Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5602-5618, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
MCG10, a Novel p53 Target Gene That
Encodes a KH Domain RNA-Binding Protein, Is Capable of Inducing
Apoptosis and Cell Cycle Arrest in G2-M
Jianhui
Zhu and
Xinbin
Chen*
Institute of Molecular Medicine and Genetics,
Medical College of Georgia, Augusta, Georgia 30912
Received 27 January 2000/Returned for modification 15 March
2000/Accepted 8 May 2000
 |
ABSTRACT |
p53, a tumor suppressor, inhibits cell proliferation by inducing
cellular genes involved in the regulation of the cell cycle. MCG10, a novel cellular p53 target gene, was identified in
a cDNA subtraction assay with mRNA isolated from a p53-producing cell line. MCG10 can be induced by wild-type but not mutant p53
and by DNA damage via two potential p53-responsive elements in the promoter of the MCG10 gene. The MCG10 gene
contains 10 exons and is located at chromosome 3p21, a region highly
susceptible to aberrant chromosomal rearrangements and deletions in
human neoplasia. The MCG10 gene locus encodes at least two
alternatively spliced transcripts, MCG10 and MCG10as. The MCG10 and
MCG10as proteins contain two domains homologous to the heterogeneous
nuclear ribonucleoprotein K homology (KH) domain. By generating cell
lines that inducibly express either wild-type or mutated forms of MCG10
and MCG10as, we found that MCG10 and MCG10as can suppress cell
proliferation by inducing apoptosis and cell cycle arrest in
G2-M. In addition, we found that MCG10 and MCG10as, through
their KH domains, can bind poly(C) and that their RNA-binding activity
is necessary for inducing apoptosis and cell cycle arrest. Furthermore,
we found that the level of the poly(C) binding MCG10 protein is
increased in cells treated with the DNA-damaging agent camptothecin in
a p53-dependent manner. These results suggest that the MCG10
RNA-binding protein is a potential mediator of p53 tumor suppression.
 |
INTRODUCTION |
RNA-binding proteins are a large
family of proteins with diverse functions which contain one or more
RNA-binding domains (RBDs) and other auxiliary domains for
protein-protein interaction and subcellular targeting (22, 23, 46,
65, 71, 78). Several ribosomal proteins are RNA-binding proteins,
for example, S6, S15, and L11, which are necessary for ribosome
assembly and may be a target for translational regulation (23,
82). Several groups of RNA-binding proteins have been shown to
play an important role in alternate splicing, RNA editing, and
alternate poly(A) site selection. Among these are the abundant
heterogeneous nuclear ribonucleoproteins (hnRNPs), which shuttle
between the nucleus and cytoplasm (48, 74, 82).
Three major RNA-binding motifs have been found in hnRNPs, that is, the
RBD, arginine/glycine-rich box (RGG), and hnRNP K homology (KH) domain.
The consensus RBD structure is composed of 90 to 100 amino acids with a





secondary structure (9). A majority of
hnRNPs, such as A, B, C, D, F, G, and H, contain one or more RBDs,
which are necessary for the ability of these hnRNPs in the regulation
of splicing, RNA trafficking, and mRNA stability (48, 82).
RNA-binding experiments demonstrate that RBD motif proteins can bind
RNA with a wide range of affinities and specificities (9).
The RGG box is composed of several closely spaced
arginine-glycine-glycine repeats with a
-spiral secondary structure
(9). Several hnRNPs contain RGG boxes along with RBD or KH
motifs. RNA-binding experiments have demonstrated that the RGG box has
a relatively weak RNA-binding affinity and specificity (9, 48,
82). However, the RGG box can unstack RNA bases and destabilize
RNA secondary structures, which enhances RNA binding for one or more
other RNA-binding motifs present in the protein. The KH domain consists
of 50 to 70 amino acids with a stable 




secondary
structure (9, 48, 66, 74, 82). A potential surface for RNA
binding is centered on the loop between the first two helices
(66). The KH motif proteins have a relatively high binding
affinity for dCdT elements and cytosine-rich RNA elements, such as
oligo(C) polymer and CU-rich elements (74). Several hnRNPs
contain one or more KH domains, for example, hnRNP K and E. The KH
motif hnRNPs have been shown to play a role in the regulation of
transcriptional activation and repression, mRNA stability, and
translational silencing (48, 74, 82). Sam68, a target of the
Src tyrosine kinase in mitosis, contains one KH domain (4,
53). Interestingly, a splicing variant, Sam68
KH, which lacks
the KH domain inhibits cell proliferation and cell cycle transition
from G1 to S (4). The fragile X syndrome gene
FMR1 encodes an RNA-binding protein with two KH domains
(83). Transcriptional silencing of FMR1 or a
mutation in the C-terminal KH domain leads to fragile X syndrome
(93, 96).
p53, a cellular gatekeeper, plays an important role in the regulation
of numerous processes, including cell cycle progression and apoptosis
(1, 13, 34, 46, 52), differentiation (2),
senescence (52), and tumor surveillance (110).
Many studies have shown that p53 transcriptional activity is required to regulate these processes (3, 76, 92, 108, 109).
Consistent with this idea, the majority of tumor-derived mutations in
p53, which is the most frequently mutated gene in human cancers, occurs in the central, conserved sequence-specific DNA-binding domain, which
is necessary for transactivation (34, 46). A number of
cellular genes have been found to be induced by p53 (27, 46). They can be classified into three major functional groups: (i) genes whose products are capable of mediating p53-dependent cell
cycle arrest (13, 27, 46), (ii) genes whose products are
capable of mediating p53-dependent apoptosis (13, 27, 46),
and (iii) genes whose products are capable of mediating other p53
activities, such as TAP1, which is involved in tumor surveillance
(110), the p48 xeroderma pigmentosa gene which is involved
in nucleotide excision repair (37), and the KAI1 gene, involved in suppression of metastasis (56).
Several cellular genes are capable of mediating p53-dependent cell
cycle arrest. p21, a well-characterized inhibitor of cyclin-dependent kinase, can induce arrest in G1 (1, 46, 52) and
can also induce G2-M arrest in cells that harbor a
dysfunctional retinoblastoma (RB) gene (69).
G2-M arrest can be induced by 14-3-3
(12, 35), which inhibits Cdc25C phosphatase activity; GADD45
(95), which is necessary for maintaining genome stability
and DNA repair; B99 (88), which is a microtubule-localized
protein with G2-phase-specific expression; and B-cell
translocation gene 2 (BTG2) (79), whose loss
disrupts G2-M arrest when cells are treated with
DNA-damaging agents.
Several candidate genes may mediate p53-dependent apoptosis. These are
bax (62), KILLER/DR5 (103),
phosphatidyl inositol 3-kinase regulatory subunit p85 (105),
PAG608 (39, 90), Siah-1 (57,
78), cathepsin D (104), and CD95 (also called Apo-1 or
Fas) receptor (5, 64). Nevertheless, it is still not clear whether these p53 targets are necessary or sufficient for inducing apoptosis. Since p53 transcriptional activity is necessary for inducing
apoptosis, it is likely that one or more cellular genes must be
involved in mediating p53-dependent apoptosis.
In the search for novel cellular target genes responsible for p53 tumor
suppression, we performed a cDNA subtraction assay and found one gene,
MCG10, that is specifically induced by wild-type but not
mutant p53 and by DNA damage. This induction occurs via two potential
p53-responsive elements. The MCG10 gene, located at
chromosome 3p21 with 10 exons, encodes at least two alternatively spliced transcripts, MCG10 and MCG10as. The MCG10 and MCG10as proteins
contain two domains homologous to an hnRNP KH domain. By generating
cell lines that inducibly express either wild-type or mutated forms of
MCG10 and MCG10as, we found that MCG10 and MCG10as can induce apoptosis
and cell cycle arrest in G2-M and that both KH domains are
necessary for these activities. We also found that MCG10 and MCG10as
are capable of binding to poly(C) and that their RNA-binding activity
is necessary for inducing apoptosis and cell cycle arrest. These
results suggest that the MCG10 RNA-binding protein is a potential
mediator of p53 tumor suppression.
 |
MATERIALS AND METHODS |
Cell culture and cell lines.
