, 36). In strains genetically depleted of other exosome
components, Rrp4p, Rrp40p, Rrp46p, or Csl4p, increased levels of U3-3'I
and -II were also observed (data not shown). In addition, an RNA
species that comigrated with the U3-3'III RNA, seen on Lhp1p-ProtA
precipitation (Fig. 5), was accumulated in the exosome mutants. On
prolonged exposure, this species could also be detected at low levels
in wild-type cells. Depletion of the exosome components did not lead to
depletion of the mature U3. Indeed, as was previously observed for the
U4 and U5 snRNAs, depletion of exosome components led to an increase in
the mature U3 snoRNA of approximately twofold (Table 2).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 6.
Northern analysis of processing of U3 snoRNA in exosome
mutants. RNA was extracted from strains carrying
GAL-regulated constructs following transfer from permissive,
RSG medium to repressive, glucose medium at 30°C for the times
indicated, or from the wild-type (WT), rnt1- ,
rrp6- , and rnt1- /rrp6- strains grown on
glucose medium at 30°C. RNA was separated on an 6% polyacrylamide
gel and hybridized with oligonucleotide probes. The panels show
successive hybridization of the same filter. Probes are indicated in
parentheses on the left and described in Materials and Methods; the
positions of RNA species detected are indicated on the right. Panel C
presents a weaker exposure of the same gel as panel A. Panels B to E
present only relevant regions of the Northern blots. The amount of
total RNA loaded in lane 16 is fourfold greater than in lane 15 and
other lanes. The positions of migration of scR1 (525 nt) and P (369 nt)
RNAs determined by hybridization of the same filter are indicated as
size markers. Mature U3 is 333 nt.
|
|
In strains lacking exosome components, the 3' processed,
intron-containing precursor is clearly detected. This is most visible
for Rrp6p (Fig.
6B, lane 2) but was also seen for several other
exosome
mutants (Fig.
6B and data not shown). This species is
not detected in
the wild type, and we speculate that this processing
intermediate is
normally a dead-end product that is degraded by
the exosome. 3'
processing appears to be dependent on snoRNP protein
binding, but
assembly with the mature snoRNP proteins may be incompatible
with
assembly of a functional spliceosome. The exosome also degrades
other
stalled, intron-containing pre-mRNAs (C. Bousquet-Antonelli,
C. Presutti, and D. Tollervey, submitted for
publication).
The combination of the deletion of both
RNT1 and
RRP6 (Fig.
6, lane 1) partially restored synthesis of
species with the same
gel mobility as the U3-3'I and U3-3'II RNAs.
Depletion of Rrp41p
or Rrp45p from the strain lacking Rnt1p (Fig.
6A
and C, lanes
7, 8, 12, and 13) led to the appearance of heterogeneous
RNA species
slightly smaller than U3-3'I, similar in size to the
species seen
in the
lhp1-

strain (Fig.
4). Consistent
with this, RNase protection
analysis in the
GAL::rrp41/rnt1-

strain reveals a ladder of
protected
RNA fragments extending from mature U3 to position U3+12
(Fig.
3A, lane 6); due to the location of the hybridization probe, only
the longer RNAs were detected by Northern hybridization (Fig.
6). A
stronger ladder of RNA species extending up to the position
of U3-3'III
was observed by Northern hybridization (Fig.
6, lanes
7, 8, 12, and
13), which was reflected by the strong protection
of the full-length
antisense probe (Fig.
3A, lane 6). The combination
of each of exosome
mutations with
rnt1-

partially restored the
mature U3
levels compared to the
rnt1-

single mutant strain (Table
2).
We conclude that the exosome complex of 3'

5' exonucleases
participates in the 3' processing of U3. This processing pathway
closely resembles that of the U1, U4, and U5 snRNAs (
5,
14,
45,
55). In each case, synthesis of the mature RNA continues
in
strains depleted of single components of the exosome, indicating
either
that different components of the complex are partially
functionally
redundant or that other exonucleases can largely
substitute for the
exosome.
The level of the mature U3 is elevated in the exosome mutants,
indicating competition between the synthetic pathway and degradation
of
the pre-U3. This was also seen for the U4 and U5 snRNAs (
5).
Consistent with this model, a truncated U3 species (U3**) was
observed
in wild-type strains (Fig.
7, lanes 1 and
12) (
24,
35). The U3** species was 5' and 3' truncated, as
shown by its
failure to hybridize to probes directed against either the
3'
end of U3 (Fig.
7B) or the 5' end of U3 (Fig.
7C). In contrast,
the
U3* species that is accumulated in
rrp6-

,
GAL::rrp41, and
GAL::rrp45
strains was truncated only at the 5' end, indicating
that U3 is
normally 3' degraded by the exosome. The level of U3*
is further
elevated in exosome mutants that also lack Rnt1p, consistent
with the
model that degradation of pre-U3 is increased in
rnt1-
strains. The 5' degradation activity has not been further characterized
but is likely due to the 5'

3' exonuclease Rat1p, which 5' processes
other snoRNAs and degrades pre-rRNA spacer fragments (
41).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 7.
Exosome components participate in the degradation of U3
snoRNA. For Northern analysis of U3 snoRNA in wild-type (WT) and
rnt1- and exosome mutant strains. RNA was extracted as
described for Fig. 2, separated on an 6% polyacrylamide gel, and
hybridized with oligonucleotide probes. The panels show successive
hybridization of the same filter. Probes are indicated in parentheses
on the left and described in Materials and Methods; the positions of
RNA species detected are indicated on the right. The amount of total
RNA loaded in lane 14 is fourfold greater than in lane 13 and other
lanes. The positions of migration of snRNA190 (190 nt), U5L
(215 nt), and snR10 (246 nt) determined by hybridization of the same
filter are indicated as size markers. Mature U3 is 333 nt. The
locations of the oligonucleotide probes and the predicted structures of
the degradation intermediates are shown schematically.
|
|
In strains lacking Rnt1p, 3' extended forms of U1 and U2 snRNAs undergo
a low level of polyadenylation (
1,
45), and the
precursors
to several snRNAs and snoRNAs are polyadenylated in
exosome mutants
(
5,
55). To determine whether this was also
the case for the
3'-extended U3, RNA was treated in vitro with
oligo(dT) and RNase H. Following this deadenylation treatment,
the longer 3'-extended species
detected in the
rnt1-
/GAL::rrp41 strain became
shorter and more discrete (data not shown), indicating
that a low level
of polyadenylation had indeed
occurred.
 |
DISCUSSION |
How is U3 processed?
A model for 3' processing of the U3A
snoRNA is presented in Fig. 8. We
postulate that processing is normally initiated by cotranscriptional
cleavage by Rnt1p across a stem structure at positions +21 and +58 with
respect to the 3' end of U3. The released 3' fragment is degraded by
the 5'
3' exonuclease Rat1p, as shown by its accumulation in the
rat1-1 strain. The 3' extended pre-snoRNA is rapidly
processed to +12 and +18, since the species extended to +21 is not
readily detected in total RNA. The products of Rnt1p cleavage of pre-U4
and pre-U5 are elevated in strains deleted for components of the
exosome (5), and we think it probable that the exosome
complex also carries out the initial shortening of the pre-U3. We
cannot, however, exclude the participation of other exonucleases, such
as the Rex1-3p family that carry out the final trimming of several
small RNA species (54). The pre-U3 is stabilized against
further 3' degradation by binding of Lhp1p to the 3' poly(U) tracts at
+19 and +13; whether Lhp1p binds to internal poly(U) tracts prior to
the start of digestion, or binds to free 3' poly(U) tracts generated
during digestion, cannot be determined at present. The larger U3-3'III
species is bound by Lhp1p, suggesting that Lhp1p does bind to internal
poly(U) sequences prior to processing, but the endpoints of this have
not been mapped and we cannot exclude the possibility that it has a
terminal poly(U) tract. It is likely that the poly(U) tracts at +19 and
+13 can each bind Lhp1p, although binding may be mutually exclusive.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
Model for the 3' processing of the U3A snoRNA. The
presence of the poly(U) tracts and stem-loop structure in the 3'
flanking sequence and the intron are indicated. For simplicity, only
one poly(U) tract is indicated. In reality, two tracts are present, at
+19 and +13, each of which is likely to act as a binding site for
Lhp1p. The activity that carries out the initial trimming to +18 and
+12 has not been determined but is likely to be the exosome. The
endpoints of the U3-int 3' species have not been determined, but the
finding that these species are associated with Lhp1p suggests that they
are processed to +18 and +12.
|
|
The box C+D snoRNAs, including U3, bind a set of common proteins,
Nop1p, Nop56p, and Nop58p (
13,
30-32,
40,
44,
53)
that
probably bind to the box D sequence close to the 3' end of
the snoRNA
and the 3'-terminal stem (
13,
57). These proteins
are not
associated with the 3'-extended U3 species, and we propose
that their
binding displaces Lhp1p from the 3' flanking sequence.
Since the snoRNP
proteins bind at the very 3' end of the snoRNA,
this displacement may
be steric. Removal of Lhp1p is envisaged
to allow the exosome to resume
processing, generating the mature
snoRNA 3' end. This is followed by
cap trimethylation; in vertebrates
this snoRNA modification requires
the conserved box C+D snoRNAs
(
50), probably acting via
binding the mature snoRNP proteins.
The yeast U3 genes are unusual in
that they contain an intron
that is excised by the normal pre-mRNA
splicing machinery. In
wild-type cells this is spliced from the
3'-extended pre-U3, since
only the 3'-extended, intron-containing
species is detected. The
endpoints of the U3-int 3' species have not
been determined, but
these species are associated with Lhp1p,
suggesting that they
may have been largely processed to +18 and +12.
Deletion of Rnt1p strongly reduces synthesis of mature U3 (Table
2).
Processing of the long 3'-extended pre-U3 species generated
in the
absence of Rnt1p cleavage involves the exosome, as shown
by their
increased levels in
rnt1-

strains lacking exosome
components.
We speculate that a processive exosome complex assembles on
the
long 3'-extended pre-U3, which is able to substantially displace
bound Lhp1p and/or the snoRNP proteins and therefore degrades
most of
the pre-U3 population. Consistent with this model, depletion
of exosome
components from
rnt1-

strains restored mature U3 to
the
wild-type level (Table
2).