HCT116, LS174T, and MCF7 cell
lines were purchased from the American Type Culture Collection. RKO,
HCT116p53
/
, and 80S14 were cultured as described
previously (8, 42, 94). RKOE6 and HCT116E6 are derivatives
of RKO and HCT116, respectively, that were stably transfected with the
E6 gene from human papillomavirus 16 (65).
HCT116p53
/
and 80S14 are derivatives of HCT116 in which
the genes encoding p53 and p21, respectively, were somatically knocked
out (8, 94). The MCF7 cell line, which expresses Tet-VP16
for the generation of tetracycline-inducible cell lines, was purchased
from ClonTech (Palo Alto, Calif.). MCF7-p53, an MCF7 derivative that
inducibly expresses p53, was generated as previously described
(15, 109). p53-3, p53(R249S)-4, and p53(
PRD)-5 cell
lines, derivatives of H1299 that inducibly express wild-type p53,
p53(R249S), and p53(
PRD), respectively, were cultured as described
previously (15, 108, 109). H1299 cell lines that inducibly
express wild-type or mutated forms of MCG10 and MCG10as were generated
as previously described (15, 109).
RNA isolation, cDNA subtraction assay, and Northern blot
analysis.
Polyadenylated RNA was isolated from p53-3 cells using
an mRNA purification kit (Pharmacia, Piscataway, N.J.). Total RNA was isolated from cells using Trizol reagents (Life Technologies, Inc.,
Gaithersburg, Md.). The cDNA subtraction assay was performed using the
ClonTech PCR-Select cDNA subtraction kit according to the
manufacturer's instruction (ClonTech). Subtracted cDNA fragments were
cloned into pCRII vector (Invitrogen, Carlsbad, Calif.). Northern blot
analysis was performed as described previously (14, 109).
p21 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes were
prepared as described previously (109). The MCG10 probe, a 1.7-kb PstI fragment, was prepared from
MCG10 cDNA.
Plasmids and mutagenesis.
The full-length cDNAs for MCG10
and MCG10as were isolated from a cDNA library made with mRNA purified
from p53-3 cells and individually cloned into a tetracycline-regulated
expression vector, pUHD10-3 (33), between the
EcoRI and XbaI sites. Mutant MCG10 and
MCG10as cDNA constructs were generated by PCR and used to replace the corresponding regions of wild-type MCG10 or
MCG10as in pUHD10-3. To generate MCG10-
KH1, the cDNA
fragment encoding amino acids 1 to 188 but lacking amino acids 78 to
185 was amplified using the T3 promoter primer as the 5'-end primer and
the 3'-end primer GCA GAT CTG ACT GGC AGG GAT GAC. The
resulting fragment was used to replace the corresponding region in
MCG10 between the EcoRI and BglII
sites. To generate MCG10-
KH2 and MCG10as-
KH2, the cDNA fragment
encoding amino acids 278 to 424 but lacking amino acids 281 to 329 of
MCG10 was amplified by the 5'-end primer ATC GGG CGC CAT GTC ACC
ATC ACT and the 3'-end primer TAG GAT CCG GTC GCT GAG AAT
AT. The resulting cDNA fragment was used to replace the
corresponding region in MCG10 or MCG10as between
the KasI and BamHI sites. To generate
MCG10as-KH2
(Ile230Asp), the cDNA fragment encoding amino
acids 224 to 369 of MCG10as was amplified by the 5'-end primer CGG
GCG CCA GGG CAG CAA GAA CAG CGA G and the 3'-end primer TAG
GAT CCG GTC GCT GAG AAT AT. The resulting fragment was used to
replace the corresponding region in MCG10as between the
NarI and BamHI sites.
Antibody production and Western blot analysis.
To generate
anti-MCG10 antibody, a 1,530-bp PstI-NcoI cDNA
fragment encoding amino acids 10 to 424 of the MCG10 polypeptide was
inserted in frame into the pRSET expression vector (Invitrogen). The
His-tagged MCG10 protein was produced in bacteria and purified with
Ni-agarose beads. Anti-MCG10 antibody was raised in a rabbit and
affinity purified using the His-tagged MCG10 protein (14). For Western blot analysis, cells were collected from culture plates in
phosphate-buffered saline (PBS), resuspended in 2× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, and boiled for 5 min. Western blot analysis was performed as previously described (109). Antiactin antibody was purchased from Sigma (St. Louis, Mo.).
Luciferase assay.
A 28-bp fragment
(5'AGCTTGGTCTTGGCCCAGACTTAGCACA3') that contains the
potential p53-responsive element 1, a 36-bp fragment (5'AGCTTGAACTTAAGACCGAGGCTCTGGACAAGTTGA3') that contains the
potential p53-responsive element 2, and a 27-bp fragment
(5'AGCTTGCTCTAGTTCTGGCCATGTTCA3') that contains the
potential p53-responsive element 3 were synthesized and cloned upstream
of a minimal c-fos promoter and a firefly luciferase
reporter gene (41). The resulting constructs were designated
p53RE-1, p53RE-2, and p53RE-3, respectively. To mutate the
p53-responsive elements in the MCG10 gene, four nucleotides in p53RE-1 (5'AGCTTGGTaTTtGCCCAGAaTTAtCACA3') and p53RE-2
(5'AGCTTGAAaTTAAtACCGAGGCTCTGGAaAAtTTGA3') which are
predicted to be critical for p53 binding (shown in lowercase) were
replaced. We then generated two reporter vectors, designated m-p53RE-1
and m-p53RE-2, and 2 µg of p53RE-1, m-p53RE-1, p53RE-2, m-p53RE-2, or
p53RE-3 was cotransfected into H1299 cells with 1 µg of pcDNA3
control vector or a vector that expresses wild-type or mutant p53. Then
0.1 µg of Renilla luciferase assay vector pRL-CMV
(Promega, Madison, Wis.) was also cotransfected as an internal control.
The dual luciferase assay was performed according to the
manufacturer's instructions (Promega).
EMSA.
The electrophoretic mobility shift assay (EMSA) probes
were 28-bp (p53RE-1) and 36-bp (p53RE-2) oligonucleotides containing a
potential p53-responsive element in the MCG10 gene. The
labeled probe DNA (5 ng) was added to a mixture [20 mM HEPES (pH 7.9), 25 mM KCl, 0.1 mM EDTA, 10% glycerol, 2 mM MgCl2, 2 mM
spermidine, 0.5 mM dithiothreitol, 0.025% NP-40, 100 ng of
double-stranded poly(dI·dC), and 2 µg of bovine serum albumin
containing 20 ng of p53 protein. The p53 protein was expressed in a
baculovirus expression system and affinity purified using anti-p53
monoclonal antibody Pab421. The p53-DNA complex was resolved in a 4%
polyacrylamide gel. For supershifting the p53-DNA complex, 1 µg of
anti-p53 monoclonal antibody Pab1801 was added to the reaction. For
competition assays, the unlabeled wild-type RGC (20 and 100 ng) or
probe DNA (20 and 100 ng) was added to the reaction.
Growth rate analysis and trypan blue exclusion assay.
To
determine the rate of cell growth, cells were seeded at approximately
5 × 104 to 7.5 × 104 cells per
60-mm plate with or without tetracycline (1.0 µg/ml). The medium was
replaced every 72 h. At the times indicated, two plates were
rinsed with PBS twice to remove dead cells and debris. Live cells on
the plates were trypsinized and collected separately. Cells from each
plate were counted at least three times using the Coulter cell counter.
The average number of cells from two plates was used for growth rate
determination. For the trypan blue dye exclusion assay, all cells were
collected separately from two plates at the times indicated. The cells
were stained with trypan blue (Sigma) for 10 min. The stained (dead)
and unstained (live) cells were counted at least three times using a
hemocytometer. The percentage of dead cells was used as an index for
the degree of apoptosis.
DNA histogram analysis and annexin V staining assay.
Cells
were seeded at 2 × 105 per 90-mm plate with or
without tetracycline. For DNA histogram analysis, both floating dead
cells in the medium and live cells on the plate were collected and
fixed with 2 ml of 70% ethanol for at least 30 min. The fixed cells were centrifuged and resuspended in 1 ml of PBS solution containing 50 µg each of RNase A (Sigma) and propidium iodide (Sigma) per ml. The
stained cells were analyzed in a fluorescence-activated cell sorter
within 4 h. The percentages of cells in the sub-G1, G0-G1, S, and G2-M phases were
determined using the ModFit program. For the annexin V staining assay,
both dead and live cells were collected and washed twice with cold PBS.
The cells were resuspended in 0.1 ml of annexin V binding buffer to a
density of 106/ml and stained according to the
manufacturer's instructions (Boehringer, Mannheim, Germany).
Mitochondrial membrane potential assay.
To determine whether
the cell death mediated by MCG10 goes through the mitochondrial
pathway, cells were seeded at approximately 6 × 103
cells/chamber (Fisher Scientific) with or without tetracycline (2 µg/ml) for 3 days. Cells were then rinsed with PBS and stained with
ApoAlert Mitochondrial Membrane Sensor reagents according to the
manufacturer's instructions (ClonTech). In normal cells, Mitosensor, a
cationic dye, is taken up in the mitochondria, where it forms
aggregates and exhibits red fluorescence. In apoptotic cells,
Mitosensor cannot aggregate in the mitochondria because of altered
mitochondrial potentials. As a result, the dye remains in monomeric
form in the cytoplasm, where it fluoresces green.
Caspase activity assay.
Cells were seeded at approximately
3 × 105 to 5 × 105 per 90-mm plate
with or without tetracycline for 3 days. Cells were then rinsed with
cold PBS, and caspase activity was assayed using the caspase 3 or 6 colorimetric protease assay reagent according to the manufacturer's
instructions (Chemicon International, Inc.). The percent increase in
relative caspase activity was the activity in cells expressing
p53 or MCG10 divided by that in control cells.
Ribonucleotide homopolymer binding assay.
The RNA-binding
assay was performed as previously described with modifications
(84). Briefly, cells were collected, washed two times with
cold PBS, and resuspended in 1 ml of RNA-binding buffer (50 mM Tris-HCl
[pH 7.4], 100 mM KCl, 2 mM MgCl2, 1 mM EDTA, 0.5% NP-40,
0.5% aprotinin, 2 µg of leupeptin per ml, and 0.5 mM
phenylmethylsulfonyl fluoride). Cytoplasmic and nuclear extracts were
prepared as previously described (77). For the RNA-binding
assay, 0.8 ml of cytoplasmic extracts or nuclear extracts was mixed
with 0.2 ml of 5 M NaCl and 5 mg of ribonucleotide homopolymer [poly(A), poly(U), poly(G), or poly(C)]-agarose beads. The mixtures were incubated and rocked at room temperature for 20 min. The beads in
the mixture were pelleted and washed three times with RNA-binding
buffer. RNA-binding proteins on the beads were resuspended in 2×
SDS-PAGE sample buffer, boiled for 8 min, and assayed by Western blot
analysis with anti-MCG10 polyclonal antibody.
Nucleotide sequence accession numbers.
The human
MCG10 genomic DNA sequence was submitted to GenBank under
accession number AF257772. The human MCG10 and
MCG10as cDNA sequences were submitted to GenBank under
accession numbers AF257770 and AF257771, respectively.
 |
RESULTS |
Upregulation of MCG10 by p53.
In our ongoing
effort to identify novel p53 target genes, the ClonTech PCR-Select cDNA
subtraction assay was performed using mRNA isolated from p53-3, a
derivative of the H1299 cell line that inducibly expresses p53 under a
tetracycline-regulated promoter (15, 109). Several cDNA
fragments that may represent genes induced by p53 were isolated. Among
these is MCG10, which is a novel gene and encodes a protein
with two regions homologous to the KH domain of the hnRNP K protein. To
confirm that MCG10 can be induced by p53, Northern blot
analysis was performed using MCG10 cDNA as the probe. We
found that MCG10 was induced in p53-3 cells when p53 was
expressed (Fig. 1A, upper panel, compare
lanes 1 and 2). As a control, we tested the expression of three
well-defined cellular p53 target genes, p21, GADD45, and 14-3-3
(28, 35, 42). We found that these genes were also induced by
p53 (Fig. 1A, lower panel). The level of induction for MCG10
was higher than that for GADD45 and 14-3-3
, albeit lower than that
for p21. In addition, mutant p53(R249S) was incapable of activating
MCG10, p21, GADD45, or 14-3-3
(Fig. 1A, compare lanes 3 and 4), consistent with the fact that this tumor-derived p53 mutant is
defective in transactivation (30). We and others have shown
recently that p53(
PRD), which lacks the proline-rich domain, is
deficient in inducing apoptosis and certain p53 target genes (91,
108). Here we found that p53(
PRD) is deficient in inducing
MCG10 (Fig. 1B, compare lanes 3 and 4), suggesting that
MCG10 is a potential mediator of p53-dependent apoptosis
(see more below). Furthermore, we determined the kinetics for p53
induction of MCG10 (Fig. 1C). We found that enhanced
expression of MCG10 was detected as early as 6 h after
p53 induction and that maximum induction occurred at 18 and 24 h.
Induction of p21 showed similar kinetics.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 1.
Upregulation of MCG10 by p53. (A) Wild-type p53 but not
mutant p53 induces MCG10. Northern blots were prepared using
10 µg of total RNA isolated from p53-3 or p53(R249S) cells that were
uninduced ( ) or induced (+) to express wild-type p53 or mutant
p53(R249S), respectively. The blots were probed with cDNAs derived from
the MCG10, 14-3-3 , GADD45, p21 and GAPDH genes. (B) The
apoptosis-deficient deletion mutant p53( PRD) is incapable of
inducing MCG10. A Northern blot was prepared using 10 µg
of total RNA isolated from p53-3 or p53( PRD)-5 cells that were
uninduced ( ) or induced (+) to express wild-type p53 or mutant
p53( PRD), respectively. The blot was probed with MCG10
cDNA and then reprobed with both p21 and GAPDH cDNAs. (C) Kinetics of
p53 induction of MCG10. A Northern blot was prepared using
10 µg of total RNA isolated from p53-3 cells that were induced for 0, 6, 12, 18, 24, 36, or 48 h. The blot was probed with
MCG10 cDNA and then reprobed with both p21 and GAPDH cDNAs.
(D) MCG10 is induced by DNA damage in cells that contain an
endogenous wild-type p53 gene but not in cells that are functionally
p53-null. Northern blots were prepared using 10 µg of total RNA
isolated from seven individual cell lines (see text for details) as
indicated above the figure, which were untreated ( ) or treated (+)
with 300 nM camptothecin for 24 h. The blots were probed with
cDNAs derived from MCG10, p21, and GAPDH. (E) Exogenous
inducible p53 cooperates with endogenous wild-type p53 in MCF7 cells to
induce MCG10. A Northern blot was prepared using 10 µg of
total RNA isolated from MCF7-p53 cells that were untreated (lane 1),
treated with 300 nM camptothecin (CPT) to induce endogenous wild-type
p53 (lane 2), induced to express exogenous p53 and treated with 300 nM
camptothecin to induce endogenous wild-type p53 (lane 3), or induced to
express exogenous p53 (lane 4). The blot was probed with cDNAs derived
from MCG10 and GAPDH.
|
|
DNA damage stabilizes and activates p53, leading to induction of p53
target genes (32, 46, 52). If MCG10 is a true p53 target, it would be induced by DNA damage in cells that contain an
endogenous wild-type p53 gene but not in cells that are p53-null. To
this end, we tested eight cell lines using the DNA-damaging agent
camptothecin, which is an inhibitor of topoisomerase I and can induce
double-strand DNA breaks (68). These cells were treated with
camptothecin, and the levels of MCG10 and p21 transcripts were determined by Northern blot analysis (Fig. 1D). We found that both
MCG10 and p21 were induced in camptothecin-treated RKO, HCT116, LS174T, and MCF7 cells, which all contain wild-type p53 (Fig.