In the absence of Lhp1p, the U3 snoRNA was still 3' processed. The
U3-3'I and U3-3'II species were absent but slightly smaller,
heterogeneous species were observed, indicating that some other
factor(s) can also bind the 3' poly(U) tract. An obvious candidate
is
the Lsm complex, which binds to the 3' poly(U) tract of the
U6 snRNA
and is required for normal 3' processing of the RNase
P RNA (
3,
17,
35,
43). Consistent with this model, mutations
in Lsm8p were
lethal in combination with the deletion of
LHP1 (
39).
In otherwise wild-type strains, depletion of exosome components
increased the mature U3 level by inhibiting a 3' degradation
pathway
that generates the truncated U3** intermediate, indicating
competition
between the synthetic and degradative pathways during
normal U3
synthesis. Similar observations have been reported for
the U4 and U5
snRNAs (
5).
The processing pathway deduced here for yeast U3 shows similarities to
the processing pathways proposed for the U1, U2, U4,
and U5
spliceosomal snRNAs. In each case, downstream cleavage
by Rnt1p is
thought to act as an entry for the exonucleases (
1,
5,
14,
45). For U1, U4, and U5, this processing was also
shown to
involve the exosome complex (
5,
55); this has not
been
addressed for U2. Also in each case, shorter 3' extended
species
normally accumulate as transient intermediates, although
their 3' ends
have not yet been accurately mapped. In the case
of pre-U4 and pre-U5,
the Rnt1p cleavage products are 3' processed
by the exosome complex and
then trimmed to the mature RNAs by
the Rex1-3p family of exonucleases
together with the Rrp6p exosome
component (
54). Other box
C+D snoRNAs are 3' trimmed by Rrp6p
(
5), but this is not the
case for
U3.
Inspection of the 3' flanking sequences reveals that poly(U) tracts are
present in the 3' flanking sequences of the U1, U2,
U4, and U5 snRNA
genes (Fig.
9). In each case, the Rnt1p
cleavage
site is adjacent to a poly(U) tract (Fig.
9A). For the U2, U3,
and U5L RNAs, the mature RNA regions (uppercase in Fig.
9A) are
located
relatively close to the Rnt1p cleavage site, with additional
poly(U)
tracts between the Rnt1p cleavage site and the mature
3' end. The
mature regions of U1, U4, and U5S are more distant,
and their 3' ends
are located within a further poly(U) tract (Fig.
9B). Lhp1p is
associated with yeast pre-U1, U2, U4, and U5 (
58).
However,
in contrast to the model presented here for U3, Lhp1p
is proposed to
function as a cofactor for the assembly of the
spliceosomal snRNAs with
the Sm proteins. The human and plant
U3 snoRNAs also have 3' flanking
poly(U) tracts, suggesting that
this feature may be conserved
throughout eukaryotes (
27,
49).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 9.
Comparison of the 3' flanking sequence of U3A to those
of the U1, U2, U4, and U5 snRNAs. In panel A, the Rnt1p cleavage sites
(\) have been aligned. The mature regions of U3, U2, and U5L are in
uppercase. For U1, U4, and U5S, the mature regions are further from the
Rnt1p cleavage site. These are aligned in the panel B. Poly(U)
sequences of four or more residues are underlined.
|
|
Why is U3 processed?
The 3' ends of almost all RNAs from all
organisms are generated by 3' processing rather than transcription
termination, but the reasons for this have largely remained obscure.
The data presented here provide a possible explanation, at least for
U3. The binding sites for the common snoRNP proteins, the box D element
and the terminal stem structure, define the 3' end of the mature U3
snoRNA. Transcription termination at this site would generate an RNA
with a monomethylguanosine cap structure and lacking the snoRNP
proteins. This could not readily be distinguished from the products of
premature termination or failed pre-mRNA splicing. It is likely that
these are normally very rapidly degraded by the exosome complex and Rat1p (C. Bousquet-Antonelli, C. Presutti, and D. Tollervey,
unpublished data). Delaying or reducing these degradative activities
might allow sufficient time for snoRNP assembly and cap trimethylation, but at the expense of allowing greater accumulation of aberrant RNAs.
Such a strategy might also allow a greater level of accidental protection of inappropriate RNA species by RNA-binding proteins. Instead, the cell has adopted a mechanism to specifically delay 3'
processing of the snoRNA. Transcription continues beyond the 3' end of
the mature snoRNA, with the transcript normally being cleaved by Rnt1p
and protected by binding of Lhp1p. This leaves the mature 3' end free
for binding of the snoRNP proteins. Such a system has the additional
advantage of acting as a quality control system. We envisage that the
snoRNP proteins, or at least Nop58p, must displace Lhp1p to allow final
maturation of the snoRNA. In the absence of Nop58p binding, the 3'
extended pre-U3 accumulates to low levels and is then degraded. Binding
of La to pre-tRNAs has also been proposed to function as a quality
control system (19), and binding of Lhp1p to the U6 snRNA
and pre-tRNAiMet is also likely to antagonize rapid 3'
degradation (8, 39).
We propose that 3' processing acts as a quality control system in the
synthesis of many RNA species and that this underlies
its ubiquitous
occurrence.
 |
ACKNOWLEDGMENTS |
We thank Bertrand Séraphin (EMBL) for the cloned K. lactis URA3 gene and R. Lührmann for the kind gift of R1131
antibodies. J.K. was the recipient of a long-term EMBO fellowship. This
work was supported by the Wellcome Trust.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Wellcome Trust
Centre for Cell Biology, ICMB, Swann Building, King's Buildings, The University of Edinburgh, Edinburgh EH9 3JR, Scotland. Phone: 44 131 650 7092. Fax: 44 131 650 7040. E-mail:
d.tollervey{at}ed.ac.uk.
Present address: Department of Chemistry and Biochemistry,
University of California, Los Angeles, CA 90095-1569.
 |
REFERENCES |
| 1.
|
About Elela, S., and M. Ares, Jr.
1998.
Depletion of yeast RNase III blocks correct U2 3' end formation and results in polyadenylated but functional U2 snRNA.
EMBO J.
17:3738-3746[CrossRef][Medline].
|
| 2.
|
Abou Elela, S.,
H. Igel, and M. Ares, Jr.
1996.
RNase III cleaves eukaryotic preribosomal RNA at a U3 snoRNP-dependent site.
Cell
85:115-124[CrossRef][Medline].
|
| 3.
|
Achsel, T.,
H. Brahms,
B. Kastner,
A. Bachi,
M. Wilm, and R. Lührmann.
1999.
A doughnut-shaped heteromer of human Sm-like proteins binds to the 3'-end of U6 snRNA, thereby facilitating U4/U6 duplex formation in vitro.
EMBO J.
18:5789-5802[CrossRef][Medline].
|
| 4.
|
Ali, N., and A. Siddiqui.
1997.
The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation.
Proc. Natl. Acad. Sci. USA
94:2249-2254[Abstract/Free Full Text].
|
| 5.
|
Allmang, C.,
J. Kufel,
G. Chanfreau,
P. Mitchell,
E. Petfalski, and D. Tollervey.
1999.
Functions of the exosome in rRNA, snoRNA and snRNA synthesis.
EMBO J.
18:5399-5410[CrossRef][Medline].
|
| 6.
|
Allmang, C.,
E. Petfalski,
A. Podtelejnikov,
M. Mann,
D. Tollervey, and P. Mitchell.
1999.
The yeast exosome and human PM-Scl are related complexes of 3'->5' exonucleases.
Genes Dev.
13:2148-2158[Abstract/Free Full Text].
|
| 7.
|
Amberg, D. C.,
A. L. Goldstein, and C. N. Cole.
1992.
Isolation and characterization of RAT1: an essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA.
Genes Dev.
6:1173-1189[Abstract/Free Full Text].
|
| 8.
|
Anderson, J.,
L. Phan,
R. Cuesta,
B. A. Carlson,
M. Pak,
K. Asano,
G. R. Bjork,
M. Tamame, and A. G. Hinnebusch.
1998.
The essential Gcd10p-Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA.
Genes Dev.
12:3650-3662[Abstract/Free Full Text].
|
| 9.
|
Anderson, J. S. J., and R. P. Parker.
1998.
The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SK12 DEVH box protein and 3' to 5' exonucleases of the exosome complex.
EMBO J.
17:1497-1506[CrossRef][Medline].
|
| 10.
|
Baudin, A.,
O. Ozier-Kalogeropoulos,
A. Denouel,
F. Lacroute, and C. Cullin.
1993.
A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:3329-3330[Free Full Text].
|
| 11.
|
Beltrame, M., and D. Tollervey.
1995.
Base-pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis.
EMBO J.
14:4350-4356[Medline].
|
| 12.
|
Beltrame, M., and D. Tollervey.
1992.
Identification and functional analysis of two U3 binding sites on yeast pre-ribosomal RNA.
EMBO J.
11:1531-1542[Medline].
|
| 13.
|
Caffarelli, E.,
M. Losito,
C. Giorgi,
A. Fatica, and I. Bozzoni.
1998.
In vivo identification of nuclear factors interacting with the conserved elements of box C/D small nucleolar RNAs.
Mol. Cell. Biol.
18:1023-1028[Abstract/Free Full Text].
|
| 14.
|
Chanfreau, G.,
S. A. Elela,
M. Ares, Jr., and C. Guthrie.
1997.
Alternative 3'-end processing of U5 snRNA by RNase III.
Genes Dev.
11:2741-2751[Abstract/Free Full Text].
|
| 15.
|
Chanfreau, G.,
P. Legrain, and A. Jacquier.
1998.
Yeast RNase III as a key processing enzyme in small nucleolar RNAs metabolism.
J. Mol. Biol.
284:975-988[CrossRef][Medline].
|
| 16.
|
Chanfreau, G.,
G. Rotondo,
P. Legrain, and A. Jacquier.
1998.
Processing of a dicistronic small nucleolar RNA precursor by the RNA endonuclease Rnt1.
EMBO J.
17:3726-3737[CrossRef][Medline].
|
| 17.
|
Cooper, M.,
L. H. Johnston, and J. D. Beggs.
1995.
Identification and characterization of Uss1p (Sdb23p): a novel U6 snRNA-associated protein with significant similarity to core proteins of small nuclear ribonucleoproteins.
EMBO J.
14:2066-2075[Medline].
|
| 18.
|
Decker, C. J., and R. Parker.
1993.
A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation.