1D, lanes 3, 4, 7 to 10, and 13 to 16). Although p21 was not expressed
in p21-null 80S14 cells (94), MCG10 was still induced by DNA damage (Fig. 1D, lanes 9 and 10), indicating that p53
can induce MCG10 independently of p21. In contrast,
MCG10 was not induced in p53-knockout cells
(HCT116p53
/
) (Fig. 1D, lanes 5 and 6) or p53-null-like
cells (RKOE6 and HCT116E6) (Fig. 1D, lanes 1 and 2 and 11 and 12).
Since exogenous p53 in H1299 cells and endogenous p53 in MCF7 cells are
capable of inducing MCG10, we wanted to determine whether
MCG10 can be cooperatively induced when both endogenous and
exogenous p53s are expressed. To do this, we generated an MCF7 cell
line, MCF7-p53, that inducibly expresses HA-tagged p53 under a
tetracycline-regulated promoter. We found that MCG10 was induced in MCF7-p53 cells treated with camptothecin to induce endogenous p53 (Fig. 1E, lane 2) or induced to express exogenous HA-tagged p53 (Fig. 1E, lane 4). In contrast, when both endogenous and
exogenous p53s were expressed, the level of MCG10 induction (6-fold) was more than additive to that induced by endogenous (1.8-fold) or exogenous (3.5-fold) p53 individually (Fig. 1E, compare
lane 3 with lanes 2 and 4).
Identification of two potential p53-responsive elements in the
MCG10 gene.
To determine whether MCG10 is a
true target of p53, we needed to look for a p53-responsive element in
the genomic DNA sequence of the MCG10 gene. To do this, we
screened a human bacterial artificial chromosome library and identified
a genomic clone containing MCG10. We then sequenced a region
of 7,083 nucleotides that spans the entire MCG10 gene locus
(Fig. 2A).
We found three potential p53-binding sites, p53-responsive elements 1, 2, and 3, located approximately 900, 1,800, and 2,000 nucleotides upstream of the MCG10
transcription start site, respectively (Fig. 2A). All three sequences
(p53RE-1, GAA CTTAAG aCC GAGGCTCT GGA CAAG
TTg; p53RE-2, GGt CTTG gCC C AGA CTTAG
CaC; and p53RE-3, Gct CTAG TTC T GGc
CATG TTC) contain mismatches (in lowercase) in the
noncritical positions within the consensus p53-binding site. Recently,
an 81,512-bp genomic DNA sequence from a P1 artificial chromosome clone
that contains the MCG10 gene locus was deposited in GenBank
(AC006255). The P1 clone was mapped at chromosome 3p21, a region highly
susceptible to aberrant chromosomal rearrangements and deletions in
neoplasia (61).


View larger version (115K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of two p53-responsive elements in the
MCG10 gene. (A) Schematic representation of the
MCG10 genomic DNA structure. Exons are shown as numbered
boxes, and introns are shown as lines. The locations of two potential
p53-responsive elements in the promoter of the MCG10 gene
are indicated. Bold uppercase letters represent nucleotides predicted
to be critical for the consensus p53-responsive element. Lowercase
letters represent mismatches. The transcript for MCG10 is
drawn above the gene structure, and the transcript for
MCG10as is shown below. Exon 4b is not present in the
MCG10as transcript. (B) Two of the three potential
p53-binding sites but not their mutated forms in the MCG10
gene are responsive to wild-type p53 in vivo. p53RE-1, m-p53RE-1,
p53RE-2, m-p53RE-2, or p53RE-3 (2 µg) was cotransfected into H1299
cells with 1 µg of pcDNA3 control vector or a vector that expresses
wild-type p53 or mutant p53(R175H). The fold increase in relative
luciferase activity is the luciferase activity induced by p53 divided
by that induced by pcDNA3. Error bars represent the standard deviations
from at least three experiments. (C) p53 binds specifically to both
p53RE-1 and p53RE-2 in vitro. The 28- and 36-bp oligonucleotide
fragments containing p53RE-1 and p53RE-2, respectively, in the
MCG10 gene were labeled with [ -32P]dCTP.
The labeled probe DNA (5 ng) was added to a mixture containing 20 ng of
p53 protein. The p53-DNA complex was resolved in a 4% polyacrylamide
gel. For competition assays, 5- or 20-fold excess unlabeled 28-bp probe
DNA (lanes 3 and 4), 36-bp unlabeled probe DNA (lanes 9 and 10), or RGC
(lanes 5 and 6 and 11 and 12) was added to the reactions.
|
|
To determine whether these binding sites are responsive to p53 in vivo,
three fragments that contain these potential p53-responsive elements
(see Materials and Methods) were synthesized and cloned upstream of a
minimal c-fos promoter and a luciferase reporter gene. The
resulting reporter vectors were designated p53RE-1, p53RE-2, and
p53RE-3. Each of the reporter vectors was cotransfected into H1299
cells with either pcDNA3 control vector or a vector that expresses
wild-type p53 or mutant p53(R175H). The Renilla luciferase
assay vector pRL-CMV was also cotransfected as an internal control. We
found that the luciferase activity of p53RE-1 and p53RE-2 but not
p53RE-3 was markedly increased by wild-type p53 (Fig. 2B). Mutant
p53(R175H) was incapable of increasing the luciferase activity of
p53RE-1 and p53RE-2 (Fig. 2B). We also replaced four nucleotides in
p53RE-1 and p53RE-2 predicted to be critical for p53 binding (see
Materials and Methods) and generated two reporters, designated
m-p53RE-1 and m-p53RE-2. We found that the luciferase activity for both
m-p53RE-1 and m-p53RE-2 was not significantly increased by wild-type
p53 or mutant p53(R175H) (Fig. 2B). These results suggest that two of
the three potential p53-responsive elements in MCG10 do
function in vivo.
To further determine whether p53 binds to the responsive elements in
the MCG10 gene, two DNA fragments (28 and 36 bp) that contain p53RE-1 and -2 (see Materials and Methods) were synthesized, 32P-labeled, and used in an EMSA (Fig. 2C). We found that
when the purified p53 protein was mixed with these DNA fragments, a
complex that presumably contained both p53 and p53RE-1 or -2 was
detected (Fig. 2C, lanes 2 and 8). The complex was supershifted with
the anti-p53 monoclonal antibody Pab1801 (data not shown). We also used
the unlabeled probe DNA and a fragment that contains a wild-type p53-binding site from the ribosomal gene cluster (RGC) (43) as competitors. The unlabeled probe DNA and wild-type RGC competed with
the 32P-labeled 28- and 36-bp probe DNA fragments from the
MCG10 gene and inhibited the formation of the p53-DNA
complex in a dose-dependent manner (Fig. 2C, lanes 3 to 6 and 9 to 12).
These results indicate that p53 interacts specifically with both
p53RE-1 and -2 in the MCG10 gene.
MCG10 gene locus encodes at least two alternatively
spliced transcripts for novel KH motif RNA-binding proteins.
To
analyze the activity of the MCG10 gene product, we used the
163-bp cDNA fragment from the cDNA subtraction assay to screen a cDNA
library made from mRNA isolated from p53-3 cells. Two cDNA clones
(2,623 and 2,458 nucleotides) were identified. When both cDNA sequences
were aligned with the 7,083-nucleotide genomic DNA sequence, we found
that 10 exons encode the 2,623-nucleotide MCG10 transcript.
The 2,458-nucleotide cDNA clone represents an alternatively spliced
transcript, MCG10as, which lacks 165 nucleotides within exon
4. We refer to the region not expressed in MCG10as as exon
4b (see Fig. 2A). The MCG10 and MCG10as
transcripts encode novel polypeptides of 424 and 369 amino acids,
respectively. Each protein contains two KH domains, three proline-rich
domains, one potential nuclear export signal, and one potential nuclear
localization signal (Fig. 3A
to C). A sequence alignment of the KH
domains from hnRNP K, FMR1, MCG10, and MCG10as showed that the critical residues in the KH domains of hnRNP K and FMR1 are conserved in those
of MCG10 and MCG10as (Fig. 3D). For example, the GXXG motif within the
KH domain of hnRNP K (82) and the critical Ile (at residue
304, marked with an asterisk) in the FMR1 KH2 (66) are conserved in the KH domains of MCG10 and MCG10as.


View larger version (94K):
[in this window]
[in a new window]
|
FIG. 3.
(A and B) Deduced amino acid sequences of MCG10 and
MCG10as. The N-terminal KH domain (KH1) and C-terminal KH domain (KH2)
in MCG10 and MCG10as are boxed. The bold italic letters represent a
55-amino-acid insertion in the N-terminal KH domain of MCG10. Three
proline-rich domains (PRD) are underlined. The nuclear export signal
(NES) and nuclear localization signal (NLS) are marked by dashes. (C)
Schematic representations of MCG10 and MCG10as protein structures. The
locations of specific features are indicated by the amino acid number.
(D) Sequence alignment of eight KH domains from hnRNP K, FMR1, MCG10,
and MCG10as. Numbers on the right indicate positions of the ending
amino acids in the KH domain. Highly conserved positions are
highlighted in colors. The GXXG motif is shown below the alignment. The
critical isoleucine residue for FMR1 KH2 that is mutated in fragile X
syndrome is indicated (*).
|
|
MCG10 and MCG10as can induce apoptosis and cell cycle arrest in
G2-M.
Activation of p53 leads to at least two
well-characterized cellular responses, cell cycle arrest and apoptosis
(1, 13, 52). Since MCG10 can be induced by p53,
we wanted to determine whether MCG10 is capable of mediating
p53 tumor suppression. To this end, we generated several cell lines
that inducibly express MCG10 and MCG10as under
the control of a tetracycline-regulated promoter. The levels of the
MCG10 and MCG10as proteins in four representative H1299 cell lines were
determined by Western blot analysis with anti-MCG10 antibody (Fig.
4A). A 45-kDa polypeptide was
specifically recognized by anti-MCG10 antibody in both MCG10- and
MCG10as-producing cells when induced. Interestingly, we found that the
apparent molecular masses of MCG10 and MCG10as are nearly identical,
although the MCG10 polypeptide is 55 amino acids longer than MCG10as
(Fig. 3A and B). When the levels of actin protein were normalized in
various cells, we found that MCG10 and MCG10as were expressed at
comparable levels. We then measured the growth rates of MCG10-17 and
MCG10as-10 cells in the absence and presence of
MCG10 and MCG10as over a 5-day period. We found that both MCG10 and
MCG10as can suppress cell proliferation (Fig. 4B and C).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
MCG10 and MCG10as are capable of suppressing cell
proliferation. (A) Levels of MCG10, MCG10as, and actin were assayed by
Western blot analysis in cell lines that inducibly express MCG10 or
MCG10as. Cell extracts were prepared from uninduced cells ( ) or cells
induced (+) to express MCG10 or MCG10as. The blot was probed with
affinity-purified anti-MCG10 polyclonal antibody (upper panel) and then
reprobed with antiactin polyclonal antibody (lower panel). (B and C)
Growth rates of MCG10-17 and MCG10as-10 cells in the presence ( ) or
absence ( ) of MCG10 or MCG10as, respectively, were measured as
described in Materials and Methods. Error bars represent the standard
deviations from at least three experiments.
|
|
To determine whether the growth suppression by MCG10 and MCG10as is due
to cell cycle arrest, apoptosis, or both, we performed DNA histogram
analysis. When cells were induced to express MCG10 for 2, 4, and 6 days, we found that the percentage of cells in S phase decreased from
35 to 23% (Fig. 5A and B), 37 to 29%
(Fig. 5E and F), and 35 to 26% (Fig. 5I and J), respectively. In
contrast, we found that the percentage of cells in G2-M
phase increased from 14 to 23% (Fig. 5A and B), 15 to 31% (Fig. 5E
and F), and 16 to 35% (Fig. 5I and J), respectively. We also found
that the number of cells in G2/M was increased when
MCG10 was induced for 1 day (data not shown). The maximum
effect was observed between 2 and 4 days following induction of
MCG10. This is consistent with the fact that p53-mediated
cell cycle arrest occurs within 24 h but remains incomplete till
48 h (15). Furthermore, we found that the ability of
MCG10 to induce arrest in G2/M is higher than that of p53
in H1299 cells, although slightly lower than that of GADD45 (95,
108). These results suggest that MCG10 can induce cell cycle
arrest in G2-M. However, no substantial increase was
detected for cells in sub-G1. Since cells can undergo apoptosis without DNA fragmentation (67, 71, 80), we
determined whether MCG10 can induce cell death by the annexin V
staining assay. We found that when cells were induced to express MCG10 for 2, 4, and 6 days, the percentage of stained cells (a combination of
cells in both the upper right and lower right boxes) was increased from
12 to 21% (Fig. 5C and D), 10 to 35% (Fig. 5G and H), and 12 to 35%
(Fig. 5K and L), respectively.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
MCG10 is capable of inducing cell cycle arrest in
G2-M and apoptosis. DNA content was quantitated by
propidium iodide staining of fixed cells that were uninduced ( MCG10)
or induced (+MCG10) to express MCG10 for 2 days (A and B), 4 days (E
and F), and 6 days (I and J). Apoptotic cells were quantitated by
propidium iodide-annexin V staining of cells that were uninduced
( MCG10) or induced (+MCG10) to express MCG10 for 2 days (C and D), 4 days (G and H), and 6 days (K and L).
|
|
To further demonstrate that MCG10 can induce apoptosis, we performed a
trypan blue dye exclusion assay. We found that the percentage of dead
(trypan blue stained) cells was significantly increased in cells
induced to express MCG10 for 2 and 4 days (Fig. 6A). It is well established that during
the apoptotic cascade, several caspases are activated and the
mitochondrial membrane potential of apoptotic cells is altered
(67). Therefore, we analyzed the activity of caspases 3 and
6 and the mitochondrial membrane potential in cells with and without
induction of MCG10. We found that the activity of caspase 6 but not
caspase 3 was significantly increased by MCG10 (Fig. 6B). We also found
that p53 substantially activated caspase 3 and, to a lesser extent, caspase 6 (Fig. 6B). Furthermore, the mitochondrial membrane was not
permeable to Mitosensor, a cationic dye in cells expressing MCG10 (Fig.
6C), or p53 (data not shown), suggesting that the mitochondrial
membrane potential is altered. Similar results were obtained for
MCG10as-producing cells (Fig. 7). These
results suggest that MCG10 can induce apoptosis without causing DNA
fragmentation.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 6.
MCG10 activates caspase 6 and induces apoptosis through
the mitochondrial pathway. (A) The percentage of dead cells induced by
MCG10 was quantified by trypan blue dye exclusion. Cells were seeded in
the presence (+) or absence ( ) of MCG10 for 2 or 4 days. Both
unstained and trypan blue-stained cells were counted using a
hemocytometer. Error bars represent the standard deviations from at
least three experiments. (B) Caspase 6 is activated by MCG10. p53-3 or
MCG10-17 cells were uninduced or induced to express p53 or MCG10 for 3 days. Cells were then collected and assayed for the activity of
caspases 3 and 6 as described in Materials and Methods. (C) The
mitochondrial membrane potentials were altered in cells induced to
express MCG10. MCG10-17 cells were uninduced ( MCG10) or induced to
express MCG10 (+MCG10) for 3 days, stained with Mitosensor, and
analyzed by fluorescence microscopy.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
MCG10as is capable of inducing both cell cycle arrest in
G2-M and apoptosis. DNA content was quantitated by
propidium iodide staining of fixed cells that were uninduced
( MCG10as) or induced (+MCG10as) to express MCG10as for 2 days (A and
B), 4 days (E and F), and 6 days (I and J). Apoptotic cells were
quantitated by propidium iodide-annexin V staining of cells that were
uninduced ( MCG10as) or induced (+MCG10as) to express MCG10as for 2 days (C and D), 4 days (G and H), and 6 days (K and L).
|
|
Role of the KH domain in the activity of MCG10 and MCG10as.
To
determine whether the KH domain is necessary for the ability of MCG10
and MCG10as to induce cell cycle arrest and apoptosis, we constructed
three KH domain deletion mutants, MCG10-
KH1, MCG10-
KH2, and
MCG10as-
KH2. We then generated several cell lines that inducibly express these mutants. Expression of the mutant MCG10 and MCG10as proteins was assayed in Western blots using anti-MCG10 antibody (Fig.