Genes Dev.
7:1632-1643[Abstract/Free Full Text].
|
| 19.
|
Fan, H.,
J. L. Goodier,
J. R. Chamberlain,
D. R. Engelke, and R. J. Maraia.
1998.
5' processing of tRNA precursors can be modulated by the human La antigen phosphoprotein.
Mol. Cell. Biol.
18:3201-3211[Abstract/Free Full Text].
|
| 20.
|
Gautier, T.,
T. Bergès,
D. Tollervey, and E. Hurt.
1997.
The nucleolar KKE/D repeat proteins Nop56p and Nop58p interact with Nop1p and are required for ribosome biogenesis.
Mol. Cell. Biol.
17:7088-7098[Abstract].
|
| 21.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 22.
|
Goodall, G. J.,
K. Wiebauer, and W. Filipowicz.
1990.
Analysis of pre-mRNA processing in transfected plant protoplasts.
Methods Enzymol.
181:148-161[Medline].
|
| 23.
|
Heise, T.,
L. G. Guidotti, and F. V. Chisari.
1999.
La autoantigen specifically recognizes a predicted stem-loop in hepatitis B virus RNA.
J. Virol.
73:5767-5776[Abstract/Free Full Text].
|
| 24.
|
Hughes, J. M. X., and M. J. Ares.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 25.
|
Hughes, J. M. X.,
D. A. M. Konings, and G. Cesareni.
1987.
The yeast homologue of U3 snRNA.
EMBO J.
6:2145-2155[Medline].
|
| 26.
|
Jansen, R.,
D. Tollervey, and E. C. Hurt.
1993.
A U3 snoRNP protein with homology to splicing factor PRP4 and G domains is required for ribosomal RNA processing.
EMBO J.
12:2549-2558[Medline].
|
| 27.
|
Kiss, T.,
C. Marshallsay, and W. Filipowicz.
1991.
Alteration of the RNA polymerase specificity of U3 snRNA genes during evolution and in vitro.
Cell
65:517-526[CrossRef][Medline].
|
| 28.
|
Kufel, J.,
B. Dichtl, and D. Tollervey.
1999.
Yeast Rnt1p is required for cleavage of the pre-ribosomal RNA in the 3' ETS but not the 5' ETS.
RNA
5:909-917[Abstract].
|
| 29.
|
Lafontaine, D., and D. Tollervey.
1996.
One-step PCR mediated strategy for the construction of conditionally expressed and epitope tagged yeast proteins.
Nucleic Acids Res.
24:3469-3472[Abstract/Free Full Text].
|
| 30.
|
Lafontaine, D. L. J., and D. Tollervey.
1999.
Nop58p is a common component of the box C+D snoRNPs that is required for stability of the snoRNAs.
RNA
5:455-467[Abstract].
|
| 31.
|
Lafontaine, D. L. J., and D. Tollervey.
2000.
Synthesis and assembly of the box C+D small nucleolar RNPs.
Mol. Cell. Biol.
20:2650-2659[Abstract/Free Full Text].
|
| 32.
|
Lischwe, M. A.,
R. L. Ochs,
R. Reddy,
R. G. Cook,
L. C. Yeoman,
E. M. Tan,
M. Reichlin, and H. Busch.
1985.
Purification and partial characterization of a nucleolar scleroderma antigen (Mr=34,000; pI, 8.5) rich in NG, NG-dimethylarginine.
J. Biol. Chem.
260:14304-14310[Abstract/Free Full Text].
|
| 33.
|
Lygerou, Z.,
P. Mitchell,
E. Petfalski,
B. Séraphin, and D. Tollervey.
1994.
The POP1 gene encodes a protein component common to the RNase MRP and RNase P ribonucleoproteins.
Genes Dev.
8:1423-1433[Abstract/Free Full Text].
|
| 34.
|
Madore, S. J.,
E. D. Wieben, and T. Pederson.
1984.
Eukaryotic small ribonucleoproteins. Anti-La human autoantibodies react with U1 RNA-protein complexes.
J. Biol. Chem.
259:1929-1933[Abstract/Free Full Text].
|
| 35.
|
Mayes, A. E.,
L. Verdone,
P. Legrain, and J. D. Beggs.
1999.
Characterization of Sm-like proteins in yeast and their association with U6 snRNA.
EMBO J.
18:4321-4331[CrossRef][Medline].
|
| 36.
|
Mitchell, P.,
E. Petfalski,
A. Shevchenko,
M. Mann, and D. Tollervey.
1997.
The exosome; a conserved eukaryotic RNA processing complex containing multiple 3' 5' exoribonuclease activities.
Cell
91:457-466[CrossRef][Medline].
|
| 37.
|
Mitchell, P.,
E. Petfalski, and D. Tollervey.
1996.
The 3'-end of yeast 5.8S rRNA is generated by an exonuclease processing mechanism.
Genes Dev.
10:502-513[Abstract/Free Full Text].
|
| 38.
|
Myslinski, E.,
V. Ségault, and C. Branlant.
1990.
An intron in the genes for U3 small nucleolar RNAs of the yeast Saccharomyces cerevisiae.
Science
247:1213-1216[Abstract/Free Full Text].
|
| 39.
|
Pannone, B. K.,
D. Xue, and S. L. Wolin.
1998.