8A, C, and E). Levels of the mutant
proteins in MCG10-
KH1-5 and MCG10-
KH2-20 were fairly comparable
to that in MCG10-17 cells (Fig. 8A and C). The level of the mutant
protein expressed in MCG10as-
KH2-23 cells was relatively low
compared to that in MCG10as-10 cells (data not shown). We then measured
the growth rates of MCG10-
KH1-5, MCG10-
KH2-20, and
MCG10as-
KH2-23 cells in the absence and presence of protein
induction over a 5-day period. We found that none of the mutants were
capable of suppressing cell proliferation (Fig. 8B, D, and F). Since a
single KH domain remains in each mutant, the results suggest that both
KH domains are required for the activity of MCG10 and MCG10as.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
Both KH domains in MCG10 and MCG10as are necessary for
inducing cell cycle arrest and apoptosis. (A) Levels of MCG10 and actin
in MCG10-17 and MCG10- KH1-5 cell lines were assayed by Western blot
analysis. Cell extracts were prepared from uninduced cells ( ) or
cells induced (+) to express MCG10 or MCG10- KH1. The blot was probed
with affinity-purified anti-MCG10 polyclonal antibody (upper panel) and
then reprobed with antiactin polyclonal antibody (lower panel). (B)
Growth rates of MCG10- KH1-5 cells in the presence ( ) and absence
( ) of MCG10- KH1 were measured as described in Materials and
Methods. (C) Levels of MCG10 and actin in MCG10-17 and MCG10- KH2-20
cell lines were assayed by Western blot analysis as described for panel
A. (D) Growth rates of MCG10- KH2-20 cells in the presence ( ) and
absence ( ) of MCG10- KH2. (E) Levels of MCG10as- KH2 and actin
in the MCG10as- KH2-23 cell line were assayed by Western blot
analysis as described for panel A. (F) Growth rates of
MCG10as- KH2-23 cells in the presence ( ) and absence ( ) of
MCG10as- KH2. Error bars represent the standard deviations from at
least three experiments.
|
|
Both KH domains in MCG10 and MCG10as are necessary for binding
RNA.
MCG10 and MCG10as each contain two KH domains. Since KH
domains are known to bind RNA, we wanted to determine whether the KH
domains in MCG10 and MCG10as also bind to RNA. To do this, poly(C)-,
poly(G)-, poly(U)-, or poly(A)-agarose beads were added to cytoplasmic
or nuclear extracts purified from uninduced cells or cells induced to
express MCG10 or MCG10as. Proteins that specifically bound to the
homopolymer beads were isolated, and the MCG10 and MCG10as proteins
were identified by Western blot analysis. We found that MCG10 and
MCG10as can bind to poly(C) but not to poly(A), poly(U), or poly(G)
(Fig. 9A). This is consistent with the
RNA-binding specificity for the KH domain (48, 74, 82). We
did not detect any MCG10 and MCG10as in the nuclear extracts,
suggesting that these proteins are predominantly located in the
cytoplasm.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 9.
KH domain in MCG10 and MCG10as is capable of and
necessary for binding poly(C). (A) MCG10 and MCG10as can bind to
poly(C) but not to poly(U), poly(G), or poly(A). Total cell extracts
run in lanes 1 and 2 were prepared from MCG10-17 and MCG10as-10 cells
that were uninduced ( ) and induced (+) to express MCG10 (upper panel)
or MCG10as (lower panel). Cytoplasmic extracts (C) and nuclear extracts
(N) were prepared from uninduced cells ( ) or cells induced (+) to
express MCG10 or MCG10as and mixed with poly(C)-, poly(U)-, poly(G)-,
or poly(A)-agarose beads. Proteins bound to the beads were isolated and
assayed by Western blot analysis using anti-MCG10 antibody. (B) The KH1
domain in MCG10 is necessary for binding poly(C). Cytoplasmic extracts
were prepared from cells induced to express MCG10- KH1, and the
RNA-binding assay was performed as described for panel A. (C and D) The
KH2 domain in MCG10 and MCG10as is necessary for binding poly(C).
Cytoplasmic extracts were prepared from cells induced to express
MCG10- KH2 or MCG10as- KH2, and the RNA-binding assay was
performed. (E) A point mutation (Ile230Asp) in the KH2 domain abrogates
the ability of MCG10as to bind to poly(C). Cytoplasmic extracts were
prepared from cells induced to express MCG10as-KH2 , and
the RNA-binding assay was performed.
|
|
To determine whether the KH domain deletion mutants that are defective
in suppressing cell proliferation are also inert in binding RNA, the
poly(C) RNA-binding assay was performed using cytoplasmic extracts from
cells expressing MCG10-
KH1, MCG10-
KH2, and MCG10as-
KH2. We
found that MCG10-
KH2 and MCG10as-
KH2 were incapable of binding
poly(C) (Fig. 9C and D), whereas MCG10-
KH1 bound poly(C) extremely
weakly (Fig. 9B). It has been reported that a missense mutation from
Ile to Asp at residue 304 in KH2 of FMR1 abrogates its RNA-binding
activity (66). To determine whether such a mutation would
affect the RNA-binding activity of MCG10as, we generated a cell line
that inducibly expresses the analogous mutant, designated
MCG10as-KH2
. We found that, like the FMR1 mutant,
MCG10as-KH2
was defective in binding RNA (Fig. 9E).
Poly(C)-binding MCG10 protein level is increased in cells following
DNA damage in a p53-dependent manner.
We have shown above that the
MCG10 gene is induced by p53 and DNA damage (Fig. 1). To
determine whether the level of MCG10 protein is increased in cells
following a genotoxic stress, cytoplasmic cell extracts were prepared
from RKO, RKOE6, HCT116, and HCT116E6 cells that were untreated or
treated with 300 nM camptothecin for 24 h. MCG10 was isolated
using the poly(C) beads and assayed by Western blot analysis with
anti-MCG10 antibody. We found that the level of MCG10 protein was
increased nearly 11-fold in RKO cells (Fig.
10, compare lanes 1 and 2), but only
2.6-fold in RKOE6 cells that are functionally p53-null when treated
with camptothecin (Fig. 10, compare lanes 3 and 4). In addition, MCG10
was detected in HCT116 cells only when treated with camptothecin, but
not in HCT116E6 cells, which are functionally p53-null (Fig. 10, lanes 5 to 8). A nonspecific protein that migrated slightly slower than MCG10
was detected in HCT116 cells (lanes 5 and 6). These results are
consistent with the data obtained by Northern blot analysis (Fig. 1C)
that induction of MCG10 by DNA damage is p53 dependent. It should be
noted that, although MCG10 mRNA is not induced by DNA damage
in RKOE6 cells (Fig. 1C, lanes 1 and 2), the level of poly(C)-binding
MCG10 protein is increased, albeit to a lesser extent than in RKO
cells. This suggests that MCG10 can be regulated posttranscriptionally
by DNA damage in a p53-independent manner.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 10.
Level of the poly(C)-binding MCG10 protein is increased
in cells treated with DNA-damaging agent camptothecin in a
p53-dependent manner. Cytoplasmic extracts were prepared from RKO,
RKOE6, HCT116, and HCT116E6 cells that were untreated ( ) or treated
(+) with camptothecin (CPT). The RNA-binding assay was performed as
described in the legend to Fig. 9A.
|
|
 |
DISCUSSION |
RNA-binding proteins have diverse functions in the regulation of
gene expression. This is the first report, to our knowledge, that a KH
motif RNA-binding protein is regulated by p53 and that it serves as a
mediator in inducing apoptosis and cell cycle arrest in
G2-M. We have demonstrated that deletion of either of the
KH domains or a point mutation in the C-terminal KH domain of MCG10as abrogates or severely diminishes the activity of MCG10 and MCG10as in
binding RNA. As a result, the MCG10 and MCG10as mutants defective in
RNA binding are also defective in inducing apoptosis and cell cycle
arrest. These results indicate that, like other RNA-binding proteins,
the RNA-binding activity is critical for the function of MCG10 and
MCG10as. Interestingly, a 55-amino-acid insertion in the N-terminal KH
domain does not interfere with the RNA-binding activity of MCG10.
Previously, we and others have shown that p53 cellular target genes are
differentially regulated by p73 (21, 50, 107). We found that
the MCG10 gene is among the group that is not induced by
p73, further supporting the idea that the p73 signaling pathway is
different from that for p53 (13). It should be mentioned that, like other p53 target genes, the MCG10 gene is induced
by DNA damage in a p53-dependent manner (Fig. 1). DNA-damaging agents can induce a number of DNA-binding proteins by both transcriptional and
posttranscriptional mechanisms, such as p53 (47),
c-jun (106), and c-fos
(29). However, the role of RNA-binding proteins in response
to genotoxic stresses is mostly unexplored. A18 hnRNP, which contains
one each of the RBD and RGG RNA-binding motifs, can be induced in
response to UV-induced DNA damage (81). Nevertheless, it is
still not clear what the physiological function of the A18 hnRNP
protein is and whether DNA damage induction of the A18 hnRNP gene is
p53 dependent. In addition, up to 13 DNA damage-inducible proteins were
found to be capable of binding to a viral RNA probe consisting of the
trans-activation-responsive element of human immunodeficiency virus type 1 and to a G+C-rich RNA probe
(11). Since the genes encoding these RNA-binding proteins
have not been characterized, it is not clear whether any of these genes
can be regulated by p53.
How does the MCG10 protein mediate p53-dependent apoptosis and cell
cycle arrest in G2-M? Based on the activities conferred by
the KH domain in other proteins, it is likely that MCG10 may regulate
expression of genes responsible for the control of the cell cycle by
both transcriptional and posttranscriptional mechanisms. For example,
by binding to the CT-rich repeat elements in the promoter of
c-myc, hnRNP K enhances transcriptional initiation, possibly
by promoting remodeling of chromatin architecture to facilitate
interactions between transcription factors (59, 60, 87). In
contrast, by binding to the CT-rich element adjacent to the
Sp1-responsive element (E2) in the promoter of the neuronal nicotinic
acetylcholine receptor
4 subunit (nACH
4) gene, hnRNP K may
directly block Sp1 binding to E2, leading to transcriptional repression
of the nACH
4 gene (26). In addition, hnRNP K and E can
bind to a CU-rich repetitive element in the 3' untranslated region
(3'-UTR) of erythroid 15-lipooxygenase (LOX) mRNA and block 80S
ribosome complex assembly on LOX RNA, leading to translational silencing of the LOX gene (73). In contrast, by binding to a CU-rich RNA element in the 3'-UTR of
-globin mRNA, hnRNP E can stabilize
-globin mRNA, leading to enhanced expression of the
-globin gene (45, 97). Interestingly, five GADD
mRNAs, including GADD45, which is a cellular target of p53 and
whose product can mediate cell cycle arrest in G2-M
(95), are stabilized in hamster cells when treated with
DNA-damaging agents (40). However, it is still not clear
whether DNA damage-induced stabilization of these GADD mRNAs is p53
dependent. It will be interesting to determine whether MCG10 can
regulate these GADD genes.
Tumorigenesis involves multistep sequential alterations of genetic
materials. One of the early outcomes of this process is immortalization
of cells, leading to an unlimited replicative life span. Recent studies
have shown that overexpression of telomerase, whose activity can be
regulated by p53 (16, 49), immortalizes cells, suggesting
that the length of the telomere is critical for a limited replicative
life span (19). Telomerase is a specialized reverse
transcriptase that synthesizes a DNA sequence using an RNA template
(19, 54). The RNA template is usually 100 to 200 nucleotides
long and contains several repeats of C-rich elements. Interestingly,
loss of heterozygosity (LOH) at 3p21, the mapped location of
MCG10, is associated with an increased telomerase activity
in head, neck, and renal carcinomas (55, 58). Since MCG10 is
a potent poly(C)-binding protein, it is possible that, by binding to
the C-rich repeats in the RNA template, MCG10 and MCG10as can sequester
the RNA template and inhibit telomere synthesis, thereby suppressing
cell proliferation.
In addition to the RNA-binding motifs, hnRNPs often contain other
auxiliary domains, most notably the proline-rich PXXP motif (P
represents proline, whereas X is any amino acid). PXXP residues can
form a left-handed polyproline type II helix, which creates a binding
site for Src homology 3 (SH3) domains (18). The proline-rich domains in hnRNP K and Sam68 have been shown to interact with several
protooncogene products, including Src (85, 98), Fyn (98), Lyn (98), and Vav (10, 36). In
addition, upon interaction with Src, hnRNP K and Sam68 can be
phosphorylated at tyrosine residues by Src tyrosine kinase (85,
89). These results support a hypothesis that extracellular
signals can be received by a membrane-associated tyrosine kinase, such
as Src, which transmits the signal to an RNA-binding protein, such as
hnRNP K and Sam68. The RNA-binding protein would then regulate the
expression of genes that control cellular responses to various
extracellular signals. MCG10 and MCG10as contain three proline-rich
domains at their carboxyl termini. Therefore, future studies are needed
to determine with what protein MCG10 and MCG10as interact and what the
physiological response is, if indeed an interaction occurs.
Most p53 target genes can mediate one defined p53 activity. For
example, p21 is necessary for mediating G1 arrest (7,
20), 14-3-3
mediates G2-M arrest (35),
and Bax possibly mediates apoptosis (62). Interestingly,
MCG10 and MCG10as can mediate two p53 activities, that is, apoptosis
and cell cycle arrest in G2-M. This may not be surprising.
Since the mechanism by which MCG10 and MCG10as may function as a
potential p53 mediator is their ability to regulate gene expression
and/or to interact with one or more signaling proteins responsible for
the control of the cell cycle, multiple pathways could be regulated. It
should be noted that MCG10 and MCG10as are potent in inducing
apoptosis, but unlike wild-type p53, they do so without inducing
significant cellular DNA fragmentation. Since the RNA-binding activity
is necessary for apoptosis, it is likely that one or more cellular genes whose products can lead to DNA breakdown are not regulated by
MCG10 and MCG10as. Indeed, caspase 3 is not significantly activated by
MCG10 (Fig. 6B). Caspase 3 is the primary effector enzyme that proteolytically inactivates DFF45 (DNA fragmentation factor 45) (also
called ICAD [inhibitor of caspase-activated DNase]) and releases
active DFF40 (also called CAD [caspase-activated DNase]), leading to
internucleosomal DNA cleavage (102).
Is MCG10 a tumor suppressor?
p53 is a bona fide tumor
suppressor because it fulfills the "classical features" of a tumor
suppressor (17). The ability of MCG10 to inhibit the growth
of transformed cells fulfills one of the criteria for a tumor
suppressor. Second, the MCG10 gene maps to chromosome 3p21,
a region highly susceptible to aberrant chromosomal rearrangements and
deletions (61). LOH at 3p21 has been found in many types of
human cancers, such as breast carcinomas, small and non-small cell lung
carcinomas, uterine and cervical carcinomas, renal cell carcinomas,
head, neck, and oral squamous cell carcinomas, ovarian cancers, and
pancreatic islet cell tumors (6, 24, 25, 31, 70, 72, 75, 100,
101). Homozygous deletions of 3p21 are also found in several lung
tumors and lung cancer cell lines (86). In esophageal
carcinomas, LOH at 3p21 is an early event, preceding loss of RB and p53
functions (63). In addition, LOH in a region syntenic with
3p21 is also found in many types of mouse cancers (22, 70).
When scid mouse tumors, which are induced by human
chromosome 3-mouse microcell hybrids, were used to screen for a common
eliminated region, one was often found at 3p21 (38, 44),
suggesting that loss of a tumor suppressor gene may be necessary for
microcell hybrids to induce tumors in scid mice. The human
mismatch repair gene (hMLH) also maps to 3p21, and loss of hMLH
function is associated with microsatellite instability at one or more
loci (51). However, only a subset (less than 30%) of
non-small cell lung carcinomas contain LOH at 3p21 with microsatellite
instability (99), suggesting that, in non-small cell lung
carcinomas without microsatellite instability, LOH at 3p21 probably
involves another tumor suppressor gene(s). Therefore, future studies
are needed to determine whether MCG10 LOH occurs in these tumors and
whether loss of MCG10 contributes to tumorigenesis.
 |
ACKNOWLEDGMENTS |
We thank Jason Paik for technical help and Rhea Markowitz for
critical reading of the manuscript.