A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts.
EMBO J.
17:7442-7453[CrossRef][Medline].
|
| 40.
|
Parker, K. A., and J. A. Steitz.
1987.
Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.
Mol. Cell. Biol.
7:2899-2913[Abstract/Free Full Text].
|
| 41.
|
Petfalski, E.,
T. Dandekar,
Y. Henry, and D. Tollervey.
1998.
Processing of the precursors to small nucleolar RNAs and rRNAs requires common components.
Mol. Cell. Biol.
18:1181-1189[Abstract/Free Full Text].
|
| 42.
|
Rinke, J., and J. A. Steitz.
1982.
Precursor molecules of both human 5S ribosomal RNA and transfer RNAs are bound by a cellular protein reactive with anti-La lupus antibodies.
Cell
29:149-159[CrossRef][Medline].
|
| 43.
|
Salgado-Garrido, J.,
E. Bragado-Nilsson,
S. Kandels-Lewis, and B. Seraphin.
1999.
Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin.
EMBO J.
18:3451-3462[CrossRef][Medline].
|
| 44.
|
Schimmang, T.,
D. Tollervey,
H. Kern,
R. Frank, and E. C. Hurt.
1989.
A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability.
EMBO J.
8:4015-4024[Medline].
|
| 45.
|
Seipelt, R. L.,
B. Zheng,
A. Asuru, and B. C. Rymond.
1999.
U1 snRNA is cleaved by RNase III and processed through an Sm site-dependent pathway.
Nucleic Acids Res.
27:587-595[Abstract/Free Full Text].
|
| 46.
|
Séraphin, B., and M. Rosbash.
1989.
Identification of functional U1 snRNA-pre-mRNA complexes committed to spliceosome assembly and splicing.
Cell
59:349-358[CrossRef][Medline].
|
| 47.
|
Sharma, K., and D. Tollervey.
1999.
Base pairing between U3 small nucleolar RNA and the 5' end of 18S rRNA is required for pre-rRNA processing.
Mol. Cell. Biol.
19:6012-6019[Abstract/Free Full Text].
|
| 48.
|
Stefano, J. E.
1984.
Purified lupus antigen La recognizes an oligouridylate stretch common to the 3' termini of RNA polymerase III transcripts.
Cell
36:145-154[CrossRef][Medline].
|
| 49.
|
Suh, D.,
H. Busch, and R. Reddy.
1986.
Isolation and characterization of a human U3 small nucleolar RNA gene.
Biochem. Biophys. Res. Commun.
137:1133-1140[CrossRef][Medline].
|
| 50.
|
Terns, M. P.,
C. Grimm,
E. Lund, and J. E. Dahlberg.
1995.
A common maturation pathway for small nucleolar RNAs.
EMBO J.
14:4860-4871[Medline].
|
| 51.
|
Tollervey, D.
1987.
A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA.
EMBO J.
6:4169-4175[Medline].
|
| 52.
|
Tollervey, D., and I. W. Mattaj.
1987.
Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate U-snRNPs.
EMBO J.
6:469-476[Medline].
|
| 53.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 54.
|
van Hoof, A.,
P. Lennertz, and R. Parker.
2000.
Three conserved members of the RNAse D family have unique and overlapping functions in the processing of 5S, 5.8S, U4, U5, RNase MRP and RNase P RNAs in yeast.
EMBO J.
19:1357-1365[CrossRef][Medline].
|
| 55.
|
van Hoof, A.,
P. Lennertz, and R. Parker.
2000.
Yeast exosome mutants accumulate 3'-extended polyadenylated forms of U4 small nuclear RNA and small nucleolar RNAs.
Mol. Cell. Biol.
20:441-452[Abstract/Free Full Text].
|
| 56.
|
Van Horn, D. J.,
C. J. Yoo,
D. Xue,
H. Shi, and S. L. Wolin.
1997.
The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation.
RNA
3:1434-1443[Abstract].
|
| 57.
|
Watkins, N. J.,
D. R. Newman,
J. F. Kuhn, and E. S. Maxwell.
1998.
In vitro assembly of the mouse U14 snoRNP core complex and identification of a 65-kDa box C/D-binding protein.
RNA
4:582-593[Abstract].
|
| 58.
|
Xue, D.,
D. Rubinson,
B. K. Pannone,
C. J. Yoo, and S. L. Wolin.
2000.
U snRNP assembly in yeast involves the La protein.
EMBO J.
19:1650-1660[CrossRef][Medline].
|
| 59.
|
Yoo, C. J., and S. L. Wolin.
1997.
The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors.
Cell
89:393-402[CrossRef][Medline].
|
Molecular and Cellular Biology, August 2000, p. 5415-5424, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Barbezier, N., Canino, G., Rodor, J., Jobet, E., Saez-Vasquez, J., Marchfelder, A., Echeverria, M.
(2009). Processing of a Dicistronic tRNA-snoRNA Precursor: Combined Analysis in Vitro and in Vivo Reveals Alternate Pathways and Coupling to Assembly of snoRNP. Plant Physiol.
150: 1598-1610
[Abstract]
[Full Text]
-
Bousquet-Antonelli, C., Deragon, J.-M.