This work is supported in part by National Cancer Institute grant CA
76069 and the Department of Defense Army Breast Cancer Program
DAMD17-97-1-7019.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CB-2803,
Institute of Molecular Medicine and Genetics, Medical College of
Georgia, Augusta, GA 30912. Phone: (706) 721-8760. Fax: (706) 721-8752. E-mail: xchen{at}mail.mcg.edu.
 |
REFERENCES |
| 1.
|
Agarwal, M. L.,
W. R. Taylor,
M. V. Chernov,
O. B. Chernova, and G. R. Stark.
1998.
The p53 network.
J. Biol. Chem.
273:1-4[Free Full Text].
|
| 2.
|
Almog, N., and V. Rotter.
1997.
Involvement of p53 in cell differentiation and development.
Biochim. Biophys. Acta
1333:F1-F27[Medline].
|
| 3.
|
Attardi, L. D.,
S. W. Lowe,
J. Brugarolas, and T. Jacks.
1996.
Transcriptional activation by p53, but not induction of the p21 gene, is essential for oncogene-mediated apoptosis.
EMBO J.
15:3693-3701[Medline].
|
| 4.
|
Barlat, I.,
F. Maurier,
M. Duchesne,
E. Guitard,
B. Tocque, and F. Schweighoffer.
1997.
A role for Sam68 in cell cycle progression antagonized by a spliced variant within the KH domain.
J. Biol. Chem.
272:3129-3132[Abstract/Free Full Text].
|
| 5.
|
Bennett, M.,
K. Macdonald,
S. W. Chan,
J. P. Luzio,
R. Simari, and P. Weissberg.
1998.
Cell surface trafficking of Fas: a rapid mechanism of p53-mediated apoptosis.
Science
282:290-293[Abstract/Free Full Text].
|
| 6.
|
Braga, E.,
E. Pugacheva,
I. Bazov,
V. Ermilova,
T. Kazubskaya,
N. Mazurenko,
F. Kisseljov,
J. Liu,
R. Garkavtseva,
E. Zabarovsky, and L. Kisselev.
1999.
Comparative allelotyping of the short arm of human chromosome 3 in epithelial tumors of four different types.
FEBS Lett.
454:215-219[CrossRef][Medline].
|
| 7.
|
Brugarolas, J.,
C. Chandrasekaran,
J. I. Gordon,
D. Beach,
T. Jacks, and G. J. Hannon.
1995.
Radiation-induced cell cycle arrest compromised by p21 deficiency.
Nature
377:552-557[CrossRef][Medline].
|
| 8.
|
Bunz, F.,
A. Dutriaux,
C. Lengauer,
T. Waldman,
S. Zhou,
J. P. Brown,
J. M. Sedivy,
K. W. Kinzler, and B. Vogelstein.
1998.
Requirement for p53 and p21 to sustain G2 arrest after DNA damage.
Science
282:1497-1501[Abstract/Free Full Text].
|
| 9.
|
Burd, C. G., and G. Dreyfuss.
1994.
Conserved structures and diversity of functions of RNA-binding proteins.
Science
265:615-621[Abstract/Free Full Text].
|
| 10.
|
Bustelo, X. R.,
K. L. Suen,
W. M. Michael,
G. Dreyfuss, and M. Barbacid.
1995.
Association of the vav proto-oncogene product with poly(rC)-specific RNA-binding proteins.
Mol. Cell. Biol.
15:1324-1332[Abstract].
|
| 11.
|
Carrier, F.,
A. Gatignol,
M. C. Hollander,
K. T. Jeang, and A. J. Fornace, Jr.
1994.
Induction of RNA-binding proteins in mammalian cells by DNA-damaging agents.
Proc. Natl. Acad. Sci. USA
91:1554-1558[Abstract/Free Full Text].
|
| 12.
|
Chan, T. A.,
H. Hermeking,
C. Lengauer,
K. W. Kinzler, and B. Vogelstein.
1999.
14-3-3Sigma is required to prevent mitotic catastrophe after DNA damage.
Nature
401:616-620[CrossRef][Medline].
|
| 13.
|
Chen, X.
1999.
The p53 family: same response, different signals?
Mol. Med. Today
5:387-392[CrossRef][Medline].
|
| 14.
|
Chen, X.,
J. Bargonetti, and C. Prives.
1995.
p53, through p21 (WAF1/CIP1), induces cyclin D1 synthesis.
Cancer Res.
55:4257-4263[Abstract/Free Full Text].
|
| 15.
|
Chen, X.,
L. J. Ko,
L. Jayaraman, and C. Prives.
1996.
p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells.
Genes Dev.
10:2438-2451[Abstract/Free Full Text].
|
| 16.
|
Chin, L.,
S. E. Artandi,
Q. Shen,
A. Tam,
S. L. Lee,
G. J. Gottlieb,
C. W. Greider, and R. A. DePinho.
1999.
p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis.
Cell
97:527-538[CrossRef][Medline].
|
| 17.
|
Clurman, B., and M. Groudine.
1997.
Tumour-suppressor genes. Killer in search of a motive?
Nature
389:122-123[CrossRef][Medline].
|
| 18.
|
Cohen, G. B.,
R. Ren, and D. Baltimore.
1995.
Modular binding domains in signal transduction proteins.
Cell
80:237-248[CrossRef][Medline].
|
| 19.
|
Colgin, L. M., and R. R. Reddel.
1999.
Telomere maintenance mechanisms and cellular immortalization.
Curr. Opin. Genet. Dev.
9:97-103[CrossRef][Medline]. (Erratum, 9:247.)
|
| 20.
|
Deng, C.,
P. Zhang,
J. W. Harper,
S. J. Elledge, and P. Leder.
1995.
Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control.
Cell
82:675-684[CrossRef][Medline].
|
| 21.
|
Di Como, C. J.,
C. Gaiddon, and C. Prives.
1999.
p73 function is inhibited by tumor-derived p53 mutants in mammalian cells.
Mol. Cell. Biol.
19:1438-1449[Abstract/Free Full Text].
|
| 22.
|
Dietrich, W. F.,
E. H. Radany,
J. S. Smith,
J. M. Bishop,
D. Hanahan, and E. S. Lander.
1994.
Genome-wide search for loss of heterozygosity in transgenic mouse tumors reveals candidate tumor suppressor genes on chromosomes 9 and 16.
Proc. Natl. Acad. Sci. USA
91:9451-9455[Abstract/Free Full Text].
|
| 23.
|
Dreyfuss, G.,
M. J. Matunis,
S. Pinol-Roma, and C. G. Burd.
1993.
hnRNP proteins and the biogenesis of mRNA.
Annu. Rev. Biochem.
62:289-321[CrossRef][Medline].
|
| 24.
|
Driouch, K.,
M. Briffod,
I. Bieche,
M. H. Champeme, and R. Lidereau.
1998.
Location of several putative genes possibly involved in human breast cancer progression.
Cancer Res.
58:2081-2086[Abstract/Free Full Text].
|
| 25.
|
Druck, T.,
K. Kastury,
P. Hadaczek,
J. Podolski,
A. Toloczko,
A. Sikorski,
M. Ohta,
S. LaForgia,
J. Lasota,
P. McCue, et al.
1995.
Loss of heterozygosity at the familial RCC t(3;8) locus in most clear cell renal carcinomas.
Cancer Res.
55:5348-5353[Abstract/Free Full Text].
|
| 26.
|
Du, Q.,
I. N. Melnikova, and P. D. Gardner.
1998.
Differential effects of heterogeneous nuclear ribonucleoprotein K on Sp1- and Sp3-mediated transcriptional activation of a neuronal nicotinic acetylcholine receptor promoter.
J. Biol. Chem.
273:19877-19883[Abstract/Free Full Text].
|
| 27.
|
el-Deiry, W. S.
1998.
Regulation of p53 downstream genes.
Semin. Cancer Biol.
8:345-357[CrossRef][Medline].
|
| 28.
|
el-Deiry, W. S.,
T. Tokino,
V. E. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
W. E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[CrossRef][Medline].
|