(2009). A comprehensive analysis of the La-motif protein superfamily. RNA
15: 750-764
[Abstract]
[Full Text]
-
Nykamp, K., Lee, M.-H., Kimble, J.
(2008). C. elegans La-related protein, LARP-1, localizes to germline P bodies and attenuates Ras-MAPK signaling during oogenesis. RNA
14: 1378-1389
[Abstract]
[Full Text]
-
Qiu, H., Eifert, J., Wacheul, L., Thiry, M., Berger, A. C., Jakovljevic, J., Woolford, J. L. Jr., Corbett, A. H., Lafontaine, D. L. J., Terns, R. M., Terns, M. P.
(2008). Identification of Genes That Function in the Biogenesis and Localization of Small Nucleolar RNAs in Saccharomyces cerevisiae. Mol. Cell. Biol.
28: 3686-3699
[Abstract]
[Full Text]
-
Carneiro, T., Carvalho, C., Braga, J., Rino, J., Milligan, L., Tollervey, D., Carmo-Fonseca, M.
(2008). Inactivation of Cleavage Factor I Components Rna14p and Rna15p Induces Sequestration of Small Nucleolar Ribonucleoproteins at Discrete Sites in the Nucleus. Mol. Biol. Cell
19: 1499-1508
[Abstract]
[Full Text]
-
Boulon, S., Marmier-Gourrier, N., Pradet-Balade, B., Wurth, L., Verheggen, C., Jady, B. E., Rothe, B., Pescia, C., Robert, M.-C., Kiss, T., Bardoni, B., Krol, A., Branlant, C., Allmang, C., Bertrand, E., Charpentier, B.
(2008). The Hsp90 chaperone controls the biogenesis of L7Ae RNPs through conserved machinery. JCB
180: 579-595
[Abstract]
[Full Text]
-
Goldfeder, M. B., Oliveira, C. C.
(2008). Cwc24p, a Novel Saccharomyces cerevisiae Nuclear Ring Finger Protein, Affects Pre-snoRNA U3 Splicing. J. Biol. Chem.
283: 2644-2653
[Abstract]
[Full Text]
-
Girard, C., Verheggen, C., Neel, H., Cammas, A., Vagner, S., Soret, J., Bertrand, E., Bordonne, R.
(2008). Characterization of a Short Isoform of Human Tgs1 Hypermethylase Associating with Small Nucleolar Ribonucleoprotein Core Proteins and Produced by Limited Proteolytic Processing. J. Biol. Chem.
283: 2060-2069
[Abstract]
[Full Text]
-
Fleurdepine, S., Deragon, J.-M., Devic, M., Guilleminot, J., Bousquet-Antonelli, C.
(2007). A bona fide La protein is required for embryogenesis in Arabidopsis thaliana. Nucleic Acids Res
35: 3306-3321
[Abstract]
[Full Text]
-
Oeffinger, M., Fatica, A., Rout, M. P., Tollervey, D.
(2007). Yeast Rrp14p is required for ribosomal subunit synthesis and for correct positioning of the mitotic spindle during mitosis. Nucleic Acids Res
35: 1354-1366
[Abstract]
[Full Text]
-
COPELA, L. A., CHAKSHUSMATHI, G., SHERRER, R. L., WOLIN, S. L.
(2006). The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability.. RNA
12: 644-654
[Abstract]
[Full Text]
-
EGECIOGLU, D. E., HENRAS, A. K., CHANFREAU, G. F.
(2006). Contributions of Trf4p- and Trf5p-dependent polyadenylation to the processing and degradative functions of the yeast nuclear exosome. RNA
12: 26-32
[Abstract]
[Full Text]
-
Schilders, G., Raijmakers, R., Raats, J. M. H., Pruijn, G. J. M.
(2005). MPP6 is an exosome-associated RNA-binding protein involved in 5.8S rRNA maturation. Nucleic Acids Res
33: 6795-6804
[Abstract]
[Full Text]
-
BELISOVA, A., SEMRAD, K., MAYER, O., KOCIAN, G., WAIGMANN, E., SCHROEDER, R., STEINER, G.
(2005). RNA chaperone activity of protein components of human Ro RNPs. RNA
11: 1084-1094
[Abstract]
[Full Text]
-
Ghazal, G., Ge, D., Gervais-Bird, J., Gagnon, J., Abou Elela, S.
(2005). Genome-Wide Prediction and Analysis of Yeast RNase III-Dependent snoRNA Processing Signals. Mol. Cell. Biol.
25: 2981-2994
[Abstract]
[Full Text]
-
DE MARCHIS, M. L., GIORGI, A., SCHININA, M. E., BOZZONI, I., FATICA, A.
(2005). Rrp15p, a novel component of pre-ribosomal particles required for 60S ribosome subunit maturation. RNA
11: 495-502
[Abstract]
[Full Text]
-
Horke, S., Reumann, K., Schulze, C., Grosse, F., Heise, T.
(2004). The La Motif and the RNA Recognition Motifs of Human La Autoantigen Contribute Individually to RNA Recognition and Subcellular Localization. J. Biol. Chem.
279: 50302-50309
[Abstract]
[Full Text]
-
Schwartz, E. I., Intine, R. V., Maraia, R. J.
(2004). CK2 Is Responsible for Phosphorylation of Human La Protein Serine-366 and Can Modulate rpL37 5'-Terminal Oligopyrimidine mRNA Metabolism. Mol. Cell. Biol.
24: 9580-9591
[Abstract]
[Full Text]
-
Kufel, J., Bousquet-Antonelli, C., Beggs, J. D., Tollervey, D.
(2004). Nuclear Pre-mRNA Decapping and 5' Degradation in Yeast Require the Lsm2-8p Complex. Mol. Cell. Biol.
24: 9646-9657
[Abstract]
[Full Text]
-
Horke, S., Reumann, K., Schweizer, M., Will, H., Heise, T.
(2004). Nuclear Trafficking of La Protein Depends on a Newly Identified Nucleolar Localization Signal and the Ability to Bind RNA. J. Biol. Chem.
279: 26563-26570
[Abstract]
[Full Text]
-
Inada, M., Guthrie, C.
(2004). Identification of Lhp1p-associated RNAs by microarray analysis in Saccharomyces cerevisiae reveals association with coding and noncoding RNAs. Proc. Natl. Acad. Sci. USA
101: 434-439
[Abstract]
[Full Text]
-
Leary, D. J., Terns, M. P., Huang, S.
(2004). Components of U3 snoRNA-containing Complexes Shuttle between Nuclei and the Cytoplasm and Differentially Localize in Nucleoli: Implications for Assembly and Function. Mol. Biol. Cell
15: 281-293
[Abstract]
[Full Text]
-
FATICA, A., OEFFINGER, M., TOLLERVEY, D., BOZZONI, I.
(2003). Cic1p/Nsa3p is required for synthesis and nuclear export of 60S ribosomal subunits. RNA
9: 1431-1436
[Abstract]
[Full Text]
-
Kufel, J., Allmang, C., Verdone, L., Beggs, J., Tollervey, D.
(2003). A complex pathway for 3' processing of the yeast U3 snoRNA. Nucleic Acids Res
31: 6788-6797
[Abstract]
[Full Text]
-
LEE, C. Y., LEE, A., CHANFREAU, G.
(2003). The roles of endonucleolytic cleavage and exonucleolytic digestion in the 5'-end processing of S. cerevisiae box C/D snoRNAs. RNA
9: 1362-1370
[Abstract]
[Full Text]
-
Fatica, A., Oeffinger, M., Dlakic, M., Tollervey, D.
(2003). Nob1p Is Required for Cleavage of the 3' End of 18S rRNA. Mol. Cell. Biol.
23: 1798-1807
[Abstract]
[Full Text]
-
Kufel, J., Allmang, C., Petfalski, E., Beggs, J., Tollervey, D.
(2003). Lsm Proteins Are Required for Normal Processing and Stability of Ribosomal RNAs. J. Biol. Chem.
278: 2147-2156
[Abstract]
[Full Text]
-
Horke, S., Reumann, K., Rang, A., Heise, T.
(2002). Molecular Characterization of the Human La Protein{middle dot}Hepatitis B Virus RNA.B Interaction in Vitro. J. Biol. Chem.
277: 34949-34958
[Abstract]
[Full Text]
-
Gerbi, S. A., Lange, T. S.
(2002). All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA. Mol. Biol. Cell
13: 3123-3137
[Abstract]
[Full Text]
-
Tomasevic, N., Peculis, B. A.
(2002). Xenopus LSm Proteins Bind U8 snoRNA via an Internal Evolutionarily Conserved Octamer Sequence. Mol. Cell. Biol.
22: 4101-4112
[Abstract]
[Full Text]
-
Maraia, R. J.
(2001). La Protein and the Trafficking of Nascent RNA Polymerase III Transcripts. JCB
153: f13-f18
[Full Text]
-
Pannone, B. K., Do Kim, S., Noe, D. A., Wolin, S. L.
(2001). Multiple Functional Interactions Between Components of the Lsm2-Lsm8 Complex, U6 snRNA, and the Yeast La Protein. Genetics
158: 187-196
[Abstract]
[Full Text]
-
Shay, J. W., Zou, Y., Hiyama, E., Wright, W. E.
(2001). Telomerase and cancer. Hum Mol Genet
10: 677-685
[Abstract]
[Full Text]
-
Dez, C., Henras, A., Faucon, B., Lafontaine, D. L. J., Caizergues-Ferrer, M., Henry, Y.
(2001). Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p. Nucleic Acids Res
29: 598-603
[Abstract]
[Full Text]
-
Maraia, R. J., Intine, R. V. A.
(2001). Recognition of Nascent RNA by the Human La Antigen: Conserved and Divergent Features of Structure and Function. Mol. Cell. Biol.
21: 367-379
[Full Text]
-
GERBI, S.A., BOROVJAGIN, A.V., EZROKHI, M., LANGE, T.S.
(2001). Ribosome Biogenesis: Role of Small Nucleolar RNA in Maturation of Eukaryotic rRNA. Cold Spring Harb Symp Quant Biol
66: 575-590
[Abstract]
-
Brouwer, R., Allmang, C., Raijmakers, R., van Aarssen, Y., Egberts, W. V., Petfalski, E., van Venrooij, W. J., Tollervey, D., Pruijn, G. J. M.
(2001). Three Novel Components of the Human Exosome. J. Biol. Chem.
276: 6177-6184
[Abstract]
[Full Text]